>Feature sequence001 1228 536 gene locus_tag LOCUS_00010 1228 536 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 protein_id gnl|my_center|LOCUS_00010 1285 1923 gene locus_tag LOCUS_00020 1285 1923 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_00020 2785 1904 gene locus_tag LOCUS_00030 2785 1904 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389217.1 protein_id gnl|my_center|LOCUS_00030 4124 2916 gene locus_tag LOCUS_00040 4124 2916 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389866.1 protein_id gnl|my_center|LOCUS_00040 4699 5280 gene locus_tag LOCUS_00050 4699 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5376 7991 gene locus_tag LOCUS_00060 gene leuS 5376 7991 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEE2 protein_id gnl|my_center|LOCUS_00060 8017 8511 gene locus_tag LOCUS_00070 8017 8511 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 protein_id gnl|my_center|LOCUS_00070 8546 9589 gene locus_tag LOCUS_00080 gene holA 8546 9589 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_00080 10602 9688 gene locus_tag LOCUS_00090 10602 9688 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709819.1 protein_id gnl|my_center|LOCUS_00090 11807 10845 gene locus_tag LOCUS_00100 gene parA 11807 10845 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV7 protein_id gnl|my_center|LOCUS_00100 12456 11776 gene locus_tag LOCUS_00110 gene rsmG 12456 11776 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW6 protein_id gnl|my_center|LOCUS_00110 14328 12472 gene locus_tag LOCUS_00120 gene mnmG 14328 12472 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV0 protein_id gnl|my_center|LOCUS_00120 15999 14692 gene locus_tag LOCUS_00130 gene mnmE 15999 14692 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 protein_id gnl|my_center|LOCUS_00130 16341 16027 gene locus_tag LOCUS_00140 16341 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16521 18560 gene locus_tag LOCUS_00150 16521 18560 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_00150 18607 18813 gene locus_tag LOCUS_00160 18607 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19495 18875 gene locus_tag LOCUS_00170 19495 18875 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142521.1 protein_id gnl|my_center|LOCUS_00170 20473 19520 gene locus_tag LOCUS_00180 20473 19520 CDS product DNA-binding transcriptional activator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_00180 20583 20759 gene locus_tag LOCUS_00190 20583 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20868 21572 gene locus_tag LOCUS_00200 20868 21572 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_00200 21671 22654 gene locus_tag LOCUS_00210 gene qor 21671 22654 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_00210 23979 22714 gene locus_tag LOCUS_00220 gene rho 23979 22714 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEF0 protein_id gnl|my_center|LOCUS_00220 24829 24383 gene locus_tag LOCUS_00230 24829 24383 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_00230 25881 24847 gene locus_tag LOCUS_00240 gene hemH 25881 24847 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN84 protein_id gnl|my_center|LOCUS_00240 26927 25878 gene locus_tag LOCUS_00250 gene hemE 26927 25878 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_00250 27499 28323 gene locus_tag LOCUS_00260 27499 28323 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_00260 28330 28968 gene locus_tag LOCUS_00270 28330 28968 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Q9 protein_id gnl|my_center|LOCUS_00270 28965 29846 gene locus_tag LOCUS_00280 gene aroE 28965 29846 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_00280 29858 30502 gene locus_tag LOCUS_00290 gene coaE 29858 30502 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58100 protein_id gnl|my_center|LOCUS_00290 30540 30956 gene locus_tag LOCUS_00300 30540 30956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_00300 30998 31681 gene locus_tag LOCUS_00310 gene dnaQ 30998 31681 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 protein_id gnl|my_center|LOCUS_00310 32199 31684 gene locus_tag LOCUS_00320 gene secB 32199 31684 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN7 protein_id gnl|my_center|LOCUS_00320 32857 32324 gene locus_tag LOCUS_00330 gene fxsA 32857 32324 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_00330 33115 33873 gene locus_tag LOCUS_00340 33115 33873 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_00340 33908 35056 gene locus_tag LOCUS_00350 33908 35056 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_00350 35109 35750 gene locus_tag LOCUS_00360 35109 35750 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_00360 35747 36139 gene locus_tag LOCUS_00370 35747 36139 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_00370 37484 36177 gene locus_tag LOCUS_00380 gene hslU 37484 36177 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN2 protein_id gnl|my_center|LOCUS_00380 38110 37559 gene locus_tag LOCUS_00390 gene hslV 38110 37559 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_00390 38875 38345 gene locus_tag LOCUS_00400 38875 38345 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_00400 39261 39872 gene locus_tag LOCUS_00410 gene hisB 39261 39872 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 protein_id gnl|my_center|LOCUS_00410 39912 40403 gene locus_tag LOCUS_00420 39912 40403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083478.1 protein_id gnl|my_center|LOCUS_00420 40407 41045 gene locus_tag LOCUS_00430 gene hisH 40407 41045 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TB1 protein_id gnl|my_center|LOCUS_00430 41066 41803 gene locus_tag LOCUS_00440 gene hisA 41066 41803 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM5 protein_id gnl|my_center|LOCUS_00440 41797 42555 gene locus_tag LOCUS_00450 gene hisF 41797 42555 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBC1 protein_id gnl|my_center|LOCUS_00450 42729 43823 gene locus_tag LOCUS_00460 42729 43823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640013.1 protein_id gnl|my_center|LOCUS_00460 43936 44268 gene locus_tag LOCUS_00470 gene hisE 43936 44268 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A228 protein_id gnl|my_center|LOCUS_00470 44273 45253 gene locus_tag LOCUS_00480 gene coaA 44273 45253 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM2 protein_id gnl|my_center|LOCUS_00480 46305 45310 gene locus_tag LOCUS_00490 46305 45310 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 protein_id gnl|my_center|LOCUS_00490 46496 47176 gene locus_tag LOCUS_00500 46496 47176 CDS product cysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710007.1 protein_id gnl|my_center|LOCUS_00500 47173 47538 gene locus_tag LOCUS_00510 47173 47538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 48177 47539 gene locus_tag LOCUS_00520 gene nth 48177 47539 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 protein_id gnl|my_center|LOCUS_00520 48243 48803 gene locus_tag LOCUS_00530 48243 48803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 49429 48797 gene locus_tag LOCUS_00540 gene gpmA 49429 48797 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T25 protein_id gnl|my_center|LOCUS_00540 50275 49460 gene locus_tag LOCUS_00550 gene dapB 50275 49460 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP1 protein_id gnl|my_center|LOCUS_00550 50419 50703 gene locus_tag LOCUS_00560 50419 50703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 51924 50773 gene locus_tag LOCUS_00570 gene dnaJ 51924 50773 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_00570 53951 52026 gene locus_tag LOCUS_00580 gene dnaK 53951 52026 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42374 protein_id gnl|my_center|LOCUS_00580 54886 54323 gene locus_tag LOCUS_00590 54886 54323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 54943 55611 gene locus_tag LOCUS_00600 54943 55611 CDS product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_00600 56309 55608 gene locus_tag LOCUS_00610 gene nnrU 56309 55608 CDS product denitrification regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973806.1 protein_id gnl|my_center|LOCUS_00610 57046 56417 gene locus_tag LOCUS_00620 gene grpE 57046 56417 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEJ3 protein_id gnl|my_center|LOCUS_00620 58215 57160 gene locus_tag LOCUS_00630 gene hrcA 58215 57160 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_00630 58419 59135 gene locus_tag LOCUS_00640 gene rph 58419 59135 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIG8 protein_id gnl|my_center|LOCUS_00640 59325 59246 gene locus_tag LOCUS_t00010 59325 59246 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 59718 60926 gene locus_tag LOCUS_00650 59718 60926 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 protein_id gnl|my_center|LOCUS_00650 62225 60939 gene locus_tag LOCUS_00660 62225 60939 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391441.1 protein_id gnl|my_center|LOCUS_00660 62385 63245 gene locus_tag LOCUS_00670 gene rsmI 62385 63245 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK8 protein_id gnl|my_center|LOCUS_00670 63246 63650 gene locus_tag LOCUS_00680 63246 63650 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_00680 63726 64319 gene locus_tag LOCUS_00690 63726 64319 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391438.1 protein_id gnl|my_center|LOCUS_00690 64376 65239 gene locus_tag LOCUS_00700 64376 65239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 65373 66320 gene locus_tag LOCUS_00710 gene gshB 65373 66320 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM6 protein_id gnl|my_center|LOCUS_00710 67272 66325 gene locus_tag LOCUS_00720 67272 66325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 67473 67318 gene locus_tag LOCUS_00730 67473 67318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 67632 68921 gene locus_tag LOCUS_00740 67632 68921 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_00740 69333 69034 gene locus_tag LOCUS_00750 69333 69034 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390813.1 protein_id gnl|my_center|LOCUS_00750 69596 69348 gene locus_tag LOCUS_00760 69596 69348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 70120 69929 gene locus_tag LOCUS_00770 70120 69929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 70274 71824 gene locus_tag LOCUS_00780 70274 71824 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710147.1 protein_id gnl|my_center|LOCUS_00780 71959 74178 gene locus_tag LOCUS_00790 71959 74178 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083486.1 protein_id gnl|my_center|LOCUS_00790 74236 75663 gene locus_tag LOCUS_00800 74236 75663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_00800 76024 76863 gene locus_tag LOCUS_00810 76024 76863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310189.1 protein_id gnl|my_center|LOCUS_00810 79143 76879 gene locus_tag LOCUS_00820 79143 76879 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706619.1 protein_id gnl|my_center|LOCUS_00820 79472 82168 gene locus_tag LOCUS_00830 gene mutS 79472 82168 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56883 protein_id gnl|my_center|LOCUS_00830 82344 85139 gene locus_tag LOCUS_00840 gene glnD 82344 85139 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T787 protein_id gnl|my_center|LOCUS_00840 85468 85541 gene locus_tag LOCUS_t00020 85468 85541 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 86322 86035 gene locus_tag LOCUS_00850 86322 86035 CDS product RelE toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268681.1 protein_id gnl|my_center|LOCUS_00850 86581 86306 gene locus_tag LOCUS_00860 86581 86306 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 protein_id gnl|my_center|LOCUS_00860 86800 88341 gene locus_tag LOCUS_00870 86800 88341 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_00870 88425 89297 gene locus_tag LOCUS_00880 88425 89297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 89443 90450 gene locus_tag LOCUS_00890 gene trpS 89443 90450 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W91 protein_id gnl|my_center|LOCUS_00890 90567 91661 gene locus_tag LOCUS_00900 90567 91661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 91689 92231 gene locus_tag LOCUS_00910 91689 92231 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974250.1 protein_id gnl|my_center|LOCUS_00910 92335 92901 gene locus_tag LOCUS_00920 92335 92901 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_00920 93031 93624 gene locus_tag LOCUS_00930 gene rutE 93031 93624 CDS product putative malonic semialdehyde reductase RutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJW1 protein_id gnl|my_center|LOCUS_00930 93644 94339 gene locus_tag LOCUS_00940 93644 94339 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_00940 94336 94857 gene locus_tag LOCUS_00950 94336 94857 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_00950 94954 95445 gene locus_tag LOCUS_00960 94954 95445 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_00960 95486 96343 gene locus_tag LOCUS_00970 gene olsA 95486 96343 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527683.1 protein_id gnl|my_center|LOCUS_00970 96428 97864 gene locus_tag LOCUS_00980 gene miaB 96428 97864 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF08 protein_id gnl|my_center|LOCUS_00980 97935 98942 gene locus_tag LOCUS_00990 97935 98942 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527679.1 protein_id gnl|my_center|LOCUS_00990 98939 99535 gene locus_tag LOCUS_01000 gene ybeY 98939 99535 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID9 protein_id gnl|my_center|LOCUS_01000 99545 100504 gene locus_tag LOCUS_01010 99545 100504 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_01010 100509 102182 gene locus_tag LOCUS_01020 gene lnt 100509 102182 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_01020 102308 102742 gene locus_tag LOCUS_01030 102308 102742 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 protein_id gnl|my_center|LOCUS_01030 102956 104125 gene locus_tag LOCUS_01040 gene metK2 102956 104125 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_01040 104144 104875 gene locus_tag LOCUS_01050 gene trmB 104144 104875 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF16 protein_id gnl|my_center|LOCUS_01050 105047 105661 gene locus_tag LOCUS_01060 gene rimP 105047 105661 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 protein_id gnl|my_center|LOCUS_01060 105665 107284 gene locus_tag LOCUS_01070 gene nusA 105665 107284 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SW5 protein_id gnl|my_center|LOCUS_01070 107268 107912 gene locus_tag LOCUS_01080 107268 107912 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_01080 107947 110574 gene locus_tag LOCUS_01090 gene infB 107947 110574 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC66 protein_id gnl|my_center|LOCUS_01090 110665 111087 gene locus_tag LOCUS_01100 gene rbfA 110665 111087 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR9 protein_id gnl|my_center|LOCUS_01100 111092 112015 gene locus_tag LOCUS_01110 gene truB 111092 112015 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB1 protein_id gnl|my_center|LOCUS_01110 112026 112295 gene locus_tag LOCUS_01120 gene rpsO 112026 112295 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_01120 112679 114892 gene locus_tag LOCUS_01130 gene pnp 112679 114892 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKQ7 protein_id gnl|my_center|LOCUS_01130 115131 115610 gene locus_tag LOCUS_01140 115131 115610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 115891 116502 gene locus_tag LOCUS_01150 115891 116502 CDS product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531172.1 protein_id gnl|my_center|LOCUS_01150 117408 116542 gene locus_tag LOCUS_01160 gene fabI 117408 116542 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WC1 protein_id gnl|my_center|LOCUS_01160 118688 117471 gene locus_tag LOCUS_01170 gene fabB 118688 117471 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_01170 119314 118805 gene locus_tag LOCUS_01180 gene fabA 119314 118805 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_01180 119654 120079 gene locus_tag LOCUS_01190 119654 120079 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_01190 120419 120841 gene locus_tag LOCUS_01200 120419 120841 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_01200 120931 122322 gene locus_tag LOCUS_01210 120931 122322 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_01210 122366 122959 gene locus_tag LOCUS_01220 122366 122959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190872.1 protein_id gnl|my_center|LOCUS_01220 123628 122963 gene locus_tag LOCUS_01230 123628 122963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 123820 124812 gene locus_tag LOCUS_01240 123820 124812 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_01240 125712 124909 gene locus_tag LOCUS_01250 gene moeB 125712 124909 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_01250 126174 125839 gene locus_tag LOCUS_01260 126174 125839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 126566 126201 gene locus_tag LOCUS_01270 126566 126201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 127155 126763 gene locus_tag LOCUS_01280 127155 126763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 128070 127270 gene locus_tag LOCUS_01290 128070 127270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 128692 128090 gene locus_tag LOCUS_01300 128692 128090 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083417.1 protein_id gnl|my_center|LOCUS_01300 129444 128716 gene locus_tag LOCUS_01310 129444 128716 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_01310 129612 130115 gene locus_tag LOCUS_01320 129612 130115 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083753.1 protein_id gnl|my_center|LOCUS_01320 131088 130129 gene locus_tag LOCUS_01330 gene cysK 131088 130129 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_01330 131600 131151 gene locus_tag LOCUS_01340 131600 131151 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_01340 132096 131608 gene locus_tag LOCUS_01350 gene dut 132096 131608 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UII1 protein_id gnl|my_center|LOCUS_01350 133337 132093 gene locus_tag LOCUS_01360 133337 132093 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_01360 135091 133487 gene locus_tag LOCUS_01370 gene aarF 135091 133487 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WD1 protein_id gnl|my_center|LOCUS_01370 135894 135094 gene locus_tag LOCUS_01380 gene ubiE 135894 135094 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WD0 protein_id gnl|my_center|LOCUS_01380 135965 136849 gene locus_tag LOCUS_01390 gene mutM 135965 136849 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_01390 136886 137281 gene locus_tag LOCUS_01400 136886 137281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 137341 138117 gene locus_tag LOCUS_01410 137341 138117 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_01410 138327 138590 gene locus_tag LOCUS_01420 gene rpsT 138327 138590 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 protein_id gnl|my_center|LOCUS_01420 139166 139639 gene locus_tag LOCUS_01430 139166 139639 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_01430 139862 141289 gene locus_tag LOCUS_01440 gene dnaA 139862 141289 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_01440 141707 142825 gene locus_tag LOCUS_01450 141707 142825 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_01450 142885 144123 gene locus_tag LOCUS_01460 gene recF 142885 144123 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBZ9 protein_id gnl|my_center|LOCUS_01460 144120 144713 gene locus_tag LOCUS_01470 gene clpP3 144120 144713 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFP9 protein_id gnl|my_center|LOCUS_01470 144754 147198 gene locus_tag LOCUS_01480 gene gyrB 144754 147198 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB82 protein_id gnl|my_center|LOCUS_01480 147750 149744 gene locus_tag LOCUS_01490 gene pbpC 147750 149744 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_01490 150950 149760 gene locus_tag LOCUS_01500 150950 149760 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_01500 151747 150947 gene locus_tag LOCUS_01510 151747 150947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_01510 153239 152001 gene locus_tag LOCUS_01520 153239 152001 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 protein_id gnl|my_center|LOCUS_01520 155073 153382 gene locus_tag LOCUS_01530 gene leuA 155073 153382 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX14 protein_id gnl|my_center|LOCUS_01530 155979 155341 gene locus_tag LOCUS_01540 155979 155341 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_01540 156214 156774 gene locus_tag LOCUS_01550 156214 156774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 157025 157951 gene locus_tag LOCUS_01560 157025 157951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 158098 159492 gene locus_tag LOCUS_01570 158098 159492 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_01570 159569 160138 gene locus_tag LOCUS_01580 159569 160138 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_01580 161139 160246 gene locus_tag LOCUS_01590 161139 160246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 162371 161247 gene locus_tag LOCUS_01600 162371 161247 CDS product DUF3066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_01600 162745 164067 gene locus_tag LOCUS_01610 162745 164067 CDS product hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_01610 164278 165549 gene locus_tag LOCUS_01620 164278 165549 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_01620 166794 165661 gene locus_tag LOCUS_01630 166794 165661 CDS product DUF3066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_01630 167394 169739 gene locus_tag LOCUS_01640 167394 169739 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_01640 169818 170357 gene locus_tag LOCUS_01650 169818 170357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 170362 170757 gene locus_tag LOCUS_01660 170362 170757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 172020 170752 gene locus_tag LOCUS_01670 172020 170752 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_01670 172721 172080 gene locus_tag LOCUS_01680 172721 172080 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_01680 173561 172797 gene locus_tag LOCUS_01690 173561 172797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 174445 173750 gene locus_tag LOCUS_01700 174445 173750 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090120.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 176038 174722 gene locus_tag LOCUS_01710 gene bioA 176038 174722 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_01710 177084 176035 gene locus_tag LOCUS_01720 gene bioB 177084 176035 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFL1 protein_id gnl|my_center|LOCUS_01720 177828 177169 gene locus_tag LOCUS_01730 177828 177169 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN8 protein_id gnl|my_center|LOCUS_01730 177965 178858 gene locus_tag LOCUS_01740 177965 178858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 178926 180131 gene locus_tag LOCUS_01750 gene bioF 178926 180131 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE2 protein_id gnl|my_center|LOCUS_01750 180134 180781 gene locus_tag LOCUS_01760 180134 180781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 181090 180800 gene locus_tag LOCUS_01770 181090 180800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 181166 181396 gene locus_tag LOCUS_01780 181166 181396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 182002 181487 gene locus_tag LOCUS_01790 gene ogt 182002 181487 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4X4 protein_id gnl|my_center|LOCUS_01790 183486 182014 gene locus_tag LOCUS_01800 183486 182014 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_01800 183701 185035 gene locus_tag LOCUS_01810 183701 185035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_01810 186514 185135 gene locus_tag LOCUS_01820 186514 185135 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088125.1 protein_id gnl|my_center|LOCUS_01820 188005 186821 gene locus_tag LOCUS_01830 188005 186821 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968001.1 protein_id gnl|my_center|LOCUS_01830 188189 188401 gene locus_tag LOCUS_01840 188189 188401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 190213 188621 gene locus_tag LOCUS_01850 190213 188621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 190695 190468 gene locus_tag LOCUS_01860 190695 190468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 190885 191679 gene locus_tag LOCUS_01870 gene phyR 190885 191679 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_01870 192445 191840 gene locus_tag LOCUS_01880 gene sigT 192445 191840 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_01880 192570 192451 gene locus_tag LOCUS_01890 192570 192451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 193171 192974 gene locus_tag LOCUS_01900 gene yjbJ 193171 192974 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296638.1 protein_id gnl|my_center|LOCUS_01900 193525 193349 gene locus_tag LOCUS_01910 193525 193349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 194488 193910 gene locus_tag LOCUS_01920 194488 193910 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028374.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence002 263 1426 gene locus_tag LOCUS_01930 263 1426 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_01930 1521 2393 gene locus_tag LOCUS_01940 1521 2393 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085343.1 protein_id gnl|my_center|LOCUS_01940 3610 2489 gene locus_tag LOCUS_01950 3610 2489 CDS product branched-chain alpha-keto acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 protein_id gnl|my_center|LOCUS_01950 4644 3637 gene locus_tag LOCUS_01960 gene acoB2 4644 3637 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888040.1 protein_id gnl|my_center|LOCUS_01960 5652 4654 gene locus_tag LOCUS_01970 gene acoA 5652 4654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_01970 6013 5639 gene locus_tag LOCUS_01980 6013 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6180 6830 gene locus_tag LOCUS_01990 6180 6830 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_01990 7344 6868 gene locus_tag LOCUS_02000 7344 6868 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_02000 7760 8848 gene locus_tag LOCUS_02010 7760 8848 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 protein_id gnl|my_center|LOCUS_02010 10261 8888 gene locus_tag LOCUS_02020 10261 8888 CDS product 4Fe-4S binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198129.1 protein_id gnl|my_center|LOCUS_02020 11163 10309 gene locus_tag LOCUS_02030 11163 10309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930218.1 protein_id gnl|my_center|LOCUS_02030 11504 11160 gene locus_tag LOCUS_02040 11504 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198127.1 protein_id gnl|my_center|LOCUS_02040 12115 11561 gene locus_tag LOCUS_02050 12115 11561 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930217.1 protein_id gnl|my_center|LOCUS_02050 12332 13066 gene locus_tag LOCUS_02060 12332 13066 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970955.1 protein_id gnl|my_center|LOCUS_02060 13978 13067 gene locus_tag LOCUS_02070 13978 13067 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 protein_id gnl|my_center|LOCUS_02070 14988 13993 gene locus_tag LOCUS_02080 14988 13993 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 protein_id gnl|my_center|LOCUS_02080 15491 14985 gene locus_tag LOCUS_02090 15491 14985 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720630.1 protein_id gnl|my_center|LOCUS_02090 16800 15706 gene locus_tag LOCUS_02100 16800 15706 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_02100 17396 17118 gene locus_tag LOCUS_02110 17396 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 17596 17393 gene locus_tag LOCUS_02120 17596 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17850 17593 gene locus_tag LOCUS_02130 17850 17593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 18311 17847 gene locus_tag LOCUS_02140 18311 17847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 18591 18845 gene locus_tag LOCUS_02150 18591 18845 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707564.1 protein_id gnl|my_center|LOCUS_02150 18919 19272 gene locus_tag LOCUS_02160 18919 19272 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG6 protein_id gnl|my_center|LOCUS_02160 19357 19899 gene locus_tag LOCUS_02170 19357 19899 CDS product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262566.1 protein_id gnl|my_center|LOCUS_02170 20213 21631 gene locus_tag LOCUS_02180 20213 21631 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_02180 21643 22461 gene locus_tag LOCUS_02190 21643 22461 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_02190 23285 22458 gene locus_tag LOCUS_02200 23285 22458 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389377.1 protein_id gnl|my_center|LOCUS_02200 24709 23288 gene locus_tag LOCUS_02210 gene hflX 24709 23288 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBM1 protein_id gnl|my_center|LOCUS_02210 24970 24722 gene locus_tag LOCUS_02220 gene hfq 24970 24722 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7H8 protein_id gnl|my_center|LOCUS_02220 26048 25191 gene locus_tag LOCUS_02230 26048 25191 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_02230 27459 26083 gene locus_tag LOCUS_02240 gene trkA 27459 26083 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_02240 28891 27497 gene locus_tag LOCUS_02250 gene ntrX 28891 27497 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535439.1 protein_id gnl|my_center|LOCUS_02250 31244 28881 gene locus_tag LOCUS_02260 gene ntrY 31244 28881 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087261.1 protein_id gnl|my_center|LOCUS_02260 32881 31439 gene locus_tag LOCUS_02270 gene ntrC 32881 31439 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_02270 34047 32917 gene locus_tag LOCUS_02280 gene ntrB 34047 32917 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_02280 35021 34047 gene locus_tag LOCUS_02290 gene nifR 35021 34047 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ25 protein_id gnl|my_center|LOCUS_02290 35188 36345 gene locus_tag LOCUS_02300 gene ispDF 35188 36345 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS1 protein_id gnl|my_center|LOCUS_02300 36350 36850 gene locus_tag LOCUS_02310 36350 36850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 36847 37341 gene locus_tag LOCUS_02320 36847 37341 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 protein_id gnl|my_center|LOCUS_02320 37842 37345 gene locus_tag LOCUS_02330 37842 37345 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969233.1 protein_id gnl|my_center|LOCUS_02330 38815 37850 gene locus_tag LOCUS_02340 gene lipA2 38815 37850 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK9 protein_id gnl|my_center|LOCUS_02340 39415 38915 gene locus_tag LOCUS_02350 39415 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 41005 39479 gene locus_tag LOCUS_02360 41005 39479 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976198.1 protein_id gnl|my_center|LOCUS_02360 41739 41005 gene locus_tag LOCUS_02370 41739 41005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 protein_id gnl|my_center|LOCUS_02370 43185 41788 gene locus_tag LOCUS_02380 43185 41788 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 protein_id gnl|my_center|LOCUS_02380 44504 43185 gene locus_tag LOCUS_02390 44504 43185 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KX1 protein_id gnl|my_center|LOCUS_02390 45917 44517 gene locus_tag LOCUS_02400 45917 44517 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975253.1 protein_id gnl|my_center|LOCUS_02400 46871 45921 gene locus_tag LOCUS_02410 gene pdhA2 46871 45921 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK1 protein_id gnl|my_center|LOCUS_02410 46957 47145 gene locus_tag LOCUS_02420 46957 47145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 47520 47167 gene locus_tag LOCUS_02430 47520 47167 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389635.1 protein_id gnl|my_center|LOCUS_02430 48866 47592 gene locus_tag LOCUS_02440 gene eno 48866 47592 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q98 protein_id gnl|my_center|LOCUS_02440 49621 49070 gene locus_tag LOCUS_02450 49621 49070 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678340.1 protein_id gnl|my_center|LOCUS_02450 50152 50865 gene locus_tag LOCUS_02460 gene queC 50152 50865 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P2 protein_id gnl|my_center|LOCUS_02460 50880 51503 gene locus_tag LOCUS_02470 gene queE 50880 51503 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P3 protein_id gnl|my_center|LOCUS_02470 51503 51871 gene locus_tag LOCUS_02480 gene ptps 51503 51871 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW2 protein_id gnl|my_center|LOCUS_02480 51885 52352 gene locus_tag LOCUS_02490 gene queF 51885 52352 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV4 protein_id gnl|my_center|LOCUS_02490 52474 53850 gene locus_tag LOCUS_02500 52474 53850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 54755 53910 gene locus_tag LOCUS_02510 gene kdsA 54755 53910 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV0 protein_id gnl|my_center|LOCUS_02510 56405 54777 gene locus_tag LOCUS_02520 gene pyrG 56405 54777 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU5 protein_id gnl|my_center|LOCUS_02520 56958 56521 gene locus_tag LOCUS_02530 56958 56521 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531735.1 protein_id gnl|my_center|LOCUS_02530 57330 57139 gene locus_tag LOCUS_02540 57330 57139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 57495 57334 gene locus_tag LOCUS_02550 57495 57334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 57741 57523 gene locus_tag LOCUS_02560 57741 57523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090083.1 protein_id gnl|my_center|LOCUS_02560 58003 57794 gene locus_tag LOCUS_02570 gene cspA 58003 57794 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_02570 58984 58226 gene locus_tag LOCUS_02580 gene tpiA 58984 58226 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU3 protein_id gnl|my_center|LOCUS_02580 59605 59946 gene locus_tag LOCUS_02590 59605 59946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 60123 62024 gene locus_tag LOCUS_02600 gene ppiD 60123 62024 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971799.1 protein_id gnl|my_center|LOCUS_02600 62021 63532 gene locus_tag LOCUS_02610 62021 63532 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_02610 64111 63581 gene locus_tag LOCUS_02620 64111 63581 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531704.1 protein_id gnl|my_center|LOCUS_02620 64696 64136 gene locus_tag LOCUS_02630 gene mobA 64696 64136 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9U5 protein_id gnl|my_center|LOCUS_02630 65046 64768 gene locus_tag LOCUS_02640 65046 64768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 65846 65043 gene locus_tag LOCUS_02650 65846 65043 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 protein_id gnl|my_center|LOCUS_02650 66548 65850 gene locus_tag LOCUS_02660 gene narI 66548 65850 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_02660 67264 66545 gene locus_tag LOCUS_02670 gene narJ 67264 66545 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_02670 68789 67266 gene locus_tag LOCUS_02680 gene narH 68789 67266 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_02680 72523 68789 gene locus_tag LOCUS_02690 gene narG 72523 68789 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 protein_id gnl|my_center|LOCUS_02690 73825 72563 gene locus_tag LOCUS_02700 73825 72563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969326.1 protein_id gnl|my_center|LOCUS_02700 73992 74750 gene locus_tag LOCUS_02710 73992 74750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 74771 76024 gene locus_tag LOCUS_02720 74771 76024 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_02720 76296 76889 gene locus_tag LOCUS_02730 gene trpG 76296 76889 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_02730 76906 77931 gene locus_tag LOCUS_02740 gene trpD 76906 77931 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF3 protein_id gnl|my_center|LOCUS_02740 77924 78721 gene locus_tag LOCUS_02750 gene trpC 77924 78721 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94327 protein_id gnl|my_center|LOCUS_02750 78725 79234 gene locus_tag LOCUS_02760 78725 79234 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1K2 protein_id gnl|my_center|LOCUS_02760 79333 79815 gene locus_tag LOCUS_02770 gene moaC 79333 79815 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL3 protein_id gnl|my_center|LOCUS_02770 79819 81030 gene locus_tag LOCUS_02780 gene moeA 79819 81030 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_02780 81149 81862 gene locus_tag LOCUS_02790 gene lexA 81149 81862 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCJ7 protein_id gnl|my_center|LOCUS_02790 84015 81856 gene locus_tag LOCUS_02800 84015 81856 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_02800 84270 85682 gene locus_tag LOCUS_02810 gene gltX2 84270 85682 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_02810 85797 87113 gene locus_tag LOCUS_02820 gene gltA 85797 87113 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR5 protein_id gnl|my_center|LOCUS_02820 88345 87158 gene locus_tag LOCUS_02830 gene lpxB 88345 87158 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KQ7 protein_id gnl|my_center|LOCUS_02830 89232 88342 gene locus_tag LOCUS_02840 gene lpxI 89232 88342 CDS product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_02840 90035 89229 gene locus_tag LOCUS_02850 gene lpxA 90035 89229 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_02850 90508 90032 gene locus_tag LOCUS_02860 gene fabZ 90508 90032 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8L1 protein_id gnl|my_center|LOCUS_02860 91568 90543 gene locus_tag LOCUS_02870 gene lpxD 91568 90543 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z4 protein_id gnl|my_center|LOCUS_02870 92199 91651 gene locus_tag LOCUS_02880 92199 91651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 94652 92304 gene locus_tag LOCUS_02890 gene bamA 94652 92304 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 protein_id gnl|my_center|LOCUS_02890 95945 94776 gene locus_tag LOCUS_02900 95945 94776 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_02900 97324 96086 gene locus_tag LOCUS_02910 gene dxr 97324 96086 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_02910 98178 97315 gene locus_tag LOCUS_02920 98178 97315 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z7 protein_id gnl|my_center|LOCUS_02920 98951 98190 gene locus_tag LOCUS_02930 98951 98190 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K6 protein_id gnl|my_center|LOCUS_02930 99588 99025 gene locus_tag LOCUS_02940 gene frr 99588 99025 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X4 protein_id gnl|my_center|LOCUS_02940 100346 99621 gene locus_tag LOCUS_02950 gene pyrH 100346 99621 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 protein_id gnl|my_center|LOCUS_02950 101432 100506 gene locus_tag LOCUS_02960 gene tsf 101432 100506 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q54 protein_id gnl|my_center|LOCUS_02960 102300 101536 gene locus_tag LOCUS_02970 gene rpsB 102300 101536 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A703 protein_id gnl|my_center|LOCUS_02970 103206 102574 gene locus_tag LOCUS_02980 103206 102574 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence003 414 223 gene locus_tag LOCUS_02990 414 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 878 426 gene locus_tag LOCUS_03000 878 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4776 949 gene locus_tag LOCUS_03010 4776 949 CDS product phage host specificity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337519.1 protein_id gnl|my_center|LOCUS_03010 5247 4780 gene locus_tag LOCUS_03020 5247 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6119 5244 gene locus_tag LOCUS_03030 6119 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_03030 6862 6230 gene locus_tag LOCUS_03040 6862 6230 CDS product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_03040 7633 6995 gene locus_tag LOCUS_03050 7633 6995 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140162.1 protein_id gnl|my_center|LOCUS_03050 7832 7641 gene locus_tag LOCUS_03060 7832 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8146 7829 gene locus_tag LOCUS_03070 8146 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 8559 8146 gene locus_tag LOCUS_03080 8559 8146 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 protein_id gnl|my_center|LOCUS_03080 9099 8710 gene locus_tag LOCUS_03090 9099 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971288.1 protein_id gnl|my_center|LOCUS_03090 9428 9096 gene locus_tag LOCUS_03100 9428 9096 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383951.1 protein_id gnl|my_center|LOCUS_03100 9997 9425 gene locus_tag LOCUS_03110 9997 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_03110 10620 10189 gene locus_tag LOCUS_03120 10620 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11927 10626 gene locus_tag LOCUS_03130 gene gp36 11927 10626 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_03130 12655 11960 gene locus_tag LOCUS_03140 12655 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 13099 12821 gene locus_tag LOCUS_03150 13099 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 14411 13203 gene locus_tag LOCUS_03160 14411 13203 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 protein_id gnl|my_center|LOCUS_03160 15784 14561 gene locus_tag LOCUS_03170 15784 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 17203 15965 gene locus_tag LOCUS_03180 17203 15965 CDS product large terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 protein_id gnl|my_center|LOCUS_03180 17735 17163 gene locus_tag LOCUS_03190 17735 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 17856 18317 gene locus_tag LOCUS_03200 17856 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 19842 18334 gene locus_tag LOCUS_03210 19842 18334 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR1 protein_id gnl|my_center|LOCUS_03210 20444 19983 gene locus_tag LOCUS_03220 20444 19983 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_03220 20669 22696 gene locus_tag LOCUS_03230 20669 22696 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532650.1 protein_id gnl|my_center|LOCUS_03230 22786 24597 gene locus_tag LOCUS_03240 22786 24597 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_03240 24775 25359 gene locus_tag LOCUS_03250 24775 25359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879652.1 protein_id gnl|my_center|LOCUS_03250 25356 25877 gene locus_tag LOCUS_03260 25356 25877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064536.1 protein_id gnl|my_center|LOCUS_03260 25969 27027 gene locus_tag LOCUS_03270 25969 27027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_03270 27076 27849 gene locus_tag LOCUS_03280 27076 27849 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082922.1 protein_id gnl|my_center|LOCUS_03280 27846 28649 gene locus_tag LOCUS_03290 27846 28649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_03290 29183 28797 gene locus_tag LOCUS_03300 29183 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 30674 29301 gene locus_tag LOCUS_03310 30674 29301 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389421.1 protein_id gnl|my_center|LOCUS_03310 30800 32134 gene locus_tag LOCUS_03320 30800 32134 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 protein_id gnl|my_center|LOCUS_03320 32259 33452 gene locus_tag LOCUS_03330 32259 33452 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085433.1 protein_id gnl|my_center|LOCUS_03330 34631 33486 gene locus_tag LOCUS_03340 34631 33486 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_03340 36269 34650 gene locus_tag LOCUS_03350 gene prfC 36269 34650 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9B9 protein_id gnl|my_center|LOCUS_03350 36738 36406 gene locus_tag LOCUS_03360 36738 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_03360 36999 38072 gene locus_tag LOCUS_03370 36999 38072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 38344 38760 gene locus_tag LOCUS_03380 38344 38760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 38929 39360 gene locus_tag LOCUS_03390 38929 39360 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_03390 40226 39357 gene locus_tag LOCUS_03400 40226 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03400 40621 40223 gene locus_tag LOCUS_03410 40621 40223 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918942.1 protein_id gnl|my_center|LOCUS_03410 40806 41372 gene locus_tag LOCUS_03420 40806 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 41826 41347 gene locus_tag LOCUS_03430 41826 41347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 42362 41889 gene locus_tag LOCUS_03440 gene mopJ 42362 41889 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265646.1 protein_id gnl|my_center|LOCUS_03440 42979 42566 gene locus_tag LOCUS_03450 42979 42566 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918833.1 protein_id gnl|my_center|LOCUS_03450 44198 43272 gene locus_tag LOCUS_03460 44198 43272 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 protein_id gnl|my_center|LOCUS_03460 44346 44627 gene locus_tag LOCUS_03470 44346 44627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 44624 45457 gene locus_tag LOCUS_03480 44624 45457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 45474 45827 gene locus_tag LOCUS_03490 45474 45827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 46879 45758 gene locus_tag LOCUS_03500 46879 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_03500 47018 47335 gene locus_tag LOCUS_03510 47018 47335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 47383 47640 gene locus_tag LOCUS_03520 47383 47640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 48842 47676 gene locus_tag LOCUS_03530 48842 47676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_03530 48956 49390 gene locus_tag LOCUS_03540 48956 49390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 49553 50488 gene locus_tag LOCUS_03550 49553 50488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_03550 50485 51252 gene locus_tag LOCUS_03560 gene yadH 50485 51252 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4P8 protein_id gnl|my_center|LOCUS_03560 53244 52084 gene locus_tag LOCUS_03570 53244 52084 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3E3 protein_id gnl|my_center|LOCUS_03570 53416 54645 gene locus_tag LOCUS_03580 gene cisZ 53416 54645 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 protein_id gnl|my_center|LOCUS_03580 54642 55325 gene locus_tag LOCUS_03590 54642 55325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 56295 55330 gene locus_tag LOCUS_03600 56295 55330 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 protein_id gnl|my_center|LOCUS_03600 58040 56295 gene locus_tag LOCUS_03610 58040 56295 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_03610 58966 58181 gene locus_tag LOCUS_03620 58966 58181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 59263 60486 gene locus_tag LOCUS_03630 59263 60486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 61989 60511 gene locus_tag LOCUS_03640 61989 60511 CDS product flavin-binding family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088683.1 protein_id gnl|my_center|LOCUS_03640 62197 63435 gene locus_tag LOCUS_03650 62197 63435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 63494 65347 gene locus_tag LOCUS_03660 63494 65347 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_03660 66302 65397 gene locus_tag LOCUS_03670 66302 65397 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_03670 66551 68104 gene locus_tag LOCUS_03680 66551 68104 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_03680 68211 68690 gene locus_tag LOCUS_03690 68211 68690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 68816 69268 gene locus_tag LOCUS_03700 68816 69268 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_03700 69366 69782 gene locus_tag LOCUS_03710 gene msrB3 69366 69782 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8J6 protein_id gnl|my_center|LOCUS_03710 69793 71892 gene locus_tag LOCUS_03720 69793 71892 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974801.1 protein_id gnl|my_center|LOCUS_03720 72834 71977 gene locus_tag LOCUS_03730 gene tauD 72834 71977 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 protein_id gnl|my_center|LOCUS_03730 72970 73770 gene locus_tag LOCUS_03740 72970 73770 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338978.1 protein_id gnl|my_center|LOCUS_03740 75727 73757 gene locus_tag LOCUS_03750 75727 73757 CDS product glycosyl hydrolase family 35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391771.1 protein_id gnl|my_center|LOCUS_03750 75866 76927 gene locus_tag LOCUS_03760 75866 76927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 77028 77324 gene locus_tag LOCUS_03770 77028 77324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 77350 78591 gene locus_tag LOCUS_03780 77350 78591 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_03780 78614 79519 gene locus_tag LOCUS_03790 78614 79519 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 protein_id gnl|my_center|LOCUS_03790 80771 79902 gene locus_tag LOCUS_03800 gene tauD 80771 79902 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_03800 81677 80838 gene locus_tag LOCUS_03810 gene tauD 81677 80838 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_03810 81769 82461 gene locus_tag LOCUS_03820 81769 82461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 83510 82512 gene locus_tag LOCUS_03830 83510 82512 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_03830 83729 84643 gene locus_tag LOCUS_03840 83729 84643 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_03840 84737 85744 gene locus_tag LOCUS_03850 84737 85744 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_03850 86961 85930 gene locus_tag LOCUS_03860 86961 85930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 protein_id gnl|my_center|LOCUS_03860 87058 87984 gene locus_tag LOCUS_03870 87058 87984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_03870 88100 89287 gene locus_tag LOCUS_03880 88100 89287 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_03880 89525 90874 gene locus_tag LOCUS_03890 89525 90874 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_03890 91410 90907 gene locus_tag LOCUS_03900 91410 90907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 91753 93624 gene locus_tag LOCUS_03910 91753 93624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_03910 93621 94559 gene locus_tag LOCUS_03920 93621 94559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 94559 95557 gene locus_tag LOCUS_03930 94559 95557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence004 715 263 gene locus_tag LOCUS_03940 715 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_03940 1566 712 gene locus_tag LOCUS_03950 1566 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4210 1538 gene locus_tag LOCUS_03960 4210 1538 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_03960 4552 4214 gene locus_tag LOCUS_03970 4552 4214 CDS product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_03970 6996 4549 gene locus_tag LOCUS_03980 6996 4549 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061458.1 protein_id gnl|my_center|LOCUS_03980 8761 7001 gene locus_tag LOCUS_03990 8761 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9844 8771 gene locus_tag LOCUS_04000 9844 8771 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_04000 11317 9887 gene locus_tag LOCUS_04010 11317 9887 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_04010 11798 12337 gene locus_tag LOCUS_04020 11798 12337 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_04020 12334 13551 gene locus_tag LOCUS_04030 12334 13551 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_04030 13860 15095 gene locus_tag LOCUS_04040 13860 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_04040 16279 15260 gene locus_tag LOCUS_04050 16279 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 17180 16272 gene locus_tag LOCUS_04060 17180 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 17622 17395 gene locus_tag LOCUS_04070 17622 17395 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970277.1 protein_id gnl|my_center|LOCUS_04070 17740 18303 gene locus_tag LOCUS_04080 17740 18303 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937597.1 protein_id gnl|my_center|LOCUS_04080 18345 18554 gene locus_tag LOCUS_04090 18345 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 18630 19385 gene locus_tag LOCUS_04100 18630 19385 CDS product cyclopentanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731477.1 protein_id gnl|my_center|LOCUS_04100 19395 19736 gene locus_tag LOCUS_04110 19395 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 20828 19776 gene locus_tag LOCUS_04120 20828 19776 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920677.1 protein_id gnl|my_center|LOCUS_04120 21608 20874 gene locus_tag LOCUS_04130 21608 20874 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920676.1 protein_id gnl|my_center|LOCUS_04130 22726 21641 gene locus_tag LOCUS_04140 gene vanA 22726 21641 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085177.1 protein_id gnl|my_center|LOCUS_04140 23887 22802 gene locus_tag LOCUS_04150 23887 22802 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530418.1 protein_id gnl|my_center|LOCUS_04150 24663 24007 gene locus_tag LOCUS_04160 24663 24007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 25358 24708 gene locus_tag LOCUS_04170 gene azoR 25358 24708 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728Q5 protein_id gnl|my_center|LOCUS_04170 26576 25395 gene locus_tag LOCUS_04180 26576 25395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701068.1 protein_id gnl|my_center|LOCUS_04180 27450 26758 gene locus_tag LOCUS_04190 27450 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 28283 27462 gene locus_tag LOCUS_04200 28283 27462 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969766.1 protein_id gnl|my_center|LOCUS_04200 29462 28296 gene locus_tag LOCUS_04210 29462 28296 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039911.1 protein_id gnl|my_center|LOCUS_04210 30625 29459 gene locus_tag LOCUS_04220 30625 29459 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_04220 30745 32337 gene locus_tag LOCUS_04230 30745 32337 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_04230 32334 33110 gene locus_tag LOCUS_04240 32334 33110 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862000.1 protein_id gnl|my_center|LOCUS_04240 33169 34071 gene locus_tag LOCUS_04250 33169 34071 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889453.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04250 35936 34251 gene locus_tag LOCUS_04260 35936 34251 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_04260 36637 36050 gene locus_tag LOCUS_04270 36637 36050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 37199 36684 gene locus_tag LOCUS_04280 37199 36684 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_04280 37342 38334 gene locus_tag LOCUS_04290 37342 38334 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704725.1 protein_id gnl|my_center|LOCUS_04290 38919 38329 gene locus_tag LOCUS_04300 38919 38329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 39119 40276 gene locus_tag LOCUS_04310 39119 40276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701068.1 protein_id gnl|my_center|LOCUS_04310 41401 40319 gene locus_tag LOCUS_04320 41401 40319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 42354 41473 gene locus_tag LOCUS_04330 42354 41473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197352.1 protein_id gnl|my_center|LOCUS_04330 43923 42421 gene locus_tag LOCUS_04340 43923 42421 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_04340 45187 44084 gene locus_tag LOCUS_04350 45187 44084 CDS product vanillate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225964.1 protein_id gnl|my_center|LOCUS_04350 46770 45550 gene locus_tag LOCUS_04360 46770 45550 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_04360 46991 46794 gene locus_tag LOCUS_04370 46991 46794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 47925 46891 gene locus_tag LOCUS_04380 47925 46891 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705632.1 protein_id gnl|my_center|LOCUS_04380 47963 48763 gene locus_tag LOCUS_04390 47963 48763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 49107 49463 gene locus_tag LOCUS_04400 49107 49463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 49435 49971 gene locus_tag LOCUS_04410 49435 49971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 50255 50179 gene locus_tag LOCUS_t00030 50255 50179 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51442 50408 gene locus_tag LOCUS_04420 51442 50408 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 protein_id gnl|my_center|LOCUS_04420 51790 51446 gene locus_tag LOCUS_04430 51790 51446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 51678 53441 gene locus_tag LOCUS_04440 51678 53441 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 protein_id gnl|my_center|LOCUS_04440 54457 53438 gene locus_tag LOCUS_04450 54457 53438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 55848 54454 gene locus_tag LOCUS_04460 55848 54454 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_04460 57641 55845 gene locus_tag LOCUS_04470 57641 55845 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_04470 58420 57668 gene locus_tag LOCUS_04480 gene otsB 58420 57668 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SB3 protein_id gnl|my_center|LOCUS_04480 60053 58473 gene locus_tag LOCUS_04490 60053 58473 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090818.1 protein_id gnl|my_center|LOCUS_04490 61518 60094 gene locus_tag LOCUS_04500 gene merA1 61518 60094 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_04500 62317 61574 gene locus_tag LOCUS_04510 62317 61574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04510 63195 62314 gene locus_tag LOCUS_04520 63195 62314 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 protein_id gnl|my_center|LOCUS_04520 63491 63625 gene locus_tag LOCUS_04530 63491 63625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 63726 64142 gene locus_tag LOCUS_04540 gene rnpA 63726 64142 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 protein_id gnl|my_center|LOCUS_04540 64135 65949 gene locus_tag LOCUS_04550 gene yidC 64135 65949 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ0 protein_id gnl|my_center|LOCUS_04550 65953 66648 gene locus_tag LOCUS_04560 gene engB 65953 66648 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_04560 66685 67602 gene locus_tag LOCUS_04570 gene argB 66685 67602 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDL4 protein_id gnl|my_center|LOCUS_04570 67683 68684 gene locus_tag LOCUS_04580 67683 68684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 68668 68880 gene locus_tag LOCUS_04590 68668 68880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 69528 68854 gene locus_tag LOCUS_04600 69528 68854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 70847 69567 gene locus_tag LOCUS_04610 70847 69567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 72596 71322 gene locus_tag LOCUS_04620 72596 71322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 72766 73506 gene locus_tag LOCUS_04630 72766 73506 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_04630 75348 73489 gene locus_tag LOCUS_04640 gene mutL 75348 73489 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV5 protein_id gnl|my_center|LOCUS_04640 76685 75351 gene locus_tag LOCUS_04650 76685 75351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 78229 76835 gene locus_tag LOCUS_04660 78229 76835 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090217.1 protein_id gnl|my_center|LOCUS_04660 79593 78226 gene locus_tag LOCUS_04670 79593 78226 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_04670 80306 79704 gene locus_tag LOCUS_04680 80306 79704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_04680 80921 80370 gene locus_tag LOCUS_04690 gene lspA 80921 80370 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DF7 protein_id gnl|my_center|LOCUS_04690 83945 80955 gene locus_tag LOCUS_04700 gene ileS 83945 80955 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E2 protein_id gnl|my_center|LOCUS_04700 84019 84195 gene locus_tag LOCUS_04710 84019 84195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 84204 84980 gene locus_tag LOCUS_04720 gene pheC 84204 84980 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01269 protein_id gnl|my_center|LOCUS_04720 85543 85115 gene locus_tag LOCUS_04730 85543 85115 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919536.1 protein_id gnl|my_center|LOCUS_04730 86433 85543 gene locus_tag LOCUS_04740 86433 85543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 86653 87978 gene locus_tag LOCUS_04750 86653 87978 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_04750 88122 88328 gene locus_tag LOCUS_04760 88122 88328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 89195 88344 gene locus_tag LOCUS_04770 89195 88344 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_04770 90697 89219 gene locus_tag LOCUS_04780 90697 89219 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_04780 92330 90999 gene locus_tag LOCUS_04790 92330 90999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence005 214 405 gene locus_tag LOCUS_04800 214 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 532 1323 gene locus_tag LOCUS_04810 532 1323 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_04810 1366 2517 gene locus_tag LOCUS_04820 1366 2517 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063639.1 protein_id gnl|my_center|LOCUS_04820 2528 3547 gene locus_tag LOCUS_04830 2528 3547 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_04830 3576 4247 gene locus_tag LOCUS_04840 3576 4247 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_04840 4322 4681 gene locus_tag LOCUS_04850 4322 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4712 5383 gene locus_tag LOCUS_04860 4712 5383 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 protein_id gnl|my_center|LOCUS_04860 5373 6746 gene locus_tag LOCUS_04870 5373 6746 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_04870 8775 7399 gene locus_tag LOCUS_04880 8775 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_04880 8845 9039 gene locus_tag LOCUS_04890 8845 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9451 10881 gene locus_tag LOCUS_04900 9451 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085907.1 protein_id gnl|my_center|LOCUS_04900 11925 10888 gene locus_tag LOCUS_04910 11925 10888 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_04910 13150 11927 gene locus_tag LOCUS_04920 13150 11927 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_04920 13403 15256 gene locus_tag LOCUS_04930 13403 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17449 15260 gene locus_tag LOCUS_04940 17449 15260 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_04940 17685 18776 gene locus_tag LOCUS_04950 gene cycH 17685 18776 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45399 protein_id gnl|my_center|LOCUS_04950 18841 19773 gene locus_tag LOCUS_04960 18841 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19911 20393 gene locus_tag LOCUS_04970 gene ccmE 19911 20393 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_04970 20390 22372 gene locus_tag LOCUS_04980 20390 22372 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_04980 22377 22850 gene locus_tag LOCUS_04990 gene ccmH 22377 22850 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45405 protein_id gnl|my_center|LOCUS_04990 23088 24566 gene locus_tag LOCUS_05000 gene dop 23088 24566 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085377.1 protein_id gnl|my_center|LOCUS_05000 24665 25342 gene locus_tag LOCUS_05010 24665 25342 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085915.1 protein_id gnl|my_center|LOCUS_05010 25414 26826 gene locus_tag LOCUS_05020 25414 26826 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_05020 26942 29887 gene locus_tag LOCUS_05030 gene glnE 26942 29887 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 protein_id gnl|my_center|LOCUS_05030 30121 31719 gene locus_tag LOCUS_05040 30121 31719 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_05040 31723 33300 gene locus_tag LOCUS_05050 31723 33300 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_05050 33297 34619 gene locus_tag LOCUS_05060 33297 34619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 34829 35638 gene locus_tag LOCUS_05070 34829 35638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 35762 36340 gene locus_tag LOCUS_05080 35762 36340 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_05080 36368 36871 gene locus_tag LOCUS_05090 36368 36871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 36868 37425 gene locus_tag LOCUS_05100 36868 37425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 37552 38889 gene locus_tag LOCUS_05110 37552 38889 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064276.1 protein_id gnl|my_center|LOCUS_05110 39009 40406 gene locus_tag LOCUS_05120 gene spuI 39009 40406 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_05120 42374 40449 gene locus_tag LOCUS_05130 42374 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 45236 42585 gene locus_tag LOCUS_05140 gene pepN 45236 42585 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 protein_id gnl|my_center|LOCUS_05140 45941 45405 gene locus_tag LOCUS_05150 45941 45405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 protein_id gnl|my_center|LOCUS_05150 46201 47328 gene locus_tag LOCUS_05160 46201 47328 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_05160 47566 48795 gene locus_tag LOCUS_05170 47566 48795 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_05170 50480 49320 gene locus_tag LOCUS_05180 50480 49320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 50979 50650 gene locus_tag LOCUS_05190 50979 50650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087423.1 protein_id gnl|my_center|LOCUS_05190 51908 50976 gene locus_tag LOCUS_05200 gene dnaJ 51908 50976 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087422.1 protein_id gnl|my_center|LOCUS_05200 52596 52075 gene locus_tag LOCUS_05210 52596 52075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 53383 52625 gene locus_tag LOCUS_05220 53383 52625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 53805 55211 gene locus_tag LOCUS_05230 gene mltF 53805 55211 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 protein_id gnl|my_center|LOCUS_05230 55373 56026 gene locus_tag LOCUS_05240 55373 56026 CDS product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 protein_id gnl|my_center|LOCUS_05240 56240 57739 gene locus_tag LOCUS_05250 56240 57739 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_05250 58954 57764 gene locus_tag LOCUS_05260 58954 57764 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_05260 59436 58951 gene locus_tag LOCUS_05270 59436 58951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 59787 61427 gene locus_tag LOCUS_05280 gene fixN3 59787 61427 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967313.1 protein_id gnl|my_center|LOCUS_05280 61434 62165 gene locus_tag LOCUS_05290 61434 62165 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970725.1 protein_id gnl|my_center|LOCUS_05290 62168 62338 gene locus_tag LOCUS_05300 gene fixQ 62168 62338 CDS product cbb3 cytochrome oxidase subunit FixQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709093.1 protein_id gnl|my_center|LOCUS_05300 62329 63210 gene locus_tag LOCUS_05310 gene fixP1 62329 63210 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH49 protein_id gnl|my_center|LOCUS_05310 63207 63422 gene locus_tag LOCUS_05320 63207 63422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 63468 64256 gene locus_tag LOCUS_05330 63468 64256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970721.1 protein_id gnl|my_center|LOCUS_05330 64267 64488 gene locus_tag LOCUS_05340 64267 64488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05340 64556 64837 gene locus_tag LOCUS_05350 64556 64837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 65732 65103 gene locus_tag LOCUS_05360 65732 65103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 66308 65775 gene locus_tag LOCUS_05370 66308 65775 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707566.1 protein_id gnl|my_center|LOCUS_05370 67685 66330 gene locus_tag LOCUS_05380 67685 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967665.1 protein_id gnl|my_center|LOCUS_05380 68226 67906 gene locus_tag LOCUS_05390 gene fdx 68226 67906 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_05390 68560 68237 gene locus_tag LOCUS_05400 68560 68237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 68939 69394 gene locus_tag LOCUS_05410 gene nsrR 68939 69394 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_05410 69633 71474 gene locus_tag LOCUS_05420 gene cysJ 69633 71474 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_05420 71483 73228 gene locus_tag LOCUS_05430 gene cysI 71483 73228 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMX5 protein_id gnl|my_center|LOCUS_05430 73273 73632 gene locus_tag LOCUS_05440 73273 73632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_05440 73842 74996 gene locus_tag LOCUS_05450 gene metB 73842 74996 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968337.1 protein_id gnl|my_center|LOCUS_05450 75197 75574 gene locus_tag LOCUS_05460 75197 75574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 protein_id gnl|my_center|LOCUS_05460 75765 77498 gene locus_tag LOCUS_05470 75765 77498 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_05470 77660 78340 gene locus_tag LOCUS_05480 77660 78340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 78334 78909 gene locus_tag LOCUS_05490 78334 78909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 79811 78951 gene locus_tag LOCUS_05500 79811 78951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_05500 79889 80215 gene locus_tag LOCUS_05510 79889 80215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 80212 81951 gene locus_tag LOCUS_05520 80212 81951 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_05520 82024 84747 gene locus_tag LOCUS_05530 82024 84747 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_05530 84992 85966 gene locus_tag LOCUS_05540 gene dusA 84992 85966 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NV0 protein_id gnl|my_center|LOCUS_05540 85995 86828 gene locus_tag LOCUS_05550 85995 86828 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIG5 protein_id gnl|my_center|LOCUS_05550 87929 86835 gene locus_tag LOCUS_05560 87929 86835 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084168.1 protein_id gnl|my_center|LOCUS_05560 88055 88300 gene locus_tag LOCUS_05570 88055 88300 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRZ3 protein_id gnl|my_center|LOCUS_05570 88297 88683 gene locus_tag LOCUS_05580 88297 88683 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887492.1 protein_id gnl|my_center|LOCUS_05580 90196 88697 gene locus_tag LOCUS_05590 90196 88697 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_05590 90967 90302 gene locus_tag LOCUS_05600 90967 90302 CDS product aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708268.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence006 4 1143 gene locus_tag LOCUS_05610 4 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1305 1697 gene locus_tag LOCUS_05620 gene flbT1 1305 1697 CDS product putative flagellum biosynthesis repressor protein FlbT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HZ2 protein_id gnl|my_center|LOCUS_05620 1759 2058 gene locus_tag LOCUS_05630 1759 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3620 2127 gene locus_tag LOCUS_05640 3620 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5486 3624 gene locus_tag LOCUS_05650 5486 3624 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 protein_id gnl|my_center|LOCUS_05650 6918 5566 gene locus_tag LOCUS_05660 6918 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6800 7045 gene locus_tag LOCUS_05670 6800 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 7286 8131 gene locus_tag LOCUS_05680 7286 8131 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_05680 8224 9399 gene locus_tag LOCUS_05690 8224 9399 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_05690 10091 9396 gene locus_tag LOCUS_05700 10091 9396 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969383.1 protein_id gnl|my_center|LOCUS_05700 11338 10088 gene locus_tag LOCUS_05710 11338 10088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946586.1 protein_id gnl|my_center|LOCUS_05710 12379 11348 gene locus_tag LOCUS_05720 12379 11348 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969385.1 protein_id gnl|my_center|LOCUS_05720 12507 12914 gene locus_tag LOCUS_05730 12507 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 16114 12911 gene locus_tag LOCUS_05740 gene dnaE2-1 16114 12911 CDS product error-prone DNA polymerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LA6 protein_id gnl|my_center|LOCUS_05740 17616 16111 gene locus_tag LOCUS_05750 17616 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970471.1 protein_id gnl|my_center|LOCUS_05750 17877 18146 gene locus_tag LOCUS_05760 17877 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 18167 18454 gene locus_tag LOCUS_05770 18167 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 19234 18470 gene locus_tag LOCUS_05780 19234 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 protein_id gnl|my_center|LOCUS_05780 20107 19490 gene locus_tag LOCUS_05790 gene pmtA 20107 19490 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_05790 21026 20157 gene locus_tag LOCUS_05800 21026 20157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 22171 21131 gene locus_tag LOCUS_05810 22171 21131 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC20 protein_id gnl|my_center|LOCUS_05810 22391 22693 gene locus_tag LOCUS_05820 22391 22693 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 protein_id gnl|my_center|LOCUS_05820 23125 22700 gene locus_tag LOCUS_05830 23125 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 23263 24801 gene locus_tag LOCUS_05840 23263 24801 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_05840 24821 25954 gene locus_tag LOCUS_05850 24821 25954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_05850 26364 25978 gene locus_tag LOCUS_05860 26364 25978 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531879.1 protein_id gnl|my_center|LOCUS_05860 26785 28992 gene locus_tag LOCUS_05870 26785 28992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 29683 29021 gene locus_tag LOCUS_05880 29683 29021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815887.1 protein_id gnl|my_center|LOCUS_05880 30621 29710 gene locus_tag LOCUS_05890 30621 29710 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937913.1 protein_id gnl|my_center|LOCUS_05890 31400 30627 gene locus_tag LOCUS_05900 31400 30627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_05900 32512 31400 gene locus_tag LOCUS_05910 32512 31400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 protein_id gnl|my_center|LOCUS_05910 32756 33154 gene locus_tag LOCUS_05920 gene cy2 32756 33154 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973792.1 protein_id gnl|my_center|LOCUS_05920 33363 35624 gene locus_tag LOCUS_05930 33363 35624 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_05930 35740 36726 gene locus_tag LOCUS_05940 35740 36726 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 protein_id gnl|my_center|LOCUS_05940 37823 36813 gene locus_tag LOCUS_05950 37823 36813 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530708.1 protein_id gnl|my_center|LOCUS_05950 38775 37918 gene locus_tag LOCUS_05960 38775 37918 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_05960 39973 38765 gene locus_tag LOCUS_05970 39973 38765 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_05970 40582 40133 gene locus_tag LOCUS_05980 40582 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 41619 40579 gene locus_tag LOCUS_05990 41619 40579 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_05990 42740 41631 gene locus_tag LOCUS_06000 42740 41631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_06000 43059 42883 gene locus_tag LOCUS_06010 43059 42883 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F5 protein_id gnl|my_center|LOCUS_06010 43155 43538 gene locus_tag LOCUS_06020 43155 43538 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_06020 43668 45170 gene locus_tag LOCUS_06030 43668 45170 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228608.1 protein_id gnl|my_center|LOCUS_06030 45203 46174 gene locus_tag LOCUS_06040 45203 46174 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_06040 46287 46706 gene locus_tag LOCUS_06050 46287 46706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_06050 46984 48345 gene locus_tag LOCUS_06060 46984 48345 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 48311 49033 gene locus_tag LOCUS_06070 48311 49033 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_06070 49030 50115 gene locus_tag LOCUS_06080 49030 50115 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_06080 50715 50095 gene locus_tag LOCUS_06090 50715 50095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_06090 50866 51447 gene locus_tag LOCUS_06100 50866 51447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 52064 51456 gene locus_tag LOCUS_06110 52064 51456 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_06110 53029 52061 gene locus_tag LOCUS_06120 gene corA 53029 52061 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT62 protein_id gnl|my_center|LOCUS_06120 53353 54705 gene locus_tag LOCUS_06130 gene rhlE 53353 54705 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 protein_id gnl|my_center|LOCUS_06130 54806 55651 gene locus_tag LOCUS_06140 54806 55651 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_06140 55753 55678 gene locus_tag LOCUS_t00040 55753 55678 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 57147 55999 gene locus_tag LOCUS_06150 gene rodA 57147 55999 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_06150 59030 57147 gene locus_tag LOCUS_06160 59030 57147 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_06160 59582 59049 gene locus_tag LOCUS_06170 59582 59049 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 protein_id gnl|my_center|LOCUS_06170 60464 59586 gene locus_tag LOCUS_06180 60464 59586 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 protein_id gnl|my_center|LOCUS_06180 61578 60538 gene locus_tag LOCUS_06190 61578 60538 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_06190 63349 61763 gene locus_tag LOCUS_06200 gene leuA 63349 61763 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A823 protein_id gnl|my_center|LOCUS_06200 64778 63837 gene locus_tag LOCUS_06210 64778 63837 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403558.1 protein_id gnl|my_center|LOCUS_06210 65030 65365 gene locus_tag LOCUS_06220 65030 65365 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_06220 65362 66273 gene locus_tag LOCUS_06230 65362 66273 CDS product zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_06230 66254 66436 gene locus_tag LOCUS_06240 66254 66436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 66433 67167 gene locus_tag LOCUS_06250 66433 67167 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_06250 67188 67625 gene locus_tag LOCUS_06260 67188 67625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 68962 67943 gene locus_tag LOCUS_06270 gene ilvC 68962 67943 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G50 protein_id gnl|my_center|LOCUS_06270 69503 68991 gene locus_tag LOCUS_06280 gene ilvH 69503 68991 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_06280 71322 69565 gene locus_tag LOCUS_06290 71322 69565 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 protein_id gnl|my_center|LOCUS_06290 72435 71491 gene locus_tag LOCUS_06300 gene miaA 72435 71491 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G43 protein_id gnl|my_center|LOCUS_06300 72462 73346 gene locus_tag LOCUS_06310 gene serB 72462 73346 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708549.1 protein_id gnl|my_center|LOCUS_06310 74888 73425 gene locus_tag LOCUS_06320 74888 73425 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 protein_id gnl|my_center|LOCUS_06320 75169 74984 gene locus_tag LOCUS_06330 75169 74984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_06330 76059 75190 gene locus_tag LOCUS_06340 76059 75190 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 protein_id gnl|my_center|LOCUS_06340 77264 76059 gene locus_tag LOCUS_06350 77264 76059 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_06350 77468 78640 gene locus_tag LOCUS_06360 77468 78640 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T733 protein_id gnl|my_center|LOCUS_06360 79099 78710 gene locus_tag LOCUS_06370 79099 78710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 80084 79167 gene locus_tag LOCUS_06380 80084 79167 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_06380 81060 80221 gene locus_tag LOCUS_06390 81060 80221 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB24 protein_id gnl|my_center|LOCUS_06390 82169 81060 gene locus_tag LOCUS_06400 82169 81060 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_06400 83044 82235 gene locus_tag LOCUS_06410 83044 82235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 83675 83169 gene locus_tag LOCUS_06420 gene folA 83675 83169 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G37 protein_id gnl|my_center|LOCUS_06420 83836 83675 gene locus_tag LOCUS_06430 83836 83675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 84630 83836 gene locus_tag LOCUS_06440 gene thyA 84630 83836 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_06440 84814 85980 gene locus_tag LOCUS_06450 84814 85980 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_06450 86610 86386 gene locus_tag LOCUS_06460 86610 86386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 86503 86985 gene locus_tag LOCUS_06470 86503 86985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_06470 86982 87341 gene locus_tag LOCUS_06480 86982 87341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 87444 88835 gene locus_tag LOCUS_06490 gene fumC 87444 88835 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PB6 protein_id gnl|my_center|LOCUS_06490 88850 89116 gene locus_tag LOCUS_06500 88850 89116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence007 1137 640 gene locus_tag LOCUS_06510 1137 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1454 1870 gene locus_tag LOCUS_06520 1454 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1867 3018 gene locus_tag LOCUS_06530 1867 3018 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_06530 3287 3739 gene locus_tag LOCUS_06540 3287 3739 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875350.1 protein_id gnl|my_center|LOCUS_06540 3829 4020 gene locus_tag LOCUS_06550 3829 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4180 4326 gene locus_tag LOCUS_06560 4180 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4392 5582 gene locus_tag LOCUS_06570 4392 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 5582 5881 gene locus_tag LOCUS_06580 5582 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971014.1 protein_id gnl|my_center|LOCUS_06580 6158 7162 gene locus_tag LOCUS_06590 6158 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7271 8938 gene locus_tag LOCUS_06600 7271 8938 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 protein_id gnl|my_center|LOCUS_06600 9024 10631 gene locus_tag LOCUS_06610 gene glt 9024 10631 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082931.1 protein_id gnl|my_center|LOCUS_06610 10698 10922 gene locus_tag LOCUS_06620 10698 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10971 11813 gene locus_tag LOCUS_06630 10971 11813 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_06630 11891 12661 gene locus_tag LOCUS_06640 gene bdhA 11891 12661 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 protein_id gnl|my_center|LOCUS_06640 12661 12960 gene locus_tag LOCUS_06650 12661 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12936 13442 gene locus_tag LOCUS_06660 12936 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06660 13531 13737 gene locus_tag LOCUS_06670 13531 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 13765 14508 gene locus_tag LOCUS_06680 gene adc2 13765 14508 CDS product putative acetoacetate decarboxylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EP4 protein_id gnl|my_center|LOCUS_06680 14554 15597 gene locus_tag LOCUS_06690 14554 15597 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_06690 16065 15667 gene locus_tag LOCUS_06700 16065 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 16319 16065 gene locus_tag LOCUS_06710 16319 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 16756 16340 gene locus_tag LOCUS_06720 16756 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16737 16880 gene locus_tag LOCUS_06730 16737 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16917 17450 gene locus_tag LOCUS_06740 16917 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 17586 18473 gene locus_tag LOCUS_06750 17586 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 18841 18749 gene locus_tag LOCUS_t00050 18841 18749 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19811 18918 gene locus_tag LOCUS_06760 gene tesB 19811 18918 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 protein_id gnl|my_center|LOCUS_06760 20252 19983 gene locus_tag LOCUS_06770 20252 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 protein_id gnl|my_center|LOCUS_06770 21061 20429 gene locus_tag LOCUS_06780 21061 20429 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_06780 21562 21209 gene locus_tag LOCUS_06790 21562 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 22339 21770 gene locus_tag LOCUS_06800 gene gst7 22339 21770 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969007.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06800 23020 22496 gene locus_tag LOCUS_06810 23020 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 24749 23241 gene locus_tag LOCUS_06820 gene gatB 24749 23241 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK5 protein_id gnl|my_center|LOCUS_06820 26233 24755 gene locus_tag LOCUS_06830 gene gatA 26233 24755 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFS8 protein_id gnl|my_center|LOCUS_06830 26524 26237 gene locus_tag LOCUS_06840 gene gatC 26524 26237 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK8 protein_id gnl|my_center|LOCUS_06840 26744 27214 gene locus_tag LOCUS_06850 26744 27214 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_06850 27331 28245 gene locus_tag LOCUS_06860 27331 28245 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 protein_id gnl|my_center|LOCUS_06860 30019 28325 gene locus_tag LOCUS_06870 30019 28325 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_06870 30180 31103 gene locus_tag LOCUS_06880 gene pyrB 30180 31103 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K19 protein_id gnl|my_center|LOCUS_06880 31100 32395 gene locus_tag LOCUS_06890 gene pyrC 31100 32395 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K18 protein_id gnl|my_center|LOCUS_06890 32398 33066 gene locus_tag LOCUS_06900 gene plsY 32398 33066 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K17 protein_id gnl|my_center|LOCUS_06900 33073 34197 gene locus_tag LOCUS_06910 gene smf 33073 34197 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087864.1 protein_id gnl|my_center|LOCUS_06910 34521 34201 gene locus_tag LOCUS_06920 34521 34201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 34882 37563 gene locus_tag LOCUS_06930 gene topA 34882 37563 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA12 protein_id gnl|my_center|LOCUS_06930 37566 39986 gene locus_tag LOCUS_06940 gene rnr 37566 39986 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ94 protein_id gnl|my_center|LOCUS_06940 40105 40545 gene locus_tag LOCUS_06950 40105 40545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087873.1 protein_id gnl|my_center|LOCUS_06950 40654 41421 gene locus_tag LOCUS_06960 40654 41421 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920315.1 protein_id gnl|my_center|LOCUS_06960 41421 42110 gene locus_tag LOCUS_06970 41421 42110 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 42207 43424 gene locus_tag LOCUS_06980 42207 43424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707651.1 protein_id gnl|my_center|LOCUS_06980 43611 43778 gene locus_tag LOCUS_06990 gene rpmG 43611 43778 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 protein_id gnl|my_center|LOCUS_06990 43969 45459 gene locus_tag LOCUS_07000 43969 45459 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_07000 47385 46012 gene locus_tag LOCUS_07010 gene pleD 47385 46012 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_07010 47799 47425 gene locus_tag LOCUS_07020 gene divK 47799 47425 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_07020 48035 48313 gene locus_tag LOCUS_07030 48035 48313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 48310 49008 gene locus_tag LOCUS_07040 48310 49008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531934.1 protein_id gnl|my_center|LOCUS_07040 49038 50261 gene locus_tag LOCUS_07050 49038 50261 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331457.1 protein_id gnl|my_center|LOCUS_07050 50287 51186 gene locus_tag LOCUS_07060 50287 51186 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_07060 51269 52570 gene locus_tag LOCUS_07070 gene dinB1 51269 52570 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFV3 protein_id gnl|my_center|LOCUS_07070 53557 52709 gene locus_tag LOCUS_07080 53557 52709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707889.1 protein_id gnl|my_center|LOCUS_07080 53729 54607 gene locus_tag LOCUS_07090 53729 54607 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_07090 54804 55532 gene locus_tag LOCUS_07100 54804 55532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 56576 55536 gene locus_tag LOCUS_07110 gene aguA 56576 55536 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK4 protein_id gnl|my_center|LOCUS_07110 56674 57141 gene locus_tag LOCUS_07120 56674 57141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_07120 57169 58368 gene locus_tag LOCUS_07130 57169 58368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 protein_id gnl|my_center|LOCUS_07130 58371 58799 gene locus_tag LOCUS_07140 58371 58799 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971569.1 protein_id gnl|my_center|LOCUS_07140 58853 60469 gene locus_tag LOCUS_07150 58853 60469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084223.1 protein_id gnl|my_center|LOCUS_07150 60888 60523 gene locus_tag LOCUS_07160 60888 60523 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_07160 63365 60993 gene locus_tag LOCUS_07170 63365 60993 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_07170 63748 63416 gene locus_tag LOCUS_07180 63748 63416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 64360 66012 gene locus_tag LOCUS_07190 64360 66012 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969214.1 protein_id gnl|my_center|LOCUS_07190 66860 66009 gene locus_tag LOCUS_07200 66860 66009 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_07200 67147 68514 gene locus_tag LOCUS_07210 67147 68514 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 protein_id gnl|my_center|LOCUS_07210 68511 69905 gene locus_tag LOCUS_07220 68511 69905 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_07220 69902 71080 gene locus_tag LOCUS_07230 69902 71080 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969773.1 protein_id gnl|my_center|LOCUS_07230 71275 72141 gene locus_tag LOCUS_07240 gene panC 71275 72141 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 protein_id gnl|my_center|LOCUS_07240 73050 72154 gene locus_tag LOCUS_07250 73050 72154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_07250 73555 73121 gene locus_tag LOCUS_07260 73555 73121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 protein_id gnl|my_center|LOCUS_07260 75570 73552 gene locus_tag LOCUS_07270 gene liuD 75570 73552 CDS product methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113506.1 protein_id gnl|my_center|LOCUS_07270 77186 75579 gene locus_tag LOCUS_07280 gene accB 77186 75579 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815953.1 protein_id gnl|my_center|LOCUS_07280 77273 77863 gene locus_tag LOCUS_07290 77273 77863 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338205.1 protein_id gnl|my_center|LOCUS_07290 77881 78273 gene locus_tag LOCUS_07300 77881 78273 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_07300 79474 78275 gene locus_tag LOCUS_07310 79474 78275 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709489.1 protein_id gnl|my_center|LOCUS_07310 79573 80457 gene locus_tag LOCUS_07320 79573 80457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 81671 80499 gene locus_tag LOCUS_07330 81671 80499 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389701.1 protein_id gnl|my_center|LOCUS_07330 82780 81755 gene locus_tag LOCUS_07340 82780 81755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_07340 84195 82810 gene locus_tag LOCUS_07350 84195 82810 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QC9 protein_id gnl|my_center|LOCUS_07350 84451 84365 gene locus_tag LOCUS_t00060 84451 84365 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85348 84524 gene locus_tag LOCUS_07360 85348 84524 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 protein_id gnl|my_center|LOCUS_07360 85905 85345 gene locus_tag LOCUS_07370 85905 85345 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_07370 86368 86117 gene locus_tag LOCUS_07380 86368 86117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 86445 87131 gene locus_tag LOCUS_07390 gene lipB 86445 87131 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U899 protein_id gnl|my_center|LOCUS_07390 >Feature sequence008 <1 593 gene locus_tag LOCUS_07400 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707339.1:two-component sensor histidine kinase 1335 598 gene locus_tag LOCUS_07410 gene gst3 1335 598 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968488.1 protein_id gnl|my_center|LOCUS_07410 2627 1389 gene locus_tag LOCUS_07420 2627 1389 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 protein_id gnl|my_center|LOCUS_07420 3217 2753 gene locus_tag LOCUS_07430 gene tadA 3217 2753 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J463 protein_id gnl|my_center|LOCUS_07430 3368 3679 gene locus_tag LOCUS_07440 3368 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3707 4723 gene locus_tag LOCUS_07450 3707 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4698 5267 gene locus_tag LOCUS_07460 4698 5267 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_07460 5297 6157 gene locus_tag LOCUS_07470 5297 6157 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532364.1 protein_id gnl|my_center|LOCUS_07470 6273 7223 gene locus_tag LOCUS_07480 6273 7223 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_07480 7220 7882 gene locus_tag LOCUS_07490 7220 7882 CDS product nicotinamide N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_07490 8020 8808 gene locus_tag LOCUS_07500 8020 8808 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918285.1 protein_id gnl|my_center|LOCUS_07500 9420 8815 gene locus_tag LOCUS_07510 9420 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9614 11155 gene locus_tag LOCUS_07520 9614 11155 CDS product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_07520 12495 11158 gene locus_tag LOCUS_07530 12495 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 12535 13056 gene locus_tag LOCUS_07540 12535 13056 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_07540 13688 13053 gene locus_tag LOCUS_07550 13688 13053 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203376.1 protein_id gnl|my_center|LOCUS_07550 14254 13694 gene locus_tag LOCUS_07560 14254 13694 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_07560 14850 14254 gene locus_tag LOCUS_07570 14850 14254 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528303.1 protein_id gnl|my_center|LOCUS_07570 15498 14926 gene locus_tag LOCUS_07580 15498 14926 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU7 protein_id gnl|my_center|LOCUS_07580 15606 16016 gene locus_tag LOCUS_07590 15606 16016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_07590 16050 17411 gene locus_tag LOCUS_07600 16050 17411 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090251.1 protein_id gnl|my_center|LOCUS_07600 17398 18216 gene locus_tag LOCUS_07610 17398 18216 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 protein_id gnl|my_center|LOCUS_07610 18307 18540 gene locus_tag LOCUS_07620 18307 18540 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_07620 18769 19059 gene locus_tag LOCUS_07630 18769 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07630 19194 21083 gene locus_tag LOCUS_07640 19194 21083 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 protein_id gnl|my_center|LOCUS_07640 21090 21836 gene locus_tag LOCUS_07650 21090 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_07650 21994 23163 gene locus_tag LOCUS_07660 21994 23163 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_07660 23156 24181 gene locus_tag LOCUS_07670 gene lpxK 23156 24181 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6I0 protein_id gnl|my_center|LOCUS_07670 24229 25134 gene locus_tag LOCUS_07680 24229 25134 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_07680 25980 25135 gene locus_tag LOCUS_07690 25980 25135 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_07690 26195 25977 gene locus_tag LOCUS_07700 26195 25977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090242.1 protein_id gnl|my_center|LOCUS_07700 27711 26257 gene locus_tag LOCUS_07710 gene xseA 27711 26257 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIM4 protein_id gnl|my_center|LOCUS_07710 27848 29131 gene locus_tag LOCUS_07720 gene purD 27848 29131 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHN3 protein_id gnl|my_center|LOCUS_07720 29212 30306 gene locus_tag LOCUS_07730 29212 30306 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_07730 30328 30783 gene locus_tag LOCUS_07740 30328 30783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 31938 30784 gene locus_tag LOCUS_07750 gene pfk-2 31938 30784 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS2 protein_id gnl|my_center|LOCUS_07750 33130 31985 gene locus_tag LOCUS_07760 33130 31985 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_07760 33324 33992 gene locus_tag LOCUS_07770 33324 33992 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529190.1 protein_id gnl|my_center|LOCUS_07770 34879 33989 gene locus_tag LOCUS_07780 34879 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 34948 35682 gene locus_tag LOCUS_07790 34948 35682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261156.1 protein_id gnl|my_center|LOCUS_07790 35835 36152 gene locus_tag LOCUS_07800 gene groS 35835 36152 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IK9 protein_id gnl|my_center|LOCUS_07800 36245 37900 gene locus_tag LOCUS_07810 gene groL7 36245 37900 CDS product 60 kDa chaperonin 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DA6 protein_id gnl|my_center|LOCUS_07810 38352 39164 gene locus_tag LOCUS_07820 38352 39164 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415986.1 protein_id gnl|my_center|LOCUS_07820 39902 39153 gene locus_tag LOCUS_07830 39902 39153 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_07830 40889 39909 gene locus_tag LOCUS_07840 gene hisG 40889 39909 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DB4 protein_id gnl|my_center|LOCUS_07840 42040 40886 gene locus_tag LOCUS_07850 gene hisZ 42040 40886 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_07850 43681 42161 gene locus_tag LOCUS_07860 gene hisS 43681 42161 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB6 protein_id gnl|my_center|LOCUS_07860 44147 45691 gene locus_tag LOCUS_07870 44147 45691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 45818 47206 gene locus_tag LOCUS_07880 gene qxtA 45818 47206 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339133.1 protein_id gnl|my_center|LOCUS_07880 47229 48239 gene locus_tag LOCUS_07890 47229 48239 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 protein_id gnl|my_center|LOCUS_07890 48214 48390 gene locus_tag LOCUS_07900 48214 48390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 49156 48392 gene locus_tag LOCUS_07910 49156 48392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 50606 49161 gene locus_tag LOCUS_07920 50606 49161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_07920 50823 52442 gene locus_tag LOCUS_07930 50823 52442 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7F8 protein_id gnl|my_center|LOCUS_07930 52484 53779 gene locus_tag LOCUS_07940 52484 53779 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530245.1 protein_id gnl|my_center|LOCUS_07940 53936 54367 gene locus_tag LOCUS_07950 53936 54367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 54766 55248 gene locus_tag LOCUS_07960 54766 55248 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J86 protein_id gnl|my_center|LOCUS_07960 55321 56469 gene locus_tag LOCUS_07970 55321 56469 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_07970 57348 56476 gene locus_tag LOCUS_07980 gene speE 57348 56476 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB1 protein_id gnl|my_center|LOCUS_07980 57863 57348 gene locus_tag LOCUS_07990 gene speH 57863 57348 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTQ3 protein_id gnl|my_center|LOCUS_07990 58502 59023 gene locus_tag LOCUS_08000 58502 59023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 59965 59027 gene locus_tag LOCUS_08010 59965 59027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919444.1 protein_id gnl|my_center|LOCUS_08010 60523 60104 gene locus_tag LOCUS_08020 60523 60104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 60465 60725 gene locus_tag LOCUS_08030 60465 60725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 62525 60810 gene locus_tag LOCUS_08040 62525 60810 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_08040 63079 62660 gene locus_tag LOCUS_08050 63079 62660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 65099 63519 gene locus_tag LOCUS_08060 65099 63519 CDS product putative acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704165.1 protein_id gnl|my_center|LOCUS_08060 65247 66317 gene locus_tag LOCUS_08070 65247 66317 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_08070 66454 67596 gene locus_tag LOCUS_08080 gene yjcL 66454 67596 CDS product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 protein_id gnl|my_center|LOCUS_08080 67675 68475 gene locus_tag LOCUS_08090 67675 68475 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_08090 68587 70335 gene locus_tag LOCUS_08100 68587 70335 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_08100 70532 73261 gene locus_tag LOCUS_08110 gene ndvB 70532 73261 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_08110 74103 73330 gene locus_tag LOCUS_08120 gene fabG 74103 73330 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_08120 75996 74245 gene locus_tag LOCUS_08130 75996 74245 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_08130 76749 76084 gene locus_tag LOCUS_08140 76749 76084 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_08140 77053 76977 gene locus_tag LOCUS_t00070 77053 76977 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 78560 77187 gene locus_tag LOCUS_08150 78560 77187 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_08150 78768 79703 gene locus_tag LOCUS_08160 78768 79703 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_08160 81694 79700 gene locus_tag LOCUS_08170 81694 79700 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_08170 81895 83928 gene locus_tag LOCUS_08180 gene amsA 81895 83928 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_08180 84460 83933 gene locus_tag LOCUS_08190 84460 83933 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_08190 84567 84818 gene locus_tag LOCUS_08200 84567 84818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence009 97 1137 gene locus_tag LOCUS_08210 97 1137 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_08210 1224 2603 gene locus_tag LOCUS_08220 1224 2603 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_08220 2596 3882 gene locus_tag LOCUS_08230 2596 3882 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_08230 3884 4744 gene locus_tag LOCUS_08240 gene pstB 3884 4744 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8C2 protein_id gnl|my_center|LOCUS_08240 4788 5510 gene locus_tag LOCUS_08250 gene phoU 4788 5510 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VF1 protein_id gnl|my_center|LOCUS_08250 5680 6378 gene locus_tag LOCUS_08260 gene phoB 5680 6378 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_08260 7028 6519 gene locus_tag LOCUS_08270 7028 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920106.1 protein_id gnl|my_center|LOCUS_08270 7352 7155 gene locus_tag LOCUS_08280 7352 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7488 8297 gene locus_tag LOCUS_08290 7488 8297 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_08290 8706 9917 gene locus_tag LOCUS_08300 gene argD 8706 9917 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q7 protein_id gnl|my_center|LOCUS_08300 9914 10843 gene locus_tag LOCUS_08310 gene arcB 9914 10843 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS9 protein_id gnl|my_center|LOCUS_08310 10872 11831 gene locus_tag LOCUS_08320 gene hslO 10872 11831 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE7 protein_id gnl|my_center|LOCUS_08320 11845 12468 gene locus_tag LOCUS_08330 11845 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 13663 12485 gene locus_tag LOCUS_08340 13663 12485 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7K7 protein_id gnl|my_center|LOCUS_08340 14160 13768 gene locus_tag LOCUS_08350 gene apaG 14160 13768 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB9 protein_id gnl|my_center|LOCUS_08350 15554 14352 gene locus_tag LOCUS_08360 gene metZ 15554 14352 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE2 protein_id gnl|my_center|LOCUS_08360 15826 16983 gene locus_tag LOCUS_08370 gene dcd 15826 16983 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970891.1 protein_id gnl|my_center|LOCUS_08370 16985 17362 gene locus_tag LOCUS_08380 16985 17362 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_08380 17359 18081 gene locus_tag LOCUS_08390 17359 18081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_08390 18113 19132 gene locus_tag LOCUS_08400 18113 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678891.1 protein_id gnl|my_center|LOCUS_08400 19200 19273 gene locus_tag LOCUS_t00080 19200 19273 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19522 19334 gene locus_tag LOCUS_08410 19522 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061312.1 protein_id gnl|my_center|LOCUS_08410 20259 19642 gene locus_tag LOCUS_08420 20259 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 20486 22471 gene locus_tag LOCUS_08430 gene betT 20486 22471 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813960.1 protein_id gnl|my_center|LOCUS_08430 22537 24063 gene locus_tag LOCUS_08440 22537 24063 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_08440 24597 24073 gene locus_tag LOCUS_08450 24597 24073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_08450 26663 24684 gene locus_tag LOCUS_08460 26663 24684 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228162.1 protein_id gnl|my_center|LOCUS_08460 26882 27922 gene locus_tag LOCUS_08470 26882 27922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 28472 27945 gene locus_tag LOCUS_08480 28472 27945 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_08480 29320 28469 gene locus_tag LOCUS_08490 29320 28469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_08490 29503 30234 gene locus_tag LOCUS_08500 29503 30234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 30658 30248 gene locus_tag LOCUS_08510 30658 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706746.1 protein_id gnl|my_center|LOCUS_08510 33568 30689 gene locus_tag LOCUS_08520 33568 30689 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_08520 35544 33661 gene locus_tag LOCUS_08530 35544 33661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 35732 37390 gene locus_tag LOCUS_08540 gene lysS 35732 37390 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKU1 protein_id gnl|my_center|LOCUS_08540 37502 38317 gene locus_tag LOCUS_08550 37502 38317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 38969 38322 gene locus_tag LOCUS_08560 38969 38322 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706748.1 protein_id gnl|my_center|LOCUS_08560 39170 39526 gene locus_tag LOCUS_08570 39170 39526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968652.1 protein_id gnl|my_center|LOCUS_08570 39530 40588 gene locus_tag LOCUS_08580 gene pyrD 39530 40588 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_08580 40621 40971 gene locus_tag LOCUS_08590 40621 40971 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_08590 42300 40975 gene locus_tag LOCUS_08600 42300 40975 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_08600 42734 42297 gene locus_tag LOCUS_08610 42734 42297 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_08610 43255 42731 gene locus_tag LOCUS_08620 43255 42731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 43578 44246 gene locus_tag LOCUS_08630 43578 44246 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918657.1 protein_id gnl|my_center|LOCUS_08630 44550 45155 gene locus_tag LOCUS_08640 44550 45155 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920228.1 protein_id gnl|my_center|LOCUS_08640 46024 45149 gene locus_tag LOCUS_08650 gene yfhM 46024 45149 CDS product AB hydrolase superfamily protein YfhM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31581 protein_id gnl|my_center|LOCUS_08650 46175 47140 gene locus_tag LOCUS_08660 46175 47140 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918655.1 protein_id gnl|my_center|LOCUS_08660 48083 47193 gene locus_tag LOCUS_08670 48083 47193 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_08670 48518 48246 gene locus_tag LOCUS_08680 48518 48246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 49385 48549 gene locus_tag LOCUS_08690 49385 48549 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809983.1 protein_id gnl|my_center|LOCUS_08690 50388 49609 gene locus_tag LOCUS_08700 50388 49609 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707992.1 protein_id gnl|my_center|LOCUS_08700 51328 50525 gene locus_tag LOCUS_08710 51328 50525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 52248 51328 gene locus_tag LOCUS_08720 52248 51328 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S85 protein_id gnl|my_center|LOCUS_08720 55434 52381 gene locus_tag LOCUS_08730 55434 52381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 56256 55687 gene locus_tag LOCUS_08740 56256 55687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 56498 57049 gene locus_tag LOCUS_08750 56498 57049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 57103 58902 gene locus_tag LOCUS_08760 gene acd 57103 58902 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_08760 58926 60083 gene locus_tag LOCUS_08770 58926 60083 CDS product putative acyl CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702816.1 protein_id gnl|my_center|LOCUS_08770 60137 61342 gene locus_tag LOCUS_08780 60137 61342 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_08780 61351 63618 gene locus_tag LOCUS_08790 61351 63618 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_08790 65500 63701 gene locus_tag LOCUS_08800 65500 63701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_08800 65705 66199 gene locus_tag LOCUS_08810 65705 66199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08810 66148 66333 gene locus_tag LOCUS_08820 66148 66333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 66378 67397 gene locus_tag LOCUS_08830 66378 67397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809071.1 protein_id gnl|my_center|LOCUS_08830 67445 68407 gene locus_tag LOCUS_08840 67445 68407 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730392.1 protein_id gnl|my_center|LOCUS_08840 68719 68411 gene locus_tag LOCUS_08850 68719 68411 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_08850 69014 68736 gene locus_tag LOCUS_08860 69014 68736 CDS product killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_08860 69124 70026 gene locus_tag LOCUS_08870 69124 70026 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_08870 70026 70640 gene locus_tag LOCUS_08880 70026 70640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 70606 71592 gene locus_tag LOCUS_08890 70606 71592 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_08890 71636 72556 gene locus_tag LOCUS_08900 71636 72556 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_08900 72580 73746 gene locus_tag LOCUS_08910 gene caiA 72580 73746 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_08910 74690 73743 gene locus_tag LOCUS_08920 74690 73743 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_08920 75859 74687 gene locus_tag LOCUS_08930 75859 74687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_08930 76414 75968 gene locus_tag LOCUS_08940 76414 75968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 77030 76440 gene locus_tag LOCUS_08950 77030 76440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 77874 78662 gene locus_tag LOCUS_08960 77874 78662 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088716.1 protein_id gnl|my_center|LOCUS_08960 79075 78788 gene locus_tag LOCUS_08970 79075 78788 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_08970 80287 79181 gene locus_tag LOCUS_08980 80287 79181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 81287 80406 gene locus_tag LOCUS_08990 81287 80406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 81489 81803 gene locus_tag LOCUS_09000 81489 81803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 82778 81927 gene locus_tag LOCUS_09010 82778 81927 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088089.1 protein_id gnl|my_center|LOCUS_09010 82886 83752 gene locus_tag LOCUS_09020 82886 83752 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence010 309 827 gene locus_tag LOCUS_09030 309 827 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085338.1 protein_id gnl|my_center|LOCUS_09030 837 1892 gene locus_tag LOCUS_09040 837 1892 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085337.1 protein_id gnl|my_center|LOCUS_09040 2119 3195 gene locus_tag LOCUS_09050 gene nadA 2119 3195 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U4 protein_id gnl|my_center|LOCUS_09050 3283 4929 gene locus_tag LOCUS_09060 gene nadB 3283 4929 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U5 protein_id gnl|my_center|LOCUS_09060 4926 5795 gene locus_tag LOCUS_09070 gene nadC 4926 5795 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_09070 5880 6719 gene locus_tag LOCUS_09080 5880 6719 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_09080 7497 6760 gene locus_tag LOCUS_09090 7497 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10640 7953 gene locus_tag LOCUS_09100 10640 7953 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 protein_id gnl|my_center|LOCUS_09100 13051 10766 gene locus_tag LOCUS_09110 gene glyS 13051 10766 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S69 protein_id gnl|my_center|LOCUS_09110 14270 13380 gene locus_tag LOCUS_09120 gene glyQ 14270 13380 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHD1 protein_id gnl|my_center|LOCUS_09120 14672 14472 gene locus_tag LOCUS_09130 14672 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 15651 14722 gene locus_tag LOCUS_09140 gene sohB 15651 14722 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_09140 16489 15707 gene locus_tag LOCUS_09150 16489 15707 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_09150 16695 16486 gene locus_tag LOCUS_09160 16695 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533280.1 protein_id gnl|my_center|LOCUS_09160 16901 16692 gene locus_tag LOCUS_09170 16901 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 16901 17971 gene locus_tag LOCUS_09180 gene ispB 16901 17971 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_09180 18845 17955 gene locus_tag LOCUS_09190 gene ispE 18845 17955 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_09190 20619 18850 gene locus_tag LOCUS_09200 20619 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_09200 22434 20761 gene locus_tag LOCUS_09210 gene fzeA 22434 20761 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_09210 22694 23629 gene locus_tag LOCUS_09220 22694 23629 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532622.1 protein_id gnl|my_center|LOCUS_09220 23718 25610 gene locus_tag LOCUS_09230 23718 25610 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_09230 25700 26239 gene locus_tag LOCUS_09240 gene moaB 25700 26239 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RM2 protein_id gnl|my_center|LOCUS_09240 26336 26761 gene locus_tag LOCUS_09250 gene mscL 26336 26761 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJI9 protein_id gnl|my_center|LOCUS_09250 27610 27011 gene locus_tag LOCUS_09260 27610 27011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_09260 28313 27618 gene locus_tag LOCUS_09270 28313 27618 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085300.1 protein_id gnl|my_center|LOCUS_09270 28380 29639 gene locus_tag LOCUS_09280 28380 29639 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707034.1 protein_id gnl|my_center|LOCUS_09280 29683 29988 gene locus_tag LOCUS_09290 29683 29988 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 protein_id gnl|my_center|LOCUS_09290 30250 30930 gene locus_tag LOCUS_09300 gene rnhB 30250 30930 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H3 protein_id gnl|my_center|LOCUS_09300 31025 32149 gene locus_tag LOCUS_09310 gene ccrMIM 31025 32149 CDS product modification methylase CcrMI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ33 protein_id gnl|my_center|LOCUS_09310 33618 32503 gene locus_tag LOCUS_09320 gene mutY 33618 32503 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085286.1 protein_id gnl|my_center|LOCUS_09320 33750 34280 gene locus_tag LOCUS_09330 33750 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532755.1 protein_id gnl|my_center|LOCUS_09330 34386 35126 gene locus_tag LOCUS_09340 34386 35126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 35182 38643 gene locus_tag LOCUS_09350 gene smc 35182 38643 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Y9 protein_id gnl|my_center|LOCUS_09350 38915 39283 gene locus_tag LOCUS_09360 gene atpI 38915 39283 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK04 protein_id gnl|my_center|LOCUS_09360 39309 40091 gene locus_tag LOCUS_09370 gene atpB 39309 40091 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_09370 40179 40406 gene locus_tag LOCUS_09380 40179 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 40502 40981 gene locus_tag LOCUS_09390 gene atpF2 40502 40981 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA6 protein_id gnl|my_center|LOCUS_09390 40998 41483 gene locus_tag LOCUS_09400 gene atpF 40998 41483 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T930 protein_id gnl|my_center|LOCUS_09400 41599 42381 gene locus_tag LOCUS_09410 41599 42381 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_09410 43636 42407 gene locus_tag LOCUS_09420 43636 42407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_09420 45269 43674 gene locus_tag LOCUS_09430 45269 43674 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 protein_id gnl|my_center|LOCUS_09430 46615 45269 gene locus_tag LOCUS_09440 gene gcvPA 46615 45269 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV1 protein_id gnl|my_center|LOCUS_09440 47046 46669 gene locus_tag LOCUS_09450 gene gcvH 47046 46669 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV0 protein_id gnl|my_center|LOCUS_09450 48221 47079 gene locus_tag LOCUS_09460 48221 47079 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I01 protein_id gnl|my_center|LOCUS_09460 49232 48624 gene locus_tag LOCUS_09470 49232 48624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 49543 50499 gene locus_tag LOCUS_09480 gene ispH 49543 50499 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 protein_id gnl|my_center|LOCUS_09480 50510 51475 gene locus_tag LOCUS_09490 gene thrB 50510 51475 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU7 protein_id gnl|my_center|LOCUS_09490 51472 51924 gene locus_tag LOCUS_09500 gene rnhA 51472 51924 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6V5 protein_id gnl|my_center|LOCUS_09500 52477 51992 gene locus_tag LOCUS_09510 52477 51992 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_09510 53467 52619 gene locus_tag LOCUS_09520 53467 52619 CDS product protein involved in C cytochrome biogenesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084307.1 protein_id gnl|my_center|LOCUS_09520 53699 54310 gene locus_tag LOCUS_09530 53699 54310 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UC5 protein_id gnl|my_center|LOCUS_09530 57326 54345 gene locus_tag LOCUS_09540 57326 54345 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084318.1 protein_id gnl|my_center|LOCUS_09540 57988 57401 gene locus_tag LOCUS_09550 gene rimJ 57988 57401 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_09550 59304 58030 gene locus_tag LOCUS_09560 59304 58030 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_09560 60780 59374 gene locus_tag LOCUS_09570 gene thrC 60780 59374 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 protein_id gnl|my_center|LOCUS_09570 61665 60910 gene locus_tag LOCUS_09580 61665 60910 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Y02 protein_id gnl|my_center|LOCUS_09580 62066 61662 gene locus_tag LOCUS_09590 62066 61662 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_09590 62992 62153 gene locus_tag LOCUS_09600 62992 62153 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_09600 63317 63132 gene locus_tag LOCUS_09610 63317 63132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 64239 63325 gene locus_tag LOCUS_09620 gene ctaB 64239 63325 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_09620 65997 64390 gene locus_tag LOCUS_09630 gene ctaD 65997 64390 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 protein_id gnl|my_center|LOCUS_09630 66923 66060 gene locus_tag LOCUS_09640 gene coxB 66923 66060 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6E5 protein_id gnl|my_center|LOCUS_09640 67380 67778 gene locus_tag LOCUS_09650 67380 67778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 67826 69259 gene locus_tag LOCUS_09660 67826 69259 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_09660 69894 69391 gene locus_tag LOCUS_09670 69894 69391 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 protein_id gnl|my_center|LOCUS_09670 70286 69903 gene locus_tag LOCUS_09680 70286 69903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 protein_id gnl|my_center|LOCUS_09680 71812 70445 gene locus_tag LOCUS_09690 71812 70445 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_09690 72051 71809 gene locus_tag LOCUS_09700 72051 71809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 72638 72048 gene locus_tag LOCUS_09710 72638 72048 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_09710 73582 72764 gene locus_tag LOCUS_09720 73582 72764 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6G5 protein_id gnl|my_center|LOCUS_09720 73734 74228 gene locus_tag LOCUS_09730 73734 74228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 74410 75333 gene locus_tag LOCUS_09740 gene ubiA 74410 75333 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 protein_id gnl|my_center|LOCUS_09740 76602 75337 gene locus_tag LOCUS_09750 76602 75337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_09750 76774 76962 gene locus_tag LOCUS_09760 76774 76962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 77117 77773 gene locus_tag LOCUS_09770 77117 77773 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_09770 77770 78789 gene locus_tag LOCUS_09780 77770 78789 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_09780 78888 79958 gene locus_tag LOCUS_09790 78888 79958 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence011 607 1848 gene locus_tag LOCUS_09800 607 1848 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_09800 3185 1845 gene locus_tag LOCUS_09810 gene wcaJ 3185 1845 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 protein_id gnl|my_center|LOCUS_09810 4643 3303 gene locus_tag LOCUS_09820 4643 3303 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_09820 5098 6183 gene locus_tag LOCUS_09830 gene gmd 5098 6183 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CVV7 protein_id gnl|my_center|LOCUS_09830 7054 6170 gene locus_tag LOCUS_09840 gene exoN2 7054 6170 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M48 protein_id gnl|my_center|LOCUS_09840 7267 8700 gene locus_tag LOCUS_09850 7267 8700 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_09850 8746 9192 gene locus_tag LOCUS_09860 8746 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 9394 9978 gene locus_tag LOCUS_09870 9394 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10932 10048 gene locus_tag LOCUS_09880 10932 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_09880 11141 11437 gene locus_tag LOCUS_09890 11141 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 13006 11441 gene locus_tag LOCUS_09900 13006 11441 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_09900 14056 13127 gene locus_tag LOCUS_09910 14056 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15096 14053 gene locus_tag LOCUS_09920 15096 14053 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_09920 15367 15828 gene locus_tag LOCUS_09930 15367 15828 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887047.1 protein_id gnl|my_center|LOCUS_09930 16908 15835 gene locus_tag LOCUS_09940 16908 15835 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986989.1 protein_id gnl|my_center|LOCUS_09940 17635 16943 gene locus_tag LOCUS_09950 17635 16943 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_09950 18807 17632 gene locus_tag LOCUS_09960 gene rkpM 18807 17632 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887051.1 protein_id gnl|my_center|LOCUS_09960 19805 18804 gene locus_tag LOCUS_09970 gene pseB 19805 18804 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_09970 21709 19952 gene locus_tag LOCUS_09980 21709 19952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 21969 23378 gene locus_tag LOCUS_09990 21969 23378 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 protein_id gnl|my_center|LOCUS_09990 23561 24979 gene locus_tag LOCUS_10000 23561 24979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088358.1 protein_id gnl|my_center|LOCUS_10000 24983 25924 gene locus_tag LOCUS_10010 24983 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_10010 25938 26756 gene locus_tag LOCUS_10020 25938 26756 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088360.1 protein_id gnl|my_center|LOCUS_10020 26737 27567 gene locus_tag LOCUS_10030 26737 27567 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_10030 27985 27581 gene locus_tag LOCUS_10040 27985 27581 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_10040 30087 28009 gene locus_tag LOCUS_10050 30087 28009 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_10050 30498 30253 gene locus_tag LOCUS_10060 30498 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 30412 31356 gene locus_tag LOCUS_10070 30412 31356 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_10070 31611 33062 gene locus_tag LOCUS_10080 31611 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_10080 33358 34353 gene locus_tag LOCUS_10090 33358 34353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 34355 35605 gene locus_tag LOCUS_10100 34355 35605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 35698 37149 gene locus_tag LOCUS_10110 35698 37149 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_10110 37159 37572 gene locus_tag LOCUS_10120 37159 37572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 38995 37577 gene locus_tag LOCUS_10130 gene gltD 38995 37577 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_10130 43762 38999 gene locus_tag LOCUS_10140 gene gltB 43762 38999 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_10140 44288 45154 gene locus_tag LOCUS_10150 44288 45154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 45233 46270 gene locus_tag LOCUS_10160 45233 46270 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_10160 46349 46783 gene locus_tag LOCUS_10170 46349 46783 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390402.1 protein_id gnl|my_center|LOCUS_10170 49469 46803 gene locus_tag LOCUS_10180 49469 46803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 49771 52455 gene locus_tag LOCUS_10190 49771 52455 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 protein_id gnl|my_center|LOCUS_10190 52971 52501 gene locus_tag LOCUS_10200 52971 52501 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 protein_id gnl|my_center|LOCUS_10200 53168 54382 gene locus_tag LOCUS_10210 53168 54382 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_10210 54421 55323 gene locus_tag LOCUS_10220 54421 55323 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_10220 55320 56273 gene locus_tag LOCUS_10230 55320 56273 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_10230 56270 57013 gene locus_tag LOCUS_10240 56270 57013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 protein_id gnl|my_center|LOCUS_10240 57013 57894 gene locus_tag LOCUS_10250 57013 57894 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_10250 57995 58783 gene locus_tag LOCUS_10260 57995 58783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 58961 59470 gene locus_tag LOCUS_10270 58961 59470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 61089 59539 gene locus_tag LOCUS_10280 61089 59539 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_10280 62729 61161 gene locus_tag LOCUS_10290 62729 61161 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_10290 62849 63262 gene locus_tag LOCUS_10300 62849 63262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 63259 64221 gene locus_tag LOCUS_10310 gene pldB 63259 64221 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_10310 65098 64289 gene locus_tag LOCUS_10320 65098 64289 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_10320 66254 65148 gene locus_tag LOCUS_10330 66254 65148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063668.1 protein_id gnl|my_center|LOCUS_10330 68257 66326 gene locus_tag LOCUS_10340 68257 66326 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_10340 69176 68592 gene locus_tag LOCUS_10350 69176 68592 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_10350 69493 69173 gene locus_tag LOCUS_10360 69493 69173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 69383 70054 gene locus_tag LOCUS_10370 69383 70054 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_10370 70051 71442 gene locus_tag LOCUS_10380 70051 71442 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086529.1 protein_id gnl|my_center|LOCUS_10380 71567 73327 gene locus_tag LOCUS_10390 71567 73327 CDS product phosphoethanolamine--lipid A transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 protein_id gnl|my_center|LOCUS_10390 73324 74067 gene locus_tag LOCUS_10400 73324 74067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 74125 75003 gene locus_tag LOCUS_10410 74125 75003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_10410 76660 75023 gene locus_tag LOCUS_10420 gene glsF 76660 75023 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_10420 77576 76695 gene locus_tag LOCUS_10430 77576 76695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 79126 78170 gene locus_tag LOCUS_10440 79126 78170 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066934.1 protein_id gnl|my_center|LOCUS_10440 79240 79752 gene locus_tag LOCUS_10450 79240 79752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 79884 79958 gene locus_tag LOCUS_t00090 79884 79958 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 221 33 gene locus_tag LOCUS_10460 221 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3068 390 gene locus_tag LOCUS_10470 gene clpB 3068 390 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM5 protein_id gnl|my_center|LOCUS_10470 3288 4055 gene locus_tag LOCUS_10480 3288 4055 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_10480 5040 4129 gene locus_tag LOCUS_10490 5040 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918761.1 protein_id gnl|my_center|LOCUS_10490 6361 5510 gene locus_tag LOCUS_10500 gene prmC 6361 5510 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XT8 protein_id gnl|my_center|LOCUS_10500 7533 6358 gene locus_tag LOCUS_10510 gene prfA 7533 6358 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_10510 8545 7502 gene locus_tag LOCUS_10520 gene ispG 8545 7502 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W0 protein_id gnl|my_center|LOCUS_10520 9946 8804 gene locus_tag LOCUS_10530 9946 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 12510 10243 gene locus_tag LOCUS_10540 gene ptsP 12510 10243 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_10540 13831 12572 gene locus_tag LOCUS_10550 13831 12572 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM0 protein_id gnl|my_center|LOCUS_10550 14046 14867 gene locus_tag LOCUS_10560 gene ubiG 14046 14867 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAL7 protein_id gnl|my_center|LOCUS_10560 14867 15295 gene locus_tag LOCUS_10570 14867 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 15292 16683 gene locus_tag LOCUS_10580 15292 16683 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919101.1 protein_id gnl|my_center|LOCUS_10580 16676 17992 gene locus_tag LOCUS_10590 16676 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_10590 18460 18002 gene locus_tag LOCUS_10600 18460 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_10600 19323 18457 gene locus_tag LOCUS_10610 19323 18457 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_10610 19585 19328 gene locus_tag LOCUS_10620 19585 19328 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 protein_id gnl|my_center|LOCUS_10620 20414 19641 gene locus_tag LOCUS_10630 gene comF 20414 19641 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_10630 20519 21505 gene locus_tag LOCUS_10640 gene bioC 20519 21505 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_10640 21689 21510 gene locus_tag LOCUS_10650 21689 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 22153 21719 gene locus_tag LOCUS_10660 22153 21719 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066735.1 protein_id gnl|my_center|LOCUS_10660 23476 22265 gene locus_tag LOCUS_10670 gene argJ 23476 22265 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_10670 23409 23876 gene locus_tag LOCUS_10680 23409 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 24764 23826 gene locus_tag LOCUS_10690 24764 23826 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK1 protein_id gnl|my_center|LOCUS_10690 25080 27806 gene locus_tag LOCUS_10700 gene secA 25080 27806 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MI9 protein_id gnl|my_center|LOCUS_10700 28593 27838 gene locus_tag LOCUS_10710 28593 27838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 28559 28750 gene locus_tag LOCUS_10720 28559 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 30110 28734 gene locus_tag LOCUS_10730 30110 28734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_10730 30246 31436 gene locus_tag LOCUS_10740 30246 31436 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_10740 31446 32699 gene locus_tag LOCUS_10750 31446 32699 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_10750 32696 34486 gene locus_tag LOCUS_10760 32696 34486 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_10760 35507 34548 gene locus_tag LOCUS_10770 gene accA 35507 34548 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHX3 protein_id gnl|my_center|LOCUS_10770 36625 35663 gene locus_tag LOCUS_10780 gene xerD 36625 35663 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHX2 protein_id gnl|my_center|LOCUS_10780 38302 36641 gene locus_tag LOCUS_10790 38302 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391486.1 protein_id gnl|my_center|LOCUS_10790 38241 38804 gene locus_tag LOCUS_10800 38241 38804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 39005 39616 gene locus_tag LOCUS_10810 gene aroK 39005 39616 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 protein_id gnl|my_center|LOCUS_10810 39609 40727 gene locus_tag LOCUS_10820 gene aroB 39609 40727 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2J0 protein_id gnl|my_center|LOCUS_10820 40729 42021 gene locus_tag LOCUS_10830 40729 42021 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_10830 42109 42366 gene locus_tag LOCUS_10840 42109 42366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 42423 43100 gene locus_tag LOCUS_10850 42423 43100 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066782.1 protein_id gnl|my_center|LOCUS_10850 43246 44241 gene locus_tag LOCUS_10860 gene cobS 43246 44241 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 protein_id gnl|my_center|LOCUS_10860 44315 46234 gene locus_tag LOCUS_10870 44315 46234 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_10870 46266 47447 gene locus_tag LOCUS_10880 46266 47447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707651.1 protein_id gnl|my_center|LOCUS_10880 47541 48953 gene locus_tag LOCUS_10890 47541 48953 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_10890 49104 50258 gene locus_tag LOCUS_10900 49104 50258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_10900 50856 50176 gene locus_tag LOCUS_10910 50856 50176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 51360 51061 gene locus_tag LOCUS_10920 gene rpmB 51360 51061 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK6 protein_id gnl|my_center|LOCUS_10920 51746 52330 gene locus_tag LOCUS_10930 51746 52330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_10930 53369 52323 gene locus_tag LOCUS_10940 53369 52323 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_10940 53550 54443 gene locus_tag LOCUS_10950 53550 54443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082993.1 protein_id gnl|my_center|LOCUS_10950 56623 54467 gene locus_tag LOCUS_10960 gene mcmA 56623 54467 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_10960 56965 57633 gene locus_tag LOCUS_10970 56965 57633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 59062 57767 gene locus_tag LOCUS_10980 59062 57767 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921283.1 protein_id gnl|my_center|LOCUS_10980 59534 59238 gene locus_tag LOCUS_10990 59534 59238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 59427 62573 gene locus_tag LOCUS_11000 59427 62573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 62579 62977 gene locus_tag LOCUS_11010 62579 62977 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_11010 63033 63500 gene locus_tag LOCUS_11020 63033 63500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_11020 63561 63899 gene locus_tag LOCUS_11030 63561 63899 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_11030 64446 65600 gene locus_tag LOCUS_11040 64446 65600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 65752 66699 gene locus_tag LOCUS_11050 gene rpoH2 65752 66699 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCP8 protein_id gnl|my_center|LOCUS_11050 68142 66712 gene locus_tag LOCUS_11060 68142 66712 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067317.1 protein_id gnl|my_center|LOCUS_11060 69164 68277 gene locus_tag LOCUS_11070 69164 68277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 69868 69182 gene locus_tag LOCUS_11080 69868 69182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 70257 70333 gene locus_tag LOCUS_t00100 70257 70333 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70721 71416 gene locus_tag LOCUS_11090 70721 71416 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208482.1 protein_id gnl|my_center|LOCUS_11090 71453 72421 gene locus_tag LOCUS_11100 71453 72421 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_11100 72822 72403 gene locus_tag LOCUS_11110 72822 72403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919719.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence013 768 1376 gene locus_tag LOCUS_11120 768 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4998 1579 gene locus_tag LOCUS_11130 gene dnaE 4998 1579 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KN8 protein_id gnl|my_center|LOCUS_11130 5326 5192 gene locus_tag LOCUS_11140 5326 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5919 5461 gene locus_tag LOCUS_11150 5919 5461 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389385.1 protein_id gnl|my_center|LOCUS_11150 6706 5993 gene locus_tag LOCUS_11160 gene lolD1 6706 5993 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_11160 8000 6717 gene locus_tag LOCUS_11170 8000 6717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_11170 9397 8078 gene locus_tag LOCUS_11180 gene proS 9397 8078 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KM8 protein_id gnl|my_center|LOCUS_11180 9937 9512 gene locus_tag LOCUS_11190 9937 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 11845 10175 gene locus_tag LOCUS_11200 11845 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 12362 11922 gene locus_tag LOCUS_11210 12362 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 13158 12883 gene locus_tag LOCUS_11220 13158 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 13603 13181 gene locus_tag LOCUS_11230 13603 13181 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_11230 13892 13596 gene locus_tag LOCUS_11240 13892 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15613 13919 gene locus_tag LOCUS_11250 15613 13919 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_11250 16390 15623 gene locus_tag LOCUS_11260 16390 15623 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_11260 17848 16397 gene locus_tag LOCUS_11270 gene nuoN1 17848 16397 CDS product NADH-quinone oxidoreductase subunit N 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QN9 protein_id gnl|my_center|LOCUS_11270 19419 17875 gene locus_tag LOCUS_11280 19419 17875 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_11280 21353 19419 gene locus_tag LOCUS_11290 21353 19419 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_11290 21671 21360 gene locus_tag LOCUS_11300 gene nuoK 21671 21360 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH93 protein_id gnl|my_center|LOCUS_11300 22393 21779 gene locus_tag LOCUS_11310 gene nuoJ 22393 21779 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 protein_id gnl|my_center|LOCUS_11310 22926 22435 gene locus_tag LOCUS_11320 gene nuoI 22926 22435 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA65 protein_id gnl|my_center|LOCUS_11320 23981 22968 gene locus_tag LOCUS_11330 gene nuoH 23981 22968 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ5 protein_id gnl|my_center|LOCUS_11330 26043 24001 gene locus_tag LOCUS_11340 26043 24001 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH89 protein_id gnl|my_center|LOCUS_11340 27336 26047 gene locus_tag LOCUS_11350 27336 26047 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_11350 27956 27336 gene locus_tag LOCUS_11360 27956 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 29131 27953 gene locus_tag LOCUS_11370 gene nuoD1 29131 27953 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56907 protein_id gnl|my_center|LOCUS_11370 29740 29138 gene locus_tag LOCUS_11380 gene nuoC 29740 29138 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAY3 protein_id gnl|my_center|LOCUS_11380 30381 29806 gene locus_tag LOCUS_11390 gene nuoB 30381 29806 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W4 protein_id gnl|my_center|LOCUS_11390 30737 30372 gene locus_tag LOCUS_11400 gene nuoA 30737 30372 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH82 protein_id gnl|my_center|LOCUS_11400 31090 31014 gene locus_tag LOCUS_t00110 31090 31014 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31333 31258 gene locus_tag LOCUS_t00120 31333 31258 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31469 32773 gene locus_tag LOCUS_11410 31469 32773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314722.1 protein_id gnl|my_center|LOCUS_11410 33174 32899 gene locus_tag LOCUS_11420 33174 32899 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_11420 35836 33371 gene locus_tag LOCUS_11430 gene lon 35836 33371 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69177 protein_id gnl|my_center|LOCUS_11430 37406 36141 gene locus_tag LOCUS_11440 gene clpX 37406 36141 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG2 protein_id gnl|my_center|LOCUS_11440 38368 37727 gene locus_tag LOCUS_11450 gene clpP2 38368 37727 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG1 protein_id gnl|my_center|LOCUS_11450 40052 38736 gene locus_tag LOCUS_11460 40052 38736 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_11460 41909 40344 gene locus_tag LOCUS_11470 gene tig 41909 40344 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG0 protein_id gnl|my_center|LOCUS_11470 42045 41961 gene locus_tag LOCUS_t00130 42045 41961 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43680 42160 gene locus_tag LOCUS_11480 43680 42160 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 protein_id gnl|my_center|LOCUS_11480 43580 43795 gene locus_tag LOCUS_11490 43580 43795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 43841 44344 gene locus_tag LOCUS_11500 43841 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 44974 44384 gene locus_tag LOCUS_11510 44974 44384 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_11510 45287 45021 gene locus_tag LOCUS_11520 45287 45021 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972002.1 protein_id gnl|my_center|LOCUS_11520 45541 45284 gene locus_tag LOCUS_11530 45541 45284 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIL4 protein_id gnl|my_center|LOCUS_11530 45674 46039 gene locus_tag LOCUS_11540 45674 46039 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706975.1 protein_id gnl|my_center|LOCUS_11540 46586 46080 gene locus_tag LOCUS_11550 46586 46080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 48408 46855 gene locus_tag LOCUS_11560 48408 46855 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_11560 49205 48540 gene locus_tag LOCUS_11570 49205 48540 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_11570 50377 49202 gene locus_tag LOCUS_11580 50377 49202 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 protein_id gnl|my_center|LOCUS_11580 50704 51042 gene locus_tag LOCUS_11590 gene glnB 50704 51042 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14179 protein_id gnl|my_center|LOCUS_11590 51201 52607 gene locus_tag LOCUS_11600 gene glnA3 51201 52607 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCG7 protein_id gnl|my_center|LOCUS_11600 54788 53490 gene locus_tag LOCUS_11610 54788 53490 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_11610 55012 57078 gene locus_tag LOCUS_11620 gene parE 55012 57078 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD54 protein_id gnl|my_center|LOCUS_11620 57181 58473 gene locus_tag LOCUS_11630 57181 58473 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_11630 58460 59065 gene locus_tag LOCUS_11640 58460 59065 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_11640 59289 60869 gene locus_tag LOCUS_11650 59289 60869 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531373.1 protein_id gnl|my_center|LOCUS_11650 62412 60949 gene locus_tag LOCUS_11660 gene calB 62412 60949 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A777 protein_id gnl|my_center|LOCUS_11660 62774 63829 gene locus_tag LOCUS_11670 62774 63829 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_11670 63981 64772 gene locus_tag LOCUS_11680 63981 64772 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969781.1 protein_id gnl|my_center|LOCUS_11680 64823 65614 gene locus_tag LOCUS_11690 64823 65614 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence014 1644 151 gene locus_tag LOCUS_11700 gene alr 1644 151 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MX1 protein_id gnl|my_center|LOCUS_11700 3217 1970 gene locus_tag LOCUS_11710 gene dnaC 3217 1970 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086848.1 protein_id gnl|my_center|LOCUS_11710 4079 3465 gene locus_tag LOCUS_11720 gene rplI 4079 3465 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 protein_id gnl|my_center|LOCUS_11720 4348 4103 gene locus_tag LOCUS_11730 gene rpsR 4348 4103 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q2 protein_id gnl|my_center|LOCUS_11730 4833 4345 gene locus_tag LOCUS_11740 4833 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5179 6120 gene locus_tag LOCUS_11750 5179 6120 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_11750 6138 6875 gene locus_tag LOCUS_11760 gene fabG 6138 6875 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_11760 7132 7371 gene locus_tag LOCUS_11770 gene acpP 7132 7371 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_11770 7486 8742 gene locus_tag LOCUS_11780 gene fabF 7486 8742 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 protein_id gnl|my_center|LOCUS_11780 8739 9833 gene locus_tag LOCUS_11790 8739 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9928 10818 gene locus_tag LOCUS_11800 9928 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_11800 10808 11467 gene locus_tag LOCUS_11810 gene gmk 10808 11467 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXB1 protein_id gnl|my_center|LOCUS_11810 11484 12263 gene locus_tag LOCUS_11820 gene ddhA 11484 12263 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708949.1 protein_id gnl|my_center|LOCUS_11820 12266 13354 gene locus_tag LOCUS_11830 gene ddhB 12266 13354 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976067.1 protein_id gnl|my_center|LOCUS_11830 13351 13911 gene locus_tag LOCUS_11840 gene rmlC 13351 13911 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708955.1 protein_id gnl|my_center|LOCUS_11840 13941 15134 gene locus_tag LOCUS_11850 13941 15134 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976068.1 protein_id gnl|my_center|LOCUS_11850 15146 16006 gene locus_tag LOCUS_11860 15146 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 16029 16937 gene locus_tag LOCUS_11870 16029 16937 CDS product CDP-4-dehydro-6-deoxy-D-gulose 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_11870 16991 17758 gene locus_tag LOCUS_11880 16991 17758 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_11880 17771 18016 gene locus_tag LOCUS_11890 17771 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 18119 18799 gene locus_tag LOCUS_11900 18119 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 19653 18796 gene locus_tag LOCUS_11910 19653 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 20726 19680 gene locus_tag LOCUS_11920 20726 19680 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086875.1 protein_id gnl|my_center|LOCUS_11920 21675 20818 gene locus_tag LOCUS_11930 gene rsmA 21675 20818 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MU0 protein_id gnl|my_center|LOCUS_11930 22694 21672 gene locus_tag LOCUS_11940 gene pdxA1 22694 21672 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QZ0 protein_id gnl|my_center|LOCUS_11940 23985 22735 gene locus_tag LOCUS_11950 23985 22735 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 protein_id gnl|my_center|LOCUS_11950 26452 24242 gene locus_tag LOCUS_11960 gene lptD 26452 24242 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN1 protein_id gnl|my_center|LOCUS_11960 27633 26539 gene locus_tag LOCUS_11970 27633 26539 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086880.1 protein_id gnl|my_center|LOCUS_11970 28832 27630 gene locus_tag LOCUS_11980 28832 27630 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_11980 29101 30594 gene locus_tag LOCUS_11990 gene pepA 29101 30594 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MT4 protein_id gnl|my_center|LOCUS_11990 30606 31055 gene locus_tag LOCUS_12000 gene holC 30606 31055 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971400.1 protein_id gnl|my_center|LOCUS_12000 31155 32096 gene locus_tag LOCUS_12010 31155 32096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 32931 32110 gene locus_tag LOCUS_12020 32931 32110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_12020 33011 33448 gene locus_tag LOCUS_12030 33011 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 35380 33464 gene locus_tag LOCUS_12040 35380 33464 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971407.1 protein_id gnl|my_center|LOCUS_12040 35473 35895 gene locus_tag LOCUS_12050 gene ndk 35473 35895 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC6 protein_id gnl|my_center|LOCUS_12050 36014 36790 gene locus_tag LOCUS_12060 36014 36790 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_12060 37450 36803 gene locus_tag LOCUS_12070 gene purN 37450 36803 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 protein_id gnl|my_center|LOCUS_12070 38538 37447 gene locus_tag LOCUS_12080 gene purM 38538 37447 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG98 protein_id gnl|my_center|LOCUS_12080 38679 39887 gene locus_tag LOCUS_12090 38679 39887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 39913 41010 gene locus_tag LOCUS_12100 gene perM 39913 41010 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_12100 41015 41680 gene locus_tag LOCUS_12110 41015 41680 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086897.1 protein_id gnl|my_center|LOCUS_12110 41775 43988 gene locus_tag LOCUS_12120 gene ppk 41775 43988 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZW1 protein_id gnl|my_center|LOCUS_12120 44022 45518 gene locus_tag LOCUS_12130 44022 45518 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 protein_id gnl|my_center|LOCUS_12130 46674 45520 gene locus_tag LOCUS_12140 gene rnd 46674 45520 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_12140 46975 46748 gene locus_tag LOCUS_12150 46975 46748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 47698 47501 gene locus_tag LOCUS_12160 47698 47501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 48012 49835 gene locus_tag LOCUS_12170 48012 49835 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532280.1 protein_id gnl|my_center|LOCUS_12170 50422 49901 gene locus_tag LOCUS_12180 50422 49901 CDS product beta-Ig-H3/fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_12180 51741 50497 gene locus_tag LOCUS_12190 51741 50497 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_12190 51947 53836 gene locus_tag LOCUS_12200 51947 53836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 57710 53943 gene locus_tag LOCUS_12210 57710 53943 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_12210 58121 58642 gene locus_tag LOCUS_12220 58121 58642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 58829 59227 gene locus_tag LOCUS_12230 58829 59227 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312623.1 protein_id gnl|my_center|LOCUS_12230 59287 59754 gene locus_tag LOCUS_12240 59287 59754 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 protein_id gnl|my_center|LOCUS_12240 59780 60253 gene locus_tag LOCUS_12250 59780 60253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 protein_id gnl|my_center|LOCUS_12250 60840 60190 gene locus_tag LOCUS_12260 gene aat 60840 60190 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U825 protein_id gnl|my_center|LOCUS_12260 62460 61108 gene locus_tag LOCUS_12270 62460 61108 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_12270 63049 62480 gene locus_tag LOCUS_12280 gene accB 63049 62480 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971548.1 protein_id gnl|my_center|LOCUS_12280 63497 63066 gene locus_tag LOCUS_12290 gene aroQ 63497 63066 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_12290 63830 64030 gene locus_tag LOCUS_12300 gene thiS 63830 64030 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_12300 64056 64868 gene locus_tag LOCUS_12310 gene thiG 64056 64868 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_12310 >Feature sequence015 1029 262 gene locus_tag LOCUS_12320 1029 262 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089827.1 protein_id gnl|my_center|LOCUS_12320 2301 1174 gene locus_tag LOCUS_12330 2301 1174 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 protein_id gnl|my_center|LOCUS_12330 3292 2633 gene locus_tag LOCUS_12340 gene aox 3292 2633 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 protein_id gnl|my_center|LOCUS_12340 3663 3286 gene locus_tag LOCUS_12350 3663 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3859 4557 gene locus_tag LOCUS_12360 3859 4557 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707571.1 protein_id gnl|my_center|LOCUS_12360 8163 4651 gene locus_tag LOCUS_12370 8163 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 8233 8493 gene locus_tag LOCUS_12380 8233 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 8654 9280 gene locus_tag LOCUS_12390 8654 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 9283 10092 gene locus_tag LOCUS_12400 9283 10092 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088396.1 protein_id gnl|my_center|LOCUS_12400 10111 11076 gene locus_tag LOCUS_12410 10111 11076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_12410 11081 12217 gene locus_tag LOCUS_12420 11081 12217 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_12420 13663 12269 gene locus_tag LOCUS_12430 13663 12269 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_12430 13839 14330 gene locus_tag LOCUS_12440 13839 14330 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089299.1 protein_id gnl|my_center|LOCUS_12440 16179 14368 gene locus_tag LOCUS_12450 16179 14368 CDS product transport integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227541.1 protein_id gnl|my_center|LOCUS_12450 16565 18817 gene locus_tag LOCUS_12460 gene pcrA 16565 18817 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXZ3 protein_id gnl|my_center|LOCUS_12460 18820 19749 gene locus_tag LOCUS_12470 gene prmA 18820 19749 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF69 protein_id gnl|my_center|LOCUS_12470 19764 21605 gene locus_tag LOCUS_12480 19764 21605 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530971.1 protein_id gnl|my_center|LOCUS_12480 23731 21602 gene locus_tag LOCUS_12490 gene ligA 23731 21602 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEL9 protein_id gnl|my_center|LOCUS_12490 25398 23728 gene locus_tag LOCUS_12500 gene recN 25398 23728 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FV6 protein_id gnl|my_center|LOCUS_12500 26216 25431 gene locus_tag LOCUS_12510 gene bamD 26216 25431 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_12510 27553 26558 gene locus_tag LOCUS_12520 gene lpxC 27553 26558 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEM2 protein_id gnl|my_center|LOCUS_12520 29499 27805 gene locus_tag LOCUS_12530 gene ftsZ 29499 27805 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF60 protein_id gnl|my_center|LOCUS_12530 31039 29729 gene locus_tag LOCUS_12540 gene ftsA 31039 29729 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_12540 32043 31036 gene locus_tag LOCUS_12550 32043 31036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 32957 32031 gene locus_tag LOCUS_12560 gene ddl 32957 32031 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM4 protein_id gnl|my_center|LOCUS_12560 33883 32954 gene locus_tag LOCUS_12570 gene murB 33883 32954 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_12570 35355 33883 gene locus_tag LOCUS_12580 gene murC 35355 33883 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 protein_id gnl|my_center|LOCUS_12580 36545 35355 gene locus_tag LOCUS_12590 gene murG 36545 35355 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF54 protein_id gnl|my_center|LOCUS_12590 37690 36542 gene locus_tag LOCUS_12600 gene ftsW 37690 36542 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_12600 39096 37687 gene locus_tag LOCUS_12610 gene murD 39096 37687 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 protein_id gnl|my_center|LOCUS_12610 40189 39101 gene locus_tag LOCUS_12620 gene mraY 40189 39101 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU4 protein_id gnl|my_center|LOCUS_12620 41628 40189 gene locus_tag LOCUS_12630 gene murF 41628 40189 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIA7 protein_id gnl|my_center|LOCUS_12630 43094 41625 gene locus_tag LOCUS_12640 gene murE 43094 41625 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_12640 44898 43135 gene locus_tag LOCUS_12650 44898 43135 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_12650 45272 44895 gene locus_tag LOCUS_12660 45272 44895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388712.1 protein_id gnl|my_center|LOCUS_12660 46285 45269 gene locus_tag LOCUS_12670 gene rsmH 46285 45269 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_12670 46761 46282 gene locus_tag LOCUS_12680 gene mraZ 46761 46282 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY1 protein_id gnl|my_center|LOCUS_12680 47585 48547 gene locus_tag LOCUS_12690 47585 48547 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_12690 49287 48544 gene locus_tag LOCUS_12700 49287 48544 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969755.1 protein_id gnl|my_center|LOCUS_12700 50153 49287 gene locus_tag LOCUS_12710 50153 49287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_12710 51012 50302 gene locus_tag LOCUS_12720 51012 50302 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708646.1 protein_id gnl|my_center|LOCUS_12720 51151 54768 gene locus_tag LOCUS_12730 51151 54768 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 protein_id gnl|my_center|LOCUS_12730 57933 55252 gene locus_tag LOCUS_12740 57933 55252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12740 59048 57987 gene locus_tag LOCUS_12750 59048 57987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12750 59973 59071 gene locus_tag LOCUS_12760 59973 59071 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A8 protein_id gnl|my_center|LOCUS_12760 60917 59973 gene locus_tag LOCUS_12770 60917 59973 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_12770 61325 62128 gene locus_tag LOCUS_12780 61325 62128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence016 971 114 gene locus_tag LOCUS_12790 971 114 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_12790 1493 1026 gene locus_tag LOCUS_12800 1493 1026 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_12800 2426 1662 gene locus_tag LOCUS_12810 2426 1662 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_12810 2674 3348 gene locus_tag LOCUS_12820 2674 3348 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_12820 3906 3406 gene locus_tag LOCUS_12830 3906 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4391 3903 gene locus_tag LOCUS_12840 4391 3903 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 protein_id gnl|my_center|LOCUS_12840 4465 5829 gene locus_tag LOCUS_12850 4465 5829 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_12850 5959 7239 gene locus_tag LOCUS_12860 gene tipF 5959 7239 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_12860 7563 8408 gene locus_tag LOCUS_12870 gene dapD 7563 8408 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_12870 8455 9657 gene locus_tag LOCUS_12880 gene dapE 8455 9657 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYE7 protein_id gnl|my_center|LOCUS_12880 9654 10262 gene locus_tag LOCUS_12890 9654 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10262 11110 gene locus_tag LOCUS_12900 gene murI 10262 11110 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E11 protein_id gnl|my_center|LOCUS_12900 11991 11251 gene locus_tag LOCUS_12910 gene truA 11991 11251 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_12910 12947 11991 gene locus_tag LOCUS_12920 gene fmt 12947 11991 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABE9 protein_id gnl|my_center|LOCUS_12920 13465 12944 gene locus_tag LOCUS_12930 gene def 13465 12944 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_12930 13570 15132 gene locus_tag LOCUS_12940 13570 15132 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_12940 15301 16638 gene locus_tag LOCUS_12950 15301 16638 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_12950 17463 16864 gene locus_tag LOCUS_12960 gene recR 17463 16864 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_12960 17851 17534 gene locus_tag LOCUS_12970 17851 17534 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 protein_id gnl|my_center|LOCUS_12970 19740 17848 gene locus_tag LOCUS_12980 19740 17848 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_12980 20024 20971 gene locus_tag LOCUS_12990 20024 20971 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_12990 21862 20975 gene locus_tag LOCUS_13000 gene pheA 21862 20975 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_13000 22662 21859 gene locus_tag LOCUS_13010 gene kdsB 22662 21859 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPI7 protein_id gnl|my_center|LOCUS_13010 23054 23710 gene locus_tag LOCUS_13020 gene cycM 23054 23710 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30323 protein_id gnl|my_center|LOCUS_13020 23959 25974 gene locus_tag LOCUS_13030 23959 25974 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_13030 25971 27848 gene locus_tag LOCUS_13040 25971 27848 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084242.1 protein_id gnl|my_center|LOCUS_13040 27856 28965 gene locus_tag LOCUS_13050 27856 28965 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_13050 28967 30034 gene locus_tag LOCUS_13060 28967 30034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084244.1 protein_id gnl|my_center|LOCUS_13060 30031 31659 gene locus_tag LOCUS_13070 30031 31659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_13070 32586 31717 gene locus_tag LOCUS_13080 32586 31717 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_13080 32981 32583 gene locus_tag LOCUS_13090 32981 32583 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537743.1 protein_id gnl|my_center|LOCUS_13090 34437 33061 gene locus_tag LOCUS_13100 34437 33061 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_13100 34572 35255 gene locus_tag LOCUS_13110 34572 35255 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203460.1 protein_id gnl|my_center|LOCUS_13110 36408 35266 gene locus_tag LOCUS_13120 36408 35266 CDS product TRAP ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228475.1 protein_id gnl|my_center|LOCUS_13120 36748 36554 gene locus_tag LOCUS_13130 36748 36554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 36705 37553 gene locus_tag LOCUS_13140 36705 37553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 38616 37636 gene locus_tag LOCUS_13150 gene ctpI 38616 37636 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084251.1 protein_id gnl|my_center|LOCUS_13150 39618 38626 gene locus_tag LOCUS_13160 gene ctpH 39618 38626 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084252.1 protein_id gnl|my_center|LOCUS_13160 41083 39632 gene locus_tag LOCUS_13170 gene ctpG 41083 39632 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_13170 42422 41097 gene locus_tag LOCUS_13180 gene cpaE 42422 41097 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 protein_id gnl|my_center|LOCUS_13180 43117 42422 gene locus_tag LOCUS_13190 gene cpaD 43117 42422 CDS product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709938.1 protein_id gnl|my_center|LOCUS_13190 44642 43137 gene locus_tag LOCUS_13200 44642 43137 CDS product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083493.1 protein_id gnl|my_center|LOCUS_13200 45404 44646 gene locus_tag LOCUS_13210 gene ctpC 45404 44646 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084257.1 protein_id gnl|my_center|LOCUS_13210 45996 45487 gene locus_tag LOCUS_13220 gene ctpB 45996 45487 CDS product type 4 prepilin peptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_13220 46464 46294 gene locus_tag LOCUS_13230 gene pilA2 46464 46294 CDS product PilA2 pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706435.1 protein_id gnl|my_center|LOCUS_13230 47607 46858 gene locus_tag LOCUS_13240 47607 46858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 47774 48301 gene locus_tag LOCUS_13250 47774 48301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 49792 48419 gene locus_tag LOCUS_13260 49792 48419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 49994 50557 gene locus_tag LOCUS_13270 49994 50557 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920787.1 protein_id gnl|my_center|LOCUS_13270 50571 51143 gene locus_tag LOCUS_13280 50571 51143 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 protein_id gnl|my_center|LOCUS_13280 52334 51177 gene locus_tag LOCUS_13290 52334 51177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 53258 52380 gene locus_tag LOCUS_13300 53258 52380 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_13300 54413 53265 gene locus_tag LOCUS_13310 54413 53265 CDS product putative lipid-transfer protein Ltp1/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701131.1 protein_id gnl|my_center|LOCUS_13310 54851 54432 gene locus_tag LOCUS_13320 54851 54432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 56442 54865 gene locus_tag LOCUS_13330 56442 54865 CDS product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225303.1 protein_id gnl|my_center|LOCUS_13330 57323 56469 gene locus_tag LOCUS_13340 57323 56469 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_13340 59386 57368 gene locus_tag LOCUS_13350 59386 57368 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455018.1 protein_id gnl|my_center|LOCUS_13350 59562 60215 gene locus_tag LOCUS_13360 59562 60215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence017 728 1030 gene locus_tag LOCUS_13370 728 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1467 1078 gene locus_tag LOCUS_13380 1467 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1774 1448 gene locus_tag LOCUS_13390 1774 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3420 1771 gene locus_tag LOCUS_13400 3420 1771 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886741.1 protein_id gnl|my_center|LOCUS_13400 5176 3467 gene locus_tag LOCUS_13410 5176 3467 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_13410 5753 6088 gene locus_tag LOCUS_13420 5753 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6384 6857 gene locus_tag LOCUS_13430 6384 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6984 7685 gene locus_tag LOCUS_13440 6984 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8137 7643 gene locus_tag LOCUS_13450 8137 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 8558 9223 gene locus_tag LOCUS_13460 8558 9223 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 protein_id gnl|my_center|LOCUS_13460 9431 9805 gene locus_tag LOCUS_13470 9431 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201003.1 protein_id gnl|my_center|LOCUS_13470 9960 10511 gene locus_tag LOCUS_13480 9960 10511 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_13480 10862 10686 gene locus_tag LOCUS_13490 10862 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 10878 11348 gene locus_tag LOCUS_13500 10878 11348 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_13500 11370 13580 gene locus_tag LOCUS_13510 11370 13580 CDS product NADPH flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 protein_id gnl|my_center|LOCUS_13510 13561 14508 gene locus_tag LOCUS_13520 13561 14508 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAW7 protein_id gnl|my_center|LOCUS_13520 14934 15578 gene locus_tag LOCUS_13530 14934 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 15594 16253 gene locus_tag LOCUS_13540 15594 16253 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_13540 16275 17285 gene locus_tag LOCUS_13550 gene ybhG 16275 17285 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_13550 17273 18208 gene locus_tag LOCUS_13560 gene ybhF-N 17273 18208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_13560 18192 19169 gene locus_tag LOCUS_13570 gene ybhF-C 18192 19169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_13570 19166 20035 gene locus_tag LOCUS_13580 19166 20035 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_13580 20085 20519 gene locus_tag LOCUS_13590 20085 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 20516 21658 gene locus_tag LOCUS_13600 gene ybhS 20516 21658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_13600 21655 22788 gene locus_tag LOCUS_13610 gene ybhR 21655 22788 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B8 protein_id gnl|my_center|LOCUS_13610 23035 24408 gene locus_tag LOCUS_13620 gene gdhA 23035 24408 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930S3 protein_id gnl|my_center|LOCUS_13620 25068 24535 gene locus_tag LOCUS_13630 25068 24535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 27428 25266 gene locus_tag LOCUS_13640 27428 25266 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073784.1 protein_id gnl|my_center|LOCUS_13640 27914 27519 gene locus_tag LOCUS_13650 27914 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 28875 28408 gene locus_tag LOCUS_13660 28875 28408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 29626 28955 gene locus_tag LOCUS_13670 29626 28955 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 protein_id gnl|my_center|LOCUS_13670 29865 29623 gene locus_tag LOCUS_13680 29865 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 30078 29914 gene locus_tag LOCUS_13690 30078 29914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 32233 30131 gene locus_tag LOCUS_13700 32233 30131 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_13700 32937 32575 gene locus_tag LOCUS_13710 32937 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 33727 33885 gene locus_tag LOCUS_13720 33727 33885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 34659 34444 gene locus_tag LOCUS_13730 34659 34444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 35441 34659 gene locus_tag LOCUS_13740 35441 34659 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 protein_id gnl|my_center|LOCUS_13740 35967 35428 gene locus_tag LOCUS_13750 35967 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 38329 35984 gene locus_tag LOCUS_13760 38329 35984 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 protein_id gnl|my_center|LOCUS_13760 39986 38340 gene locus_tag LOCUS_13770 39986 38340 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009950383.1 protein_id gnl|my_center|LOCUS_13770 41129 40128 gene locus_tag LOCUS_13780 41129 40128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 42342 41122 gene locus_tag LOCUS_13790 gene ackA 42342 41122 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYF1 protein_id gnl|my_center|LOCUS_13790 44165 42342 gene locus_tag LOCUS_13800 44165 42342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946767.1 protein_id gnl|my_center|LOCUS_13800 44500 44162 gene locus_tag LOCUS_13810 44500 44162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 44843 44493 gene locus_tag LOCUS_13820 44843 44493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 45403 44858 gene locus_tag LOCUS_13830 45403 44858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 45393 45731 gene locus_tag LOCUS_13840 45393 45731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 45909 47144 gene locus_tag LOCUS_13850 45909 47144 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_13850 47279 47566 gene locus_tag LOCUS_13860 47279 47566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 47612 49189 gene locus_tag LOCUS_13870 47612 49189 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887542.1 protein_id gnl|my_center|LOCUS_13870 49368 50153 gene locus_tag LOCUS_13880 49368 50153 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_13880 51626 50313 gene locus_tag LOCUS_13890 51626 50313 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_13890 53475 52288 gene locus_tag LOCUS_13900 gene thlA 53475 52288 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45359 protein_id gnl|my_center|LOCUS_13900 54250 53528 gene locus_tag LOCUS_13910 54250 53528 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_13910 55026 54835 gene locus_tag LOCUS_13920 55026 54835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 55413 55661 gene locus_tag LOCUS_13930 55413 55661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 55652 56056 gene locus_tag LOCUS_13940 55652 56056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13940 56172 57080 gene locus_tag LOCUS_13950 56172 57080 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338926.1 protein_id gnl|my_center|LOCUS_13950 57564 58226 gene locus_tag LOCUS_13960 57564 58226 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_13960 58626 59648 gene locus_tag LOCUS_13970 gene adhA 58626 59648 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence018 1460 339 gene locus_tag LOCUS_13980 1460 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_13980 2651 1578 gene locus_tag LOCUS_13990 2651 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2719 3369 gene locus_tag LOCUS_14000 2719 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4020 3379 gene locus_tag LOCUS_14010 4020 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4229 4783 gene locus_tag LOCUS_14020 4229 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4928 6568 gene locus_tag LOCUS_14030 4928 6568 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_14030 7579 6575 gene locus_tag LOCUS_14040 7579 6575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918077.1 protein_id gnl|my_center|LOCUS_14040 7793 10675 gene locus_tag LOCUS_14050 7793 10675 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529547.1 protein_id gnl|my_center|LOCUS_14050 10752 11753 gene locus_tag LOCUS_14060 10752 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 11898 12185 gene locus_tag LOCUS_14070 11898 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 13392 12244 gene locus_tag LOCUS_14080 13392 12244 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_14080 15201 13588 gene locus_tag LOCUS_14090 gene pckA 15201 13588 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43086 protein_id gnl|my_center|LOCUS_14090 17027 15525 gene locus_tag LOCUS_14100 17027 15525 CDS product carboxypeptidase S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_14100 17367 18068 gene locus_tag LOCUS_14110 17367 18068 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_14110 18037 19953 gene locus_tag LOCUS_14120 18037 19953 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 protein_id gnl|my_center|LOCUS_14120 19950 20426 gene locus_tag LOCUS_14130 gene hprK 19950 20426 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918128.1 protein_id gnl|my_center|LOCUS_14130 20675 21082 gene locus_tag LOCUS_14140 20675 21082 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_14140 21085 21381 gene locus_tag LOCUS_14150 21085 21381 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532014.1 protein_id gnl|my_center|LOCUS_14150 21613 23031 gene locus_tag LOCUS_14160 gene ahcY 21613 23031 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HP6 protein_id gnl|my_center|LOCUS_14160 23427 23164 gene locus_tag LOCUS_14170 23427 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 23426 25876 gene locus_tag LOCUS_14180 23426 25876 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970612.1 protein_id gnl|my_center|LOCUS_14180 26425 26141 gene locus_tag LOCUS_14190 26425 26141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 27246 26689 gene locus_tag LOCUS_14200 27246 26689 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8G5 protein_id gnl|my_center|LOCUS_14200 27441 27908 gene locus_tag LOCUS_14210 27441 27908 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085522.1 protein_id gnl|my_center|LOCUS_14210 27922 30177 gene locus_tag LOCUS_14220 27922 30177 CDS product oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_14220 30385 31404 gene locus_tag LOCUS_14230 30385 31404 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_14230 31949 31629 gene locus_tag LOCUS_14240 gene fdxB 31949 31629 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 protein_id gnl|my_center|LOCUS_14240 33216 31996 gene locus_tag LOCUS_14250 33216 31996 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_14250 34228 33710 gene locus_tag LOCUS_14260 34228 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 34617 34345 gene locus_tag LOCUS_14270 34617 34345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 34516 34851 gene locus_tag LOCUS_14280 34516 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14280 34848 35933 gene locus_tag LOCUS_14290 34848 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14290 35942 36652 gene locus_tag LOCUS_14300 gene galF 35942 36652 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_14300 36677 39685 gene locus_tag LOCUS_14310 36677 39685 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_14310 39682 43161 gene locus_tag LOCUS_14320 39682 43161 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_14320 43285 43605 gene locus_tag LOCUS_14330 43285 43605 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_14330 44993 43653 gene locus_tag LOCUS_14340 gene folC 44993 43653 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_14340 45904 44990 gene locus_tag LOCUS_14350 gene accD 45904 44990 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE3 protein_id gnl|my_center|LOCUS_14350 46756 45917 gene locus_tag LOCUS_14360 gene trpA 46756 45917 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_14360 48000 46753 gene locus_tag LOCUS_14370 gene trpB 48000 46753 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E5 protein_id gnl|my_center|LOCUS_14370 48713 48036 gene locus_tag LOCUS_14380 gene trpF 48713 48036 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE6 protein_id gnl|my_center|LOCUS_14380 49392 48691 gene locus_tag LOCUS_14390 gene pyrF 49392 48691 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_14390 49746 49465 gene locus_tag LOCUS_14400 49746 49465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 50140 49808 gene locus_tag LOCUS_14410 gene ihfB 50140 49808 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE8 protein_id gnl|my_center|LOCUS_14410 51056 50214 gene locus_tag LOCUS_14420 51056 50214 CDS product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974235.1 protein_id gnl|my_center|LOCUS_14420 51015 51182 gene locus_tag LOCUS_14430 51015 51182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 53003 51294 gene locus_tag LOCUS_14440 gene rpsA 53003 51294 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF0 protein_id gnl|my_center|LOCUS_14440 53857 53201 gene locus_tag LOCUS_14450 gene cmk 53857 53201 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_14450 55116 53854 gene locus_tag LOCUS_14460 gene aroA 55116 53854 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_14460 55416 55802 gene locus_tag LOCUS_14470 55416 55802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 55923 55998 gene locus_tag LOCUS_t00140 55923 55998 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 315 674 gene locus_tag LOCUS_14480 315 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 598 1263 gene locus_tag LOCUS_14490 598 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 1659 1357 gene locus_tag LOCUS_14500 1659 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083553.1 protein_id gnl|my_center|LOCUS_14500 2180 1731 gene locus_tag LOCUS_14510 2180 1731 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527659.1 protein_id gnl|my_center|LOCUS_14510 2426 3043 gene locus_tag LOCUS_14520 gene sodB 2426 3043 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDA9 protein_id gnl|my_center|LOCUS_14520 4202 3177 gene locus_tag LOCUS_14530 gene idiA 4202 3177 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_14530 5338 4298 gene locus_tag LOCUS_14540 5338 4298 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_14540 5337 7283 gene locus_tag LOCUS_14550 5337 7283 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_14550 7314 9581 gene locus_tag LOCUS_14560 gene fadE 7314 9581 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085213.1 protein_id gnl|my_center|LOCUS_14560 9675 11510 gene locus_tag LOCUS_14570 9675 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_14570 11782 12315 gene locus_tag LOCUS_14580 11782 12315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 12308 13444 gene locus_tag LOCUS_14590 12308 13444 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_14590 13441 16644 gene locus_tag LOCUS_14600 13441 16644 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_14600 17503 16658 gene locus_tag LOCUS_14610 17503 16658 CDS product 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813498.1 protein_id gnl|my_center|LOCUS_14610 19224 17590 gene locus_tag LOCUS_14620 19224 17590 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_14620 21129 19522 gene locus_tag LOCUS_14630 gene caiC 21129 19522 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_14630 22374 21139 gene locus_tag LOCUS_14640 22374 21139 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064431.1 protein_id gnl|my_center|LOCUS_14640 23200 22406 gene locus_tag LOCUS_14650 23200 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 24448 23243 gene locus_tag LOCUS_14660 24448 23243 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878671.1 protein_id gnl|my_center|LOCUS_14660 27660 24568 gene locus_tag LOCUS_14670 27660 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 28649 27660 gene locus_tag LOCUS_14680 28649 27660 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_14680 30085 28646 gene locus_tag LOCUS_14690 30085 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 31508 30276 gene locus_tag LOCUS_14700 31508 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_14700 32964 31834 gene locus_tag LOCUS_14710 gene acd 32964 31834 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_14710 34185 32980 gene locus_tag LOCUS_14720 34185 32980 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_14720 35392 34202 gene locus_tag LOCUS_14730 35392 34202 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_14730 36017 35406 gene locus_tag LOCUS_14740 36017 35406 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_14740 38023 36020 gene locus_tag LOCUS_14750 gene atuF 38023 36020 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_14750 38847 38035 gene locus_tag LOCUS_14760 gene atuE 38847 38035 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_14760 40486 38864 gene locus_tag LOCUS_14770 40486 38864 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544675.1 protein_id gnl|my_center|LOCUS_14770 42331 40523 gene locus_tag LOCUS_14780 gene atuA 42331 40523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_14780 42518 43156 gene locus_tag LOCUS_14790 42518 43156 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701130.1 protein_id gnl|my_center|LOCUS_14790 44322 43210 gene locus_tag LOCUS_14800 44322 43210 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_14800 45972 44335 gene locus_tag LOCUS_14810 45972 44335 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929741.1 protein_id gnl|my_center|LOCUS_14810 47477 46191 gene locus_tag LOCUS_14820 47477 46191 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878671.1 protein_id gnl|my_center|LOCUS_14820 47667 48815 gene locus_tag LOCUS_14830 47667 48815 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_14830 49365 52619 gene locus_tag LOCUS_14840 gene cas9 49365 52619 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P897 protein_id gnl|my_center|LOCUS_14840 52616 53542 gene locus_tag LOCUS_14850 gene cas1 52616 53542 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_14850 53555 53881 gene locus_tag LOCUS_14860 gene cas2 53555 53881 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WVJ7 protein_id gnl|my_center|LOCUS_14860 53956 >54829 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttagccgatagaaaatcgcggaccagccgcaac >Feature sequence020 578 159 gene locus_tag LOCUS_14870 578 159 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388697.1 protein_id gnl|my_center|LOCUS_14870 1090 578 gene locus_tag LOCUS_14880 gene rnk 1090 578 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836246.1 protein_id gnl|my_center|LOCUS_14880 1433 2368 gene locus_tag LOCUS_14890 1433 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3145 2504 gene locus_tag LOCUS_14900 gene cynT 3145 2504 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KY0 protein_id gnl|my_center|LOCUS_14900 3373 4167 gene locus_tag LOCUS_14910 gene cysD 3373 4167 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_14910 4180 6099 gene locus_tag LOCUS_14920 gene nodQ 4180 6099 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_14920 6138 7124 gene locus_tag LOCUS_14930 6138 7124 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_14930 7257 8618 gene locus_tag LOCUS_14940 gene glmU 7257 8618 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_14940 8621 10444 gene locus_tag LOCUS_14950 gene glmS 8621 10444 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 protein_id gnl|my_center|LOCUS_14950 10456 11223 gene locus_tag LOCUS_14960 10456 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 11422 12675 gene locus_tag LOCUS_14970 11422 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 12754 13224 gene locus_tag LOCUS_14980 12754 13224 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R297 protein_id gnl|my_center|LOCUS_14980 13348 14856 gene locus_tag LOCUS_14990 13348 14856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_14990 14869 16071 gene locus_tag LOCUS_15000 14869 16071 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_15000 16227 17735 gene locus_tag LOCUS_15010 16227 17735 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_15010 17739 18779 gene locus_tag LOCUS_15020 17739 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 19627 18821 gene locus_tag LOCUS_15030 19627 18821 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_15030 20007 19624 gene locus_tag LOCUS_15040 20007 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 protein_id gnl|my_center|LOCUS_15040 21022 20018 gene locus_tag LOCUS_15050 21022 20018 CDS product tyrosine protein kinase:aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_15050 22058 21024 gene locus_tag LOCUS_15060 22058 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 22255 22998 gene locus_tag LOCUS_15070 22255 22998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_15070 24795 22990 gene locus_tag LOCUS_15080 24795 22990 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_15080 24676 24984 gene locus_tag LOCUS_15090 24676 24984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 25172 25465 gene locus_tag LOCUS_15100 25172 25465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 protein_id gnl|my_center|LOCUS_15100 25482 28994 gene locus_tag LOCUS_15110 gene mfd 25482 28994 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LE3 protein_id gnl|my_center|LOCUS_15110 29663 29013 gene locus_tag LOCUS_15120 29663 29013 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 protein_id gnl|my_center|LOCUS_15120 29822 30601 gene locus_tag LOCUS_15130 29822 30601 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_15130 30725 30943 gene locus_tag LOCUS_15140 30725 30943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 31042 32535 gene locus_tag LOCUS_15150 gene putP 31042 32535 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_15150 32633 32839 gene locus_tag LOCUS_15160 32633 32839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 34396 32840 gene locus_tag LOCUS_15170 34396 32840 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817768.1 protein_id gnl|my_center|LOCUS_15170 34547 35677 gene locus_tag LOCUS_15180 34547 35677 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_15180 35863 36459 gene locus_tag LOCUS_15190 35863 36459 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_15190 38231 36534 gene locus_tag LOCUS_15200 38231 36534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087361.1 protein_id gnl|my_center|LOCUS_15200 38572 39135 gene locus_tag LOCUS_15210 38572 39135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 39866 39144 gene locus_tag LOCUS_15220 39866 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 40314 39982 gene locus_tag LOCUS_15230 40314 39982 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_15230 40471 41574 gene locus_tag LOCUS_15240 40471 41574 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_15240 42624 41581 gene locus_tag LOCUS_15250 gene mclA 42624 41581 CDS product Malyl-CoA/beta-methylmalyl-CoA/citramalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC35 protein_id gnl|my_center|LOCUS_15250 44005 42713 gene locus_tag LOCUS_15260 44005 42713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_15260 45373 44087 gene locus_tag LOCUS_15270 45373 44087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085441.1 protein_id gnl|my_center|LOCUS_15270 45536 46153 gene locus_tag LOCUS_15280 45536 46153 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_15280 46273 46668 gene locus_tag LOCUS_15290 46273 46668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 46813 47151 gene locus_tag LOCUS_15300 46813 47151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 47225 47314 gene locus_tag LOCUS_t00150 47225 47314 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <48730 47579 gene locus_tag LOCUS_15310 <48730 47579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEB3:NADH-quinone oxidoreductase subunit N >Feature sequence021 1623 610 gene locus_tag LOCUS_15320 1623 610 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086750.1 protein_id gnl|my_center|LOCUS_15320 2721 1696 gene locus_tag LOCUS_15330 2721 1696 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_15330 4306 2969 gene locus_tag LOCUS_15340 4306 2969 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390985.1 protein_id gnl|my_center|LOCUS_15340 6366 4402 gene locus_tag LOCUS_15350 gene macB 6366 4402 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPB4 protein_id gnl|my_center|LOCUS_15350 7592 6372 gene locus_tag LOCUS_15360 gene macA 7592 6372 CDS product macrolide-specific efflux protein MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708505.1 protein_id gnl|my_center|LOCUS_15360 8724 7726 gene locus_tag LOCUS_15370 8724 7726 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_15370 8926 10593 gene locus_tag LOCUS_15380 gene nadE 8926 10593 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975715.1 protein_id gnl|my_center|LOCUS_15380 10685 12031 gene locus_tag LOCUS_15390 gene gltX1 10685 12031 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 protein_id gnl|my_center|LOCUS_15390 12522 14171 gene locus_tag LOCUS_15400 12522 14171 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_15400 14483 15409 gene locus_tag LOCUS_15410 14483 15409 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388464.1 protein_id gnl|my_center|LOCUS_15410 16047 15499 gene locus_tag LOCUS_15420 16047 15499 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 protein_id gnl|my_center|LOCUS_15420 16197 17156 gene locus_tag LOCUS_15430 16197 17156 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_15430 17323 19257 gene locus_tag LOCUS_15440 17323 19257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930067.1 protein_id gnl|my_center|LOCUS_15440 19329 20009 gene locus_tag LOCUS_15450 gene psd 19329 20009 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_15450 20057 20923 gene locus_tag LOCUS_15460 gene pssA 20057 20923 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_15460 21144 20929 gene locus_tag LOCUS_15470 21144 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 22432 21137 gene locus_tag LOCUS_15480 22432 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 22691 25000 gene locus_tag LOCUS_15490 22691 25000 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_15490 25160 26569 gene locus_tag LOCUS_15500 25160 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 28097 26589 gene locus_tag LOCUS_15510 28097 26589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 29038 28232 gene locus_tag LOCUS_15520 gene uppP 29038 28232 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP8 protein_id gnl|my_center|LOCUS_15520 31284 29161 gene locus_tag LOCUS_15530 31284 29161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 31435 31938 gene locus_tag LOCUS_15540 31435 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 32061 32930 gene locus_tag LOCUS_15550 32061 32930 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807877.1 protein_id gnl|my_center|LOCUS_15550 32966 34846 gene locus_tag LOCUS_15560 32966 34846 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482972.1 protein_id gnl|my_center|LOCUS_15560 34974 35579 gene locus_tag LOCUS_15570 34974 35579 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_15570 36610 35582 gene locus_tag LOCUS_15580 36610 35582 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_15580 36946 37371 gene locus_tag LOCUS_15590 36946 37371 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_15590 37601 39295 gene locus_tag LOCUS_15600 gene phaC1 37601 39295 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_15600 39349 40230 gene locus_tag LOCUS_15610 gene phaB 39349 40230 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739559.1 protein_id gnl|my_center|LOCUS_15610 40358 42007 gene locus_tag LOCUS_15620 40358 42007 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_15620 41995 42984 gene locus_tag LOCUS_15630 41995 42984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 protein_id gnl|my_center|LOCUS_15630 43073 45241 gene locus_tag LOCUS_15640 43073 45241 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_15640 45238 45969 gene locus_tag LOCUS_15650 45238 45969 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_15650 46174 47043 gene locus_tag LOCUS_15660 46174 47043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 48231 47107 gene locus_tag LOCUS_15670 48231 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence022 1955 1002 gene locus_tag LOCUS_15680 gene argC 1955 1002 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H555 protein_id gnl|my_center|LOCUS_15680 2534 2028 gene locus_tag LOCUS_15690 gene rpsI 2534 2028 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGF4 protein_id gnl|my_center|LOCUS_15690 3001 2537 gene locus_tag LOCUS_15700 gene rplM 3001 2537 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFZ7 protein_id gnl|my_center|LOCUS_15700 3603 3178 gene locus_tag LOCUS_15710 3603 3178 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969131.1 protein_id gnl|my_center|LOCUS_15710 3698 4252 gene locus_tag LOCUS_15720 3698 4252 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106016.1 protein_id gnl|my_center|LOCUS_15720 4305 5126 gene locus_tag LOCUS_15730 gene fadB 4305 5126 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_15730 5126 5536 gene locus_tag LOCUS_15740 5126 5536 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704912.1 protein_id gnl|my_center|LOCUS_15740 5657 6931 gene locus_tag LOCUS_15750 5657 6931 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 protein_id gnl|my_center|LOCUS_15750 8081 7047 gene locus_tag LOCUS_15760 gene ctaA 8081 7047 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_15760 8235 8450 gene locus_tag LOCUS_15770 8235 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087732.1 protein_id gnl|my_center|LOCUS_15770 8677 8601 gene locus_tag LOCUS_t00160 8677 8601 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9228 8761 gene locus_tag LOCUS_15780 9228 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 9680 9300 gene locus_tag LOCUS_15790 gene ihfA 9680 9300 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 protein_id gnl|my_center|LOCUS_15790 10744 9767 gene locus_tag LOCUS_15800 gene fabH 10744 9767 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K89 protein_id gnl|my_center|LOCUS_15800 11823 10741 gene locus_tag LOCUS_15810 gene plsX 11823 10741 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K88 protein_id gnl|my_center|LOCUS_15810 12492 11938 gene locus_tag LOCUS_15820 12492 11938 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707544.1 protein_id gnl|my_center|LOCUS_15820 13070 12492 gene locus_tag LOCUS_15830 13070 12492 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087784.1 protein_id gnl|my_center|LOCUS_15830 13187 13690 gene locus_tag LOCUS_15840 13187 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 15881 13764 gene locus_tag LOCUS_15850 gene hppA 15881 13764 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K83 protein_id gnl|my_center|LOCUS_15850 17049 16042 gene locus_tag LOCUS_15860 gene thiL 17049 16042 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K82 protein_id gnl|my_center|LOCUS_15860 17539 17030 gene locus_tag LOCUS_15870 gene nusB 17539 17030 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QT9 protein_id gnl|my_center|LOCUS_15870 18023 17565 gene locus_tag LOCUS_15880 gene ribH 18023 17565 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7P7 protein_id gnl|my_center|LOCUS_15880 19168 18020 gene locus_tag LOCUS_15890 19168 18020 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_15890 19800 19174 gene locus_tag LOCUS_15900 19800 19174 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_15900 20924 19800 gene locus_tag LOCUS_15910 20924 19800 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_15910 21467 20979 gene locus_tag LOCUS_15920 gene nrdR 21467 20979 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THE3 protein_id gnl|my_center|LOCUS_15920 22834 21518 gene locus_tag LOCUS_15930 gene glyA 22834 21518 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_15930 23349 23801 gene locus_tag LOCUS_15940 23349 23801 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918833.1 protein_id gnl|my_center|LOCUS_15940 23976 23815 gene locus_tag LOCUS_15950 23976 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 25400 24114 gene locus_tag LOCUS_15960 25400 24114 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J8 protein_id gnl|my_center|LOCUS_15960 26327 25542 gene locus_tag LOCUS_15970 26327 25542 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_15970 27649 26351 gene locus_tag LOCUS_15980 27649 26351 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532254.1 protein_id gnl|my_center|LOCUS_15980 28400 27888 gene locus_tag LOCUS_15990 gene mucS 28400 27888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_15990 29432 28536 gene locus_tag LOCUS_16000 29432 28536 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_16000 30491 29451 gene locus_tag LOCUS_16010 30491 29451 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_16010 31632 30493 gene locus_tag LOCUS_16020 31632 30493 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_16020 31802 32812 gene locus_tag LOCUS_16030 gene hemB 31802 32812 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_16030 33267 32809 gene locus_tag LOCUS_16040 33267 32809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 34523 33378 gene locus_tag LOCUS_16050 34523 33378 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_16050 35392 34523 gene locus_tag LOCUS_16060 35392 34523 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_16060 36337 35483 gene locus_tag LOCUS_16070 36337 35483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 36738 36334 gene locus_tag LOCUS_16080 36738 36334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 37112 36735 gene locus_tag LOCUS_16090 37112 36735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 37977 37168 gene locus_tag LOCUS_16100 37977 37168 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_16100 38315 38788 gene locus_tag LOCUS_16110 38315 38788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 39267 38785 gene locus_tag LOCUS_16120 39267 38785 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920136.1 protein_id gnl|my_center|LOCUS_16120 39589 40452 gene locus_tag LOCUS_16130 39589 40452 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_16130 40470 41369 gene locus_tag LOCUS_16140 40470 41369 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_16140 41460 41939 gene locus_tag LOCUS_16150 41460 41939 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971440.1 protein_id gnl|my_center|LOCUS_16150 42028 43890 gene locus_tag LOCUS_16160 42028 43890 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_16160 43887 44669 gene locus_tag LOCUS_16170 gene ate 43887 44669 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K72 protein_id gnl|my_center|LOCUS_16170 44817 45890 gene locus_tag LOCUS_16180 44817 45890 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_16180 45912 46451 gene locus_tag LOCUS_16190 45912 46451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_16190 46465 48039 gene locus_tag LOCUS_16200 46465 48039 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence023 600 238 gene locus_tag LOCUS_16210 600 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16210 835 617 gene locus_tag LOCUS_16220 835 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 2380 1094 gene locus_tag LOCUS_16230 2380 1094 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878671.1 protein_id gnl|my_center|LOCUS_16230 2786 2466 gene locus_tag LOCUS_16240 2786 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4051 2858 gene locus_tag LOCUS_16250 4051 2858 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703683.1 protein_id gnl|my_center|LOCUS_16250 5651 4089 gene locus_tag LOCUS_16260 5651 4089 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_16260 6775 5663 gene locus_tag LOCUS_16270 6775 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 6946 7959 gene locus_tag LOCUS_16280 6946 7959 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207159.1 protein_id gnl|my_center|LOCUS_16280 8948 8037 gene locus_tag LOCUS_16290 gene rr07 8948 8037 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_16290 8886 9107 gene locus_tag LOCUS_16300 8886 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 9171 9698 gene locus_tag LOCUS_16310 9171 9698 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_16310 9777 10226 gene locus_tag LOCUS_16320 9777 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 10278 12251 gene locus_tag LOCUS_16330 10278 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12287 12778 gene locus_tag LOCUS_16340 12287 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 13026 13295 gene locus_tag LOCUS_16350 13026 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 13844 13755 gene locus_tag LOCUS_t00170 13844 13755 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14043 14336 gene locus_tag LOCUS_16360 14043 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 15483 14470 gene locus_tag LOCUS_16370 15483 14470 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095270.1 protein_id gnl|my_center|LOCUS_16370 15646 17205 gene locus_tag LOCUS_16380 15646 17205 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_16380 17306 18313 gene locus_tag LOCUS_16390 17306 18313 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969434.1 protein_id gnl|my_center|LOCUS_16390 18326 19288 gene locus_tag LOCUS_16400 18326 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969435.1 protein_id gnl|my_center|LOCUS_16400 19285 19815 gene locus_tag LOCUS_16410 19285 19815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 19808 20797 gene locus_tag LOCUS_16420 19808 20797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969437.1 protein_id gnl|my_center|LOCUS_16420 20794 22323 gene locus_tag LOCUS_16430 20794 22323 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969438.1 protein_id gnl|my_center|LOCUS_16430 22320 23669 gene locus_tag LOCUS_16440 22320 23669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 26004 23617 gene locus_tag LOCUS_16450 26004 23617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_16450 26228 27934 gene locus_tag LOCUS_16460 26228 27934 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_16460 30411 28000 gene locus_tag LOCUS_16470 30411 28000 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878946.1 protein_id gnl|my_center|LOCUS_16470 31303 30392 gene locus_tag LOCUS_16480 31303 30392 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_16480 31510 32319 gene locus_tag LOCUS_16490 31510 32319 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_16490 33343 32303 gene locus_tag LOCUS_16500 33343 32303 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_16500 35275 33473 gene locus_tag LOCUS_16510 gene lepA 35275 33473 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGR1 protein_id gnl|my_center|LOCUS_16510 36226 35402 gene locus_tag LOCUS_16520 36226 35402 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_16520 37031 36228 gene locus_tag LOCUS_16530 37031 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 39541 37106 gene locus_tag LOCUS_16540 gene pheT 39541 37106 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC6 protein_id gnl|my_center|LOCUS_16540 40629 39538 gene locus_tag LOCUS_16550 gene pheS 40629 39538 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WI1 protein_id gnl|my_center|LOCUS_16550 41198 40842 gene locus_tag LOCUS_16560 gene rplT 41198 40842 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_16560 41439 41233 gene locus_tag LOCUS_16570 gene rpmI 41439 41233 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCP8 protein_id gnl|my_center|LOCUS_16570 41776 42306 gene locus_tag LOCUS_16580 41776 42306 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_16580 42779 42333 gene locus_tag LOCUS_16590 42779 42333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 44305 43055 gene locus_tag LOCUS_16600 44305 43055 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_16600 44567 44866 gene locus_tag LOCUS_16610 44567 44866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 44938 45846 gene locus_tag LOCUS_16620 44938 45846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 45855 46841 gene locus_tag LOCUS_16630 45855 46841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence024 406 612 gene locus_tag LOCUS_16640 406 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 982 1290 gene locus_tag LOCUS_16650 982 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1367 2629 gene locus_tag LOCUS_16660 1367 2629 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_16660 2626 3795 gene locus_tag LOCUS_16670 2626 3795 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_16670 3805 6939 gene locus_tag LOCUS_16680 3805 6939 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_16680 6941 7261 gene locus_tag LOCUS_16690 6941 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 7267 8190 gene locus_tag LOCUS_16700 gene czcD 7267 8190 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_16700 8463 8696 gene locus_tag LOCUS_16710 8463 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9422 10270 gene locus_tag LOCUS_16720 gene cobA 9422 10270 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969585.1 protein_id gnl|my_center|LOCUS_16720 10554 10315 gene locus_tag LOCUS_16730 10554 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 10858 11841 gene locus_tag LOCUS_16740 gene cobT 10858 11841 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDH9 protein_id gnl|my_center|LOCUS_16740 12081 13277 gene locus_tag LOCUS_16750 12081 13277 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_16750 13331 14461 gene locus_tag LOCUS_16760 13331 14461 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_16760 15880 14525 gene locus_tag LOCUS_16770 15880 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331325.1 protein_id gnl|my_center|LOCUS_16770 16182 17267 gene locus_tag LOCUS_16780 16182 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038986.1 protein_id gnl|my_center|LOCUS_16780 18719 17274 gene locus_tag LOCUS_16790 18719 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 19003 19815 gene locus_tag LOCUS_16800 19003 19815 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_16800 19975 20271 gene locus_tag LOCUS_16810 19975 20271 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919993.1 protein_id gnl|my_center|LOCUS_16810 20295 21503 gene locus_tag LOCUS_16820 20295 21503 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919992.1 protein_id gnl|my_center|LOCUS_16820 21512 21988 gene locus_tag LOCUS_16830 21512 21988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 22294 22013 gene locus_tag LOCUS_16840 22294 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 22641 22429 gene locus_tag LOCUS_16850 22641 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 24654 22717 gene locus_tag LOCUS_16860 24654 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 25621 24716 gene locus_tag LOCUS_16870 25621 24716 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_16870 25699 25998 gene locus_tag LOCUS_16880 25699 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 26156 27634 gene locus_tag LOCUS_16890 26156 27634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_16890 28629 27592 gene locus_tag LOCUS_16900 28629 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_16900 29128 28685 gene locus_tag LOCUS_16910 29128 28685 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_16910 29330 29794 gene locus_tag LOCUS_16920 29330 29794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 29948 30487 gene locus_tag LOCUS_16930 29948 30487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 30575 31726 gene locus_tag LOCUS_16940 30575 31726 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_16940 31747 32346 gene locus_tag LOCUS_16950 31747 32346 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_16950 32389 33402 gene locus_tag LOCUS_16960 32389 33402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_16960 35908 33413 gene locus_tag LOCUS_16970 35908 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 36300 36225 gene locus_tag LOCUS_t00180 36300 36225 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 36455 37624 gene locus_tag LOCUS_16980 36455 37624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 38307 37621 gene locus_tag LOCUS_16990 gene gph 38307 37621 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_16990 38443 38934 gene locus_tag LOCUS_17000 38443 38934 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228517.1 protein_id gnl|my_center|LOCUS_17000 40095 38953 gene locus_tag LOCUS_17010 40095 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064658.1 protein_id gnl|my_center|LOCUS_17010 40263 41723 gene locus_tag LOCUS_17020 gene gabD 40263 41723 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_17020 41727 42425 gene locus_tag LOCUS_17030 gene rpiA 41727 42425 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9T4 protein_id gnl|my_center|LOCUS_17030 42604 43986 gene locus_tag LOCUS_17040 gene gor 42604 43986 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_17040 44082 45530 gene locus_tag LOCUS_17050 44082 45530 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NQ6 protein_id gnl|my_center|LOCUS_17050 >Feature sequence025 46 243 gene locus_tag LOCUS_17060 46 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 909 2510 gene locus_tag LOCUS_17070 909 2510 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707729.1 protein_id gnl|my_center|LOCUS_17070 3065 4156 gene locus_tag LOCUS_17080 3065 4156 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3R5 protein_id gnl|my_center|LOCUS_17080 4407 4153 gene locus_tag LOCUS_17090 4407 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4328 5245 gene locus_tag LOCUS_17100 4328 5245 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265910.1 protein_id gnl|my_center|LOCUS_17100 5242 6093 gene locus_tag LOCUS_17110 5242 6093 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640674.1 protein_id gnl|my_center|LOCUS_17110 6140 7228 gene locus_tag LOCUS_17120 6140 7228 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3R8 protein_id gnl|my_center|LOCUS_17120 8048 7260 gene locus_tag LOCUS_17130 8048 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8726 8064 gene locus_tag LOCUS_17140 8726 8064 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528496.1 protein_id gnl|my_center|LOCUS_17140 8916 10040 gene locus_tag LOCUS_17150 8916 10040 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067010.1 protein_id gnl|my_center|LOCUS_17150 10051 11625 gene locus_tag LOCUS_17160 10051 11625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528494.1 protein_id gnl|my_center|LOCUS_17160 12899 11727 gene locus_tag LOCUS_17170 12899 11727 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 protein_id gnl|my_center|LOCUS_17170 13249 14517 gene locus_tag LOCUS_17180 13249 14517 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_17180 15495 14557 gene locus_tag LOCUS_17190 15495 14557 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 protein_id gnl|my_center|LOCUS_17190 16302 15577 gene locus_tag LOCUS_17200 16302 15577 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919073.1 protein_id gnl|my_center|LOCUS_17200 16410 17519 gene locus_tag LOCUS_17210 16410 17519 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_17210 17516 20620 gene locus_tag LOCUS_17220 gene acrB5 17516 20620 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_17220 23128 20771 gene locus_tag LOCUS_17230 23128 20771 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_17230 23697 24737 gene locus_tag LOCUS_17240 23697 24737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359835.1 protein_id gnl|my_center|LOCUS_17240 24734 27481 gene locus_tag LOCUS_17250 24734 27481 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_17250 27521 28651 gene locus_tag LOCUS_17260 27521 28651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_17260 28868 30586 gene locus_tag LOCUS_17270 gene fixN 28868 30586 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03073 protein_id gnl|my_center|LOCUS_17270 30601 31326 gene locus_tag LOCUS_17280 gene fixO2 30601 31326 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 protein_id gnl|my_center|LOCUS_17280 31336 31569 gene locus_tag LOCUS_17290 31336 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 31566 32453 gene locus_tag LOCUS_17300 gene fixP 31566 32453 CDS product Cbb3-type cytochrome c oxidase subunit FixP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03075 protein_id gnl|my_center|LOCUS_17300 32524 34050 gene locus_tag LOCUS_17310 gene fixG 32524 34050 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_17310 34047 34574 gene locus_tag LOCUS_17320 34047 34574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 34584 36821 gene locus_tag LOCUS_17330 34584 36821 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_17330 36818 36979 gene locus_tag LOCUS_17340 36818 36979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 37780 36983 gene locus_tag LOCUS_17350 37780 36983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_17350 37965 38591 gene locus_tag LOCUS_17360 gene msrA 37965 38591 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_17360 38602 39102 gene locus_tag LOCUS_17370 38602 39102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 39257 40084 gene locus_tag LOCUS_17380 39257 40084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 40591 40133 gene locus_tag LOCUS_17390 40591 40133 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA4 protein_id gnl|my_center|LOCUS_17390 40680 41927 gene locus_tag LOCUS_17400 40680 41927 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 protein_id gnl|my_center|LOCUS_17400 42693 41914 gene locus_tag LOCUS_17410 gene bdhA 42693 41914 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_17410 43013 42825 gene locus_tag LOCUS_17420 43013 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 43348 43142 gene locus_tag LOCUS_17430 43348 43142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_17430 43488 44882 gene locus_tag LOCUS_17440 43488 44882 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_17440 44905 45660 gene locus_tag LOCUS_17450 44905 45660 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087714.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence026 357 698 gene locus_tag LOCUS_17460 357 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 748 1527 gene locus_tag LOCUS_17470 748 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1710 1624 gene locus_tag LOCUS_t00190 1710 1624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1907 2431 gene locus_tag LOCUS_17480 1907 2431 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084158.1 protein_id gnl|my_center|LOCUS_17480 2428 3021 gene locus_tag LOCUS_17490 gene coq7 2428 3021 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_17490 3593 3033 gene locus_tag LOCUS_17500 3593 3033 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 protein_id gnl|my_center|LOCUS_17500 4018 3704 gene locus_tag LOCUS_17510 4018 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 4376 3936 gene locus_tag LOCUS_17520 4376 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17520 4463 5365 gene locus_tag LOCUS_17530 gene gltX 4463 5365 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084190.1 protein_id gnl|my_center|LOCUS_17530 5475 5624 gene locus_tag LOCUS_17540 5475 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6354 5665 gene locus_tag LOCUS_17550 6354 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7478 6360 gene locus_tag LOCUS_17560 7478 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7765 7475 gene locus_tag LOCUS_17570 7765 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 10063 8060 gene locus_tag LOCUS_17580 10063 8060 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_17580 10256 11503 gene locus_tag LOCUS_17590 10256 11503 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_17590 12682 11597 gene locus_tag LOCUS_17600 12682 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_17600 12971 14260 gene locus_tag LOCUS_17610 12971 14260 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_17610 15953 14505 gene locus_tag LOCUS_17620 15953 14505 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_17620 16213 17922 gene locus_tag LOCUS_17630 16213 17922 CDS product (2S)-methylsuccinyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_17630 18014 18205 gene locus_tag LOCUS_17640 18014 18205 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529428.1 protein_id gnl|my_center|LOCUS_17640 18335 18877 gene locus_tag LOCUS_17650 18335 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 19068 19952 gene locus_tag LOCUS_17660 gene dhaA 19068 19952 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_17660 19968 20099 gene locus_tag LOCUS_17670 19968 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 20108 20698 gene locus_tag LOCUS_17680 20108 20698 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_17680 20964 21713 gene locus_tag LOCUS_17690 gene etfB 20964 21713 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53575 protein_id gnl|my_center|LOCUS_17690 21710 22651 gene locus_tag LOCUS_17700 gene etfA 21710 22651 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53573 protein_id gnl|my_center|LOCUS_17700 22837 23712 gene locus_tag LOCUS_17710 gene hbdA 22837 23712 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45223 protein_id gnl|my_center|LOCUS_17710 23833 24000 gene locus_tag LOCUS_17720 23833 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 24068 24895 gene locus_tag LOCUS_17730 24068 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388089.1 protein_id gnl|my_center|LOCUS_17730 25484 24864 gene locus_tag LOCUS_17740 25484 24864 CDS product thiol:disulfide interchange protein TlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709199.1 protein_id gnl|my_center|LOCUS_17740 25576 26970 gene locus_tag LOCUS_17750 gene argH1 25576 26970 CDS product argininosuccinate lyase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MH1 protein_id gnl|my_center|LOCUS_17750 27002 27226 gene locus_tag LOCUS_17760 27002 27226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 27234 28502 gene locus_tag LOCUS_17770 gene lysA 27234 28502 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9L4 protein_id gnl|my_center|LOCUS_17770 28594 31101 gene locus_tag LOCUS_17780 28594 31101 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 protein_id gnl|my_center|LOCUS_17780 31481 31098 gene locus_tag LOCUS_17790 31481 31098 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_17790 32033 31488 gene locus_tag LOCUS_17800 gene hpt 32033 31488 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527423.1 protein_id gnl|my_center|LOCUS_17800 33028 32030 gene locus_tag LOCUS_17810 33028 32030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920076.1 protein_id gnl|my_center|LOCUS_17810 33170 33883 gene locus_tag LOCUS_17820 33170 33883 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 protein_id gnl|my_center|LOCUS_17820 33876 34853 gene locus_tag LOCUS_17830 33876 34853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 34963 35601 gene locus_tag LOCUS_17840 34963 35601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920079.1 protein_id gnl|my_center|LOCUS_17840 35629 36372 gene locus_tag LOCUS_17850 gene plsC 35629 36372 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_17850 36519 38852 gene locus_tag LOCUS_17860 36519 38852 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_17860 38920 39873 gene locus_tag LOCUS_17870 38920 39873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 39870 40334 gene locus_tag LOCUS_17880 39870 40334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 40365 40781 gene locus_tag LOCUS_17890 40365 40781 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035979.1 protein_id gnl|my_center|LOCUS_17890 40831 42036 gene locus_tag LOCUS_17900 40831 42036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971122.1 protein_id gnl|my_center|LOCUS_17900 42526 41978 gene locus_tag LOCUS_17910 gene chaC 42526 41978 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UM2 protein_id gnl|my_center|LOCUS_17910 >Feature sequence027 1902 937 gene locus_tag LOCUS_17920 1902 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2412 1939 gene locus_tag LOCUS_17930 2412 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3261 2554 gene locus_tag LOCUS_17940 3261 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4194 3388 gene locus_tag LOCUS_17950 4194 3388 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 protein_id gnl|my_center|LOCUS_17950 4772 4209 gene locus_tag LOCUS_17960 gene efp 4772 4209 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_17960 6108 4933 gene locus_tag LOCUS_17970 6108 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6767 6105 gene locus_tag LOCUS_17980 gene thiE 6767 6105 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_17980 7877 6858 gene locus_tag LOCUS_17990 7877 6858 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7E8 protein_id gnl|my_center|LOCUS_17990 9131 7923 gene locus_tag LOCUS_18000 gene pgk 9131 7923 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7E9 protein_id gnl|my_center|LOCUS_18000 10157 9150 gene locus_tag LOCUS_18010 10157 9150 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW8 protein_id gnl|my_center|LOCUS_18010 12235 10181 gene locus_tag LOCUS_18020 gene tkt2 12235 10181 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M82 protein_id gnl|my_center|LOCUS_18020 12558 12824 gene locus_tag LOCUS_18030 12558 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 12889 13248 gene locus_tag LOCUS_18040 gene zapA 12889 13248 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW6 protein_id gnl|my_center|LOCUS_18040 13502 14101 gene locus_tag LOCUS_18050 13502 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 14098 14910 gene locus_tag LOCUS_18060 14098 14910 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_18060 14916 15941 gene locus_tag LOCUS_18070 14916 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 16308 17054 gene locus_tag LOCUS_18080 16308 17054 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U83 protein_id gnl|my_center|LOCUS_18080 17150 17677 gene locus_tag LOCUS_18090 gene ruvC 17150 17677 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ9 protein_id gnl|my_center|LOCUS_18090 17674 18285 gene locus_tag LOCUS_18100 gene ruvA 17674 18285 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U81 protein_id gnl|my_center|LOCUS_18100 18282 19340 gene locus_tag LOCUS_18110 gene ruvB 18282 19340 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U80 protein_id gnl|my_center|LOCUS_18110 19337 19849 gene locus_tag LOCUS_18120 19337 19849 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_18120 20148 20873 gene locus_tag LOCUS_18130 gene tolQ 20148 20873 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_18130 20934 21335 gene locus_tag LOCUS_18140 20934 21335 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_18140 21345 22166 gene locus_tag LOCUS_18150 21345 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 22322 23686 gene locus_tag LOCUS_18160 gene tolB 22322 23686 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L4 protein_id gnl|my_center|LOCUS_18160 24034 24537 gene locus_tag LOCUS_18170 gene omp16 24034 24537 CDS product outer membrane lipoprotein Omp16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q926C3 protein_id gnl|my_center|LOCUS_18170 24731 25621 gene locus_tag LOCUS_18180 24731 25621 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_18180 25662 27035 gene locus_tag LOCUS_18190 gene tilS 25662 27035 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 protein_id gnl|my_center|LOCUS_18190 27205 29133 gene locus_tag LOCUS_18200 gene ftsH 27205 29133 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C810 protein_id gnl|my_center|LOCUS_18200 29303 30124 gene locus_tag LOCUS_18210 29303 30124 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTT1 protein_id gnl|my_center|LOCUS_18210 30297 31643 gene locus_tag LOCUS_18220 gene glmM 30297 31643 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN1 protein_id gnl|my_center|LOCUS_18220 31792 32304 gene locus_tag LOCUS_18230 31792 32304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 32364 32843 gene locus_tag LOCUS_18240 32364 32843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 33258 32857 gene locus_tag LOCUS_18250 33258 32857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 33403 34236 gene locus_tag LOCUS_18260 33403 34236 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_18260 34266 35093 gene locus_tag LOCUS_18270 34266 35093 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_18270 35196 36371 gene locus_tag LOCUS_18280 gene serC 35196 36371 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709275.1 protein_id gnl|my_center|LOCUS_18280 36536 38113 gene locus_tag LOCUS_18290 gene serA 36536 38113 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_18290 38372 39664 gene locus_tag LOCUS_18300 gene purA 38372 39664 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MA5 protein_id gnl|my_center|LOCUS_18300 39719 40039 gene locus_tag LOCUS_18310 39719 40039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_18310 40039 40452 gene locus_tag LOCUS_18320 40039 40452 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530737.1 protein_id gnl|my_center|LOCUS_18320 40923 40522 gene locus_tag LOCUS_18330 40923 40522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 41453 41037 gene locus_tag LOCUS_18340 41453 41037 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence028 45 119 gene locus_tag LOCUS_t00200 45 119 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 193 693 gene locus_tag LOCUS_18350 193 693 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EB5 protein_id gnl|my_center|LOCUS_18350 766 2259 gene locus_tag LOCUS_18360 766 2259 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_18360 2256 3680 gene locus_tag LOCUS_18370 2256 3680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_18370 5330 3717 gene locus_tag LOCUS_18380 gene purH 5330 3717 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D3 protein_id gnl|my_center|LOCUS_18380 5521 5928 gene locus_tag LOCUS_18390 5521 5928 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086934.1 protein_id gnl|my_center|LOCUS_18390 8006 6120 gene locus_tag LOCUS_18400 8006 6120 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 protein_id gnl|my_center|LOCUS_18400 8730 8068 gene locus_tag LOCUS_18410 8730 8068 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_18410 9865 8849 gene locus_tag LOCUS_18420 9865 8849 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640348.1 protein_id gnl|my_center|LOCUS_18420 10659 9862 gene locus_tag LOCUS_18430 10659 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 11575 10820 gene locus_tag LOCUS_18440 11575 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 12979 11645 gene locus_tag LOCUS_18450 gene sun 12979 11645 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_18450 13899 13039 gene locus_tag LOCUS_18460 gene htpX 13899 13039 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UED6 protein_id gnl|my_center|LOCUS_18460 13999 14205 gene locus_tag LOCUS_18470 13999 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 14477 15208 gene locus_tag LOCUS_18480 14477 15208 CDS product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_18480 15324 16826 gene locus_tag LOCUS_18490 15324 16826 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202532.1 protein_id gnl|my_center|LOCUS_18490 17096 16902 gene locus_tag LOCUS_18500 17096 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 17250 17744 gene locus_tag LOCUS_18510 17250 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 19831 17873 gene locus_tag LOCUS_18520 gene acsA 19831 17873 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WV5 protein_id gnl|my_center|LOCUS_18520 21798 20059 gene locus_tag LOCUS_18530 21798 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22187 22933 gene locus_tag LOCUS_18540 22187 22933 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_18540 23003 23227 gene locus_tag LOCUS_18550 23003 23227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 23231 23620 gene locus_tag LOCUS_18560 gene doc 23231 23620 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_18560 24658 24299 gene locus_tag LOCUS_18570 24658 24299 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917957.1 protein_id gnl|my_center|LOCUS_18570 25080 24655 gene locus_tag LOCUS_18580 25080 24655 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 protein_id gnl|my_center|LOCUS_18580 25385 25101 gene locus_tag LOCUS_18590 25385 25101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709695.1 protein_id gnl|my_center|LOCUS_18590 26426 25425 gene locus_tag LOCUS_18600 gene gpsA 26426 25425 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 protein_id gnl|my_center|LOCUS_18600 26534 27142 gene locus_tag LOCUS_18610 26534 27142 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974635.1 protein_id gnl|my_center|LOCUS_18610 27580 27705 gene locus_tag LOCUS_18620 27580 27705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 28730 27831 gene locus_tag LOCUS_18630 28730 27831 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_18630 29841 28753 gene locus_tag LOCUS_18640 gene tsaD 29841 28753 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF2 protein_id gnl|my_center|LOCUS_18640 30218 30006 gene locus_tag LOCUS_18650 30218 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 30120 30899 gene locus_tag LOCUS_18660 gene hemC 30120 30899 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_18660 30908 31621 gene locus_tag LOCUS_18670 30908 31621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 31703 33007 gene locus_tag LOCUS_18680 31703 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 33016 34575 gene locus_tag LOCUS_18690 33016 34575 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083393.1 protein_id gnl|my_center|LOCUS_18690 34569 35615 gene locus_tag LOCUS_18700 34569 35615 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_18700 35720 35795 gene locus_tag LOCUS_t00210 35720 35795 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37120 35912 gene locus_tag LOCUS_18710 37120 35912 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089997.1 protein_id gnl|my_center|LOCUS_18710 37320 38192 gene locus_tag LOCUS_18720 37320 38192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 38189 39907 gene locus_tag LOCUS_18730 38189 39907 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 protein_id gnl|my_center|LOCUS_18730 40049 40504 gene locus_tag LOCUS_18740 40049 40504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087647.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence029 698 51 gene locus_tag LOCUS_18750 698 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_18750 876 1874 gene locus_tag LOCUS_18760 876 1874 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388122.1 protein_id gnl|my_center|LOCUS_18760 1888 2847 gene locus_tag LOCUS_18770 1888 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_18770 2866 5685 gene locus_tag LOCUS_18780 2866 5685 CDS product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_18780 5682 7757 gene locus_tag LOCUS_18790 5682 7757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_18790 8003 8719 gene locus_tag LOCUS_18800 8003 8719 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267626.1 protein_id gnl|my_center|LOCUS_18800 8716 9588 gene locus_tag LOCUS_18810 8716 9588 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 protein_id gnl|my_center|LOCUS_18810 9600 10562 gene locus_tag LOCUS_18820 9600 10562 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_18820 11134 10610 gene locus_tag LOCUS_18830 11134 10610 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_18830 11508 12422 gene locus_tag LOCUS_18840 11508 12422 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_18840 13389 12475 gene locus_tag LOCUS_18850 13389 12475 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_18850 13545 14156 gene locus_tag LOCUS_18860 13545 14156 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMU2 protein_id gnl|my_center|LOCUS_18860 14202 15200 gene locus_tag LOCUS_18870 14202 15200 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_18870 15581 15213 gene locus_tag LOCUS_18880 15581 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 15778 17205 gene locus_tag LOCUS_18890 15778 17205 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_18890 17422 18156 gene locus_tag LOCUS_18900 17422 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 18207 19082 gene locus_tag LOCUS_18910 18207 19082 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_18910 19280 19777 gene locus_tag LOCUS_18920 19280 19777 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_18920 19789 20334 gene locus_tag LOCUS_18930 19789 20334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 20331 20843 gene locus_tag LOCUS_18940 20331 20843 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_18940 21672 20848 gene locus_tag LOCUS_18950 21672 20848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_18950 21869 23002 gene locus_tag LOCUS_18960 21869 23002 CDS product DUF3066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_18960 23154 24050 gene locus_tag LOCUS_18970 23154 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 24209 25822 gene locus_tag LOCUS_18980 24209 25822 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_18980 26044 27237 gene locus_tag LOCUS_18990 26044 27237 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_18990 27319 28458 gene locus_tag LOCUS_19000 27319 28458 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_19000 28614 28874 gene locus_tag LOCUS_19010 28614 28874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 29116 28835 gene locus_tag LOCUS_19020 29116 28835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 29284 29487 gene locus_tag LOCUS_19030 gene cspA 29284 29487 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_19030 29766 30974 gene locus_tag LOCUS_19040 29766 30974 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_19040 30971 31951 gene locus_tag LOCUS_19050 30971 31951 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_19050 32125 31979 gene locus_tag LOCUS_19060 32125 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 32274 32900 gene locus_tag LOCUS_19070 32274 32900 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_19070 33557 32910 gene locus_tag LOCUS_19080 33557 32910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 33822 33574 gene locus_tag LOCUS_19090 33822 33574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 33852 34199 gene locus_tag LOCUS_19100 33852 34199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 34196 34420 gene locus_tag LOCUS_19110 34196 34420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 35365 34430 gene locus_tag LOCUS_19120 35365 34430 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_19120 35467 36054 gene locus_tag LOCUS_19130 gene pksA 35467 36054 CDS product HTH-type transcriptional regulator PksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34381 protein_id gnl|my_center|LOCUS_19130 36066 36725 gene locus_tag LOCUS_19140 gene rluA 36066 36725 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_19140 37003 36722 gene locus_tag LOCUS_19150 37003 36722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 37456 37097 gene locus_tag LOCUS_19160 37456 37097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 37874 39019 gene locus_tag LOCUS_19170 37874 39019 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707734.1 protein_id gnl|my_center|LOCUS_19170 39343 39023 gene locus_tag LOCUS_19180 39343 39023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence030 1203 295 gene locus_tag LOCUS_19190 1203 295 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257720.1 protein_id gnl|my_center|LOCUS_19190 3555 1309 gene locus_tag LOCUS_19200 gene parC 3555 1309 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THH2 protein_id gnl|my_center|LOCUS_19200 4385 3657 gene locus_tag LOCUS_19210 gene recO 4385 3657 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ0 protein_id gnl|my_center|LOCUS_19210 4836 4486 gene locus_tag LOCUS_19220 4836 4486 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_19220 5753 4839 gene locus_tag LOCUS_19230 gene era 5753 4839 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 protein_id gnl|my_center|LOCUS_19230 6458 5835 gene locus_tag LOCUS_19240 gene rnc 6458 5835 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_19240 7264 6506 gene locus_tag LOCUS_19250 gene sipF 7264 6506 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K52 protein_id gnl|my_center|LOCUS_19250 7745 7344 gene locus_tag LOCUS_19260 gene acpS 7745 7344 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ6 protein_id gnl|my_center|LOCUS_19260 8557 7742 gene locus_tag LOCUS_19270 gene pdxJ 8557 7742 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_19270 9177 8554 gene locus_tag LOCUS_19280 9177 8554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 protein_id gnl|my_center|LOCUS_19280 9774 9190 gene locus_tag LOCUS_19290 gene pyrE 9774 9190 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 protein_id gnl|my_center|LOCUS_19290 11967 9817 gene locus_tag LOCUS_19300 11967 9817 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_19300 12576 12151 gene locus_tag LOCUS_19310 gene rpoZ 12576 12151 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH70 protein_id gnl|my_center|LOCUS_19310 13225 12683 gene locus_tag LOCUS_19320 13225 12683 CDS product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_19320 13370 13987 gene locus_tag LOCUS_19330 13370 13987 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_19330 14022 14663 gene locus_tag LOCUS_19340 14022 14663 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_19340 15157 14660 gene locus_tag LOCUS_19350 gene smpB 15157 14660 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8R6 protein_id gnl|my_center|LOCUS_19350 16058 15183 gene locus_tag LOCUS_19360 gene dapA 16058 15183 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 protein_id gnl|my_center|LOCUS_19360 16413 18674 gene locus_tag LOCUS_19370 16413 18674 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087833.1 protein_id gnl|my_center|LOCUS_19370 18717 19637 gene locus_tag LOCUS_19380 18717 19637 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 protein_id gnl|my_center|LOCUS_19380 20614 19775 gene locus_tag LOCUS_19390 20614 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 21413 20601 gene locus_tag LOCUS_19400 21413 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 23014 21899 gene locus_tag LOCUS_19410 23014 21899 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 protein_id gnl|my_center|LOCUS_19410 23784 23356 gene locus_tag LOCUS_19420 23784 23356 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_19420 23875 24273 gene locus_tag LOCUS_19430 23875 24273 CDS product mercury transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294667.1 protein_id gnl|my_center|LOCUS_19430 24295 24642 gene locus_tag LOCUS_19440 24295 24642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 24903 26333 gene locus_tag LOCUS_19450 gene merA 24903 26333 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 protein_id gnl|my_center|LOCUS_19450 26338 26556 gene locus_tag LOCUS_19460 26338 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 26925 27440 gene locus_tag LOCUS_19470 26925 27440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19470 28148 30343 gene locus_tag LOCUS_19480 gene nosR 28148 30343 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_19480 30361 32301 gene locus_tag LOCUS_19490 gene nosZ 30361 32301 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ6 protein_id gnl|my_center|LOCUS_19490 32314 33648 gene locus_tag LOCUS_19500 32314 33648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 33614 34513 gene locus_tag LOCUS_19510 gene nosF 33614 34513 CDS product copper ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_19510 34510 35331 gene locus_tag LOCUS_19520 gene nosY 34510 35331 CDS product NosY permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967625.1 protein_id gnl|my_center|LOCUS_19520 35328 35900 gene locus_tag LOCUS_19530 gene nosL 35328 35900 CDS product NosL copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_19530 35902 36816 gene locus_tag LOCUS_19540 gene nosX 35902 36816 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Z49 protein_id gnl|my_center|LOCUS_19540 37078 36896 gene locus_tag LOCUS_19550 37078 36896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence031 581 2305 gene locus_tag LOCUS_19560 gene argS 581 2305 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J281 protein_id gnl|my_center|LOCUS_19560 2305 3093 gene locus_tag LOCUS_19570 2305 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3090 4103 gene locus_tag LOCUS_19580 3090 4103 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 protein_id gnl|my_center|LOCUS_19580 4249 5163 gene locus_tag LOCUS_19590 4249 5163 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969278.1 protein_id gnl|my_center|LOCUS_19590 5160 5981 gene locus_tag LOCUS_19600 5160 5981 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB5 protein_id gnl|my_center|LOCUS_19600 6193 6420 gene locus_tag LOCUS_19610 6193 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6493 7044 gene locus_tag LOCUS_19620 6493 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 7041 7874 gene locus_tag LOCUS_19630 gene tatC 7041 7874 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KZ9 protein_id gnl|my_center|LOCUS_19630 8007 9314 gene locus_tag LOCUS_19640 gene serS 8007 9314 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q22 protein_id gnl|my_center|LOCUS_19640 9307 10164 gene locus_tag LOCUS_19650 gene surE 9307 10164 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 protein_id gnl|my_center|LOCUS_19650 10194 10844 gene locus_tag LOCUS_19660 gene pcm 10194 10844 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_19660 10845 11846 gene locus_tag LOCUS_19670 10845 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 12703 11843 gene locus_tag LOCUS_19680 12703 11843 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_19680 12951 13265 gene locus_tag LOCUS_19690 12951 13265 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534584.1 protein_id gnl|my_center|LOCUS_19690 13306 14913 gene locus_tag LOCUS_19700 13306 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19700 14936 15886 gene locus_tag LOCUS_19710 14936 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19710 15890 16264 gene locus_tag LOCUS_19720 15890 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_19720 16390 17004 gene locus_tag LOCUS_19730 16390 17004 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_19730 17074 17937 gene locus_tag LOCUS_19740 gene crtB 17074 17937 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971712.1 protein_id gnl|my_center|LOCUS_19740 18477 17938 gene locus_tag LOCUS_19750 18477 17938 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_19750 19893 18481 gene locus_tag LOCUS_19760 gene trmFO 19893 18481 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_19760 21349 19922 gene locus_tag LOCUS_19770 gene gatA 21349 19922 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_19770 22857 21430 gene locus_tag LOCUS_19780 gene gatA 22857 21430 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_19780 25051 22928 gene locus_tag LOCUS_19790 25051 22928 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_19790 28234 25130 gene locus_tag LOCUS_19800 gene uvrA 28234 25130 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB22 protein_id gnl|my_center|LOCUS_19800 28419 28679 gene locus_tag LOCUS_19810 28419 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 28772 29263 gene locus_tag LOCUS_19820 28772 29263 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8V6 protein_id gnl|my_center|LOCUS_19820 29304 30194 gene locus_tag LOCUS_19830 29304 30194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099950.1 protein_id gnl|my_center|LOCUS_19830 30439 33300 gene locus_tag LOCUS_19840 gene gyrA 30439 33300 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L52 protein_id gnl|my_center|LOCUS_19840 33309 33815 gene locus_tag LOCUS_19850 gene coaD 33309 33815 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L55 protein_id gnl|my_center|LOCUS_19850 33853 34389 gene locus_tag LOCUS_19860 33853 34389 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK3 protein_id gnl|my_center|LOCUS_19860 34431 34904 gene locus_tag LOCUS_19870 gene ppiB 34431 34904 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_19870 35031 36089 gene locus_tag LOCUS_19880 gene queA 35031 36089 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB05 protein_id gnl|my_center|LOCUS_19880 36086 37225 gene locus_tag LOCUS_19890 gene tgt 36086 37225 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB03 protein_id gnl|my_center|LOCUS_19890 37393 37467 gene locus_tag LOCUS_t00220 37393 37467 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 1416 394 gene locus_tag LOCUS_19900 gene asd 1416 394 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWX8 protein_id gnl|my_center|LOCUS_19900 2610 1504 gene locus_tag LOCUS_19910 gene leuB 2610 1504 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KY8 protein_id gnl|my_center|LOCUS_19910 3345 2740 gene locus_tag LOCUS_19920 gene leuD 3345 2740 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THU7 protein_id gnl|my_center|LOCUS_19920 4801 3356 gene locus_tag LOCUS_19930 gene leuC 4801 3356 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9V0 protein_id gnl|my_center|LOCUS_19930 5330 4938 gene locus_tag LOCUS_19940 gene rplS 5330 4938 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X35 protein_id gnl|my_center|LOCUS_19940 6140 5427 gene locus_tag LOCUS_19950 gene trmD 6140 5427 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_19950 6700 6137 gene locus_tag LOCUS_19960 gene rimM 6700 6137 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV58 protein_id gnl|my_center|LOCUS_19960 7114 6707 gene locus_tag LOCUS_19970 7114 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 8736 7189 gene locus_tag LOCUS_19980 gene ffh 8736 7189 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG5 protein_id gnl|my_center|LOCUS_19980 8976 9218 gene locus_tag LOCUS_19990 8976 9218 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFG9 protein_id gnl|my_center|LOCUS_19990 9219 9605 gene locus_tag LOCUS_20000 9219 9605 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_20000 10077 9589 gene locus_tag LOCUS_20010 10077 9589 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919960.1 protein_id gnl|my_center|LOCUS_20010 10913 10077 gene locus_tag LOCUS_20020 10913 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 11016 11897 gene locus_tag LOCUS_20030 gene dapF 11016 11897 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X45 protein_id gnl|my_center|LOCUS_20030 11894 13168 gene locus_tag LOCUS_20040 11894 13168 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_20040 13165 14130 gene locus_tag LOCUS_20050 13165 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 14197 14832 gene locus_tag LOCUS_20060 14197 14832 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE36 protein_id gnl|my_center|LOCUS_20060 16485 14860 gene locus_tag LOCUS_20070 16485 14860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204900.1 protein_id gnl|my_center|LOCUS_20070 17087 16581 gene locus_tag LOCUS_20080 17087 16581 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_20080 17644 18108 gene locus_tag LOCUS_20090 17644 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 18695 18135 gene locus_tag LOCUS_20100 gene cycY 18695 18135 CDS product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30960 protein_id gnl|my_center|LOCUS_20100 18895 18692 gene locus_tag LOCUS_20110 18895 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 19667 18900 gene locus_tag LOCUS_20120 gene cycZ 19667 18900 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30962 protein_id gnl|my_center|LOCUS_20120 20444 19767 gene locus_tag LOCUS_20130 gene ccmB 20444 19767 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5F1 protein_id gnl|my_center|LOCUS_20130 21025 20441 gene locus_tag LOCUS_20140 gene ccmA 21025 20441 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30963 protein_id gnl|my_center|LOCUS_20140 21860 21057 gene locus_tag LOCUS_20150 21860 21057 CDS product putative enoyl-coa hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704585.1 protein_id gnl|my_center|LOCUS_20150 22379 22137 gene locus_tag LOCUS_20160 22379 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 22360 25380 gene locus_tag LOCUS_20170 gene acnA 22360 25380 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L56 protein_id gnl|my_center|LOCUS_20170 26643 25501 gene locus_tag LOCUS_20180 26643 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 28582 26648 gene locus_tag LOCUS_20190 28582 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_20190 29321 28587 gene locus_tag LOCUS_20200 29321 28587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_20200 30301 29318 gene locus_tag LOCUS_20210 30301 29318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_20210 30907 31329 gene locus_tag LOCUS_20220 30907 31329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 32174 31413 gene locus_tag LOCUS_20230 32174 31413 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970505.1 protein_id gnl|my_center|LOCUS_20230 34943 32364 gene locus_tag LOCUS_20240 34943 32364 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067282.1 protein_id gnl|my_center|LOCUS_20240 35632 34940 gene locus_tag LOCUS_20250 35632 34940 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 protein_id gnl|my_center|LOCUS_20250 35731 36456 gene locus_tag LOCUS_20260 35731 36456 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence033 714 283 gene locus_tag LOCUS_20270 714 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1296 919 gene locus_tag LOCUS_20280 1296 919 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_20280 1754 1353 gene locus_tag LOCUS_20290 1754 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2541 1999 gene locus_tag LOCUS_20300 2541 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2862 4082 gene locus_tag LOCUS_20310 2862 4082 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 protein_id gnl|my_center|LOCUS_20310 4262 4702 gene locus_tag LOCUS_20320 4262 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_20320 6045 4843 gene locus_tag LOCUS_20330 6045 4843 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_20330 6557 6096 gene locus_tag LOCUS_20340 6557 6096 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 protein_id gnl|my_center|LOCUS_20340 7792 6581 gene locus_tag LOCUS_20350 7792 6581 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_20350 8076 9902 gene locus_tag LOCUS_20360 8076 9902 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090889.1 protein_id gnl|my_center|LOCUS_20360 9998 10768 gene locus_tag LOCUS_20370 9998 10768 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085812.1 protein_id gnl|my_center|LOCUS_20370 11513 10773 gene locus_tag LOCUS_20380 11513 10773 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 protein_id gnl|my_center|LOCUS_20380 12495 11521 gene locus_tag LOCUS_20390 gene pip 12495 11521 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 protein_id gnl|my_center|LOCUS_20390 12729 14810 gene locus_tag LOCUS_20400 12729 14810 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2R4 protein_id gnl|my_center|LOCUS_20400 14990 15949 gene locus_tag LOCUS_20410 14990 15949 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD35 protein_id gnl|my_center|LOCUS_20410 15985 16413 gene locus_tag LOCUS_20420 15985 16413 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528627.1 protein_id gnl|my_center|LOCUS_20420 16580 16927 gene locus_tag LOCUS_20430 gene hup 16580 16927 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 protein_id gnl|my_center|LOCUS_20430 17028 18020 gene locus_tag LOCUS_20440 17028 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 18465 18118 gene locus_tag LOCUS_20450 18465 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 18374 19285 gene locus_tag LOCUS_20460 18374 19285 CDS product cobalamin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_20460 19282 20286 gene locus_tag LOCUS_20470 19282 20286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_20470 20286 21080 gene locus_tag LOCUS_20480 20286 21080 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_20480 21251 22558 gene locus_tag LOCUS_20490 21251 22558 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 protein_id gnl|my_center|LOCUS_20490 23393 22635 gene locus_tag LOCUS_20500 23393 22635 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709267.1 protein_id gnl|my_center|LOCUS_20500 23596 24267 gene locus_tag LOCUS_20510 23596 24267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 24272 25429 gene locus_tag LOCUS_20520 24272 25429 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_20520 26336 25599 gene locus_tag LOCUS_20530 26336 25599 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_20530 26917 26843 gene locus_tag LOCUS_t00230 26917 26843 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27151 27327 gene locus_tag LOCUS_20540 27151 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 27482 28759 gene locus_tag LOCUS_20550 gene murA 27482 28759 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHW9 protein_id gnl|my_center|LOCUS_20550 28779 29219 gene locus_tag LOCUS_20560 28779 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_20560 29372 30667 gene locus_tag LOCUS_20570 gene hisD1 29372 30667 CDS product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S26 protein_id gnl|my_center|LOCUS_20570 30779 31309 gene locus_tag LOCUS_20580 30779 31309 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX3 protein_id gnl|my_center|LOCUS_20580 31313 31810 gene locus_tag LOCUS_20590 31313 31810 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_20590 31888 32613 gene locus_tag LOCUS_20600 31888 32613 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869321.1 protein_id gnl|my_center|LOCUS_20600 32735 32953 gene locus_tag LOCUS_20610 gene infA 32735 32953 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Z0 protein_id gnl|my_center|LOCUS_20610 32961 33560 gene locus_tag LOCUS_20620 32961 33560 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V5 protein_id gnl|my_center|LOCUS_20620 33683 35203 gene locus_tag LOCUS_20630 33683 35203 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364105.1 protein_id gnl|my_center|LOCUS_20630 35213 35452 gene locus_tag LOCUS_20640 35213 35452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 35574 35649 gene locus_tag LOCUS_t00240 35574 35649 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 617 237 gene locus_tag LOCUS_20650 617 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1141 722 gene locus_tag LOCUS_20660 1141 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1311 2483 gene locus_tag LOCUS_20670 1311 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_20670 2599 3096 gene locus_tag LOCUS_20680 2599 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3086 3283 gene locus_tag LOCUS_20690 3086 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4507 3353 gene locus_tag LOCUS_20700 gene lldD 4507 3353 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A943 protein_id gnl|my_center|LOCUS_20700 5503 4721 gene locus_tag LOCUS_20710 5503 4721 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_20710 6193 5699 gene locus_tag LOCUS_20720 6193 5699 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_20720 6280 7023 gene locus_tag LOCUS_20730 6280 7023 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_20730 7402 8742 gene locus_tag LOCUS_20740 7402 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_20740 9248 8961 gene locus_tag LOCUS_20750 9248 8961 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088373.1 protein_id gnl|my_center|LOCUS_20750 10743 9331 gene locus_tag LOCUS_20760 10743 9331 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707063.1 protein_id gnl|my_center|LOCUS_20760 10916 11203 gene locus_tag LOCUS_20770 10916 11203 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_20770 12672 11302 gene locus_tag LOCUS_20780 12672 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 13295 14176 gene locus_tag LOCUS_20790 13295 14176 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_20790 15172 14192 gene locus_tag LOCUS_20800 15172 14192 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX96 protein_id gnl|my_center|LOCUS_20800 15260 17041 gene locus_tag LOCUS_20810 gene mmgC 15260 17041 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_20810 17169 18224 gene locus_tag LOCUS_20820 17169 18224 CDS product zinc metallohydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_20820 18279 19208 gene locus_tag LOCUS_20830 18279 19208 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_20830 19247 19507 gene locus_tag LOCUS_20840 gene xseB 19247 19507 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T828 protein_id gnl|my_center|LOCUS_20840 19527 20432 gene locus_tag LOCUS_20850 19527 20432 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_20850 20526 22475 gene locus_tag LOCUS_20860 gene dxs 20526 22475 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T825 protein_id gnl|my_center|LOCUS_20860 22482 23228 gene locus_tag LOCUS_20870 22482 23228 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974694.1 protein_id gnl|my_center|LOCUS_20870 23218 24465 gene locus_tag LOCUS_20880 23218 24465 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 protein_id gnl|my_center|LOCUS_20880 25636 24542 gene locus_tag LOCUS_20890 gene aroC 25636 24542 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY1 protein_id gnl|my_center|LOCUS_20890 26571 25732 gene locus_tag LOCUS_20900 gene fabI 26571 25732 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX9 protein_id gnl|my_center|LOCUS_20900 27585 26701 gene locus_tag LOCUS_20910 27585 26701 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706153.1 protein_id gnl|my_center|LOCUS_20910 28358 27654 gene locus_tag LOCUS_20920 28358 27654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 28877 28389 gene locus_tag LOCUS_20930 gene omp 28877 28389 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_20930 29027 29650 gene locus_tag LOCUS_20940 gene pdxH 29027 29650 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHC2 protein_id gnl|my_center|LOCUS_20940 29706 30644 gene locus_tag LOCUS_20950 29706 30644 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_20950 30657 32234 gene locus_tag LOCUS_20960 30657 32234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918804.1 protein_id gnl|my_center|LOCUS_20960 32279 33034 gene locus_tag LOCUS_20970 gene fixR 32279 33034 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_20970 33545 33123 gene locus_tag LOCUS_20980 33545 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 <34955 33555 gene locus_tag LOCUS_20990 <34955 33555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975253.1:aspartate aminotransferase family protein >Feature sequence035 78 154 gene locus_tag LOCUS_t00250 78 154 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 665 1714 gene locus_tag LOCUS_21000 665 1714 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538255.1 protein_id gnl|my_center|LOCUS_21000 2107 1724 gene locus_tag LOCUS_21010 2107 1724 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_21010 3416 2175 gene locus_tag LOCUS_21020 3416 2175 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_21020 3585 4241 gene locus_tag LOCUS_21030 3585 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 6359 4362 gene locus_tag LOCUS_21040 6359 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_21040 7348 6413 gene locus_tag LOCUS_21050 7348 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 8755 7940 gene locus_tag LOCUS_21060 8755 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 9890 8844 gene locus_tag LOCUS_21070 gene oruR 9890 8844 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_21070 10017 10871 gene locus_tag LOCUS_21080 10017 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_21080 10916 12331 gene locus_tag LOCUS_21090 10916 12331 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_21090 12503 12913 gene locus_tag LOCUS_21100 12503 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 12874 13149 gene locus_tag LOCUS_21110 12874 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 13471 14247 gene locus_tag LOCUS_21120 13471 14247 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_21120 16437 14296 gene locus_tag LOCUS_21130 16437 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 16870 16448 gene locus_tag LOCUS_21140 16870 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 17243 16968 gene locus_tag LOCUS_21150 17243 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 17678 17421 gene locus_tag LOCUS_21160 17678 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 18392 17691 gene locus_tag LOCUS_21170 18392 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 19330 18389 gene locus_tag LOCUS_21180 gene tadC 19330 18389 CDS product type II secretion system protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103955.1 protein_id gnl|my_center|LOCUS_21180 20271 19345 gene locus_tag LOCUS_21190 20271 19345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 21504 20287 gene locus_tag LOCUS_21200 21504 20287 CDS product type II/IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939399.1 protein_id gnl|my_center|LOCUS_21200 22712 21510 gene locus_tag LOCUS_21210 22712 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 24105 22720 gene locus_tag LOCUS_21220 24105 22720 CDS product exported fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 protein_id gnl|my_center|LOCUS_21220 25047 24151 gene locus_tag LOCUS_21230 25047 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 25712 27388 gene locus_tag LOCUS_21240 25712 27388 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203914.1 protein_id gnl|my_center|LOCUS_21240 28506 27496 gene locus_tag LOCUS_21250 28506 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 28820 28503 gene locus_tag LOCUS_21260 28820 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 28864 30402 gene locus_tag LOCUS_21270 28864 30402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 30511 30894 gene locus_tag LOCUS_21280 30511 30894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 31050 31424 gene locus_tag LOCUS_21290 31050 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 31513 31983 gene locus_tag LOCUS_21300 31513 31983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 32539 32027 gene locus_tag LOCUS_21310 32539 32027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 33325 33600 gene locus_tag LOCUS_21320 33325 33600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence036 <1 1322 gene locus_tag LOCUS_21330 <1 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WIT3:L-gulono-1,4-lactone dehydrogenase 1550 1326 gene locus_tag LOCUS_21340 gene madF 1550 1326 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_21340 3123 1588 gene locus_tag LOCUS_21350 3123 1588 CDS product carboxyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811623.1 protein_id gnl|my_center|LOCUS_21350 4339 3221 gene locus_tag LOCUS_21360 gene modC 4339 3221 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCD5 protein_id gnl|my_center|LOCUS_21360 5055 4336 gene locus_tag LOCUS_21370 gene modB 5055 4336 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_21370 5848 5063 gene locus_tag LOCUS_21380 gene modA 5848 5063 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101994.1 protein_id gnl|my_center|LOCUS_21380 7029 5866 gene locus_tag LOCUS_21390 gene metC 7029 5866 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_21390 7260 8366 gene locus_tag LOCUS_21400 7260 8366 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_21400 8419 9573 gene locus_tag LOCUS_21410 8419 9573 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_21410 9577 10686 gene locus_tag LOCUS_21420 9577 10686 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_21420 10697 11476 gene locus_tag LOCUS_21430 gene aapP 10697 11476 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707870.1 protein_id gnl|my_center|LOCUS_21430 11679 11834 gene locus_tag LOCUS_21440 11679 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21440 12501 11983 gene locus_tag LOCUS_21450 12501 11983 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_21450 13385 12540 gene locus_tag LOCUS_21460 13385 12540 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_21460 14414 13416 gene locus_tag LOCUS_21470 gene cysK 14414 13416 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_21470 15134 14520 gene locus_tag LOCUS_21480 gene nudF 15134 14520 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_21480 15341 15766 gene locus_tag LOCUS_21490 15341 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 15884 17101 gene locus_tag LOCUS_21500 15884 17101 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_21500 17098 18684 gene locus_tag LOCUS_21510 17098 18684 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_21510 18681 21842 gene locus_tag LOCUS_21520 18681 21842 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_21520 22309 21845 gene locus_tag LOCUS_21530 22309 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 22424 23737 gene locus_tag LOCUS_21540 22424 23737 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_21540 24135 23872 gene locus_tag LOCUS_21550 24135 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 24468 24190 gene locus_tag LOCUS_21560 24468 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 25282 24542 gene locus_tag LOCUS_21570 25282 24542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 27159 25282 gene locus_tag LOCUS_21580 gene pcoA 27159 25282 CDS product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_21580 28026 27211 gene locus_tag LOCUS_21590 28026 27211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 28561 28133 gene locus_tag LOCUS_21600 28561 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 28929 28612 gene locus_tag LOCUS_21610 28929 28612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 30056 29151 gene locus_tag LOCUS_21620 30056 29151 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087752.1 protein_id gnl|my_center|LOCUS_21620 31015 30233 gene locus_tag LOCUS_21630 31015 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence037 1002 1364 gene locus_tag LOCUS_21640 1002 1364 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_21640 1499 2089 gene locus_tag LOCUS_21650 1499 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2086 2871 gene locus_tag LOCUS_21660 2086 2871 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087529.1 protein_id gnl|my_center|LOCUS_21660 4389 2875 gene locus_tag LOCUS_21670 4389 2875 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IN3 protein_id gnl|my_center|LOCUS_21670 4592 4975 gene locus_tag LOCUS_21680 4592 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5871 4984 gene locus_tag LOCUS_21690 5871 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 7636 5888 gene locus_tag LOCUS_21700 gene ilvD 7636 5888 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_21700 7830 8915 gene locus_tag LOCUS_21710 7830 8915 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_21710 9031 9270 gene locus_tag LOCUS_21720 9031 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 12008 9279 gene locus_tag LOCUS_21730 gene valS 12008 9279 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8N3 protein_id gnl|my_center|LOCUS_21730 12841 12137 gene locus_tag LOCUS_21740 12841 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 14412 12994 gene locus_tag LOCUS_21750 14412 12994 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_21750 15242 14580 gene locus_tag LOCUS_21760 15242 14580 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_21760 15513 15586 gene locus_tag LOCUS_t00260 15513 15586 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16982 15657 gene locus_tag LOCUS_21770 16982 15657 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971489.1 protein_id gnl|my_center|LOCUS_21770 18129 16984 gene locus_tag LOCUS_21780 18129 16984 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087736.1 protein_id gnl|my_center|LOCUS_21780 18770 18204 gene locus_tag LOCUS_21790 18770 18204 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529250.1 protein_id gnl|my_center|LOCUS_21790 19019 21235 gene locus_tag LOCUS_21800 gene exoP 19019 21235 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973526.1 protein_id gnl|my_center|LOCUS_21800 22156 21245 gene locus_tag LOCUS_21810 22156 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 23475 22204 gene locus_tag LOCUS_21820 23475 22204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_21820 24866 23472 gene locus_tag LOCUS_21830 24866 23472 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 protein_id gnl|my_center|LOCUS_21830 26152 24863 gene locus_tag LOCUS_21840 26152 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 26299 27375 gene locus_tag LOCUS_21850 26299 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_21850 27387 27566 gene locus_tag LOCUS_21860 27387 27566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 27787 27861 gene locus_tag LOCUS_t00270 27787 27861 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 28015 28368 gene locus_tag LOCUS_21870 28015 28368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 28666 29406 gene locus_tag LOCUS_21880 28666 29406 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_21880 29735 29550 gene locus_tag LOCUS_21890 29735 29550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence038 140 1015 gene locus_tag LOCUS_21900 140 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1382 1158 gene locus_tag LOCUS_21910 1382 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1264 1596 gene locus_tag LOCUS_21920 1264 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2424 1606 gene locus_tag LOCUS_21930 2424 1606 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_21930 3293 2421 gene locus_tag LOCUS_21940 3293 2421 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_21940 4867 3311 gene locus_tag LOCUS_21950 gene metG 4867 3311 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_21950 6185 4986 gene locus_tag LOCUS_21960 6185 4986 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338405.1 protein_id gnl|my_center|LOCUS_21960 6938 6219 gene locus_tag LOCUS_21970 6938 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7710 7078 gene locus_tag LOCUS_21980 gene tmk 7710 7078 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ9 protein_id gnl|my_center|LOCUS_21980 8866 7715 gene locus_tag LOCUS_21990 8866 7715 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_21990 9901 8903 gene locus_tag LOCUS_22000 9901 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_22000 10109 11482 gene locus_tag LOCUS_22010 10109 11482 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_22010 11767 11504 gene locus_tag LOCUS_22020 11767 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 14131 12428 gene locus_tag LOCUS_22030 gene norB 14131 12428 CDS product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085999.1 protein_id gnl|my_center|LOCUS_22030 15099 14128 gene locus_tag LOCUS_22040 15099 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 15302 15096 gene locus_tag LOCUS_22050 15302 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 15557 16015 gene locus_tag LOCUS_22060 15557 16015 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191066.1 protein_id gnl|my_center|LOCUS_22060 16319 16101 gene locus_tag LOCUS_22070 16319 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 17963 16647 gene locus_tag LOCUS_22080 17963 16647 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_22080 18233 18036 gene locus_tag LOCUS_22090 18233 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 19414 18242 gene locus_tag LOCUS_22100 19414 18242 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_22100 19753 20877 gene locus_tag LOCUS_22110 19753 20877 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089764.1 protein_id gnl|my_center|LOCUS_22110 20891 21637 gene locus_tag LOCUS_22120 gene adc1 20891 21637 CDS product putative acetoacetate decarboxylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89CN4 protein_id gnl|my_center|LOCUS_22120 21684 22466 gene locus_tag LOCUS_22130 gene bdhA 21684 22466 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 protein_id gnl|my_center|LOCUS_22130 23678 22575 gene locus_tag LOCUS_22140 23678 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66504 protein_id gnl|my_center|LOCUS_22140 23977 24339 gene locus_tag LOCUS_22150 23977 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 24339 26552 gene locus_tag LOCUS_22160 24339 26552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 26549 27448 gene locus_tag LOCUS_22170 gene nuoH 26549 27448 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJU3 protein_id gnl|my_center|LOCUS_22170 27445 27969 gene locus_tag LOCUS_22180 27445 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 27966 28277 gene locus_tag LOCUS_22190 gene nuoK 27966 28277 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED3 protein_id gnl|my_center|LOCUS_22190 >Feature sequence039 1289 321 gene locus_tag LOCUS_22200 1289 321 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_22200 2389 1286 gene locus_tag LOCUS_22210 gene hisC2 2389 1286 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL9 protein_id gnl|my_center|LOCUS_22210 3293 2397 gene locus_tag LOCUS_22220 3293 2397 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_22220 3525 4730 gene locus_tag LOCUS_22230 gene metX 3525 4730 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_22230 4727 5353 gene locus_tag LOCUS_22240 4727 5353 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_22240 6110 5358 gene locus_tag LOCUS_22250 6110 5358 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_22250 6266 7036 gene locus_tag LOCUS_22260 gene gloB 6266 7036 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK2 protein_id gnl|my_center|LOCUS_22260 7038 7475 gene locus_tag LOCUS_22270 7038 7475 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970112.1 protein_id gnl|my_center|LOCUS_22270 7598 8536 gene locus_tag LOCUS_22280 7598 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 8546 9190 gene locus_tag LOCUS_22290 8546 9190 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390267.1 protein_id gnl|my_center|LOCUS_22290 9979 9254 gene locus_tag LOCUS_22300 9979 9254 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 protein_id gnl|my_center|LOCUS_22300 11258 10068 gene locus_tag LOCUS_22310 gene atoB 11258 10068 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083058.1 protein_id gnl|my_center|LOCUS_22310 11538 12152 gene locus_tag LOCUS_22320 11538 12152 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_22320 13952 12171 gene locus_tag LOCUS_22330 13952 12171 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083772.1 protein_id gnl|my_center|LOCUS_22330 14153 14551 gene locus_tag LOCUS_22340 14153 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 16160 14571 gene locus_tag LOCUS_22350 16160 14571 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_22350 16530 16168 gene locus_tag LOCUS_22360 16530 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918395.1 protein_id gnl|my_center|LOCUS_22360 17351 16536 gene locus_tag LOCUS_22370 17351 16536 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_22370 18528 17416 gene locus_tag LOCUS_22380 18528 17416 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE45 protein_id gnl|my_center|LOCUS_22380 19344 18541 gene locus_tag LOCUS_22390 19344 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 19510 20589 gene locus_tag LOCUS_22400 19510 20589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 20618 22060 gene locus_tag LOCUS_22410 gene pabB 20618 22060 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084887.1 protein_id gnl|my_center|LOCUS_22410 22057 22656 gene locus_tag LOCUS_22420 22057 22656 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_22420 22653 23501 gene locus_tag LOCUS_22430 22653 23501 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920789.1 protein_id gnl|my_center|LOCUS_22430 23895 23503 gene locus_tag LOCUS_22440 23895 23503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918358.1 protein_id gnl|my_center|LOCUS_22440 24032 25117 gene locus_tag LOCUS_22450 24032 25117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_22450 25368 25186 gene locus_tag LOCUS_22460 gene rpmF 25368 25186 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE65 protein_id gnl|my_center|LOCUS_22460 26159 25572 gene locus_tag LOCUS_22470 26159 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 27421 26303 gene locus_tag LOCUS_22480 gene ald 27421 26303 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX09 protein_id gnl|my_center|LOCUS_22480 27860 27609 gene locus_tag LOCUS_22490 27860 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence040 1390 731 gene locus_tag LOCUS_22500 1390 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2590 1718 gene locus_tag LOCUS_22510 2590 1718 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 protein_id gnl|my_center|LOCUS_22510 2719 3888 gene locus_tag LOCUS_22520 2719 3888 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_22520 4059 5036 gene locus_tag LOCUS_22530 4059 5036 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_22530 6772 5087 gene locus_tag LOCUS_22540 6772 5087 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_22540 7000 6821 gene locus_tag LOCUS_22550 7000 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 8313 7057 gene locus_tag LOCUS_22560 8313 7057 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_22560 8628 9365 gene locus_tag LOCUS_22570 8628 9365 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084311.1 protein_id gnl|my_center|LOCUS_22570 9551 11446 gene locus_tag LOCUS_22580 9551 11446 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 protein_id gnl|my_center|LOCUS_22580 12291 11479 gene locus_tag LOCUS_22590 12291 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 13460 12360 gene locus_tag LOCUS_22600 13460 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_22600 13841 13521 gene locus_tag LOCUS_22610 gene fdx 13841 13521 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_22610 14158 14514 gene locus_tag LOCUS_22620 14158 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 18741 14533 gene locus_tag LOCUS_22630 18741 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 20645 18741 gene locus_tag LOCUS_22640 20645 18741 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_22640 21311 21994 gene locus_tag LOCUS_22650 21311 21994 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 protein_id gnl|my_center|LOCUS_22650 22901 22008 gene locus_tag LOCUS_22660 22901 22008 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_22660 23501 22983 gene locus_tag LOCUS_22670 23501 22983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 24406 23516 gene locus_tag LOCUS_22680 24406 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_22680 24512 25144 gene locus_tag LOCUS_22690 24512 25144 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_22690 25492 25190 gene locus_tag LOCUS_22700 25492 25190 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529770.1 protein_id gnl|my_center|LOCUS_22700 26359 25508 gene locus_tag LOCUS_22710 26359 25508 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 protein_id gnl|my_center|LOCUS_22710 26530 26673 gene locus_tag LOCUS_22720 26530 26673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 26695 27882 gene locus_tag LOCUS_22730 gene phoR 26695 27882 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence041 25 564 gene locus_tag LOCUS_22740 25 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 858 1430 gene locus_tag LOCUS_22750 858 1430 CDS product putative adenosine monophosphate-protein transferase y4lH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55548 protein_id gnl|my_center|LOCUS_22750 1612 1536 gene locus_tag LOCUS_t00280 1612 1536 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2448 1771 gene locus_tag LOCUS_22760 gene PmtA 2448 1771 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_22760 3762 2539 gene locus_tag LOCUS_22770 gene mnmA 3762 2539 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ES7 protein_id gnl|my_center|LOCUS_22770 4044 5573 gene locus_tag LOCUS_22780 4044 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5593 6273 gene locus_tag LOCUS_22790 gene flgD 5593 6273 CDS product flagellar hook assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_773637.2 protein_id gnl|my_center|LOCUS_22790 6366 6680 gene locus_tag LOCUS_22800 6366 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_22800 6963 8630 gene locus_tag LOCUS_22810 6963 8630 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ6 protein_id gnl|my_center|LOCUS_22810 8642 9667 gene locus_tag LOCUS_22820 gene fliG 8642 9667 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6V1 protein_id gnl|my_center|LOCUS_22820 9700 10380 gene locus_tag LOCUS_22830 gene fliH 9700 10380 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_22830 10408 10758 gene locus_tag LOCUS_22840 10408 10758 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_22840 10826 12193 gene locus_tag LOCUS_22850 gene flbD 10826 12193 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 protein_id gnl|my_center|LOCUS_22850 12230 14365 gene locus_tag LOCUS_22860 gene flhA 12230 14365 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084995.1 protein_id gnl|my_center|LOCUS_22860 14724 15047 gene locus_tag LOCUS_22870 14724 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 15614 15129 gene locus_tag LOCUS_22880 15614 15129 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59562 protein_id gnl|my_center|LOCUS_22880 16108 15698 gene locus_tag LOCUS_22890 16108 15698 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_22890 17535 16108 gene locus_tag LOCUS_22900 gene fliI 17535 16108 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 protein_id gnl|my_center|LOCUS_22900 17826 18533 gene locus_tag LOCUS_22910 gene ctrA 17826 18533 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527557.1 protein_id gnl|my_center|LOCUS_22910 19291 18629 gene locus_tag LOCUS_22920 19291 18629 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084981.1 protein_id gnl|my_center|LOCUS_22920 19442 20254 gene locus_tag LOCUS_22930 19442 20254 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_22930 20949 20599 gene locus_tag LOCUS_22940 20949 20599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760346.1 protein_id gnl|my_center|LOCUS_22940 21188 20958 gene locus_tag LOCUS_22950 21188 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 23281 21185 gene locus_tag LOCUS_22960 23281 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 23404 24108 gene locus_tag LOCUS_22970 23404 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 24251 24967 gene locus_tag LOCUS_22980 24251 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 25057 25467 gene locus_tag LOCUS_22990 25057 25467 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143050.1 protein_id gnl|my_center|LOCUS_22990 25583 25508 gene locus_tag LOCUS_t00290 25583 25508 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 26474 26166 gene locus_tag LOCUS_23000 26474 26166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 26581 27708 gene locus_tag LOCUS_23010 gene rluD 26581 27708 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MA7 protein_id gnl|my_center|LOCUS_23010 >Feature sequence042 <1 1071 gene locus_tag LOCUS_23020 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389348.1:acyl-CoA synthetase 1338 1162 gene locus_tag LOCUS_23030 1338 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1448 2125 gene locus_tag LOCUS_23040 gene ubiX 1448 2125 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PF2 protein_id gnl|my_center|LOCUS_23040 2213 2419 gene locus_tag LOCUS_23050 2213 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_23050 3214 2504 gene locus_tag LOCUS_23060 gene dgcA 3214 2504 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_23060 3400 5265 gene locus_tag LOCUS_23070 3400 5265 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640264.1 protein_id gnl|my_center|LOCUS_23070 7965 5296 gene locus_tag LOCUS_23080 7965 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 8364 8825 gene locus_tag LOCUS_23090 gene purE 8364 8825 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIL3 protein_id gnl|my_center|LOCUS_23090 8925 10043 gene locus_tag LOCUS_23100 gene purK 8925 10043 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 protein_id gnl|my_center|LOCUS_23100 10129 10761 gene locus_tag LOCUS_23110 10129 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 11492 10758 gene locus_tag LOCUS_23120 11492 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_23120 12075 11485 gene locus_tag LOCUS_23130 gene def 12075 11485 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK0 protein_id gnl|my_center|LOCUS_23130 12308 12529 gene locus_tag LOCUS_23140 gene rpsU 12308 12529 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UD53 protein_id gnl|my_center|LOCUS_23140 13657 12653 gene locus_tag LOCUS_23150 13657 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701235.1 protein_id gnl|my_center|LOCUS_23150 14048 13668 gene locus_tag LOCUS_23160 14048 13668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 14215 14949 gene locus_tag LOCUS_23170 14215 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 15435 14953 gene locus_tag LOCUS_23180 15435 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 15787 15437 gene locus_tag LOCUS_23190 15787 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 16201 15878 gene locus_tag LOCUS_23200 16201 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 17812 16406 gene locus_tag LOCUS_23210 17812 16406 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3A1 protein_id gnl|my_center|LOCUS_23210 18143 17826 gene locus_tag LOCUS_23220 18143 17826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 19276 18143 gene locus_tag LOCUS_23230 gene pntA 19276 18143 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089863.1 protein_id gnl|my_center|LOCUS_23230 19551 19408 gene locus_tag LOCUS_23240 19551 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 20686 19703 gene locus_tag LOCUS_23250 20686 19703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_23250 21126 20683 gene locus_tag LOCUS_23260 21126 20683 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_23260 22593 21211 gene locus_tag LOCUS_23270 22593 21211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_23270 24458 22590 gene locus_tag LOCUS_23280 gene pepF 24458 22590 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970197.1 protein_id gnl|my_center|LOCUS_23280 25464 24628 gene locus_tag LOCUS_23290 25464 24628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 25833 27350 gene locus_tag LOCUS_23300 25833 27350 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529737.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence043 421 2832 gene locus_tag LOCUS_23310 421 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3532 4881 gene locus_tag LOCUS_23320 3532 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_23320 5055 6425 gene locus_tag LOCUS_23330 5055 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_23330 6768 7784 gene locus_tag LOCUS_23340 6768 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_23340 7920 8723 gene locus_tag LOCUS_23350 7920 8723 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_23350 8832 10025 gene locus_tag LOCUS_23360 8832 10025 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_23360 10107 10907 gene locus_tag LOCUS_23370 10107 10907 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_23370 11109 11034 gene locus_tag LOCUS_t00300 11109 11034 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11376 11678 gene locus_tag LOCUS_23380 11376 11678 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_23380 11686 12012 gene locus_tag LOCUS_23390 11686 12012 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH5 protein_id gnl|my_center|LOCUS_23390 12169 13077 gene locus_tag LOCUS_23400 gene folD 12169 13077 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4A3 protein_id gnl|my_center|LOCUS_23400 13088 14104 gene locus_tag LOCUS_23410 13088 14104 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031473.1 protein_id gnl|my_center|LOCUS_23410 14106 15599 gene locus_tag LOCUS_23420 14106 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 16884 15655 gene locus_tag LOCUS_23430 gene argG 16884 15655 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 protein_id gnl|my_center|LOCUS_23430 17004 17198 gene locus_tag LOCUS_23440 17004 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 17504 17178 gene locus_tag LOCUS_23450 17504 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772705.1 protein_id gnl|my_center|LOCUS_23450 18736 17525 gene locus_tag LOCUS_23460 gene rlmN 18736 17525 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWI1 protein_id gnl|my_center|LOCUS_23460 19448 18861 gene locus_tag LOCUS_23470 19448 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_23470 19769 20773 gene locus_tag LOCUS_23480 19769 20773 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_23480 20824 21546 gene locus_tag LOCUS_23490 20824 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 21626 22852 gene locus_tag LOCUS_23500 21626 22852 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_23500 23285 22854 gene locus_tag LOCUS_23510 23285 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918012.1 protein_id gnl|my_center|LOCUS_23510 23543 24325 gene locus_tag LOCUS_23520 23543 24325 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_23520 24836 24501 gene locus_tag LOCUS_23530 24836 24501 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_23530 24935 25342 gene locus_tag LOCUS_23540 24935 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_23540 25898 25350 gene locus_tag LOCUS_23550 gene ligT 25898 25350 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWH9 protein_id gnl|my_center|LOCUS_23550 >Feature sequence044 1651 3291 gene locus_tag LOCUS_23560 1651 3291 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_23560 3364 4104 gene locus_tag LOCUS_23570 3364 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 5013 4108 gene locus_tag LOCUS_23580 5013 4108 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_23580 6655 5084 gene locus_tag LOCUS_23590 6655 5084 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_23590 7644 6652 gene locus_tag LOCUS_23600 7644 6652 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088998.1 protein_id gnl|my_center|LOCUS_23600 8223 7735 gene locus_tag LOCUS_23610 8223 7735 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_23610 10003 8453 gene locus_tag LOCUS_23620 10003 8453 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_23620 10329 10523 gene locus_tag LOCUS_23630 10329 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 11865 10630 gene locus_tag LOCUS_23640 11865 10630 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878820.1 protein_id gnl|my_center|LOCUS_23640 12874 12035 gene locus_tag LOCUS_23650 12874 12035 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_23650 12961 13806 gene locus_tag LOCUS_23660 12961 13806 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_23660 15847 13874 gene locus_tag LOCUS_23670 15847 13874 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388247.1 protein_id gnl|my_center|LOCUS_23670 16905 16270 gene locus_tag LOCUS_23680 16905 16270 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 protein_id gnl|my_center|LOCUS_23680 17174 17098 gene locus_tag LOCUS_t00310 17174 17098 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17356 17430 gene locus_tag LOCUS_t00320 17356 17430 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17943 18257 gene locus_tag LOCUS_23690 17943 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 18795 18607 gene locus_tag LOCUS_23700 18795 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 20710 19841 gene locus_tag LOCUS_23710 gene aguB 20710 19841 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_23710 20852 20703 gene locus_tag LOCUS_23720 20852 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 21058 22077 gene locus_tag LOCUS_23730 gene ptcA 21058 22077 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MSR6 protein_id gnl|my_center|LOCUS_23730 22122 23525 gene locus_tag LOCUS_23740 22122 23525 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 protein_id gnl|my_center|LOCUS_23740 23615 24715 gene locus_tag LOCUS_23750 gene aguA1 23615 24715 CDS product putative agmatine deiminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAS5 protein_id gnl|my_center|LOCUS_23750 24793 25650 gene locus_tag LOCUS_23760 gene arcC-2 24793 25650 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG5 protein_id gnl|my_center|LOCUS_23760 >Feature sequence045 1494 313 gene locus_tag LOCUS_23770 1494 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3489 1876 gene locus_tag LOCUS_23780 gene flbA 3489 1876 CDS product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 protein_id gnl|my_center|LOCUS_23780 4072 3596 gene locus_tag LOCUS_23790 4072 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4404 4069 gene locus_tag LOCUS_23800 4404 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 5555 4404 gene locus_tag LOCUS_23810 gene flgI1 5555 4404 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I01 protein_id gnl|my_center|LOCUS_23810 5846 6286 gene locus_tag LOCUS_23820 gene fliX 5846 6286 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32348 protein_id gnl|my_center|LOCUS_23820 6438 6854 gene locus_tag LOCUS_23830 gene dksA 6438 6854 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC05 protein_id gnl|my_center|LOCUS_23830 7073 6873 gene locus_tag LOCUS_23840 7073 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 7635 7399 gene locus_tag LOCUS_23850 7635 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 8545 7808 gene locus_tag LOCUS_23860 gene flgH1 8545 7808 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 protein_id gnl|my_center|LOCUS_23860 9574 8576 gene locus_tag LOCUS_23870 gene flgA 9574 8576 CDS product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_23870 10372 9587 gene locus_tag LOCUS_23880 10372 9587 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF5 protein_id gnl|my_center|LOCUS_23880 11146 10415 gene locus_tag LOCUS_23890 11146 10415 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF6 protein_id gnl|my_center|LOCUS_23890 11495 11998 gene locus_tag LOCUS_23900 11495 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 12024 13136 gene locus_tag LOCUS_23910 gene fliM 12024 13136 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 protein_id gnl|my_center|LOCUS_23910 13133 13624 gene locus_tag LOCUS_23920 13133 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 13639 14463 gene locus_tag LOCUS_23930 13639 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088566.1 protein_id gnl|my_center|LOCUS_23930 14575 18039 gene locus_tag LOCUS_23940 14575 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088560.1 protein_id gnl|my_center|LOCUS_23940 18864 18061 gene locus_tag LOCUS_23950 gene fliP 18864 18061 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C588 protein_id gnl|my_center|LOCUS_23950 19250 18861 gene locus_tag LOCUS_23960 19250 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 19510 19938 gene locus_tag LOCUS_23970 gene flgB 19510 19938 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I25 protein_id gnl|my_center|LOCUS_23970 19962 20381 gene locus_tag LOCUS_23980 gene flgC 19962 20381 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I26 protein_id gnl|my_center|LOCUS_23980 20396 20716 gene locus_tag LOCUS_23990 gene fliE 20396 20716 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8E1 protein_id gnl|my_center|LOCUS_23990 20751 21014 gene locus_tag LOCUS_24000 gene fliQ 20751 21014 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_24000 21034 21795 gene locus_tag LOCUS_24010 gene fliR 21034 21795 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 protein_id gnl|my_center|LOCUS_24010 21811 22887 gene locus_tag LOCUS_24020 gene flhB 21811 22887 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_24020 23077 22856 gene locus_tag LOCUS_24030 23077 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence046 547 861 gene locus_tag LOCUS_24040 547 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 866 2830 gene locus_tag LOCUS_24050 gene thrS 866 2830 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_24050 2932 4773 gene locus_tag LOCUS_24060 2932 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5569 4775 gene locus_tag LOCUS_24070 5569 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919085.1 protein_id gnl|my_center|LOCUS_24070 5715 6299 gene locus_tag LOCUS_24080 5715 6299 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975233.1 protein_id gnl|my_center|LOCUS_24080 6591 6304 gene locus_tag LOCUS_24090 6591 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 6697 7416 gene locus_tag LOCUS_24100 6697 7416 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707007.1 protein_id gnl|my_center|LOCUS_24100 8898 7456 gene locus_tag LOCUS_24110 8898 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 9953 9030 gene locus_tag LOCUS_24120 9953 9030 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088162.1 protein_id gnl|my_center|LOCUS_24120 10823 9969 gene locus_tag LOCUS_24130 10823 9969 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_24130 11291 10827 gene locus_tag LOCUS_24140 11291 10827 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_24140 11438 12607 gene locus_tag LOCUS_24150 11438 12607 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063903.1 protein_id gnl|my_center|LOCUS_24150 12620 13027 gene locus_tag LOCUS_24160 12620 13027 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 protein_id gnl|my_center|LOCUS_24160 13184 13567 gene locus_tag LOCUS_24170 13184 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 15135 13717 gene locus_tag LOCUS_24180 15135 13717 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_24180 15314 16342 gene locus_tag LOCUS_24190 15314 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 17224 16355 gene locus_tag LOCUS_24200 17224 16355 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_24200 18505 17309 gene locus_tag LOCUS_24210 18505 17309 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_24210 18735 19871 gene locus_tag LOCUS_24220 18735 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088267.1 protein_id gnl|my_center|LOCUS_24220 19961 21175 gene locus_tag LOCUS_24230 gene paaJ 19961 21175 CDS product beta-ketoadipyl CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545612.1 protein_id gnl|my_center|LOCUS_24230 22432 21212 gene locus_tag LOCUS_24240 22432 21212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 22580 23413 gene locus_tag LOCUS_24250 22580 23413 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_24250 23455 23542 gene locus_tag LOCUS_t00330 23455 23542 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 24804 24037 gene locus_tag LOCUS_24260 gene nadK 24804 24037 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7K4 protein_id gnl|my_center|LOCUS_24260 >Feature sequence047 837 283 gene locus_tag LOCUS_24270 837 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1626 1159 gene locus_tag LOCUS_24280 1626 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2097 2306 gene locus_tag LOCUS_24290 2097 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2434 2784 gene locus_tag LOCUS_24300 2434 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_24300 2787 3086 gene locus_tag LOCUS_24310 2787 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3176 4414 gene locus_tag LOCUS_24320 3176 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 4852 6702 gene locus_tag LOCUS_24330 gene acd 4852 6702 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_24330 6831 7709 gene locus_tag LOCUS_24340 6831 7709 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_24340 7809 8744 gene locus_tag LOCUS_24350 7809 8744 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_24350 9953 9234 gene locus_tag LOCUS_24360 9953 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 10122 10322 gene locus_tag LOCUS_24370 10122 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 11641 10520 gene locus_tag LOCUS_24380 11641 10520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_24380 12716 11808 gene locus_tag LOCUS_24390 12716 11808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_24390 13626 12721 gene locus_tag LOCUS_24400 gene lipg 13626 12721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_24400 13787 14434 gene locus_tag LOCUS_24410 13787 14434 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_24410 15256 14486 gene locus_tag LOCUS_24420 15256 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 15436 17157 gene locus_tag LOCUS_24430 gene glpA 15436 17157 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_24430 17154 18104 gene locus_tag LOCUS_24440 17154 18104 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_24440 18192 19862 gene locus_tag LOCUS_24450 18192 19862 CDS product alkylglycerone-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500125.1 protein_id gnl|my_center|LOCUS_24450 21656 20022 gene locus_tag LOCUS_24460 21656 20022 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387925.1 protein_id gnl|my_center|LOCUS_24460 21689 21883 gene locus_tag LOCUS_24470 21689 21883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 21935 22714 gene locus_tag LOCUS_24480 21935 22714 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888133.1 protein_id gnl|my_center|LOCUS_24480 23729 22788 gene locus_tag LOCUS_24490 23729 22788 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_24490 24064 23858 gene locus_tag LOCUS_24500 24064 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 <24976 24268 gene locus_tag LOCUS_24510 <24976 24268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089892.1:glucose 1-dehydrogenase >Feature sequence048 1870 2835 gene locus_tag LOCUS_24520 gene prfB 1870 2835 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ76 protein_id gnl|my_center|LOCUS_24520 3733 3194 gene locus_tag LOCUS_24530 3733 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 5141 3762 gene locus_tag LOCUS_24540 5141 3762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087096.1 protein_id gnl|my_center|LOCUS_24540 6032 5457 gene locus_tag LOCUS_24550 6032 5457 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_24550 6320 9895 gene locus_tag LOCUS_24560 6320 9895 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969432.1 protein_id gnl|my_center|LOCUS_24560 10013 11125 gene locus_tag LOCUS_24570 10013 11125 CDS product DUF3066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_24570 12384 11284 gene locus_tag LOCUS_24580 gene yqiG 12384 11284 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_24580 13715 12453 gene locus_tag LOCUS_24590 gene tyrS 13715 12453 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGB4 protein_id gnl|my_center|LOCUS_24590 13825 14949 gene locus_tag LOCUS_24600 gene anmK 13825 14949 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89M62 protein_id gnl|my_center|LOCUS_24600 15665 15009 gene locus_tag LOCUS_24610 15665 15009 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_24610 15986 16465 gene locus_tag LOCUS_24620 15986 16465 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_24620 16522 17730 gene locus_tag LOCUS_24630 16522 17730 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_24630 17732 19180 gene locus_tag LOCUS_24640 17732 19180 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087111.1 protein_id gnl|my_center|LOCUS_24640 19253 20002 gene locus_tag LOCUS_24650 19253 20002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087112.1 protein_id gnl|my_center|LOCUS_24650 19999 21321 gene locus_tag LOCUS_24660 19999 21321 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_24660 21318 22562 gene locus_tag LOCUS_24670 21318 22562 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGA5 protein_id gnl|my_center|LOCUS_24670 22573 22965 gene locus_tag LOCUS_24680 22573 22965 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969429.1 protein_id gnl|my_center|LOCUS_24680 23007 23336 gene locus_tag LOCUS_24690 23007 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_24690 23343 23750 gene locus_tag LOCUS_24700 23343 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence049 1436 624 gene locus_tag LOCUS_24710 1436 624 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_24710 1697 2704 gene locus_tag LOCUS_24720 1697 2704 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_24720 4969 2726 gene locus_tag LOCUS_24730 4969 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 5238 5630 gene locus_tag LOCUS_24740 5238 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5638 7095 gene locus_tag LOCUS_24750 5638 7095 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 protein_id gnl|my_center|LOCUS_24750 7883 7197 gene locus_tag LOCUS_24760 7883 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 9710 8070 gene locus_tag LOCUS_24770 9710 8070 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815792.1 protein_id gnl|my_center|LOCUS_24770 10234 9707 gene locus_tag LOCUS_24780 10234 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 10337 11005 gene locus_tag LOCUS_24790 10337 11005 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_24790 11087 12220 gene locus_tag LOCUS_24800 11087 12220 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_24800 12289 12867 gene locus_tag LOCUS_24810 gene gmhA 12289 12867 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJT7 protein_id gnl|my_center|LOCUS_24810 13700 12858 gene locus_tag LOCUS_24820 13700 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 15203 13704 gene locus_tag LOCUS_24830 gene hldE 15203 13704 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_24830 15324 15956 gene locus_tag LOCUS_24840 gene hisB 15324 15956 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125469.1 protein_id gnl|my_center|LOCUS_24840 16138 15953 gene locus_tag LOCUS_24850 16138 15953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 16907 16194 gene locus_tag LOCUS_24860 16907 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 17174 19135 gene locus_tag LOCUS_24870 17174 19135 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_24870 19227 20675 gene locus_tag LOCUS_24880 19227 20675 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064178.1 protein_id gnl|my_center|LOCUS_24880 20803 21075 gene locus_tag LOCUS_24890 20803 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 21085 21585 gene locus_tag LOCUS_24900 21085 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 21591 22097 gene locus_tag LOCUS_24910 21591 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 23232 22135 gene locus_tag LOCUS_24920 23232 22135 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085596.1 protein_id gnl|my_center|LOCUS_24920 23584 23315 gene locus_tag LOCUS_24930 23584 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence050 2 985 gene locus_tag LOCUS_24940 2 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1020 1256 gene locus_tag LOCUS_24950 1020 1256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_24950 1288 1626 gene locus_tag LOCUS_24960 1288 1626 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD75 protein_id gnl|my_center|LOCUS_24960 2421 1753 gene locus_tag LOCUS_24970 gene rpsD 2421 1753 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J446 protein_id gnl|my_center|LOCUS_24970 3981 2575 gene locus_tag LOCUS_24980 3981 2575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_24980 5423 4104 gene locus_tag LOCUS_24990 5423 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_24990 7239 5485 gene locus_tag LOCUS_25000 7239 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_25000 8742 7276 gene locus_tag LOCUS_25010 8742 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 9616 8726 gene locus_tag LOCUS_25020 9616 8726 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269057.1 protein_id gnl|my_center|LOCUS_25020 10365 9613 gene locus_tag LOCUS_25030 gene ucpA1 10365 9613 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_25030 10705 10355 gene locus_tag LOCUS_25040 10705 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975561.1 protein_id gnl|my_center|LOCUS_25040 11819 10707 gene locus_tag LOCUS_25050 11819 10707 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_25050 12699 11806 gene locus_tag LOCUS_25060 12699 11806 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_25060 13730 12696 gene locus_tag LOCUS_25070 13730 12696 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_25070 14746 13919 gene locus_tag LOCUS_25080 gene kdgR 14746 13919 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039141.1 protein_id gnl|my_center|LOCUS_25080 14937 16214 gene locus_tag LOCUS_25090 14937 16214 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_25090 16977 16189 gene locus_tag LOCUS_25100 gene trmJ 16977 16189 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_25100 17173 18393 gene locus_tag LOCUS_25110 gene icd 17173 18393 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD89 protein_id gnl|my_center|LOCUS_25110 21119 18438 gene locus_tag LOCUS_25120 gene alaS 21119 18438 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI0 protein_id gnl|my_center|LOCUS_25120 22530 21415 gene locus_tag LOCUS_25130 gene recA 22530 21415 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG98 protein_id gnl|my_center|LOCUS_25130 >Feature sequence051 1671 283 gene locus_tag LOCUS_25140 1671 283 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 protein_id gnl|my_center|LOCUS_25140 2506 1658 gene locus_tag LOCUS_25150 2506 1658 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533989.1 protein_id gnl|my_center|LOCUS_25150 3346 2609 gene locus_tag LOCUS_25160 3346 2609 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9V7 protein_id gnl|my_center|LOCUS_25160 6016 3446 gene locus_tag LOCUS_25170 6016 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 7386 6142 gene locus_tag LOCUS_25180 7386 6142 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_25180 8992 7742 gene locus_tag LOCUS_25190 8992 7742 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_25190 10643 9300 gene locus_tag LOCUS_25200 gene amt-2 10643 9300 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_25200 11046 10708 gene locus_tag LOCUS_25210 11046 10708 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067257.1 protein_id gnl|my_center|LOCUS_25210 12764 11430 gene locus_tag LOCUS_25220 12764 11430 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIZ9 protein_id gnl|my_center|LOCUS_25220 13146 15401 gene locus_tag LOCUS_25230 13146 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 16818 15463 gene locus_tag LOCUS_25240 16818 15463 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140029.1 protein_id gnl|my_center|LOCUS_25240 16950 18179 gene locus_tag LOCUS_25250 16950 18179 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 protein_id gnl|my_center|LOCUS_25250 18586 18230 gene locus_tag LOCUS_25260 18586 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 protein_id gnl|my_center|LOCUS_25260 18838 18614 gene locus_tag LOCUS_25270 18838 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 19558 18875 gene locus_tag LOCUS_25280 19558 18875 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_25280 20486 19572 gene locus_tag LOCUS_25290 gene trxA 20486 19572 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_25290 21148 20615 gene locus_tag LOCUS_25300 21148 20615 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_25300 21306 21380 gene locus_tag LOCUS_t00340 21306 21380 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 331 1842 gene locus_tag LOCUS_25310 331 1842 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_25310 2020 2403 gene locus_tag LOCUS_25320 2020 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2431 3021 gene locus_tag LOCUS_25330 2431 3021 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C794 protein_id gnl|my_center|LOCUS_25330 3018 3356 gene locus_tag LOCUS_25340 3018 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3484 4680 gene locus_tag LOCUS_25350 gene alr 3484 4680 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MX2 protein_id gnl|my_center|LOCUS_25350 4677 5450 gene locus_tag LOCUS_25360 4677 5450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_25360 5462 6235 gene locus_tag LOCUS_25370 5462 6235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_25370 6332 7762 gene locus_tag LOCUS_25380 gene radA 6332 7762 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7F5 protein_id gnl|my_center|LOCUS_25380 7792 8463 gene locus_tag LOCUS_25390 7792 8463 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532527.1 protein_id gnl|my_center|LOCUS_25390 8491 10038 gene locus_tag LOCUS_25400 gene purF 8491 10038 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MY2 protein_id gnl|my_center|LOCUS_25400 10072 10791 gene locus_tag LOCUS_25410 10072 10791 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_25410 12247 10823 gene locus_tag LOCUS_25420 gene der 12247 10823 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y1 protein_id gnl|my_center|LOCUS_25420 13638 12268 gene locus_tag LOCUS_25430 13638 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 14415 13645 gene locus_tag LOCUS_25440 14415 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_25440 15380 14556 gene locus_tag LOCUS_25450 gene panB3 15380 14556 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MZ4 protein_id gnl|my_center|LOCUS_25450 16414 15641 gene locus_tag LOCUS_25460 16414 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 16959 16411 gene locus_tag LOCUS_25470 16959 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 17469 18164 gene locus_tag LOCUS_25480 17469 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25480 18088 18831 gene locus_tag LOCUS_25490 18088 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25490 20050 19070 gene locus_tag LOCUS_25500 20050 19070 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710161.1 protein_id gnl|my_center|LOCUS_25500 20413 20676 gene locus_tag LOCUS_25510 20413 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence053 666 1346 gene locus_tag LOCUS_25520 666 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3069 1423 gene locus_tag LOCUS_25530 3069 1423 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_25530 3401 4003 gene locus_tag LOCUS_25540 3401 4003 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088316.1 protein_id gnl|my_center|LOCUS_25540 4111 4818 gene locus_tag LOCUS_25550 4111 4818 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_25550 5288 5920 gene locus_tag LOCUS_25560 5288 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 6790 6017 gene locus_tag LOCUS_25570 gene fadB 6790 6017 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_25570 6990 7721 gene locus_tag LOCUS_25580 6990 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 7933 8358 gene locus_tag LOCUS_25590 7933 8358 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N4 protein_id gnl|my_center|LOCUS_25590 9588 8365 gene locus_tag LOCUS_25600 9588 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 10432 9611 gene locus_tag LOCUS_25610 10432 9611 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_25610 10967 10500 gene locus_tag LOCUS_25620 10967 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 11497 10967 gene locus_tag LOCUS_25630 11497 10967 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_25630 11737 12792 gene locus_tag LOCUS_25640 11737 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 13127 12816 gene locus_tag LOCUS_25650 13127 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 13535 13167 gene locus_tag LOCUS_25660 13535 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 13747 14511 gene locus_tag LOCUS_25670 13747 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 14751 14539 gene locus_tag LOCUS_25680 14751 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_25680 14982 15203 gene locus_tag LOCUS_25690 14982 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 16003 15200 gene locus_tag LOCUS_25700 16003 15200 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_25700 16153 16431 gene locus_tag LOCUS_25710 16153 16431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 16449 17720 gene locus_tag LOCUS_25720 16449 17720 CDS product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_25720 18554 17721 gene locus_tag LOCUS_25730 gene cysE 18554 17721 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088333.1 protein_id gnl|my_center|LOCUS_25730 18750 19559 gene locus_tag LOCUS_25740 18750 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence054 204 512 gene locus_tag LOCUS_25750 gene rpsJ 204 512 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_25750 551 1303 gene locus_tag LOCUS_25760 gene rplC 551 1303 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QH0 protein_id gnl|my_center|LOCUS_25760 1303 1923 gene locus_tag LOCUS_25770 gene rplD 1303 1923 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE19 protein_id gnl|my_center|LOCUS_25770 1920 2210 gene locus_tag LOCUS_25780 gene rplW 1920 2210 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J86 protein_id gnl|my_center|LOCUS_25780 2265 3104 gene locus_tag LOCUS_25790 gene rplB 2265 3104 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC7 protein_id gnl|my_center|LOCUS_25790 3116 3394 gene locus_tag LOCUS_25800 gene rpsS 3116 3394 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R8 protein_id gnl|my_center|LOCUS_25800 3398 3778 gene locus_tag LOCUS_25810 gene rplV 3398 3778 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE23 protein_id gnl|my_center|LOCUS_25810 3778 4491 gene locus_tag LOCUS_25820 gene rpsC 3778 4491 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J90 protein_id gnl|my_center|LOCUS_25820 4525 4938 gene locus_tag LOCUS_25830 gene rplP 4525 4938 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD1 protein_id gnl|my_center|LOCUS_25830 4992 5195 gene locus_tag LOCUS_25840 gene rpmC 4992 5195 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 protein_id gnl|my_center|LOCUS_25840 5208 5444 gene locus_tag LOCUS_25850 gene rpsQ 5208 5444 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE27 protein_id gnl|my_center|LOCUS_25850 5490 5858 gene locus_tag LOCUS_25860 gene rplN 5490 5858 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J94 protein_id gnl|my_center|LOCUS_25860 5858 6175 gene locus_tag LOCUS_25870 gene rplX 5858 6175 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_25870 6168 6725 gene locus_tag LOCUS_25880 gene rplE 6168 6725 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U871 protein_id gnl|my_center|LOCUS_25880 6768 7073 gene locus_tag LOCUS_25890 gene rpsN 6768 7073 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q9 protein_id gnl|my_center|LOCUS_25890 7085 7483 gene locus_tag LOCUS_25900 gene rpsH 7085 7483 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T9 protein_id gnl|my_center|LOCUS_25900 7531 8064 gene locus_tag LOCUS_25910 gene rplF 7531 8064 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD9 protein_id gnl|my_center|LOCUS_25910 8069 8434 gene locus_tag LOCUS_25920 gene rplR 8069 8434 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME0 protein_id gnl|my_center|LOCUS_25920 8447 9010 gene locus_tag LOCUS_25930 gene rpsE 8447 9010 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA1 protein_id gnl|my_center|LOCUS_25930 9024 9227 gene locus_tag LOCUS_25940 gene rpmD 9024 9227 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF2 protein_id gnl|my_center|LOCUS_25940 9268 9750 gene locus_tag LOCUS_25950 gene rplO 9268 9750 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE36 protein_id gnl|my_center|LOCUS_25950 9809 11140 gene locus_tag LOCUS_25960 gene prlA 9809 11140 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA4 protein_id gnl|my_center|LOCUS_25960 11137 11751 gene locus_tag LOCUS_25970 gene adk 11137 11751 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY1 protein_id gnl|my_center|LOCUS_25970 11906 12274 gene locus_tag LOCUS_25980 gene rpsM 11906 12274 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME6 protein_id gnl|my_center|LOCUS_25980 12346 12735 gene locus_tag LOCUS_25990 gene rpsK 12346 12735 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME7 protein_id gnl|my_center|LOCUS_25990 12907 13923 gene locus_tag LOCUS_26000 gene rpoA 12907 13923 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA7 protein_id gnl|my_center|LOCUS_26000 13980 14399 gene locus_tag LOCUS_26010 gene rplQ 13980 14399 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4G0 protein_id gnl|my_center|LOCUS_26010 14690 16204 gene locus_tag LOCUS_26020 14690 16204 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088124.1 protein_id gnl|my_center|LOCUS_26020 16683 16201 gene locus_tag LOCUS_26030 16683 16201 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_26030 17011 16805 gene locus_tag LOCUS_26040 17011 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 17337 17008 gene locus_tag LOCUS_26050 17337 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 17218 18495 gene locus_tag LOCUS_26060 17218 18495 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_26060 18492 18875 gene locus_tag LOCUS_26070 gene crcB 18492 18875 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_26070 18872 19864 gene locus_tag LOCUS_26080 18872 19864 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_26080 >Feature sequence055 2389 221 gene locus_tag LOCUS_26090 gene priA 2389 221 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S6 protein_id gnl|my_center|LOCUS_26090 2658 3314 gene locus_tag LOCUS_26100 gene tal 2658 3314 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK3 protein_id gnl|my_center|LOCUS_26100 3356 4096 gene locus_tag LOCUS_26110 3356 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26110 4069 5109 gene locus_tag LOCUS_26120 gene xerC 4069 5109 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC70 protein_id gnl|my_center|LOCUS_26120 6633 5242 gene locus_tag LOCUS_26130 gene lpdA 6633 5242 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X65 protein_id gnl|my_center|LOCUS_26130 8061 6781 gene locus_tag LOCUS_26140 gene sucB 8061 6781 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X64 protein_id gnl|my_center|LOCUS_26140 11290 8102 gene locus_tag LOCUS_26150 gene sucA 11290 8102 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 protein_id gnl|my_center|LOCUS_26150 12389 11514 gene locus_tag LOCUS_26160 12389 11514 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_26160 13558 12389 gene locus_tag LOCUS_26170 gene sucC 13558 12389 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ84 protein_id gnl|my_center|LOCUS_26170 14879 13806 gene locus_tag LOCUS_26180 14879 13806 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_26180 16074 15061 gene locus_tag LOCUS_26190 gene mdh 16074 15061 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EYJ6 protein_id gnl|my_center|LOCUS_26190 16458 17045 gene locus_tag LOCUS_26200 16458 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 18179 17058 gene locus_tag LOCUS_26210 18179 17058 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence056 683 3220 gene locus_tag LOCUS_26220 683 3220 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869728.1 protein_id gnl|my_center|LOCUS_26220 3220 4101 gene locus_tag LOCUS_26230 3220 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 4103 4963 gene locus_tag LOCUS_26240 4103 4963 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_26240 4979 5350 gene locus_tag LOCUS_26250 4979 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 6613 5489 gene locus_tag LOCUS_26260 6613 5489 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_26260 6798 7457 gene locus_tag LOCUS_26270 6798 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 8137 7454 gene locus_tag LOCUS_26280 8137 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 8893 8258 gene locus_tag LOCUS_26290 gene tag 8893 8258 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_26290 9782 8874 gene locus_tag LOCUS_26300 9782 8874 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_26300 9996 10967 gene locus_tag LOCUS_26310 9996 10967 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_26310 10964 12301 gene locus_tag LOCUS_26320 gene pyrC 10964 12301 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S50 protein_id gnl|my_center|LOCUS_26320 12713 12441 gene locus_tag LOCUS_26330 12713 12441 CDS product Usg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529022.1 protein_id gnl|my_center|LOCUS_26330 13065 14057 gene locus_tag LOCUS_26340 13065 14057 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 protein_id gnl|my_center|LOCUS_26340 14086 15933 gene locus_tag LOCUS_26350 14086 15933 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 protein_id gnl|my_center|LOCUS_26350 15967 16641 gene locus_tag LOCUS_26360 15967 16641 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_26360 16681 18225 gene locus_tag LOCUS_26370 16681 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence057 811 41 gene locus_tag LOCUS_26380 811 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1158 1082 gene locus_tag LOCUS_t00350 1158 1082 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1472 1164 gene locus_tag LOCUS_26390 1472 1164 CDS product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_26390 1712 1933 gene locus_tag LOCUS_26400 1712 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2108 2032 gene locus_tag LOCUS_t00360 2108 2032 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2613 2182 gene locus_tag LOCUS_26410 2613 2182 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_26410 3275 2712 gene locus_tag LOCUS_26420 gene cspA 3275 2712 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971879.1 protein_id gnl|my_center|LOCUS_26420 3629 4102 gene locus_tag LOCUS_26430 3629 4102 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_26430 4104 4394 gene locus_tag LOCUS_26440 4104 4394 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_26440 4394 4768 gene locus_tag LOCUS_26450 4394 4768 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_26450 4765 5334 gene locus_tag LOCUS_26460 4765 5334 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_26460 5339 5776 gene locus_tag LOCUS_26470 5339 5776 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_26470 5776 6198 gene locus_tag LOCUS_26480 5776 6198 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_26480 6198 7703 gene locus_tag LOCUS_26490 6198 7703 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_26490 7711 9219 gene locus_tag LOCUS_26500 7711 9219 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_26500 9216 9575 gene locus_tag LOCUS_26510 9216 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 9568 11262 gene locus_tag LOCUS_26520 9568 11262 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_26520 11326 11967 gene locus_tag LOCUS_26530 11326 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 12077 12541 gene locus_tag LOCUS_26540 12077 12541 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 protein_id gnl|my_center|LOCUS_26540 12589 14979 gene locus_tag LOCUS_26550 12589 14979 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531266.1 protein_id gnl|my_center|LOCUS_26550 14991 15788 gene locus_tag LOCUS_26560 gene cooxM 14991 15788 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_26560 15844 16755 gene locus_tag LOCUS_26570 15844 16755 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975640.1 protein_id gnl|my_center|LOCUS_26570 16757 17953 gene locus_tag LOCUS_26580 16757 17953 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence058 551 1345 gene locus_tag LOCUS_26590 551 1345 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_26590 1425 2288 gene locus_tag LOCUS_26600 1425 2288 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_26600 2695 2285 gene locus_tag LOCUS_26610 2695 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731300.1 protein_id gnl|my_center|LOCUS_26610 2806 3165 gene locus_tag LOCUS_26620 2806 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3289 4080 gene locus_tag LOCUS_26630 3289 4080 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_26630 4977 4231 gene locus_tag LOCUS_26640 4977 4231 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_26640 5139 6395 gene locus_tag LOCUS_26650 5139 6395 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_26650 7772 6405 gene locus_tag LOCUS_26660 7772 6405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919616.1 protein_id gnl|my_center|LOCUS_26660 8563 7811 gene locus_tag LOCUS_26670 8563 7811 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088335.1 protein_id gnl|my_center|LOCUS_26670 10007 8568 gene locus_tag LOCUS_26680 10007 8568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_26680 10241 10489 gene locus_tag LOCUS_26690 10241 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 protein_id gnl|my_center|LOCUS_26690 11348 10518 gene locus_tag LOCUS_26700 gene rkpH 11348 10518 CDS product ribitol type dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968672.1 protein_id gnl|my_center|LOCUS_26700 12975 11350 gene locus_tag LOCUS_26710 12975 11350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 protein_id gnl|my_center|LOCUS_26710 14735 13074 gene locus_tag LOCUS_26720 gene ilvD 14735 13074 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E3F3 protein_id gnl|my_center|LOCUS_26720 15011 14925 gene locus_tag LOCUS_t00370 15011 14925 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15380 15129 gene locus_tag LOCUS_26730 15380 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 16426 15644 gene locus_tag LOCUS_26740 16426 15644 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_26740 16688 17509 gene locus_tag LOCUS_26750 gene map1 16688 17509 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PL7 protein_id gnl|my_center|LOCUS_26750 >Feature sequence059 1253 72 gene locus_tag LOCUS_26760 1253 72 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_26760 1479 1697 gene locus_tag LOCUS_26770 1479 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1947 2234 gene locus_tag LOCUS_26780 1947 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2321 3397 gene locus_tag LOCUS_26790 2321 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3378 4052 gene locus_tag LOCUS_26800 3378 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 4101 4688 gene locus_tag LOCUS_26810 4101 4688 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_26810 5335 4685 gene locus_tag LOCUS_26820 5335 4685 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_26820 5487 6044 gene locus_tag LOCUS_26830 gene SigD 5487 6044 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087693.1 protein_id gnl|my_center|LOCUS_26830 6131 6715 gene locus_tag LOCUS_26840 6131 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 6752 7264 gene locus_tag LOCUS_26850 6752 7264 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_26850 7982 7284 gene locus_tag LOCUS_26860 7982 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 8119 9078 gene locus_tag LOCUS_26870 8119 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 9609 9127 gene locus_tag LOCUS_26880 9609 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_26880 10421 9645 gene locus_tag LOCUS_26890 10421 9645 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 protein_id gnl|my_center|LOCUS_26890 11319 10414 gene locus_tag LOCUS_26900 11319 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886669.1 protein_id gnl|my_center|LOCUS_26900 11560 11793 gene locus_tag LOCUS_26910 11560 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 11885 12343 gene locus_tag LOCUS_26920 11885 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 12413 13564 gene locus_tag LOCUS_26930 12413 13564 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_26930 13564 14679 gene locus_tag LOCUS_26940 gene pitA 13564 14679 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2L1 protein_id gnl|my_center|LOCUS_26940 14784 15008 gene locus_tag LOCUS_26950 14784 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 15483 15094 gene locus_tag LOCUS_26960 15483 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 15726 17381 gene locus_tag LOCUS_26970 15726 17381 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383668.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence060 799 206 gene locus_tag LOCUS_26980 799 206 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_26980 1531 986 gene locus_tag LOCUS_26990 1531 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2845 1541 gene locus_tag LOCUS_27000 2845 1541 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 protein_id gnl|my_center|LOCUS_27000 3537 2878 gene locus_tag LOCUS_27010 3537 2878 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_27010 4322 3615 gene locus_tag LOCUS_27020 4322 3615 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224791.1 protein_id gnl|my_center|LOCUS_27020 4431 5225 gene locus_tag LOCUS_27030 4431 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 5386 5745 gene locus_tag LOCUS_27040 5386 5745 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072437.1 protein_id gnl|my_center|LOCUS_27040 5742 6338 gene locus_tag LOCUS_27050 5742 6338 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_27050 6633 6346 gene locus_tag LOCUS_27060 6633 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 protein_id gnl|my_center|LOCUS_27060 6873 8675 gene locus_tag LOCUS_27070 6873 8675 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 protein_id gnl|my_center|LOCUS_27070 9976 8759 gene locus_tag LOCUS_27080 9976 8759 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701280.1 protein_id gnl|my_center|LOCUS_27080 10705 10058 gene locus_tag LOCUS_27090 10705 10058 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227922.1 protein_id gnl|my_center|LOCUS_27090 10874 11689 gene locus_tag LOCUS_27100 10874 11689 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_27100 12844 11768 gene locus_tag LOCUS_27110 12844 11768 CDS product hyaluronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_27110 13829 12897 gene locus_tag LOCUS_27120 13829 12897 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764106.1 protein_id gnl|my_center|LOCUS_27120 14624 13839 gene locus_tag LOCUS_27130 14624 13839 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_27130 14989 14690 gene locus_tag LOCUS_27140 14989 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 16332 15358 gene locus_tag LOCUS_27150 16332 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 17156 16437 gene locus_tag LOCUS_27160 17156 16437 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085044.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27160 >Feature sequence061 <1 924 gene locus_tag LOCUS_27170 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UBS0:glutamate 5-kinase 1044 2333 gene locus_tag LOCUS_27180 gene proA 1044 2333 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLY9 protein_id gnl|my_center|LOCUS_27180 2342 2944 gene locus_tag LOCUS_27190 gene nadD 2342 2944 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2X5 protein_id gnl|my_center|LOCUS_27190 2992 3540 gene locus_tag LOCUS_27200 gene rsfS 2992 3540 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCI2 protein_id gnl|my_center|LOCUS_27200 3620 4102 gene locus_tag LOCUS_27210 gene rlmH 3620 4102 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI5 protein_id gnl|my_center|LOCUS_27210 4259 5791 gene locus_tag LOCUS_27220 gene gpmI 4259 5791 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_27220 5784 7169 gene locus_tag LOCUS_27230 5784 7169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_27230 7170 8498 gene locus_tag LOCUS_27240 gene ctpA 7170 8498 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_27240 8537 9826 gene locus_tag LOCUS_27250 8537 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 9823 10377 gene locus_tag LOCUS_27260 gene rppH 9823 10377 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS8 protein_id gnl|my_center|LOCUS_27260 11238 10414 gene locus_tag LOCUS_27270 11238 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_27270 11838 11440 gene locus_tag LOCUS_27280 gene atpC 11838 11440 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL34 protein_id gnl|my_center|LOCUS_27280 13306 11870 gene locus_tag LOCUS_27290 gene atpD 13306 11870 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL33 protein_id gnl|my_center|LOCUS_27290 14224 13340 gene locus_tag LOCUS_27300 gene atpG 14224 13340 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL32 protein_id gnl|my_center|LOCUS_27300 15797 14268 gene locus_tag LOCUS_27310 gene atpA 15797 14268 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL31 protein_id gnl|my_center|LOCUS_27310 16327 15797 gene locus_tag LOCUS_27320 gene atpH 16327 15797 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 protein_id gnl|my_center|LOCUS_27320 >Feature sequence062 865 266 gene locus_tag LOCUS_27330 865 266 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_27330 1430 849 gene locus_tag LOCUS_27340 1430 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970823.1 protein_id gnl|my_center|LOCUS_27340 3287 1755 gene locus_tag LOCUS_27350 gene rpoN2 3287 1755 CDS product RNA polymerase sigma-54 factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30333 protein_id gnl|my_center|LOCUS_27350 4109 3315 gene locus_tag LOCUS_27360 4109 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 4775 4200 gene locus_tag LOCUS_27370 4775 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 5482 4775 gene locus_tag LOCUS_27380 5482 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 6235 5624 gene locus_tag LOCUS_27390 6235 5624 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_27390 6419 6333 gene locus_tag LOCUS_t00380 6419 6333 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6575 7582 gene locus_tag LOCUS_27400 6575 7582 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_27400 7592 8032 gene locus_tag LOCUS_27410 7592 8032 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_27410 8072 8752 gene locus_tag LOCUS_27420 8072 8752 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_27420 8757 9884 gene locus_tag LOCUS_27430 gene queG 8757 9884 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_27430 10630 9869 gene locus_tag LOCUS_27440 10630 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 10688 11584 gene locus_tag LOCUS_27450 10688 11584 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_27450 12408 11614 gene locus_tag LOCUS_27460 12408 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 12468 13649 gene locus_tag LOCUS_27470 12468 13649 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_27470 13646 13981 gene locus_tag LOCUS_27480 13646 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 14176 14697 gene locus_tag LOCUS_27490 gene infC 14176 14697 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H312 protein_id gnl|my_center|LOCUS_27490 15714 14761 gene locus_tag LOCUS_27500 15714 14761 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089324.1 protein_id gnl|my_center|LOCUS_27500 16047 16295 gene locus_tag LOCUS_27510 16047 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence063 224 583 gene locus_tag LOCUS_27520 224 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 677 1462 gene locus_tag LOCUS_27530 677 1462 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_27530 2216 1512 gene locus_tag LOCUS_27540 gene fixK 2216 1512 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085542.1 protein_id gnl|my_center|LOCUS_27540 2739 2350 gene locus_tag LOCUS_27550 2739 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3483 2857 gene locus_tag LOCUS_27560 3483 2857 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_27560 4602 3493 gene locus_tag LOCUS_27570 4602 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 9866 4920 gene locus_tag LOCUS_27580 9866 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 11212 9917 gene locus_tag LOCUS_27590 11212 9917 CDS product filamentous hemagglutinin outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067719.1 protein_id gnl|my_center|LOCUS_27590 12874 11324 gene locus_tag LOCUS_27600 12874 11324 CDS product heme utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088867.1 protein_id gnl|my_center|LOCUS_27600 14907 13360 gene locus_tag LOCUS_27610 14907 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 15046 15837 gene locus_tag LOCUS_27620 15046 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 16008 15933 gene locus_tag LOCUS_t00390 16008 15933 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 2323 38 gene locus_tag LOCUS_27630 2323 38 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_27630 2715 3917 gene locus_tag LOCUS_27640 2715 3917 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8I0 protein_id gnl|my_center|LOCUS_27640 4791 3979 gene locus_tag LOCUS_27650 4791 3979 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_27650 4947 5414 gene locus_tag LOCUS_27660 4947 5414 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_27660 6515 5511 gene locus_tag LOCUS_27670 gene trxB 6515 5511 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DQ9 protein_id gnl|my_center|LOCUS_27670 7226 6621 gene locus_tag LOCUS_27680 7226 6621 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948650.1 protein_id gnl|my_center|LOCUS_27680 8356 7385 gene locus_tag LOCUS_27690 8356 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_27690 8473 8958 gene locus_tag LOCUS_27700 gene putR 8473 8958 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_27700 9526 9053 gene locus_tag LOCUS_27710 gene greA 9526 9053 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DR1 protein_id gnl|my_center|LOCUS_27710 12932 9723 gene locus_tag LOCUS_27720 gene carB 12932 9723 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4D6 protein_id gnl|my_center|LOCUS_27720 13049 13408 gene locus_tag LOCUS_27730 13049 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 14682 13522 gene locus_tag LOCUS_27740 gene carA 14682 13522 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DR8 protein_id gnl|my_center|LOCUS_27740 15133 15597 gene locus_tag LOCUS_27750 15133 15597 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence065 910 1788 gene locus_tag LOCUS_27760 910 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1872 3371 gene locus_tag LOCUS_27770 1872 3371 CDS product recombinase RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222052.1 protein_id gnl|my_center|LOCUS_27770 3368 4600 gene locus_tag LOCUS_27780 3368 4600 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266185.1 protein_id gnl|my_center|LOCUS_27780 4607 6478 gene locus_tag LOCUS_27790 4607 6478 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_27790 6471 6686 gene locus_tag LOCUS_27800 6471 6686 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216696.1 protein_id gnl|my_center|LOCUS_27800 6756 7997 gene locus_tag LOCUS_27810 6756 7997 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7G9 protein_id gnl|my_center|LOCUS_27810 7994 10342 gene locus_tag LOCUS_27820 7994 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 10383 12029 gene locus_tag LOCUS_27830 10383 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 12026 12553 gene locus_tag LOCUS_27840 12026 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 12795 13352 gene locus_tag LOCUS_27850 12795 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 14094 13366 gene locus_tag LOCUS_27860 14094 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence066 192 560 gene locus_tag LOCUS_27870 192 560 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368395.1 protein_id gnl|my_center|LOCUS_27870 557 952 gene locus_tag LOCUS_27880 557 952 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368396.1 protein_id gnl|my_center|LOCUS_27880 2062 1070 gene locus_tag LOCUS_27890 2062 1070 CDS product trans-2-enoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_27890 3084 2101 gene locus_tag LOCUS_27900 3084 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 4007 3231 gene locus_tag LOCUS_27910 4007 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27910 5389 4040 gene locus_tag LOCUS_27920 5389 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_27920 5675 7135 gene locus_tag LOCUS_27930 5675 7135 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_27930 9825 7231 gene locus_tag LOCUS_27940 9825 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 10702 12093 gene locus_tag LOCUS_27950 10702 12093 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531365.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence067 2110 2748 gene locus_tag LOCUS_27960 2110 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2919 4196 gene locus_tag LOCUS_27970 gene aatC 2919 4196 CDS product putative aminotransferase AatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87320 protein_id gnl|my_center|LOCUS_27970 4193 5506 gene locus_tag LOCUS_27980 4193 5506 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720567.1 protein_id gnl|my_center|LOCUS_27980 5559 6533 gene locus_tag LOCUS_27990 5559 6533 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD76 protein_id gnl|my_center|LOCUS_27990 6633 8444 gene locus_tag LOCUS_28000 6633 8444 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_28000 8547 8621 gene locus_tag LOCUS_t00400 8547 8621 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9026 8670 gene locus_tag LOCUS_28010 9026 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 9501 9082 gene locus_tag LOCUS_28020 9501 9082 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_28020 9582 10325 gene locus_tag LOCUS_28030 gene cobB1 9582 10325 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_28030 10376 11980 gene locus_tag LOCUS_28040 10376 11980 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528264.1 protein_id gnl|my_center|LOCUS_28040 13610 11964 gene locus_tag LOCUS_28050 13610 11964 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_28050 14299 13607 gene locus_tag LOCUS_28060 14299 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 >Feature sequence068 261 821 gene locus_tag LOCUS_28070 261 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 894 1607 gene locus_tag LOCUS_28080 894 1607 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_28080 1604 3397 gene locus_tag LOCUS_28090 1604 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 3567 4391 gene locus_tag LOCUS_28100 3567 4391 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 protein_id gnl|my_center|LOCUS_28100 4610 6142 gene locus_tag LOCUS_28110 4610 6142 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531455.1 protein_id gnl|my_center|LOCUS_28110 6399 8414 gene locus_tag LOCUS_28120 6399 8414 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 protein_id gnl|my_center|LOCUS_28120 8754 9821 gene locus_tag LOCUS_28130 8754 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 13190 9831 gene locus_tag LOCUS_28140 13190 9831 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence069 1349 2854 gene locus_tag LOCUS_28150 1349 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2860 3873 gene locus_tag LOCUS_28160 2860 3873 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_28160 3927 5075 gene locus_tag LOCUS_28170 3927 5075 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_28170 5188 6063 gene locus_tag LOCUS_28180 5188 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6053 6775 gene locus_tag LOCUS_28190 6053 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 6830 7558 gene locus_tag LOCUS_28200 6830 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 7583 9709 gene locus_tag LOCUS_28210 7583 9709 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_28210 9706 10425 gene locus_tag LOCUS_28220 9706 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 10431 11534 gene locus_tag LOCUS_28230 10431 11534 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence070 2203 1835 gene locus_tag LOCUS_28240 2203 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2424 3110 gene locus_tag LOCUS_28250 2424 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3251 3859 gene locus_tag LOCUS_28260 3251 3859 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 protein_id gnl|my_center|LOCUS_28260 3884 4729 gene locus_tag LOCUS_28270 gene tauD 3884 4729 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_28270 4814 5872 gene locus_tag LOCUS_28280 4814 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 5944 6792 gene locus_tag LOCUS_28290 5944 6792 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_28290 6940 8100 gene locus_tag LOCUS_28300 6940 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_28300 11186 8115 gene locus_tag LOCUS_28310 11186 8115 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_28310 12334 11201 gene locus_tag LOCUS_28320 12334 11201 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence071 1283 189 gene locus_tag LOCUS_28330 1283 189 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_28330 2489 1296 gene locus_tag LOCUS_28340 2489 1296 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_28340 4911 2725 gene locus_tag LOCUS_28350 4911 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 6113 5232 gene locus_tag LOCUS_28360 6113 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28360 7308 6055 gene locus_tag LOCUS_28370 7308 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28370 7792 7493 gene locus_tag LOCUS_28380 7792 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 7719 9059 gene locus_tag LOCUS_28390 7719 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_28390 9056 9895 gene locus_tag LOCUS_28400 gene rlmJ 9056 9895 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZW8 protein_id gnl|my_center|LOCUS_28400 10031 11347 gene locus_tag LOCUS_28410 10031 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence072 702 2648 gene locus_tag LOCUS_28420 702 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3813 3550 gene locus_tag LOCUS_28430 3813 3550 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK2 protein_id gnl|my_center|LOCUS_28430 4347 4039 gene locus_tag LOCUS_28440 4347 4039 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089871.1 protein_id gnl|my_center|LOCUS_28440 5216 4392 gene locus_tag LOCUS_28450 5216 4392 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066894.1 protein_id gnl|my_center|LOCUS_28450 5237 6601 gene locus_tag LOCUS_28460 5237 6601 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 protein_id gnl|my_center|LOCUS_28460 6613 8046 gene locus_tag LOCUS_28470 6613 8046 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCX6 protein_id gnl|my_center|LOCUS_28470 9069 8050 gene locus_tag LOCUS_28480 9069 8050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090277.1 protein_id gnl|my_center|LOCUS_28480 9722 9099 gene locus_tag LOCUS_28490 9722 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090279.1 protein_id gnl|my_center|LOCUS_28490 10819 9764 gene locus_tag LOCUS_28500 10819 9764 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence073 1646 240 gene locus_tag LOCUS_28510 gene cysS 1646 240 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_28510 2222 2854 gene locus_tag LOCUS_28520 gene folE 2222 2854 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY3 protein_id gnl|my_center|LOCUS_28520 2936 3391 gene locus_tag LOCUS_28530 2936 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3517 4590 gene locus_tag LOCUS_28540 3517 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5030 4602 gene locus_tag LOCUS_28550 5030 4602 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_28550 5274 6572 gene locus_tag LOCUS_28560 5274 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 6569 7132 gene locus_tag LOCUS_28570 6569 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 protein_id gnl|my_center|LOCUS_28570 7548 7189 gene locus_tag LOCUS_28580 7548 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 8474 7659 gene locus_tag LOCUS_28590 8474 7659 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975222.1 protein_id gnl|my_center|LOCUS_28590 9069 8467 gene locus_tag LOCUS_28600 9069 8467 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_28600 9443 10513 gene locus_tag LOCUS_28610 gene hfaB 9443 10513 CDS product putative transcription activator protein HfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27343 protein_id gnl|my_center|LOCUS_28610 >Feature sequence074 <1 600 gene locus_tag LOCUS_28620 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085849.1:class II aldolase 733 3072 gene locus_tag LOCUS_28630 733 3072 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_28630 3094 3798 gene locus_tag LOCUS_28640 3094 3798 CDS product putative transcriptional regulator, AraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700820.1 protein_id gnl|my_center|LOCUS_28640 4460 3801 gene locus_tag LOCUS_28650 4460 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 4730 5428 gene locus_tag LOCUS_28660 4730 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5470 6504 gene locus_tag LOCUS_28670 5470 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 6525 7751 gene locus_tag LOCUS_28680 6525 7751 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_28680 7882 8364 gene locus_tag LOCUS_28690 7882 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 8515 8441 gene locus_tag LOCUS_t00410 8515 8441 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9546 8689 gene locus_tag LOCUS_28700 9546 8689 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390513.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28700 9740 9824 gene locus_tag LOCUS_t00420 9740 9824 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9989 10062 gene locus_tag LOCUS_t00430 9989 10062 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 <1 840 gene locus_tag LOCUS_28710 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067401.1:acyl-CoA synthetase 1066 1893 gene locus_tag LOCUS_28720 1066 1893 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_28720 2652 1915 gene locus_tag LOCUS_28730 2652 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531751.1 protein_id gnl|my_center|LOCUS_28730 3409 2849 gene locus_tag LOCUS_28740 3409 2849 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931004.1 protein_id gnl|my_center|LOCUS_28740 4552 3551 gene locus_tag LOCUS_28750 4552 3551 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_28750 4672 4872 gene locus_tag LOCUS_28760 4672 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 5246 5830 gene locus_tag LOCUS_28770 gene rcdA 5246 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_28770 6126 5905 gene locus_tag LOCUS_28780 gene rpmE 6126 5905 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4M5 protein_id gnl|my_center|LOCUS_28780 6437 8293 gene locus_tag LOCUS_28790 6437 8293 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084324.1 protein_id gnl|my_center|LOCUS_28790 8311 9405 gene locus_tag LOCUS_28800 8311 9405 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence076 896 339 gene locus_tag LOCUS_28810 896 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1582 893 gene locus_tag LOCUS_28820 1582 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 3267 1582 gene locus_tag LOCUS_28830 3267 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 3867 3280 gene locus_tag LOCUS_28840 3867 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 5745 4243 gene locus_tag LOCUS_28850 5745 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 6319 5837 gene locus_tag LOCUS_28860 6319 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 7300 6998 gene locus_tag LOCUS_28870 7300 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061950.1 protein_id gnl|my_center|LOCUS_28870 8097 8360 gene locus_tag LOCUS_28880 8097 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 8657 8424 gene locus_tag LOCUS_28890 8657 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 9510 9166 gene locus_tag LOCUS_28900 9510 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence077 474 1463 gene locus_tag LOCUS_28910 gene rpoH 474 1463 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD4 protein_id gnl|my_center|LOCUS_28910 1706 1473 gene locus_tag LOCUS_28920 1706 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1663 2745 gene locus_tag LOCUS_28930 1663 2745 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_28930 3480 2749 gene locus_tag LOCUS_28940 3480 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550778.1 protein_id gnl|my_center|LOCUS_28940 4264 3617 gene locus_tag LOCUS_28950 gene msrA 4264 3617 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_28950 5931 4369 gene locus_tag LOCUS_28960 5931 4369 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943995.1 protein_id gnl|my_center|LOCUS_28960 6596 6066 gene locus_tag LOCUS_28970 6596 6066 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089401.1 protein_id gnl|my_center|LOCUS_28970 8781 6904 gene locus_tag LOCUS_28980 gene thiC 8781 6904 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FP0 protein_id gnl|my_center|LOCUS_28980 >Feature sequence078 492 1214 gene locus_tag LOCUS_28990 492 1214 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229264.1 protein_id gnl|my_center|LOCUS_28990 2038 1259 gene locus_tag LOCUS_29000 2038 1259 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925816.1 protein_id gnl|my_center|LOCUS_29000 4131 2200 gene locus_tag LOCUS_29010 4131 2200 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_29010 4308 5021 gene locus_tag LOCUS_29020 4308 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 5402 5085 gene locus_tag LOCUS_29030 5402 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_29030 5757 6518 gene locus_tag LOCUS_29040 gene purC 5757 6518 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 protein_id gnl|my_center|LOCUS_29040 6691 6936 gene locus_tag LOCUS_29050 gene purS 6691 6936 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PI2 protein_id gnl|my_center|LOCUS_29050 6939 7607 gene locus_tag LOCUS_29060 gene purQ 6939 7607 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L4 protein_id gnl|my_center|LOCUS_29060 >Feature sequence079 73 1455 gene locus_tag LOCUS_29070 73 1455 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105418.1 protein_id gnl|my_center|LOCUS_29070 1907 2530 gene locus_tag LOCUS_29080 1907 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 2559 3365 gene locus_tag LOCUS_29090 2559 3365 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_29090 3513 4136 gene locus_tag LOCUS_29100 3513 4136 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971718.1 protein_id gnl|my_center|LOCUS_29100 4609 4127 gene locus_tag LOCUS_29110 4609 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5099 4602 gene locus_tag LOCUS_29120 5099 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 5194 5667 gene locus_tag LOCUS_29130 5194 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_29130 6372 5686 gene locus_tag LOCUS_29140 6372 5686 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_29140 8188 6380 gene locus_tag LOCUS_29150 8188 6380 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence080 1261 578 gene locus_tag LOCUS_29160 1261 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1778 1353 gene locus_tag LOCUS_29170 1778 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2408 2319 gene locus_tag LOCUS_t00440 2408 2319 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2935 3990 gene locus_tag LOCUS_29180 2935 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 4031 4348 gene locus_tag LOCUS_29190 4031 4348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918516.1 protein_id gnl|my_center|LOCUS_29190 4462 5229 gene locus_tag LOCUS_29200 4462 5229 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY48 protein_id gnl|my_center|LOCUS_29200 5350 5661 gene locus_tag LOCUS_29210 gene rplU 5350 5661 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV2 protein_id gnl|my_center|LOCUS_29210 5682 5960 gene locus_tag LOCUS_29220 gene rpmA 5682 5960 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR6 protein_id gnl|my_center|LOCUS_29220 6084 6653 gene locus_tag LOCUS_29230 6084 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 6655 7704 gene locus_tag LOCUS_29240 gene obg 6655 7704 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLY7 protein_id gnl|my_center|LOCUS_29240 >Feature sequence081 1486 251 gene locus_tag LOCUS_29250 1486 251 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_29250 1708 1505 gene locus_tag LOCUS_29260 1708 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 1733 3037 gene locus_tag LOCUS_29270 1733 3037 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265614.1 protein_id gnl|my_center|LOCUS_29270 3248 3048 gene locus_tag LOCUS_29280 3248 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 4263 3268 gene locus_tag LOCUS_29290 4263 3268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_29290 4795 4307 gene locus_tag LOCUS_29300 4795 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 6242 4806 gene locus_tag LOCUS_29310 6242 4806 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388424.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence082 901 38 gene locus_tag LOCUS_29320 901 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1292 1056 gene locus_tag LOCUS_29330 1292 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1400 2182 gene locus_tag LOCUS_29340 gene mtgA 1400 2182 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYG3 protein_id gnl|my_center|LOCUS_29340 2886 2392 gene locus_tag LOCUS_29350 2886 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4492 2897 gene locus_tag LOCUS_29360 4492 2897 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_29360 4994 4602 gene locus_tag LOCUS_29370 gene vapC 4994 4602 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAG1 protein_id gnl|my_center|LOCUS_29370 5233 4994 gene locus_tag LOCUS_29380 5233 4994 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887087.1 protein_id gnl|my_center|LOCUS_29380 5838 7265 gene locus_tag LOCUS_29390 5838 7265 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence083 354 1598 gene locus_tag LOCUS_29400 354 1598 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266185.1 protein_id gnl|my_center|LOCUS_29400 1555 3426 gene locus_tag LOCUS_29410 1555 3426 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_29410 3436 3648 gene locus_tag LOCUS_29420 3436 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3679 5100 gene locus_tag LOCUS_29430 3679 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447105.1 protein_id gnl|my_center|LOCUS_29430 5235 5438 gene locus_tag LOCUS_29440 5235 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence084 25 552 gene locus_tag LOCUS_29450 25 552 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_29450 539 1639 gene locus_tag LOCUS_29460 539 1639 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_29460 2039 1689 gene locus_tag LOCUS_29470 2039 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2390 3892 gene locus_tag LOCUS_29480 2390 3892 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence085 1664 468 gene locus_tag LOCUS_29490 gene lhgO 1664 468 CDS product L-2-hydroxyglutarate oxidase LhgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XYZ8 protein_id gnl|my_center|LOCUS_29490 3010 1712 gene locus_tag LOCUS_29500 3010 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_29500 4603 3617 gene locus_tag LOCUS_29510 4603 3617 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930618.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence086 1857 448 gene locus_tag LOCUS_29520 1857 448 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_29520 3434 1941 gene locus_tag LOCUS_29530 gene glpK1 3434 1941 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_29530 3555 4592 gene locus_tag LOCUS_29540 gene moaA 3555 4592 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 protein_id gnl|my_center|LOCUS_29540 >Feature sequence087 <1 721 gene locus_tag LOCUS_29550 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083330.1:citrate lyase subunit beta 765 1814 gene locus_tag LOCUS_29560 765 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388956.1 protein_id gnl|my_center|LOCUS_29560 1823 2395 gene locus_tag LOCUS_29570 1823 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2721 3128 gene locus_tag LOCUS_29580 gene sdhC 2721 3128 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_29580 3128 3529 gene locus_tag LOCUS_29590 3128 3529 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence088 521 2506 gene locus_tag LOCUS_29600 gene rpoD 521 2506 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM5 protein_id gnl|my_center|LOCUS_29600 2556 2918 gene locus_tag LOCUS_29610 gene panD 2556 2918 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A602 protein_id gnl|my_center|LOCUS_29610 3245 2997 gene locus_tag LOCUS_29620 3245 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 4278 3541 gene locus_tag LOCUS_29630 gene pp26 4278 3541 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972105.1 protein_id gnl|my_center|LOCUS_29630 4492 4568 gene locus_tag LOCUS_t00450 4492 4568 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 2104 1502 gene locus_tag LOCUS_29640 gene fic 2104 1502 CDS product cell filamentation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_29640 2550 2089 gene locus_tag LOCUS_29650 2550 2089 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_29650 3001 2771 gene locus_tag LOCUS_29660 3001 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3612 3301 gene locus_tag LOCUS_29670 3612 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3721 3590 gene locus_tag LOCUS_29680 3721 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3911 3780 gene locus_tag LOCUS_29690 3911 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence090 1776 790 gene locus_tag LOCUS_29700 1776 790 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973651.1 protein_id gnl|my_center|LOCUS_29700 2290 1964 gene locus_tag LOCUS_29710 2290 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 2699 4120 gene locus_tag LOCUS_29720 2699 4120 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919653.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence091 1462 188 gene locus_tag LOCUS_29730 1462 188 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C607 protein_id gnl|my_center|LOCUS_29730 2014 1475 gene locus_tag LOCUS_29740 gene petA 2014 1475 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDQ5 protein_id gnl|my_center|LOCUS_29740 2399 2872 gene locus_tag LOCUS_29750 gene trmL 2399 2872 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE3 protein_id gnl|my_center|LOCUS_29750 >Feature sequence092 2496 3413 gene locus_tag LOCUS_29760 2496 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55426 protein_id gnl|my_center|LOCUS_29760 >Feature sequence093 <1 819 gene locus_tag LOCUS_29770 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CCQ9:succinate dehydrogenase flavoprotein subunit 839 1618 gene locus_tag LOCUS_29780 839 1618 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIY6 protein_id gnl|my_center|LOCUS_29780 2216 1668 gene locus_tag LOCUS_29790 2216 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2996 3361 gene locus_tag LOCUS_29800 2996 3361 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence094 40 116 gene locus_tag LOCUS_t00460 40 116 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1594 1779 gene locus_tag LOCUS_29810 1594 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2655 1846 gene locus_tag LOCUS_29820 2655 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 2887 3117 gene locus_tag LOCUS_29830 2887 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence095 2045 3073 gene locus_tag LOCUS_29840 2045 3073 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640573.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence096 1 2223 gene locus_tag LOCUS_29850 1 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 <3233 2685 gene locus_tag LOCUS_29860 <3233 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104858.1:AraC family transcriptional regulator >Feature sequence097 199 549 gene locus_tag LOCUS_29870 199 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 546 1769 gene locus_tag LOCUS_29880 546 1769 CDS product putative kinase Y4dM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55412 protein_id gnl|my_center|LOCUS_29880 2878 1766 gene locus_tag LOCUS_29890 2878 1766 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040073.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence098 1119 928 gene locus_tag LOCUS_29900 1119 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1814 2173 gene locus_tag LOCUS_29910 1814 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2186 2419 gene locus_tag LOCUS_29920 2186 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence099 1109 1495 gene locus_tag LOCUS_29930 1109 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1495 2724 gene locus_tag LOCUS_29940 1495 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389727.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence100 >Feature sequence101 1786 326 gene locus_tag LOCUS_29950 1786 326 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_29950 2861 1800 gene locus_tag LOCUS_29960 2861 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence102 1175 195 gene locus_tag LOCUS_29970 1175 195 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_29970 1441 1172 gene locus_tag LOCUS_29980 1441 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1636 1956 gene locus_tag LOCUS_29990 1636 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 2287 1949 gene locus_tag LOCUS_30000 2287 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence103 >Feature sequence104 1987 1061 gene locus_tag LOCUS_30010 1987 1061 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_30010 >Feature sequence105 442 1029 gene locus_tag LOCUS_30020 442 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence106 2 469 gene locus_tag LOCUS_30030 2 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence107 239 325 gene locus_tag LOCUS_t00470 239 325 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 >Feature sequence109 <1400 407 gene locus_tag LOCUS_30040 <1400 407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971054.1:IS110 family transposase >Feature sequence110 1372 806 gene locus_tag LOCUS_30050 1372 806 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531258.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence111 719 48 gene locus_tag LOCUS_30060 719 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 1156 890 gene locus_tag LOCUS_30070 1156 890 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213260.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence112 >Feature sequence113 <1026 443 gene locus_tag LOCUS_30080 <1026 443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63JB0:acetaldehyde dehydrogenase >Feature sequence114