>Feature sequence001 715 377 gene locus_tag LOCUS_00010 715 377 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_00010 2234 861 gene locus_tag LOCUS_00020 2234 861 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_00020 2359 3027 gene locus_tag LOCUS_00030 2359 3027 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203460.1 protein_id gnl|my_center|LOCUS_00030 3358 4035 gene locus_tag LOCUS_00040 3358 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970735.1 protein_id gnl|my_center|LOCUS_00040 5130 4150 gene locus_tag LOCUS_00050 gene tadC2 5130 4150 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706438.1 protein_id gnl|my_center|LOCUS_00050 6159 5161 gene locus_tag LOCUS_00060 gene ctpH 6159 5161 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084252.1 protein_id gnl|my_center|LOCUS_00060 7617 6172 gene locus_tag LOCUS_00070 gene ctpG 7617 6172 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_00070 8949 7624 gene locus_tag LOCUS_00080 gene cpaE 8949 7624 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 9659 8961 gene locus_tag LOCUS_00090 gene ctpE 9659 8961 CDS product type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970739.1 protein_id gnl|my_center|LOCUS_00090 11244 9667 gene locus_tag LOCUS_00100 gene cpaC 11244 9667 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_00100 12074 11241 gene locus_tag LOCUS_00110 gene ctpC 12074 11241 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084257.1 protein_id gnl|my_center|LOCUS_00110 12819 12250 gene locus_tag LOCUS_00120 gene ctpB 12819 12250 CDS product type 4 prepilin peptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_00120 13147 12983 gene locus_tag LOCUS_00130 gene ctpA 13147 12983 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084259.1 protein_id gnl|my_center|LOCUS_00130 14118 13468 gene locus_tag LOCUS_00140 14118 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14446 15006 gene locus_tag LOCUS_00150 14446 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16637 15108 gene locus_tag LOCUS_00160 16637 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532519.1 protein_id gnl|my_center|LOCUS_00160 16926 17489 gene locus_tag LOCUS_00170 16926 17489 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_00170 17492 18028 gene locus_tag LOCUS_00180 17492 18028 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 protein_id gnl|my_center|LOCUS_00180 18177 19187 gene locus_tag LOCUS_00190 18177 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_00190 19456 19367 gene locus_tag LOCUS_t00010 19456 19367 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19736 20041 gene locus_tag LOCUS_00200 19736 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20087 20368 gene locus_tag LOCUS_00210 20087 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 <21326 20375 gene locus_tag LOCUS_00220 <21326 20375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TGR1:elongation factor 4 >Feature sequence002 1052 315 gene locus_tag LOCUS_00230 1052 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2237 1296 gene locus_tag LOCUS_00240 gene gshB 2237 1296 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_00240 3323 2412 gene locus_tag LOCUS_00250 3323 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 protein_id gnl|my_center|LOCUS_00250 4324 3395 gene locus_tag LOCUS_00260 4324 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 5046 4684 gene locus_tag LOCUS_00270 5046 4684 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP9 protein_id gnl|my_center|LOCUS_00270 5951 5043 gene locus_tag LOCUS_00280 gene rsmI 5951 5043 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN08 protein_id gnl|my_center|LOCUS_00280 6132 7346 gene locus_tag LOCUS_00290 6132 7346 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391441.1 protein_id gnl|my_center|LOCUS_00290 8509 7343 gene locus_tag LOCUS_00300 gene hemN 8509 7343 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083499.1 protein_id gnl|my_center|LOCUS_00300 9122 8493 gene locus_tag LOCUS_00310 9122 8493 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_00310 9839 9126 gene locus_tag LOCUS_00320 gene rph 9839 9126 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SK2 protein_id gnl|my_center|LOCUS_00320 10111 11199 gene locus_tag LOCUS_00330 gene hrcA 10111 11199 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REF2 protein_id gnl|my_center|LOCUS_00330 11348 12118 gene locus_tag LOCUS_00340 11348 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 13460 12291 gene locus_tag LOCUS_00350 13460 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 13448 13996 gene locus_tag LOCUS_00360 13448 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 14659 13997 gene locus_tag LOCUS_00370 14659 13997 CDS product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_00370 14916 16862 gene locus_tag LOCUS_00380 gene dnaK 14916 16862 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 protein_id gnl|my_center|LOCUS_00380 16969 18129 gene locus_tag LOCUS_00390 gene dnaJ 16969 18129 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_00390 19208 18126 gene locus_tag LOCUS_00400 19208 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 19147 19332 gene locus_tag LOCUS_00410 19147 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence003 1285 1728 gene locus_tag LOCUS_00420 1285 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 1725 2132 gene locus_tag LOCUS_00430 1725 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_00430 3079 2381 gene locus_tag LOCUS_00440 3079 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5733 3343 gene locus_tag LOCUS_00450 5733 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6232 5960 gene locus_tag LOCUS_00460 6232 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00460 7510 6302 gene locus_tag LOCUS_00470 7510 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00470 11053 7643 gene locus_tag LOCUS_00480 11053 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 15097 11246 gene locus_tag LOCUS_00490 15097 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 15836 16381 gene locus_tag LOCUS_00500 15836 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 16378 18231 gene locus_tag LOCUS_00510 16378 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 18578 18811 gene locus_tag LOCUS_00520 18578 18811 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937862.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence004 1423 1965 gene locus_tag LOCUS_00530 1423 1965 CDS product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_00530 2068 3246 gene locus_tag LOCUS_00540 2068 3246 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_00540 3393 4634 gene locus_tag LOCUS_00550 3393 4634 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_00550 4700 5554 gene locus_tag LOCUS_00560 4700 5554 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_00560 6296 5556 gene locus_tag LOCUS_00570 gene echA16 6296 5556 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950782.1 protein_id gnl|my_center|LOCUS_00570 6399 7292 gene locus_tag LOCUS_00580 6399 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 7289 7879 gene locus_tag LOCUS_00590 7289 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 8901 7888 gene locus_tag LOCUS_00600 8901 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 10668 8923 gene locus_tag LOCUS_00610 10668 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 11347 10700 gene locus_tag LOCUS_00620 11347 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 11429 12355 gene locus_tag LOCUS_00630 11429 12355 CDS product 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_00630 12392 13261 gene locus_tag LOCUS_00640 12392 13261 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_00640 13271 14779 gene locus_tag LOCUS_00650 gene mhpA 13271 14779 CDS product 3-(3-hydroxyphenyl)propionate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 protein_id gnl|my_center|LOCUS_00650 16034 14781 gene locus_tag LOCUS_00660 16034 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 16168 16569 gene locus_tag LOCUS_00670 16168 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 16870 17898 gene locus_tag LOCUS_00680 gene oruR 16870 17898 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 225 2516 gene locus_tag LOCUS_00690 225 2516 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272564.1 protein_id gnl|my_center|LOCUS_00690 2513 2749 gene locus_tag LOCUS_00700 2513 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4255 2789 gene locus_tag LOCUS_00710 4255 2789 CDS product carboxypeptidase S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_00710 4402 5121 gene locus_tag LOCUS_00720 gene paaG 4402 5121 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_00720 5900 5118 gene locus_tag LOCUS_00730 gene bdhA 5900 5118 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_00730 6046 6657 gene locus_tag LOCUS_00740 6046 6657 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_00740 6687 7724 gene locus_tag LOCUS_00750 6687 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809071.1 protein_id gnl|my_center|LOCUS_00750 7771 8841 gene locus_tag LOCUS_00760 7771 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_00760 11141 8838 gene locus_tag LOCUS_00770 11141 8838 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114386.1 protein_id gnl|my_center|LOCUS_00770 11296 11727 gene locus_tag LOCUS_00780 11296 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11754 12908 gene locus_tag LOCUS_00790 11754 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_00790 13517 12909 gene locus_tag LOCUS_00800 13517 12909 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_00800 13737 14243 gene locus_tag LOCUS_00810 gene hspC 13737 14243 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970852.1 protein_id gnl|my_center|LOCUS_00810 14273 14542 gene locus_tag LOCUS_00820 14273 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 15043 14579 gene locus_tag LOCUS_00830 15043 14579 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence006 713 201 gene locus_tag LOCUS_00840 713 201 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_00840 1118 735 gene locus_tag LOCUS_00850 1118 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1271 4132 gene locus_tag LOCUS_00860 1271 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4491 4129 gene locus_tag LOCUS_00870 4491 4129 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920799.1 protein_id gnl|my_center|LOCUS_00870 5292 4510 gene locus_tag LOCUS_00880 5292 4510 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIY6 protein_id gnl|my_center|LOCUS_00880 5674 5357 gene locus_tag LOCUS_00890 5674 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 7545 5725 gene locus_tag LOCUS_00900 gene sdhA 7545 5725 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 protein_id gnl|my_center|LOCUS_00900 7959 7576 gene locus_tag LOCUS_00910 gene sdhD 7959 7576 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504989.1 protein_id gnl|my_center|LOCUS_00910 8375 7959 gene locus_tag LOCUS_00920 gene sdhC 8375 7959 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_00920 8751 9149 gene locus_tag LOCUS_00930 8751 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 9327 9776 gene locus_tag LOCUS_00940 9327 9776 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840937.1 protein_id gnl|my_center|LOCUS_00940 9789 10514 gene locus_tag LOCUS_00950 9789 10514 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_00950 11554 10511 gene locus_tag LOCUS_00960 11554 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921483.1 protein_id gnl|my_center|LOCUS_00960 12420 11551 gene locus_tag LOCUS_00970 gene citE 12420 11551 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_00970 12550 13371 gene locus_tag LOCUS_00980 12550 13371 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UED0 protein_id gnl|my_center|LOCUS_00980 <15080 13368 gene locus_tag LOCUS_00990 <15080 13368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390961.1:PAS domain-containing sensor histidine kinase >Feature sequence007 995 588 gene locus_tag LOCUS_01000 995 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 1102 1614 gene locus_tag LOCUS_01010 1102 1614 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142676.1 protein_id gnl|my_center|LOCUS_01010 2544 1672 gene locus_tag LOCUS_01020 2544 1672 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_01020 2633 3016 gene locus_tag LOCUS_01030 2633 3016 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920704.1 protein_id gnl|my_center|LOCUS_01030 3013 3561 gene locus_tag LOCUS_01040 3013 3561 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920703.1 protein_id gnl|my_center|LOCUS_01040 3561 4355 gene locus_tag LOCUS_01050 3561 4355 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4H2 protein_id gnl|my_center|LOCUS_01050 5678 4419 gene locus_tag LOCUS_01060 5678 4419 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_01060 6950 5691 gene locus_tag LOCUS_01070 6950 5691 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_01070 7105 8466 gene locus_tag LOCUS_01080 7105 8466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_01080 8463 9224 gene locus_tag LOCUS_01090 8463 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 9322 10092 gene locus_tag LOCUS_01100 gene dpm1 9322 10092 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_01100 10111 10872 gene locus_tag LOCUS_01110 10111 10872 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 protein_id gnl|my_center|LOCUS_01110 12007 10907 gene locus_tag LOCUS_01120 12007 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_01120 13042 12020 gene locus_tag LOCUS_01130 gene bioB 13042 12020 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFL1 protein_id gnl|my_center|LOCUS_01130 14648 13221 gene locus_tag LOCUS_01140 14648 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLN7 protein_id gnl|my_center|LOCUS_01140 >Feature sequence008 <1 1315 gene locus_tag LOCUS_01150 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267578.1:membrane protein 1327 1797 gene locus_tag LOCUS_01160 1327 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 3116 1794 gene locus_tag LOCUS_01170 3116 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 3319 4491 gene locus_tag LOCUS_01180 3319 4491 CDS product metal-activated pyridoxal enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948224.1 protein_id gnl|my_center|LOCUS_01180 4583 5164 gene locus_tag LOCUS_01190 4583 5164 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404712.1 protein_id gnl|my_center|LOCUS_01190 5260 5559 gene locus_tag LOCUS_01200 5260 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 5556 6380 gene locus_tag LOCUS_01210 5556 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 6553 7716 gene locus_tag LOCUS_01220 gene pfk-2 6553 7716 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS2 protein_id gnl|my_center|LOCUS_01220 7734 8831 gene locus_tag LOCUS_01230 gene pfk-2 7734 8831 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS2 protein_id gnl|my_center|LOCUS_01230 8851 9309 gene locus_tag LOCUS_01240 8851 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9824 9306 gene locus_tag LOCUS_01250 9824 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10972 10088 gene locus_tag LOCUS_01260 10972 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 11125 12480 gene locus_tag LOCUS_01270 11125 12480 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056263.1 protein_id gnl|my_center|LOCUS_01270 13492 12719 gene locus_tag LOCUS_01280 13492 12719 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_01280 13797 14483 gene locus_tag LOCUS_01290 13797 14483 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710077.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence009 <1 1310 gene locus_tag LOCUS_01300 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265553.1:glycosyltransferase WbuB 1806 1336 gene locus_tag LOCUS_01310 1806 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 2878 1955 gene locus_tag LOCUS_01320 2878 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_01320 3612 2875 gene locus_tag LOCUS_01330 3612 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038853.1 protein_id gnl|my_center|LOCUS_01330 4846 3905 gene locus_tag LOCUS_01340 gene wcaG 4846 3905 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_01340 5972 4863 gene locus_tag LOCUS_01350 gene gmd 5972 4863 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_01350 7023 6292 gene locus_tag LOCUS_01360 7023 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_01360 8000 7020 gene locus_tag LOCUS_01370 8000 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 8249 8040 gene locus_tag LOCUS_01380 8249 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 9232 8246 gene locus_tag LOCUS_01390 9232 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 10036 9425 gene locus_tag LOCUS_01400 10036 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 11827 10646 gene locus_tag LOCUS_01410 11827 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 12575 11838 gene locus_tag LOCUS_01420 12575 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14095 12572 gene locus_tag LOCUS_01430 14095 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence010 3148 1253 gene locus_tag LOCUS_01440 gene dxs 3148 1253 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T825 protein_id gnl|my_center|LOCUS_01440 4144 3185 gene locus_tag LOCUS_01450 4144 3185 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_01450 5326 4157 gene locus_tag LOCUS_01460 gene ispG 5326 4157 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 protein_id gnl|my_center|LOCUS_01460 5748 6758 gene locus_tag LOCUS_01470 gene ispH 5748 6758 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD1 protein_id gnl|my_center|LOCUS_01470 6826 8004 gene locus_tag LOCUS_01480 6826 8004 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085790.1 protein_id gnl|my_center|LOCUS_01480 8649 7954 gene locus_tag LOCUS_01490 8649 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 10659 8704 gene locus_tag LOCUS_01500 10659 8704 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_01500 12017 10752 gene locus_tag LOCUS_01510 12017 10752 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_01510 12957 12022 gene locus_tag LOCUS_01520 12957 12022 CDS product squalene synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085786.1 protein_id gnl|my_center|LOCUS_01520 13586 12954 gene locus_tag LOCUS_01530 13586 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 >Feature sequence011 <1 903 gene locus_tag LOCUS_01540 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082970.1:acyl-CoA dehydrogenase 944 1615 gene locus_tag LOCUS_01550 944 1615 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_01550 1713 2099 gene locus_tag LOCUS_01560 1713 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2115 2786 gene locus_tag LOCUS_01570 2115 2786 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532639.1 protein_id gnl|my_center|LOCUS_01570 2776 4140 gene locus_tag LOCUS_01580 2776 4140 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_01580 4347 4817 gene locus_tag LOCUS_01590 gene omp 4347 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_01590 6255 4963 gene locus_tag LOCUS_01600 6255 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 6578 8002 gene locus_tag LOCUS_01610 6578 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9072 8017 gene locus_tag LOCUS_01620 gene dcyD 9072 8017 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76316 protein_id gnl|my_center|LOCUS_01620 10302 9088 gene locus_tag LOCUS_01630 10302 9088 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_01630 10459 11853 gene locus_tag LOCUS_01640 10459 11853 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811314.1 protein_id gnl|my_center|LOCUS_01640 14030 11874 gene locus_tag LOCUS_01650 14030 11874 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence012 <1 1090 gene locus_tag LOCUS_01660 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918830.1:cytochrome P450 2334 1114 gene locus_tag LOCUS_01670 2334 1114 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_01670 2542 2466 gene locus_tag LOCUS_t00020 2542 2466 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2891 3490 gene locus_tag LOCUS_01680 2891 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4246 3551 gene locus_tag LOCUS_01690 gene PmtA 4246 3551 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_01690 5529 4324 gene locus_tag LOCUS_01700 gene mnmA 5529 4324 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_01700 5748 5569 gene locus_tag LOCUS_01710 5748 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5810 7429 gene locus_tag LOCUS_01720 5810 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7439 8110 gene locus_tag LOCUS_01730 gene flgD 7439 8110 CDS product flagellar hook assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_773637.2 protein_id gnl|my_center|LOCUS_01730 8258 8536 gene locus_tag LOCUS_01740 8258 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_01740 8889 10628 gene locus_tag LOCUS_01750 gene fliF 8889 10628 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ES3 protein_id gnl|my_center|LOCUS_01750 10662 11690 gene locus_tag LOCUS_01760 gene fliG 10662 11690 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6V1 protein_id gnl|my_center|LOCUS_01760 11727 12422 gene locus_tag LOCUS_01770 11727 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 12480 12884 gene locus_tag LOCUS_01780 12480 12884 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_01780 12912 13685 gene locus_tag LOCUS_01790 12912 13685 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence013 1353 793 gene locus_tag LOCUS_01800 gene pduO 1353 793 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_01800 2155 1370 gene locus_tag LOCUS_01810 2155 1370 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_01810 3147 2152 gene locus_tag LOCUS_01820 3147 2152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_01820 3950 3144 gene locus_tag LOCUS_01830 3950 3144 CDS product cobalamin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_01830 6009 3979 gene locus_tag LOCUS_01840 6009 3979 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_01840 6406 6221 gene locus_tag LOCUS_01850 6406 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6606 7901 gene locus_tag LOCUS_01860 6606 7901 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_01860 7961 10018 gene locus_tag LOCUS_01870 gene fadH1 7961 10018 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_01870 11067 10027 gene locus_tag LOCUS_01880 11067 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 12839 11064 gene locus_tag LOCUS_01890 12839 11064 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_01890 13166 13819 gene locus_tag LOCUS_01900 13166 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence014 893 168 gene locus_tag LOCUS_01910 gene galF 893 168 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_01910 2013 904 gene locus_tag LOCUS_01920 2013 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 2644 2027 gene locus_tag LOCUS_01930 2644 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 2789 4006 gene locus_tag LOCUS_01940 2789 4006 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_01940 4266 4586 gene locus_tag LOCUS_01950 4266 4586 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_01950 5520 5014 gene locus_tag LOCUS_01960 5520 5014 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_01960 5891 5517 gene locus_tag LOCUS_01970 5891 5517 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_01970 9126 6652 gene locus_tag LOCUS_01980 9126 6652 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970612.1 protein_id gnl|my_center|LOCUS_01980 10777 9380 gene locus_tag LOCUS_01990 gene ahcY 10777 9380 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF2 protein_id gnl|my_center|LOCUS_01990 11147 13345 gene locus_tag LOCUS_02000 11147 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 13660 13349 gene locus_tag LOCUS_02010 13660 13349 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532014.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence015 351 1262 gene locus_tag LOCUS_02020 351 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4343 1296 gene locus_tag LOCUS_02030 4343 1296 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918488.1 protein_id gnl|my_center|LOCUS_02030 11800 4340 gene locus_tag LOCUS_02040 11800 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence016 655 1173 gene locus_tag LOCUS_02050 655 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3629 1170 gene locus_tag LOCUS_02060 gene gyrB 3629 1170 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKT5 protein_id gnl|my_center|LOCUS_02060 4305 3670 gene locus_tag LOCUS_02070 gene clpP 4305 3670 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU1 protein_id gnl|my_center|LOCUS_02070 5553 4315 gene locus_tag LOCUS_02080 gene recF 5553 4315 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ65 protein_id gnl|my_center|LOCUS_02080 6715 5609 gene locus_tag LOCUS_02090 gene dnaN 6715 5609 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W64 protein_id gnl|my_center|LOCUS_02090 7230 7694 gene locus_tag LOCUS_02100 7230 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972834.1 protein_id gnl|my_center|LOCUS_02100 9339 7780 gene locus_tag LOCUS_02110 gene dnaA 9339 7780 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_02110 9936 9466 gene locus_tag LOCUS_02120 9936 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401921.1 protein_id gnl|my_center|LOCUS_02120 10928 10659 gene locus_tag LOCUS_02130 gene rpsT 10928 10659 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 protein_id gnl|my_center|LOCUS_02130 11225 12535 gene locus_tag LOCUS_02140 11225 12535 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_02140 12576 13319 gene locus_tag LOCUS_02150 12576 13319 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence017 547 1383 gene locus_tag LOCUS_02160 547 1383 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_02160 1409 2194 gene locus_tag LOCUS_02170 1409 2194 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_02170 2763 2191 gene locus_tag LOCUS_02180 2763 2191 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_02180 3736 2897 gene locus_tag LOCUS_02190 3736 2897 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_02190 3831 4520 gene locus_tag LOCUS_02200 3831 4520 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257441.1 protein_id gnl|my_center|LOCUS_02200 5237 4560 gene locus_tag LOCUS_02210 5237 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5884 5234 gene locus_tag LOCUS_02220 5884 5234 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_02220 5987 6889 gene locus_tag LOCUS_02230 5987 6889 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_02230 7045 7671 gene locus_tag LOCUS_02240 7045 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7909 9078 gene locus_tag LOCUS_02250 7909 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9152 9808 gene locus_tag LOCUS_02260 9152 9808 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 protein_id gnl|my_center|LOCUS_02260 10808 9819 gene locus_tag LOCUS_02270 10808 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523946.1 protein_id gnl|my_center|LOCUS_02270 11459 10854 gene locus_tag LOCUS_02280 11459 10854 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640024.1 protein_id gnl|my_center|LOCUS_02280 12204 11470 gene locus_tag LOCUS_02290 12204 11470 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_02290 12328 12822 gene locus_tag LOCUS_02300 12328 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 13216 12872 gene locus_tag LOCUS_02310 13216 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence018 1613 753 gene locus_tag LOCUS_02320 1613 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 1772 2086 gene locus_tag LOCUS_02330 1772 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2178 2633 gene locus_tag LOCUS_02340 2178 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2633 3202 gene locus_tag LOCUS_02350 2633 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3206 3649 gene locus_tag LOCUS_02360 3206 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3646 3951 gene locus_tag LOCUS_02370 3646 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4035 4547 gene locus_tag LOCUS_02380 4035 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 4560 6230 gene locus_tag LOCUS_02390 4560 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 protein_id gnl|my_center|LOCUS_02390 6232 7767 gene locus_tag LOCUS_02400 6232 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_312997.1 protein_id gnl|my_center|LOCUS_02400 7769 9046 gene locus_tag LOCUS_02410 7769 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9065 9718 gene locus_tag LOCUS_02420 9065 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9924 9715 gene locus_tag LOCUS_02430 9924 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10413 11579 gene locus_tag LOCUS_02440 10413 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_02440 11625 12041 gene locus_tag LOCUS_02450 11625 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12087 13031 gene locus_tag LOCUS_02460 12087 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286905.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence019 20 634 gene locus_tag LOCUS_02470 20 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 1876 716 gene locus_tag LOCUS_02480 1876 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2696 1956 gene locus_tag LOCUS_02490 2696 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4415 2697 gene locus_tag LOCUS_02500 4415 2697 CDS product sulfatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705192.1 protein_id gnl|my_center|LOCUS_02500 5036 4620 gene locus_tag LOCUS_02510 5036 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 5300 6172 gene locus_tag LOCUS_02520 5300 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 8016 6307 gene locus_tag LOCUS_02530 gene phyK 8016 6307 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923290.1 protein_id gnl|my_center|LOCUS_02530 8586 8038 gene locus_tag LOCUS_02540 8586 8038 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8D7 protein_id gnl|my_center|LOCUS_02540 8806 8588 gene locus_tag LOCUS_02550 8806 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8953 9750 gene locus_tag LOCUS_02560 gene phyR 8953 9750 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_02560 9805 10113 gene locus_tag LOCUS_02570 9805 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 10125 10499 gene locus_tag LOCUS_02580 10125 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 11219 10515 gene locus_tag LOCUS_02590 gene fixK 11219 10515 CDS product nitrogen fixation regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311539.1 protein_id gnl|my_center|LOCUS_02590 12521 11394 gene locus_tag LOCUS_02600 12521 11394 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_02600 12773 12597 gene locus_tag LOCUS_02610 12773 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 13002 12808 gene locus_tag LOCUS_02620 13002 12808 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence020 299 1432 gene locus_tag LOCUS_02630 299 1432 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_02630 2250 1429 gene locus_tag LOCUS_02640 2250 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2783 2319 gene locus_tag LOCUS_02650 2783 2319 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528467.1 protein_id gnl|my_center|LOCUS_02650 3475 4113 gene locus_tag LOCUS_02660 3475 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4302 4514 gene locus_tag LOCUS_02670 4302 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5330 5677 gene locus_tag LOCUS_02680 5330 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7224 5698 gene locus_tag LOCUS_02690 gene hapE 7224 5698 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_02690 7438 7920 gene locus_tag LOCUS_02700 7438 7920 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN7 protein_id gnl|my_center|LOCUS_02700 8043 8861 gene locus_tag LOCUS_02710 8043 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 8889 9041 gene locus_tag LOCUS_02720 8889 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9720 9154 gene locus_tag LOCUS_02730 9720 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 11095 9713 gene locus_tag LOCUS_02740 11095 9713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_02740 11280 11762 gene locus_tag LOCUS_02750 11280 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence021 213 782 gene locus_tag LOCUS_02760 213 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 849 1886 gene locus_tag LOCUS_02770 gene lpxD 849 1886 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q47 protein_id gnl|my_center|LOCUS_02770 1935 2474 gene locus_tag LOCUS_02780 gene fabZ 1935 2474 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z3 protein_id gnl|my_center|LOCUS_02780 2474 3289 gene locus_tag LOCUS_02790 gene lpxA 2474 3289 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR1 protein_id gnl|my_center|LOCUS_02790 3311 4162 gene locus_tag LOCUS_02800 gene lpxI 3311 4162 CDS product UDP-2,3-diacylglucosamine pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_02800 4159 5376 gene locus_tag LOCUS_02810 gene lpxB 4159 5376 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KQ7 protein_id gnl|my_center|LOCUS_02810 6721 5423 gene locus_tag LOCUS_02820 gene gltA 6721 5423 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR5 protein_id gnl|my_center|LOCUS_02820 8316 6883 gene locus_tag LOCUS_02830 gene gltX2 8316 6883 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_02830 8983 8789 gene locus_tag LOCUS_02840 8983 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 9039 10766 gene locus_tag LOCUS_02850 9039 10766 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_02850 10847 11041 gene locus_tag LOCUS_02860 10847 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11768 11055 gene locus_tag LOCUS_02870 gene lexA 11768 11055 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFK2 protein_id gnl|my_center|LOCUS_02870 12495 12007 gene locus_tag LOCUS_02880 gene moaC 12495 12007 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA6 protein_id gnl|my_center|LOCUS_02880 12830 12492 gene locus_tag LOCUS_02890 12830 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence022 258 1001 gene locus_tag LOCUS_02900 gene truA 258 1001 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF26 protein_id gnl|my_center|LOCUS_02900 1814 1005 gene locus_tag LOCUS_02910 gene murI 1814 1005 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E11 protein_id gnl|my_center|LOCUS_02910 2419 1817 gene locus_tag LOCUS_02920 2419 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3630 2422 gene locus_tag LOCUS_02930 gene dapE 3630 2422 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP2 protein_id gnl|my_center|LOCUS_02930 4476 3631 gene locus_tag LOCUS_02940 gene dapD 4476 3631 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_02940 5320 4613 gene locus_tag LOCUS_02950 5320 4613 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_02950 5507 6769 gene locus_tag LOCUS_02960 5507 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7792 6803 gene locus_tag LOCUS_02970 7792 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 8717 7806 gene locus_tag LOCUS_02980 gene argB 8717 7806 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5K5 protein_id gnl|my_center|LOCUS_02980 9508 8849 gene locus_tag LOCUS_02990 gene engB 9508 8849 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_02990 11373 9529 gene locus_tag LOCUS_03000 gene yidC 11373 9529 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ0 protein_id gnl|my_center|LOCUS_03000 11773 11354 gene locus_tag LOCUS_03010 gene rnpA 11773 11354 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 protein_id gnl|my_center|LOCUS_03010 >Feature sequence023 321 398 gene locus_tag LOCUS_t00030 321 398 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 417 605 gene locus_tag LOCUS_03020 417 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 614 1039 gene locus_tag LOCUS_03030 614 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939981.1 protein_id gnl|my_center|LOCUS_03030 1039 1497 gene locus_tag LOCUS_03040 1039 1497 CDS product virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_03040 1494 1931 gene locus_tag LOCUS_03050 1494 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 1940 2239 gene locus_tag LOCUS_03060 1940 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2306 3250 gene locus_tag LOCUS_03070 2306 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3353 3772 gene locus_tag LOCUS_03080 3353 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 3853 4173 gene locus_tag LOCUS_03090 3853 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4173 9335 gene locus_tag LOCUS_03100 4173 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 9332 10906 gene locus_tag LOCUS_03110 9332 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 10916 11779 gene locus_tag LOCUS_03120 10916 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence024 144 1601 gene locus_tag LOCUS_03130 144 1601 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_03130 2102 1608 gene locus_tag LOCUS_03140 2102 1608 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918306.1 protein_id gnl|my_center|LOCUS_03140 2249 2956 gene locus_tag LOCUS_03150 2249 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3083 3727 gene locus_tag LOCUS_03160 3083 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3727 4233 gene locus_tag LOCUS_03170 3727 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4406 5542 gene locus_tag LOCUS_03180 4406 5542 CDS product DUF3066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_03180 5867 6079 gene locus_tag LOCUS_03190 5867 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6408 7268 gene locus_tag LOCUS_03200 6408 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7880 7257 gene locus_tag LOCUS_03210 7880 7257 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899803.1 protein_id gnl|my_center|LOCUS_03210 8079 8654 gene locus_tag LOCUS_03220 8079 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8809 10440 gene locus_tag LOCUS_03230 8809 10440 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_03230 10430 11506 gene locus_tag LOCUS_03240 gene serA 10430 11506 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971592.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence025 1202 468 gene locus_tag LOCUS_03250 1202 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390834.1 protein_id gnl|my_center|LOCUS_03250 2210 1392 gene locus_tag LOCUS_03260 gene panB3 2210 1392 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MZ4 protein_id gnl|my_center|LOCUS_03260 3127 2294 gene locus_tag LOCUS_03270 3127 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4038 3130 gene locus_tag LOCUS_03280 4038 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 4997 4113 gene locus_tag LOCUS_03290 4997 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 5808 5092 gene locus_tag LOCUS_03300 5808 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7414 5828 gene locus_tag LOCUS_03310 gene guaA 7414 5828 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 protein_id gnl|my_center|LOCUS_03310 9202 7967 gene locus_tag LOCUS_03320 9202 7967 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_03320 10674 9199 gene locus_tag LOCUS_03330 gene guaB 10674 9199 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N70 protein_id gnl|my_center|LOCUS_03330 11595 10855 gene locus_tag LOCUS_03340 gene rlmE 11595 10855 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 protein_id gnl|my_center|LOCUS_03340 <12315 11611 gene locus_tag LOCUS_03350 <12315 11611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919488.1:exopolyphosphatase >Feature sequence026 411 1754 gene locus_tag LOCUS_03360 411 1754 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_03360 2334 1879 gene locus_tag LOCUS_03370 2334 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2483 3193 gene locus_tag LOCUS_03380 2483 3193 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_03380 4366 3221 gene locus_tag LOCUS_03390 4366 3221 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_03390 4629 4369 gene locus_tag LOCUS_03400 4629 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4981 5403 gene locus_tag LOCUS_03410 4981 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6090 5410 gene locus_tag LOCUS_03420 6090 5410 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 protein_id gnl|my_center|LOCUS_03420 6231 7349 gene locus_tag LOCUS_03430 6231 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8767 7346 gene locus_tag LOCUS_03440 8767 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 10053 8821 gene locus_tag LOCUS_03450 10053 8821 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_03450 10704 10117 gene locus_tag LOCUS_03460 10704 10117 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_03460 10827 11582 gene locus_tag LOCUS_03470 10827 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence027 893 408 gene locus_tag LOCUS_03480 gene rppH 893 408 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDW5 protein_id gnl|my_center|LOCUS_03480 2159 912 gene locus_tag LOCUS_03490 2159 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3735 2389 gene locus_tag LOCUS_03500 gene ctpA 3735 2389 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_03500 5099 3855 gene locus_tag LOCUS_03510 5099 3855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_03510 6543 5083 gene locus_tag LOCUS_03520 gene gpmI 6543 5083 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAA5 protein_id gnl|my_center|LOCUS_03520 7166 6675 gene locus_tag LOCUS_03530 gene rlmH 7166 6675 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 protein_id gnl|my_center|LOCUS_03530 7443 7192 gene locus_tag LOCUS_03540 7443 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 8803 7790 gene locus_tag LOCUS_03550 8803 7790 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_03550 10258 8900 gene locus_tag LOCUS_03560 10258 8900 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_03560 11043 10414 gene locus_tag LOCUS_03570 gene nadD 11043 10414 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2X5 protein_id gnl|my_center|LOCUS_03570 <11853 11044 gene locus_tag LOCUS_03580 <11853 11044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UBS1:gamma-glutamyl phosphate reductase >Feature sequence028 335 1597 gene locus_tag LOCUS_03590 335 1597 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917952.1 protein_id gnl|my_center|LOCUS_03590 3299 1686 gene locus_tag LOCUS_03600 3299 1686 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_03600 3545 4660 gene locus_tag LOCUS_03610 3545 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205957.1 protein_id gnl|my_center|LOCUS_03610 5751 4657 gene locus_tag LOCUS_03620 5751 4657 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084168.1 protein_id gnl|my_center|LOCUS_03620 5920 8295 gene locus_tag LOCUS_03630 5920 8295 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_03630 11389 8276 gene locus_tag LOCUS_03640 11389 8276 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence029 532 356 gene locus_tag LOCUS_03650 532 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1879 632 gene locus_tag LOCUS_03660 1879 632 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_03660 2905 1964 gene locus_tag LOCUS_03670 2905 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3522 3001 gene locus_tag LOCUS_03680 gene infC 3522 3001 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ST3 protein_id gnl|my_center|LOCUS_03680 4612 3659 gene locus_tag LOCUS_03690 4612 3659 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_03690 5808 4609 gene locus_tag LOCUS_03700 5808 4609 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_03700 5849 6625 gene locus_tag LOCUS_03710 5849 6625 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_03710 7497 6622 gene locus_tag LOCUS_03720 7497 6622 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_03720 7579 8388 gene locus_tag LOCUS_03730 7579 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391126.1 protein_id gnl|my_center|LOCUS_03730 9110 8406 gene locus_tag LOCUS_03740 9110 8406 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_03740 9236 10036 gene locus_tag LOCUS_03750 gene uppP1 9236 10036 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_03750 11023 10052 gene locus_tag LOCUS_03760 11023 10052 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence030 1379 348 gene locus_tag LOCUS_03770 1379 348 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 protein_id gnl|my_center|LOCUS_03770 2640 1408 gene locus_tag LOCUS_03780 2640 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2799 3434 gene locus_tag LOCUS_03790 gene pdxH 2799 3434 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_03790 3534 4508 gene locus_tag LOCUS_03800 3534 4508 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_03800 4518 5267 gene locus_tag LOCUS_03810 gene fixR 4518 5267 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_03810 6656 5271 gene locus_tag LOCUS_03820 6656 5271 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969374.1 protein_id gnl|my_center|LOCUS_03820 6788 7600 gene locus_tag LOCUS_03830 6788 7600 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_03830 7954 7604 gene locus_tag LOCUS_03840 7954 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 9456 7996 gene locus_tag LOCUS_03850 9456 7996 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_03850 9683 11335 gene locus_tag LOCUS_03860 9683 11335 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence031 1566 1099 gene locus_tag LOCUS_03870 1566 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03870 2036 3229 gene locus_tag LOCUS_03880 2036 3229 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_03880 3241 4326 gene locus_tag LOCUS_03890 3241 4326 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_03890 4434 5633 gene locus_tag LOCUS_03900 4434 5633 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_03900 5791 6966 gene locus_tag LOCUS_03910 5791 6966 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926854.1 protein_id gnl|my_center|LOCUS_03910 6963 7355 gene locus_tag LOCUS_03920 6963 7355 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_03920 7442 9052 gene locus_tag LOCUS_03930 7442 9052 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_03930 9123 9305 gene locus_tag LOCUS_03940 9123 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 9274 9732 gene locus_tag LOCUS_03950 9274 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03950 9729 9908 gene locus_tag LOCUS_03960 9729 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03960 10800 9961 gene locus_tag LOCUS_03970 gene bpoA 10800 9961 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418777.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence032 406 1680 gene locus_tag LOCUS_03980 406 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1677 2591 gene locus_tag LOCUS_03990 1677 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4867 2588 gene locus_tag LOCUS_04000 4867 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5127 5765 gene locus_tag LOCUS_04010 5127 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5775 7010 gene locus_tag LOCUS_04020 5775 7010 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969122.1 protein_id gnl|my_center|LOCUS_04020 7012 8283 gene locus_tag LOCUS_04030 7012 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087738.1 protein_id gnl|my_center|LOCUS_04030 8423 8347 gene locus_tag LOCUS_t00040 8423 8347 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9034 8531 gene locus_tag LOCUS_04040 9034 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9405 9070 gene locus_tag LOCUS_04050 gene ihfA 9405 9070 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 protein_id gnl|my_center|LOCUS_04050 10482 9514 gene locus_tag LOCUS_04060 gene fabH 10482 9514 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 protein_id gnl|my_center|LOCUS_04060 <11412 10479 gene locus_tag LOCUS_04070 <11412 10479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89K88:phosphate acyltransferase >Feature sequence033 5138 2247 gene locus_tag LOCUS_04080 5138 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 8184 5374 gene locus_tag LOCUS_04090 8184 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 8898 8599 gene locus_tag LOCUS_04100 8898 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 9543 9154 gene locus_tag LOCUS_04110 9543 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence034 95 1414 gene locus_tag LOCUS_04120 gene proS 95 1414 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KM8 protein_id gnl|my_center|LOCUS_04120 1422 2747 gene locus_tag LOCUS_04130 1422 2747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_04130 2740 3444 gene locus_tag LOCUS_04140 gene lolD1 2740 3444 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_04140 3946 7275 gene locus_tag LOCUS_04150 gene dnaE 3946 7275 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KN8 protein_id gnl|my_center|LOCUS_04150 9460 7283 gene locus_tag LOCUS_04160 9460 7283 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_04160 9845 10660 gene locus_tag LOCUS_04170 9845 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence035 14 433 gene locus_tag LOCUS_04180 gene rplQ 14 433 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4G0 protein_id gnl|my_center|LOCUS_04180 642 2069 gene locus_tag LOCUS_04190 642 2069 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_04190 2121 3431 gene locus_tag LOCUS_04200 2121 3431 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088123.1 protein_id gnl|my_center|LOCUS_04200 3428 3808 gene locus_tag LOCUS_04210 gene crcB 3428 3808 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_04210 3805 4800 gene locus_tag LOCUS_04220 gene rluC 3805 4800 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB12 protein_id gnl|my_center|LOCUS_04220 4797 5483 gene locus_tag LOCUS_04230 4797 5483 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_04230 5486 6247 gene locus_tag LOCUS_04240 5486 6247 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_04240 6971 6252 gene locus_tag LOCUS_04250 gene lipB 6971 6252 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6B8 protein_id gnl|my_center|LOCUS_04250 7080 7316 gene locus_tag LOCUS_04260 7080 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920036.1 protein_id gnl|my_center|LOCUS_04260 7496 8056 gene locus_tag LOCUS_04270 7496 8056 CDS product precorrin-2 oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_04270 8053 8850 gene locus_tag LOCUS_04280 8053 8850 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 protein_id gnl|my_center|LOCUS_04280 8994 9080 gene locus_tag LOCUS_t00050 8994 9080 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9267 10679 gene locus_tag LOCUS_04290 9267 10679 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8A6 protein_id gnl|my_center|LOCUS_04290 >Feature sequence036 2078 267 gene locus_tag LOCUS_04300 2078 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3456 2071 gene locus_tag LOCUS_04310 3456 2071 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_04310 4757 3723 gene locus_tag LOCUS_04320 4757 3723 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_04320 6567 5098 gene locus_tag LOCUS_04330 6567 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7830 6610 gene locus_tag LOCUS_04340 7830 6610 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_04340 7974 8819 gene locus_tag LOCUS_04350 7974 8819 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_04350 8959 9696 gene locus_tag LOCUS_04360 8959 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_04360 10355 9693 gene locus_tag LOCUS_04370 10355 9693 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269213.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence037 550 68 gene locus_tag LOCUS_04380 550 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970763.1 protein_id gnl|my_center|LOCUS_04380 1513 674 gene locus_tag LOCUS_04390 1513 674 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_04390 2307 1528 gene locus_tag LOCUS_04400 2307 1528 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_04400 2544 3407 gene locus_tag LOCUS_04410 2544 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5044 3428 gene locus_tag LOCUS_04420 5044 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_04420 5282 6187 gene locus_tag LOCUS_04430 5282 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6768 6184 gene locus_tag LOCUS_04440 6768 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6697 6987 gene locus_tag LOCUS_04450 6697 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7931 7044 gene locus_tag LOCUS_04460 7931 7044 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_04460 8070 8684 gene locus_tag LOCUS_04470 8070 8684 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_04470 8765 9742 gene locus_tag LOCUS_04480 8765 9742 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930748.1 protein_id gnl|my_center|LOCUS_04480 10418 9750 gene locus_tag LOCUS_04490 10418 9750 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 protein_id gnl|my_center|LOCUS_04490 <11201 10546 gene locus_tag LOCUS_04500 <11201 10546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085723.1:thiol:disulfide oxidoreductase >Feature sequence038 226 852 gene locus_tag LOCUS_04510 226 852 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_04510 849 1325 gene locus_tag LOCUS_04520 849 1325 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_04520 1322 1675 gene locus_tag LOCUS_04530 1322 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_04530 2395 1688 gene locus_tag LOCUS_04540 gene trmB 2395 1688 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF16 protein_id gnl|my_center|LOCUS_04540 3633 2422 gene locus_tag LOCUS_04550 gene metK2 3633 2422 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_04550 4389 3955 gene locus_tag LOCUS_04560 4389 3955 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 protein_id gnl|my_center|LOCUS_04560 6165 4540 gene locus_tag LOCUS_04570 gene lnt 6165 4540 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_04570 7137 6181 gene locus_tag LOCUS_04580 gene corC 7137 6181 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_04580 7803 7276 gene locus_tag LOCUS_04590 gene ybeY 7803 7276 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W99 protein_id gnl|my_center|LOCUS_04590 8932 7796 gene locus_tag LOCUS_04600 8932 7796 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 protein_id gnl|my_center|LOCUS_04600 10350 8929 gene locus_tag LOCUS_04610 gene miaB 10350 8929 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF08 protein_id gnl|my_center|LOCUS_04610 <11170 10570 gene locus_tag LOCUS_04620 <11170 10570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391516.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence039 776 1378 gene locus_tag LOCUS_04630 776 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390800.1 protein_id gnl|my_center|LOCUS_04630 1908 2969 gene locus_tag LOCUS_04640 gene gcvT 1908 2969 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZ70 protein_id gnl|my_center|LOCUS_04640 3000 3377 gene locus_tag LOCUS_04650 gene gcvH 3000 3377 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV0 protein_id gnl|my_center|LOCUS_04650 3377 4723 gene locus_tag LOCUS_04660 gene gcvPA 3377 4723 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A353 protein_id gnl|my_center|LOCUS_04660 4720 6237 gene locus_tag LOCUS_04670 4720 6237 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 protein_id gnl|my_center|LOCUS_04670 6272 6859 gene locus_tag LOCUS_04680 6272 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083985.1 protein_id gnl|my_center|LOCUS_04680 7509 7015 gene locus_tag LOCUS_04690 gene atpF1 7509 7015 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHB8 protein_id gnl|my_center|LOCUS_04690 8151 7522 gene locus_tag LOCUS_04700 gene atpF2 8151 7522 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHB7 protein_id gnl|my_center|LOCUS_04700 8432 8205 gene locus_tag LOCUS_04710 gene atpE 8432 8205 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533642.1 protein_id gnl|my_center|LOCUS_04710 9272 8514 gene locus_tag LOCUS_04720 gene atpB 9272 8514 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_04720 9609 9313 gene locus_tag LOCUS_04730 9609 9313 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA3 protein_id gnl|my_center|LOCUS_04730 10480 10028 gene locus_tag LOCUS_04740 10480 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 10842 10510 gene locus_tag LOCUS_04750 10842 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence040 1008 451 gene locus_tag LOCUS_04760 1008 451 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 protein_id gnl|my_center|LOCUS_04760 1096 2004 gene locus_tag LOCUS_04770 gene gltX 1096 2004 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084190.1 protein_id gnl|my_center|LOCUS_04770 2009 2611 gene locus_tag LOCUS_04780 2009 2611 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977283.1 protein_id gnl|my_center|LOCUS_04780 2943 2695 gene locus_tag LOCUS_04790 2943 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2827 3198 gene locus_tag LOCUS_04800 2827 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4157 3195 gene locus_tag LOCUS_04810 4157 3195 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090122.1 protein_id gnl|my_center|LOCUS_04810 4714 4325 gene locus_tag LOCUS_04820 4714 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 5695 4976 gene locus_tag LOCUS_04830 5695 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 7207 5771 gene locus_tag LOCUS_04840 7207 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7649 9313 gene locus_tag LOCUS_04850 7649 9313 CDS product (2S)-methylsuccinyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_04850 9870 9433 gene locus_tag LOCUS_04860 9870 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 9984 11015 gene locus_tag LOCUS_04870 9984 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence041 416 105 gene locus_tag LOCUS_04880 416 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 685 1839 gene locus_tag LOCUS_04890 685 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_04890 2661 1846 gene locus_tag LOCUS_04900 2661 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 2969 2658 gene locus_tag LOCUS_04910 2969 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3082 3999 gene locus_tag LOCUS_04920 3082 3999 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_04920 5073 4012 gene locus_tag LOCUS_04930 5073 4012 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_04930 5228 6214 gene locus_tag LOCUS_04940 5228 6214 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265972.1 protein_id gnl|my_center|LOCUS_04940 6235 6561 gene locus_tag LOCUS_04950 6235 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7136 6603 gene locus_tag LOCUS_04960 7136 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7983 9491 gene locus_tag LOCUS_04970 7983 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 10066 9488 gene locus_tag LOCUS_04980 10066 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10391 10627 gene locus_tag LOCUS_04990 10391 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence042 878 802 gene locus_tag LOCUS_t00060 878 802 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1508 1068 gene locus_tag LOCUS_05000 1508 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 2050 1535 gene locus_tag LOCUS_05010 2050 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2636 2115 gene locus_tag LOCUS_05020 2636 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3537 2971 gene locus_tag LOCUS_05030 3537 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3925 3530 gene locus_tag LOCUS_05040 3925 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4148 3930 gene locus_tag LOCUS_05050 4148 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5048 4416 gene locus_tag LOCUS_05060 5048 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5841 5068 gene locus_tag LOCUS_05070 5841 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8071 6464 gene locus_tag LOCUS_05080 8071 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 8206 10053 gene locus_tag LOCUS_05090 8206 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 10651 10130 gene locus_tag LOCUS_05100 10651 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence043 2629 296 gene locus_tag LOCUS_05110 gene pcrA 2629 296 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXZ3 protein_id gnl|my_center|LOCUS_05110 4323 2695 gene locus_tag LOCUS_05120 4323 2695 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_05120 4506 4811 gene locus_tag LOCUS_05130 4506 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5330 4815 gene locus_tag LOCUS_05140 5330 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5845 5327 gene locus_tag LOCUS_05150 5845 5327 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089299.1 protein_id gnl|my_center|LOCUS_05150 6042 7442 gene locus_tag LOCUS_05160 6042 7442 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_05160 7709 7449 gene locus_tag LOCUS_05170 7709 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence044 270 923 gene locus_tag LOCUS_05180 270 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_05180 920 2215 gene locus_tag LOCUS_05190 gene kdtA 920 2215 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_05190 2202 3239 gene locus_tag LOCUS_05200 gene lpxK 2202 3239 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DC5 protein_id gnl|my_center|LOCUS_05200 3253 4131 gene locus_tag LOCUS_05210 3253 4131 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_05210 5122 4307 gene locus_tag LOCUS_05220 5122 4307 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_05220 5324 5115 gene locus_tag LOCUS_05230 5324 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532341.1 protein_id gnl|my_center|LOCUS_05230 7068 5548 gene locus_tag LOCUS_05240 gene xseA 7068 5548 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G2 protein_id gnl|my_center|LOCUS_05240 7201 8547 gene locus_tag LOCUS_05250 gene purD 7201 8547 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6P8 protein_id gnl|my_center|LOCUS_05250 8621 9718 gene locus_tag LOCUS_05260 8621 9718 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_05260 <10952 9715 gene locus_tag LOCUS_05270 <10952 9715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967826.1:mechanosensitive ion channel protein >Feature sequence045 1730 927 gene locus_tag LOCUS_05280 1730 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3177 2224 gene locus_tag LOCUS_05290 3177 2224 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709375.1 protein_id gnl|my_center|LOCUS_05290 3459 3818 gene locus_tag LOCUS_05300 3459 3818 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 protein_id gnl|my_center|LOCUS_05300 3940 5382 gene locus_tag LOCUS_05310 3940 5382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_05310 5495 5569 gene locus_tag LOCUS_t00070 5495 5569 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <10743 5663 gene locus_tag LOCUS_05320 <10743 5663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence046 <1 2342 gene locus_tag LOCUS_05330 <1 2342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:RND transporter 2444 2908 gene locus_tag LOCUS_05340 2444 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_05340 3628 2984 gene locus_tag LOCUS_05350 3628 2984 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_05350 4944 3634 gene locus_tag LOCUS_05360 4944 3634 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640276.1 protein_id gnl|my_center|LOCUS_05360 5053 6219 gene locus_tag LOCUS_05370 gene bioF 5053 6219 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE2 protein_id gnl|my_center|LOCUS_05370 6216 6896 gene locus_tag LOCUS_05380 gene bioD 6216 6896 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z2 protein_id gnl|my_center|LOCUS_05380 7176 6991 gene locus_tag LOCUS_05390 7176 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 7322 7534 gene locus_tag LOCUS_05400 7322 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8419 7574 gene locus_tag LOCUS_05410 8419 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9874 8501 gene locus_tag LOCUS_05420 9874 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence047 <1 1773 gene locus_tag LOCUS_05430 <1 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389885.1:glycosyl transferase 1770 2801 gene locus_tag LOCUS_05440 1770 2801 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_05440 2835 4604 gene locus_tag LOCUS_05450 2835 4604 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_05450 4709 5701 gene locus_tag LOCUS_05460 4709 5701 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 protein_id gnl|my_center|LOCUS_05460 5770 7635 gene locus_tag LOCUS_05470 5770 7635 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 protein_id gnl|my_center|LOCUS_05470 7696 8337 gene locus_tag LOCUS_05480 7696 8337 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_05480 8395 9939 gene locus_tag LOCUS_05490 8395 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence048 1031 30 gene locus_tag LOCUS_05500 gene aatA 1031 30 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CI70 protein_id gnl|my_center|LOCUS_05500 1812 1159 gene locus_tag LOCUS_05510 gene aox 1812 1159 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 protein_id gnl|my_center|LOCUS_05510 2639 1953 gene locus_tag LOCUS_05520 2639 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_05520 2737 4221 gene locus_tag LOCUS_05530 2737 4221 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810139.1 protein_id gnl|my_center|LOCUS_05530 4258 4866 gene locus_tag LOCUS_05540 4258 4866 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530087.1 protein_id gnl|my_center|LOCUS_05540 5044 7371 gene locus_tag LOCUS_05550 5044 7371 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_05550 7379 8044 gene locus_tag LOCUS_05560 7379 8044 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_05560 9591 8923 gene locus_tag LOCUS_05570 gene gst5 9591 8923 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_05570 10238 9747 gene locus_tag LOCUS_05580 10238 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence049 364 972 gene locus_tag LOCUS_05590 364 972 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_05590 3541 980 gene locus_tag LOCUS_05600 3541 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 4395 3781 gene locus_tag LOCUS_05610 4395 3781 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_05610 5360 4392 gene locus_tag LOCUS_05620 gene pip 5360 4392 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W8Y7 protein_id gnl|my_center|LOCUS_05620 5682 5476 gene locus_tag LOCUS_05630 5682 5476 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389274.1 protein_id gnl|my_center|LOCUS_05630 6169 7788 gene locus_tag LOCUS_05640 gene mccB 6169 7788 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_05640 7800 8594 gene locus_tag LOCUS_05650 7800 8594 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920030.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence050 199 939 gene locus_tag LOCUS_05660 gene cobB1 199 939 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_05660 1541 936 gene locus_tag LOCUS_05670 1541 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2438 1707 gene locus_tag LOCUS_05680 2438 1707 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_05680 2537 4135 gene locus_tag LOCUS_05690 gene algA 2537 4135 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_05690 5862 4165 gene locus_tag LOCUS_05700 5862 4165 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_05700 6131 5859 gene locus_tag LOCUS_05710 6131 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7664 6144 gene locus_tag LOCUS_05720 7664 6144 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_05720 9211 7661 gene locus_tag LOCUS_05730 9211 7661 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_05730 9645 9211 gene locus_tag LOCUS_05740 9645 9211 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_05740 10098 9649 gene locus_tag LOCUS_05750 10098 9649 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence051 2162 1050 gene locus_tag LOCUS_05760 2162 1050 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 protein_id gnl|my_center|LOCUS_05760 2610 2948 gene locus_tag LOCUS_05770 2610 2948 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_05770 3068 4474 gene locus_tag LOCUS_05780 gene glnA3 3068 4474 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCG7 protein_id gnl|my_center|LOCUS_05780 4839 4642 gene locus_tag LOCUS_05790 4839 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6553 5240 gene locus_tag LOCUS_05800 6553 5240 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_05800 6768 6553 gene locus_tag LOCUS_05810 6768 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6778 8823 gene locus_tag LOCUS_05820 gene parE 6778 8823 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD54 protein_id gnl|my_center|LOCUS_05820 8858 9565 gene locus_tag LOCUS_05830 8858 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence052 883 176 gene locus_tag LOCUS_05840 883 176 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_05840 2104 977 gene locus_tag LOCUS_05850 2104 977 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_05850 3448 2261 gene locus_tag LOCUS_05860 3448 2261 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_05860 3718 4536 gene locus_tag LOCUS_05870 3718 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5355 4486 gene locus_tag LOCUS_05880 5355 4486 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 protein_id gnl|my_center|LOCUS_05880 5583 6281 gene locus_tag LOCUS_05890 5583 6281 CDS product aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708268.1 protein_id gnl|my_center|LOCUS_05890 6381 7880 gene locus_tag LOCUS_05900 6381 7880 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_05900 7884 8300 gene locus_tag LOCUS_05910 7884 8300 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I644 protein_id gnl|my_center|LOCUS_05910 9133 8297 gene locus_tag LOCUS_05920 9133 8297 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIG5 protein_id gnl|my_center|LOCUS_05920 <9786 9146 gene locus_tag LOCUS_05930 <9786 9146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPD0:tRNA-dihydrouridine(20/20a) synthase >Feature sequence053 78 317 gene locus_tag LOCUS_05940 78 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 4177 380 gene locus_tag LOCUS_05950 4177 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088560.1 protein_id gnl|my_center|LOCUS_05950 4887 4174 gene locus_tag LOCUS_05960 4887 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5561 4884 gene locus_tag LOCUS_05970 5561 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6460 5738 gene locus_tag LOCUS_05980 6460 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_05980 6960 6493 gene locus_tag LOCUS_05990 6960 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8135 6957 gene locus_tag LOCUS_06000 gene fliM 8135 6957 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXB5 protein_id gnl|my_center|LOCUS_06000 8724 8173 gene locus_tag LOCUS_06010 8724 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence054 2244 1594 gene locus_tag LOCUS_06020 2244 1594 CDS product HTH-type transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMC3 protein_id gnl|my_center|LOCUS_06020 2457 3347 gene locus_tag LOCUS_06030 2457 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4869 3481 gene locus_tag LOCUS_06040 4869 3481 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_06040 5148 5786 gene locus_tag LOCUS_06050 5148 5786 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265774.1 protein_id gnl|my_center|LOCUS_06050 6695 5910 gene locus_tag LOCUS_06060 6695 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7806 6616 gene locus_tag LOCUS_06070 7806 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8239 7784 gene locus_tag LOCUS_06080 gene hfaA 8239 7784 CDS product holdfast attachment protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27342 protein_id gnl|my_center|LOCUS_06080 8565 9206 gene locus_tag LOCUS_06090 8565 9206 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence055 212 1237 gene locus_tag LOCUS_06100 gene hslO 212 1237 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1H2 protein_id gnl|my_center|LOCUS_06100 1314 1841 gene locus_tag LOCUS_06110 1314 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391022.1 protein_id gnl|my_center|LOCUS_06110 3000 1831 gene locus_tag LOCUS_06120 3000 1831 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_06120 3249 4574 gene locus_tag LOCUS_06130 3249 4574 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708486.1 protein_id gnl|my_center|LOCUS_06130 4577 7831 gene locus_tag LOCUS_06140 4577 7831 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06140 <9412 7856 gene locus_tag LOCUS_06150 <9412 7856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706128.1:short chain dehydrogenase >Feature sequence056 <1 664 gene locus_tag LOCUS_06160 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702326.1:putative fatty acid desaturase 803 2431 gene locus_tag LOCUS_06170 803 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_06170 2844 2428 gene locus_tag LOCUS_06180 2844 2428 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089903.1 protein_id gnl|my_center|LOCUS_06180 3007 3519 gene locus_tag LOCUS_06190 3007 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187158.1 protein_id gnl|my_center|LOCUS_06190 4053 3562 gene locus_tag LOCUS_06200 4053 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4252 4941 gene locus_tag LOCUS_06210 4252 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102977.1 protein_id gnl|my_center|LOCUS_06210 4938 6824 gene locus_tag LOCUS_06220 4938 6824 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102976.1 protein_id gnl|my_center|LOCUS_06220 6811 7722 gene locus_tag LOCUS_06230 6811 7722 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence057 375 1331 gene locus_tag LOCUS_06240 375 1331 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225255.1 protein_id gnl|my_center|LOCUS_06240 1426 2433 gene locus_tag LOCUS_06250 1426 2433 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_06250 3471 2464 gene locus_tag LOCUS_06260 3471 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 protein_id gnl|my_center|LOCUS_06260 3605 4486 gene locus_tag LOCUS_06270 3605 4486 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_06270 4583 5827 gene locus_tag LOCUS_06280 4583 5827 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_06280 6850 5837 gene locus_tag LOCUS_06290 6850 5837 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_06290 7887 6850 gene locus_tag LOCUS_06300 7887 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 <9311 8240 gene locus_tag LOCUS_06310 <9311 8240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190901.1:aldehyde dehydrogenase >Feature sequence058 1640 426 gene locus_tag LOCUS_06320 1640 426 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808460.1 protein_id gnl|my_center|LOCUS_06320 2246 2638 gene locus_tag LOCUS_06330 2246 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3505 2654 gene locus_tag LOCUS_06340 3505 2654 CDS product 2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_06340 4126 3515 gene locus_tag LOCUS_06350 gene trpG 4126 3515 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 protein_id gnl|my_center|LOCUS_06350 5475 4123 gene locus_tag LOCUS_06360 5475 4123 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920790.1 protein_id gnl|my_center|LOCUS_06360 5754 6584 gene locus_tag LOCUS_06370 5754 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6605 7414 gene locus_tag LOCUS_06380 6605 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 7423 7809 gene locus_tag LOCUS_06390 7423 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918395.1 protein_id gnl|my_center|LOCUS_06390 7810 8436 gene locus_tag LOCUS_06400 7810 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence059 1143 574 gene locus_tag LOCUS_06410 1143 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2264 1209 gene locus_tag LOCUS_06420 2264 1209 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_06420 3011 2382 gene locus_tag LOCUS_06430 3011 2382 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_06430 3152 3027 gene locus_tag LOCUS_06440 gene rpmJ 3152 3027 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH8 protein_id gnl|my_center|LOCUS_06440 3436 4452 gene locus_tag LOCUS_06450 3436 4452 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_06450 5079 4456 gene locus_tag LOCUS_06460 5079 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5813 5106 gene locus_tag LOCUS_06470 5813 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7295 5976 gene locus_tag LOCUS_06480 7295 5976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_06480 7422 8150 gene locus_tag LOCUS_06490 7422 8150 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence060 <1 671 gene locus_tag LOCUS_06500 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707495.1:short chain dehydrogenase 678 1112 gene locus_tag LOCUS_06510 678 1112 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_06510 1469 3412 gene locus_tag LOCUS_06520 gene uvrC 1469 3412 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKK4 protein_id gnl|my_center|LOCUS_06520 3469 4134 gene locus_tag LOCUS_06530 3469 4134 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532480.1 protein_id gnl|my_center|LOCUS_06530 4135 4395 gene locus_tag LOCUS_06540 gene moaD 4135 4395 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_06540 4400 4852 gene locus_tag LOCUS_06550 gene moaE 4400 4852 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_06550 5755 4859 gene locus_tag LOCUS_06560 5755 4859 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_06560 6012 6545 gene locus_tag LOCUS_06570 gene petP 6012 6545 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385502.1 protein_id gnl|my_center|LOCUS_06570 6538 7257 gene locus_tag LOCUS_06580 6538 7257 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708803.1 protein_id gnl|my_center|LOCUS_06580 7313 8698 gene locus_tag LOCUS_06590 7313 8698 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence061 1279 233 gene locus_tag LOCUS_06600 1279 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 1455 2102 gene locus_tag LOCUS_06610 1455 2102 CDS product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 protein_id gnl|my_center|LOCUS_06610 3949 2177 gene locus_tag LOCUS_06620 3949 2177 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_06620 4320 3970 gene locus_tag LOCUS_06630 4320 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5087 4422 gene locus_tag LOCUS_06640 5087 4422 CDS product putative transcriptional regulator, TetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703936.1 protein_id gnl|my_center|LOCUS_06640 5147 5344 gene locus_tag LOCUS_06650 5147 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5381 6565 gene locus_tag LOCUS_06660 5381 6565 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039906.1 protein_id gnl|my_center|LOCUS_06660 7779 6577 gene locus_tag LOCUS_06670 7779 6577 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_06670 7948 8157 gene locus_tag LOCUS_06680 7948 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 8797 8189 gene locus_tag LOCUS_06690 8797 8189 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence062 <1 1250 gene locus_tag LOCUS_06700 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92LJ6:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1247 1621 gene locus_tag LOCUS_06710 1247 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1682 3088 gene locus_tag LOCUS_06720 gene lpdA 1682 3088 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X65 protein_id gnl|my_center|LOCUS_06720 4065 3100 gene locus_tag LOCUS_06730 gene xerC 4065 3100 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDN2 protein_id gnl|my_center|LOCUS_06730 4950 4084 gene locus_tag LOCUS_06740 4950 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5073 7289 gene locus_tag LOCUS_06750 gene priA 5073 7289 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL6 protein_id gnl|my_center|LOCUS_06750 <9097 7313 gene locus_tag LOCUS_06760 <9097 7313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:diguanylate cyclase >Feature sequence063 216 1274 gene locus_tag LOCUS_06770 216 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2385 1486 gene locus_tag LOCUS_06780 2385 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3020 3448 gene locus_tag LOCUS_06790 3020 3448 CDS product DNA N-6-adenine-methyltransferase of bacteriophage inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254197.1 protein_id gnl|my_center|LOCUS_06790 3466 4269 gene locus_tag LOCUS_06800 3466 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4502 5398 gene locus_tag LOCUS_06810 4502 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55426 protein_id gnl|my_center|LOCUS_06810 5626 5793 gene locus_tag LOCUS_06820 5626 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5797 5988 gene locus_tag LOCUS_06830 5797 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5994 6209 gene locus_tag LOCUS_06840 5994 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6641 6177 gene locus_tag LOCUS_06850 6641 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7005 6652 gene locus_tag LOCUS_06860 7005 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7331 7492 gene locus_tag LOCUS_06870 7331 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence064 243 2183 gene locus_tag LOCUS_06880 gene thrS 243 2183 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAX8 protein_id gnl|my_center|LOCUS_06880 4415 2259 gene locus_tag LOCUS_06890 4415 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6771 4615 gene locus_tag LOCUS_06900 6771 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6910 8694 gene locus_tag LOCUS_06910 6910 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence065 374 745 gene locus_tag LOCUS_06920 374 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1216 776 gene locus_tag LOCUS_06930 1216 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1305 1751 gene locus_tag LOCUS_06940 1305 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2699 1767 gene locus_tag LOCUS_06950 gene prs 2699 1767 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N73 protein_id gnl|my_center|LOCUS_06950 3821 2808 gene locus_tag LOCUS_06960 3821 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4053 3829 gene locus_tag LOCUS_06970 4053 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4735 3959 gene locus_tag LOCUS_06980 4735 3959 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFJ6 protein_id gnl|my_center|LOCUS_06980 5823 4741 gene locus_tag LOCUS_06990 5823 4741 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_06990 6731 5823 gene locus_tag LOCUS_07000 gene lgt 6731 5823 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDB4 protein_id gnl|my_center|LOCUS_07000 6972 7247 gene locus_tag LOCUS_07010 6972 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 protein_id gnl|my_center|LOCUS_07010 7474 7974 gene locus_tag LOCUS_07020 7474 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090187.1 protein_id gnl|my_center|LOCUS_07020 7980 8816 gene locus_tag LOCUS_07030 gene proC 7980 8816 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI5 protein_id gnl|my_center|LOCUS_07030 >Feature sequence066 <1 1474 gene locus_tag LOCUS_07040 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228250.1:polyhydroxyalkanoate synthase 1526 2338 gene locus_tag LOCUS_07050 gene phaD 1526 2338 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_07050 2340 3410 gene locus_tag LOCUS_07060 2340 3410 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_07060 4762 3443 gene locus_tag LOCUS_07070 4762 3443 CDS product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_07070 5081 4899 gene locus_tag LOCUS_07080 5081 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721784.1 protein_id gnl|my_center|LOCUS_07080 5172 6047 gene locus_tag LOCUS_07090 5172 6047 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_07090 6257 6090 gene locus_tag LOCUS_07100 6257 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721784.1 protein_id gnl|my_center|LOCUS_07100 6466 8124 gene locus_tag LOCUS_07110 6466 8124 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383668.1 protein_id gnl|my_center|LOCUS_07110 8859 8134 gene locus_tag LOCUS_07120 8859 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence067 <1 643 gene locus_tag LOCUS_07130 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UI28:methionine aminopeptidase 647 1717 gene locus_tag LOCUS_07140 647 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2435 1695 gene locus_tag LOCUS_07150 2435 1695 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090573.1 protein_id gnl|my_center|LOCUS_07150 2553 3260 gene locus_tag LOCUS_07160 2553 3260 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_07160 4792 3266 gene locus_tag LOCUS_07170 gene ggt 4792 3266 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_07170 6424 4811 gene locus_tag LOCUS_07180 gene pckA 6424 4811 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEJ7 protein_id gnl|my_center|LOCUS_07180 7040 7780 gene locus_tag LOCUS_07190 gene chvI 7040 7780 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970615.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence068 700 1188 gene locus_tag LOCUS_07200 700 1188 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_07200 2003 1500 gene locus_tag LOCUS_07210 2003 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2821 2024 gene locus_tag LOCUS_07220 2821 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI89 protein_id gnl|my_center|LOCUS_07220 2907 3356 gene locus_tag LOCUS_07230 2907 3356 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769553.1 protein_id gnl|my_center|LOCUS_07230 3443 4075 gene locus_tag LOCUS_07240 3443 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4072 5979 gene locus_tag LOCUS_07250 4072 5979 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVC5 protein_id gnl|my_center|LOCUS_07250 6129 7154 gene locus_tag LOCUS_07260 6129 7154 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 protein_id gnl|my_center|LOCUS_07260 7212 8471 gene locus_tag LOCUS_07270 7212 8471 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920352.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence069 <1 588 gene locus_tag LOCUS_07280 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537501.1:glutamine amidotransferase 1256 585 gene locus_tag LOCUS_07290 gene rluA 1256 585 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSW3 protein_id gnl|my_center|LOCUS_07290 1837 1253 gene locus_tag LOCUS_07300 1837 1253 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226788.1 protein_id gnl|my_center|LOCUS_07300 1938 2312 gene locus_tag LOCUS_07310 1938 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2861 2319 gene locus_tag LOCUS_07320 2861 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3510 3046 gene locus_tag LOCUS_07330 3510 3046 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_07330 4734 3520 gene locus_tag LOCUS_07340 gene dcaF 4734 3520 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_07340 4852 5772 gene locus_tag LOCUS_07350 gene dhmA 4852 5772 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_07350 6631 5816 gene locus_tag LOCUS_07360 6631 5816 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_07360 7734 6634 gene locus_tag LOCUS_07370 gene luxA 7734 6634 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263741.1 protein_id gnl|my_center|LOCUS_07370 8232 7789 gene locus_tag LOCUS_07380 8232 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence070 <1 651 gene locus_tag LOCUS_07390 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265509.1:ABC transporter ATP-binding protein 1277 669 gene locus_tag LOCUS_07400 1277 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1580 1656 gene locus_tag LOCUS_t00080 1580 1656 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1771 2814 gene locus_tag LOCUS_07410 1771 2814 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040073.1 protein_id gnl|my_center|LOCUS_07410 4137 2833 gene locus_tag LOCUS_07420 4137 2833 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390196.1 protein_id gnl|my_center|LOCUS_07420 4388 4137 gene locus_tag LOCUS_07430 4388 4137 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385708.1 protein_id gnl|my_center|LOCUS_07430 4743 4567 gene locus_tag LOCUS_07440 4743 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5255 4980 gene locus_tag LOCUS_07450 5255 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 7551 5506 gene locus_tag LOCUS_07460 7551 5506 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence071 269 943 gene locus_tag LOCUS_07470 269 943 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120276.1 protein_id gnl|my_center|LOCUS_07470 1011 1829 gene locus_tag LOCUS_07480 1011 1829 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969349.1 protein_id gnl|my_center|LOCUS_07480 2330 1833 gene locus_tag LOCUS_07490 2330 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460054.1 protein_id gnl|my_center|LOCUS_07490 3716 2379 gene locus_tag LOCUS_07500 3716 2379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_07500 4985 3726 gene locus_tag LOCUS_07510 4985 3726 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_07510 5881 4991 gene locus_tag LOCUS_07520 5881 4991 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_07520 7182 5878 gene locus_tag LOCUS_07530 7182 5878 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_07530 8699 7248 gene locus_tag LOCUS_07540 gene phrA 8699 7248 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_07540 >Feature sequence072 <1 1158 gene locus_tag LOCUS_07550 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89IN3:microcystinase C 1568 1131 gene locus_tag LOCUS_07560 1568 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2346 1561 gene locus_tag LOCUS_07570 gene xthA 2346 1561 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 protein_id gnl|my_center|LOCUS_07570 2785 2408 gene locus_tag LOCUS_07580 2785 2408 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531288.1 protein_id gnl|my_center|LOCUS_07580 2930 3385 gene locus_tag LOCUS_07590 gene ytoQ 2930 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_07590 3389 4591 gene locus_tag LOCUS_07600 3389 4591 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 protein_id gnl|my_center|LOCUS_07600 4685 6451 gene locus_tag LOCUS_07610 gene argS 4685 6451 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBT3 protein_id gnl|my_center|LOCUS_07610 6508 7317 gene locus_tag LOCUS_07620 6508 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7317 8351 gene locus_tag LOCUS_07630 7317 8351 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence073 1512 712 gene locus_tag LOCUS_07640 gene mvrA 1512 712 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 protein_id gnl|my_center|LOCUS_07640 1919 2200 gene locus_tag LOCUS_07650 1919 2200 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_07650 2293 2583 gene locus_tag LOCUS_07660 2293 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2602 4296 gene locus_tag LOCUS_07670 2602 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4293 4691 gene locus_tag LOCUS_07680 4293 4691 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775533.1 protein_id gnl|my_center|LOCUS_07680 4688 5821 gene locus_tag LOCUS_07690 4688 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 5818 6513 gene locus_tag LOCUS_07700 5818 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6523 7488 gene locus_tag LOCUS_07710 6523 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8174 7485 gene locus_tag LOCUS_07720 gene ptmB 8174 7485 CDS product posttranslational modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_07720 <8721 8174 gene locus_tag LOCUS_07730 <8721 8174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459658.1:alcohol dehydrogenase >Feature sequence074 2365 347 gene locus_tag LOCUS_07740 2365 347 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083190.1 protein_id gnl|my_center|LOCUS_07740 2911 4668 gene locus_tag LOCUS_07750 2911 4668 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039283.1 protein_id gnl|my_center|LOCUS_07750 4790 5632 gene locus_tag LOCUS_07760 gene yfdC 4790 5632 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 protein_id gnl|my_center|LOCUS_07760 6004 5702 gene locus_tag LOCUS_07770 6004 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5921 7672 gene locus_tag LOCUS_07780 5921 7672 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence075 1245 460 gene locus_tag LOCUS_07790 1245 460 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_07790 2799 1249 gene locus_tag LOCUS_07800 gene metG 2799 1249 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFA2 protein_id gnl|my_center|LOCUS_07800 3953 2832 gene locus_tag LOCUS_07810 3953 2832 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338405.1 protein_id gnl|my_center|LOCUS_07810 4615 3953 gene locus_tag LOCUS_07820 gene tmk 4615 3953 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D5 protein_id gnl|my_center|LOCUS_07820 5772 4615 gene locus_tag LOCUS_07830 5772 4615 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_07830 6942 5920 gene locus_tag LOCUS_07840 6942 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_07840 7075 8412 gene locus_tag LOCUS_07850 7075 8412 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence076 2290 1595 gene locus_tag LOCUS_07860 2290 1595 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086897.1 protein_id gnl|my_center|LOCUS_07860 3350 2283 gene locus_tag LOCUS_07870 gene perM 3350 2283 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969095.1 protein_id gnl|my_center|LOCUS_07870 3939 3337 gene locus_tag LOCUS_07880 3939 3337 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_07880 5234 3936 gene locus_tag LOCUS_07890 5234 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5465 6508 gene locus_tag LOCUS_07900 gene purM 5465 6508 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG8 protein_id gnl|my_center|LOCUS_07900 6505 7158 gene locus_tag LOCUS_07910 gene purN 6505 7158 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WI1 protein_id gnl|my_center|LOCUS_07910 7600 7178 gene locus_tag LOCUS_07920 gene ndk 7600 7178 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QX9 protein_id gnl|my_center|LOCUS_07920 >Feature sequence077 298 795 gene locus_tag LOCUS_07930 298 795 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_07930 874 2265 gene locus_tag LOCUS_07940 874 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2906 2262 gene locus_tag LOCUS_07950 2906 2262 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920499.1 protein_id gnl|my_center|LOCUS_07950 3839 2919 gene locus_tag LOCUS_07960 3839 2919 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF36 protein_id gnl|my_center|LOCUS_07960 5153 3936 gene locus_tag LOCUS_07970 gene fabB 5153 3936 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_07970 5746 5219 gene locus_tag LOCUS_07980 gene fabA 5746 5219 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 protein_id gnl|my_center|LOCUS_07980 5947 6585 gene locus_tag LOCUS_07990 5947 6585 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_07990 6653 7060 gene locus_tag LOCUS_08000 6653 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 7239 7667 gene locus_tag LOCUS_08010 7239 7667 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_08010 7915 8334 gene locus_tag LOCUS_08020 7915 8334 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence078 1404 1015 gene locus_tag LOCUS_08030 gene rpsK 1404 1015 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59370 protein_id gnl|my_center|LOCUS_08030 1855 1487 gene locus_tag LOCUS_08040 gene rpsM 1855 1487 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 protein_id gnl|my_center|LOCUS_08040 2690 2112 gene locus_tag LOCUS_08050 gene adk 2690 2112 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY1 protein_id gnl|my_center|LOCUS_08050 4018 2687 gene locus_tag LOCUS_08060 gene prlA 4018 2687 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA4 protein_id gnl|my_center|LOCUS_08060 4575 4078 gene locus_tag LOCUS_08070 gene rplO 4575 4078 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ8 protein_id gnl|my_center|LOCUS_08070 4835 4644 gene locus_tag LOCUS_08080 gene rpmD 4835 4644 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68995 protein_id gnl|my_center|LOCUS_08080 5430 4846 gene locus_tag LOCUS_08090 gene rpsE 5430 4846 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA1 protein_id gnl|my_center|LOCUS_08090 5798 5448 gene locus_tag LOCUS_08100 gene rplR 5798 5448 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE34 protein_id gnl|my_center|LOCUS_08100 6361 5828 gene locus_tag LOCUS_08110 gene rplF 6361 5828 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J99 protein_id gnl|my_center|LOCUS_08110 6811 6413 gene locus_tag LOCUS_08120 gene rpsH 6811 6413 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE32 protein_id gnl|my_center|LOCUS_08120 7128 6823 gene locus_tag LOCUS_08130 gene rpsN 7128 6823 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF7 protein_id gnl|my_center|LOCUS_08130 7756 7184 gene locus_tag LOCUS_08140 gene rplE 7756 7184 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD6 protein_id gnl|my_center|LOCUS_08140 8072 7749 gene locus_tag LOCUS_08150 gene rplX 8072 7749 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_08150 8445 8077 gene locus_tag LOCUS_08160 gene rplN 8445 8077 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD4 protein_id gnl|my_center|LOCUS_08160 >Feature sequence079 50 682 gene locus_tag LOCUS_08170 gene gpmA 50 682 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP0 protein_id gnl|my_center|LOCUS_08170 1217 705 gene locus_tag LOCUS_08180 1217 705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_08180 1321 2040 gene locus_tag LOCUS_08190 1321 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2432 2037 gene locus_tag LOCUS_08200 2432 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3163 2465 gene locus_tag LOCUS_08210 3163 2465 CDS product cysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083518.1 protein_id gnl|my_center|LOCUS_08210 3359 4351 gene locus_tag LOCUS_08220 3359 4351 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 protein_id gnl|my_center|LOCUS_08220 4884 4489 gene locus_tag LOCUS_08230 4884 4489 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_08230 5249 4890 gene locus_tag LOCUS_08240 gene hisE 5249 4890 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA8 protein_id gnl|my_center|LOCUS_08240 6575 5358 gene locus_tag LOCUS_08250 6575 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_08250 8233 6614 gene locus_tag LOCUS_08260 8233 6614 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence080 45 857 gene locus_tag LOCUS_08270 45 857 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388462.1 protein_id gnl|my_center|LOCUS_08270 865 1551 gene locus_tag LOCUS_08280 gene modB 865 1551 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 protein_id gnl|my_center|LOCUS_08280 1567 1779 gene locus_tag LOCUS_08290 gene madF 1567 1779 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_08290 1805 2197 gene locus_tag LOCUS_08300 1805 2197 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640410.1 protein_id gnl|my_center|LOCUS_08300 3576 2194 gene locus_tag LOCUS_08310 3576 2194 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_08310 5062 3692 gene locus_tag LOCUS_08320 5062 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_08320 6092 5316 gene locus_tag LOCUS_08330 6092 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7053 6298 gene locus_tag LOCUS_08340 7053 6298 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337109.1 protein_id gnl|my_center|LOCUS_08340 7294 7218 gene locus_tag LOCUS_t00090 7294 7218 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7633 7325 gene locus_tag LOCUS_08350 7633 7325 CDS product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_08350 8429 7734 gene locus_tag LOCUS_08360 8429 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence081 822 460 gene locus_tag LOCUS_08370 822 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1258 824 gene locus_tag LOCUS_08380 1258 824 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532659.1 protein_id gnl|my_center|LOCUS_08380 1923 1510 gene locus_tag LOCUS_08390 1923 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3047 2160 gene locus_tag LOCUS_08400 3047 2160 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_08400 4847 3183 gene locus_tag LOCUS_08410 4847 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6114 5029 gene locus_tag LOCUS_08420 6114 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 6583 8274 gene locus_tag LOCUS_08430 6583 8274 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence082 35 1174 gene locus_tag LOCUS_08440 35 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1368 1781 gene locus_tag LOCUS_08450 gene flbT1 1368 1781 CDS product putative flagellum biosynthesis repressor protein FlbT 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HZ2 protein_id gnl|my_center|LOCUS_08450 1744 2112 gene locus_tag LOCUS_08460 gene flaF 1744 2112 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008554779.1 protein_id gnl|my_center|LOCUS_08460 3696 2203 gene locus_tag LOCUS_08470 3696 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5598 3718 gene locus_tag LOCUS_08480 5598 3718 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 protein_id gnl|my_center|LOCUS_08480 7061 5670 gene locus_tag LOCUS_08490 7061 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7358 8203 gene locus_tag LOCUS_08500 7358 8203 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089434.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence083 1522 1127 gene locus_tag LOCUS_08510 1522 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2292 1573 gene locus_tag LOCUS_08520 gene trmD 2292 1573 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_08520 2878 2279 gene locus_tag LOCUS_08530 gene rimM 2878 2279 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 protein_id gnl|my_center|LOCUS_08530 3331 2891 gene locus_tag LOCUS_08540 3331 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5033 3459 gene locus_tag LOCUS_08550 gene ffh 5033 3459 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L45 protein_id gnl|my_center|LOCUS_08550 5736 5230 gene locus_tag LOCUS_08560 5736 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6882 5827 gene locus_tag LOCUS_08570 6882 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7049 7483 gene locus_tag LOCUS_08580 7049 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8326 7496 gene locus_tag LOCUS_08590 8326 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence084 576 1073 gene locus_tag LOCUS_08600 576 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1122 2069 gene locus_tag LOCUS_08610 1122 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2133 3080 gene locus_tag LOCUS_08620 2133 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3167 3877 gene locus_tag LOCUS_08630 3167 3877 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084685.1 protein_id gnl|my_center|LOCUS_08630 3932 4603 gene locus_tag LOCUS_08640 3932 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4590 4820 gene locus_tag LOCUS_08650 4590 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5189 4833 gene locus_tag LOCUS_08660 5189 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5445 6794 gene locus_tag LOCUS_08670 5445 6794 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_08670 7838 6804 gene locus_tag LOCUS_08680 gene pyrC 7838 6804 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD18 protein_id gnl|my_center|LOCUS_08680 >Feature sequence085 <1 805 gene locus_tag LOCUS_08690 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087855.1:transporter 864 1835 gene locus_tag LOCUS_08700 gene pyrB 864 1835 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K19 protein_id gnl|my_center|LOCUS_08700 1864 3147 gene locus_tag LOCUS_08710 gene pyrC 1864 3147 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K18 protein_id gnl|my_center|LOCUS_08710 3190 3828 gene locus_tag LOCUS_08720 gene plsY 3190 3828 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ47 protein_id gnl|my_center|LOCUS_08720 3836 4981 gene locus_tag LOCUS_08730 3836 4981 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971531.1 protein_id gnl|my_center|LOCUS_08730 5231 4995 gene locus_tag LOCUS_08740 5231 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5579 8287 gene locus_tag LOCUS_08750 gene topA 5579 8287 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_08750 >Feature sequence086 <1 850 gene locus_tag LOCUS_08760 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083801.1:acyl-CoA dehydrogenase 1461 847 gene locus_tag LOCUS_08770 1461 847 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_08770 2188 1472 gene locus_tag LOCUS_08780 2188 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2340 2723 gene locus_tag LOCUS_08790 2340 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3187 2744 gene locus_tag LOCUS_08800 3187 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3282 4127 gene locus_tag LOCUS_08810 3282 4127 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_08810 4160 4489 gene locus_tag LOCUS_08820 4160 4489 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 protein_id gnl|my_center|LOCUS_08820 5391 4486 gene locus_tag LOCUS_08830 5391 4486 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_08830 6931 5624 gene locus_tag LOCUS_08840 6931 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_08840 6910 7107 gene locus_tag LOCUS_08850 6910 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 8207 7101 gene locus_tag LOCUS_08860 8207 7101 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266766.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence087 1124 144 gene locus_tag LOCUS_08870 gene trxB 1124 144 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DQ9 protein_id gnl|my_center|LOCUS_08870 1934 1332 gene locus_tag LOCUS_08880 1934 1332 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_08880 3468 2503 gene locus_tag LOCUS_08890 3468 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_08890 3694 4185 gene locus_tag LOCUS_08900 gene putR 3694 4185 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_08900 4874 4401 gene locus_tag LOCUS_08910 gene greA 4874 4401 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1V7 protein_id gnl|my_center|LOCUS_08910 5550 5170 gene locus_tag LOCUS_08920 5550 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 <8296 5727 gene locus_tag LOCUS_08930 <8296 5727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89DR2:carbamoyl-phosphate synthase large chain >Feature sequence088 1476 3170 gene locus_tag LOCUS_08940 1476 3170 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528911.1 protein_id gnl|my_center|LOCUS_08940 3237 4361 gene locus_tag LOCUS_08950 3237 4361 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_08950 4473 4934 gene locus_tag LOCUS_08960 4473 4934 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122325.1 protein_id gnl|my_center|LOCUS_08960 5108 5183 gene locus_tag LOCUS_t00100 5108 5183 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5342 6010 gene locus_tag LOCUS_08970 5342 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6140 6496 gene locus_tag LOCUS_08980 6140 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6968 6519 gene locus_tag LOCUS_08990 6968 6519 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 protein_id gnl|my_center|LOCUS_08990 7125 7598 gene locus_tag LOCUS_09000 7125 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7610 7993 gene locus_tag LOCUS_09010 7610 7993 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence089 623 78 gene locus_tag LOCUS_09020 623 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1967 804 gene locus_tag LOCUS_09030 1967 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_09030 2630 2037 gene locus_tag LOCUS_09040 2630 2037 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_09040 3427 2630 gene locus_tag LOCUS_09050 gene caiD 3427 2630 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787370.1 protein_id gnl|my_center|LOCUS_09050 3838 3449 gene locus_tag LOCUS_09060 3838 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 protein_id gnl|my_center|LOCUS_09060 4869 3838 gene locus_tag LOCUS_09070 4869 3838 CDS product tyrosine protein kinase:aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_09070 5897 4866 gene locus_tag LOCUS_09080 5897 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6057 6779 gene locus_tag LOCUS_09090 6057 6779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_09090 6783 7121 gene locus_tag LOCUS_09100 6783 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 <8236 7103 gene locus_tag LOCUS_09110 <8236 7103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531908.1:ATP-dependent DNA helicase RecG >Feature sequence090 220 753 gene locus_tag LOCUS_09120 220 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1559 750 gene locus_tag LOCUS_09130 1559 750 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971115.1 protein_id gnl|my_center|LOCUS_09130 1717 2772 gene locus_tag LOCUS_09140 gene rihA 1717 2772 CDS product purine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223529.1 protein_id gnl|my_center|LOCUS_09140 2832 3746 gene locus_tag LOCUS_09150 2832 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 protein_id gnl|my_center|LOCUS_09150 3751 4326 gene locus_tag LOCUS_09160 3751 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5474 4323 gene locus_tag LOCUS_09170 gene ygaY 5474 4323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206250.1 protein_id gnl|my_center|LOCUS_09170 6465 5629 gene locus_tag LOCUS_09180 6465 5629 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_09180 6648 7538 gene locus_tag LOCUS_09190 gene pcaD 6648 7538 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_09190 <8229 7545 gene locus_tag LOCUS_09200 <8229 7545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836546.1:NADH-dependent flavin oxidoreductase >Feature sequence091 1669 488 gene locus_tag LOCUS_09210 gene proB 1669 488 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X86 protein_id gnl|my_center|LOCUS_09210 2748 1666 gene locus_tag LOCUS_09220 gene obg 2748 1666 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CB41 protein_id gnl|my_center|LOCUS_09220 3365 2745 gene locus_tag LOCUS_09230 3365 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3941 3375 gene locus_tag LOCUS_09240 3941 3375 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_09240 4345 4067 gene locus_tag LOCUS_09250 gene rpmA 4345 4067 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR6 protein_id gnl|my_center|LOCUS_09250 4710 4390 gene locus_tag LOCUS_09260 gene rplU 4710 4390 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9X5 protein_id gnl|my_center|LOCUS_09260 5629 4883 gene locus_tag LOCUS_09270 gene pcs 5629 4883 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_09270 5715 6437 gene locus_tag LOCUS_09280 5715 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232567.2 protein_id gnl|my_center|LOCUS_09280 6470 6664 gene locus_tag LOCUS_09290 6470 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 6774 6863 gene locus_tag LOCUS_t00110 6774 6863 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6971 7465 gene locus_tag LOCUS_09300 6971 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119100.1 protein_id gnl|my_center|LOCUS_09300 <8162 7478 gene locus_tag LOCUS_09310 <8162 7478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228679.1:3-hydroxybutyryl-CoA dehydratase >Feature sequence092 62 850 gene locus_tag LOCUS_09320 62 850 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_09320 1343 858 gene locus_tag LOCUS_09330 1343 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1906 1364 gene locus_tag LOCUS_09340 1906 1364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_09340 3149 1992 gene locus_tag LOCUS_09350 3149 1992 CDS product ammonia monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 protein_id gnl|my_center|LOCUS_09350 3913 3146 gene locus_tag LOCUS_09360 gene nadK 3913 3146 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QJ0 protein_id gnl|my_center|LOCUS_09360 3997 4332 gene locus_tag LOCUS_09370 3997 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4410 5903 gene locus_tag LOCUS_09380 gene glpK1 4410 5903 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_09380 6026 7429 gene locus_tag LOCUS_09390 6026 7429 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence093 <1 821 gene locus_tag LOCUS_09400 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729177.1:oxidoreductase 934 1152 gene locus_tag LOCUS_09410 934 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_09410 1974 1201 gene locus_tag LOCUS_09420 1974 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2276 2587 gene locus_tag LOCUS_09430 2276 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3039 3329 gene locus_tag LOCUS_09440 3039 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4604 3513 gene locus_tag LOCUS_09450 4604 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088336.1 protein_id gnl|my_center|LOCUS_09450 5182 4745 gene locus_tag LOCUS_09460 5182 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_09460 5384 6088 gene locus_tag LOCUS_09470 5384 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6096 6707 gene locus_tag LOCUS_09480 6096 6707 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920954.1 protein_id gnl|my_center|LOCUS_09480 <8055 6729 gene locus_tag LOCUS_09490 <8055 6729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339001.1:dTDP-glucose 4,6-dehydratase >Feature sequence094 35 529 gene locus_tag LOCUS_09500 35 529 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_09500 1203 541 gene locus_tag LOCUS_09510 1203 541 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168185.1 protein_id gnl|my_center|LOCUS_09510 1311 1961 gene locus_tag LOCUS_09520 1311 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2040 2564 gene locus_tag LOCUS_09530 2040 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3043 2672 gene locus_tag LOCUS_09540 3043 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4568 3303 gene locus_tag LOCUS_09550 4568 3303 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389421.1 protein_id gnl|my_center|LOCUS_09550 4692 6029 gene locus_tag LOCUS_09560 4692 6029 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_09560 6248 6048 gene locus_tag LOCUS_09570 6248 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7536 6343 gene locus_tag LOCUS_09580 gene chrA 7536 6343 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence095 2767 1775 gene locus_tag LOCUS_09590 gene cobS 2767 1775 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083012.1 protein_id gnl|my_center|LOCUS_09590 3719 3054 gene locus_tag LOCUS_09600 3719 3054 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709225.1 protein_id gnl|my_center|LOCUS_09600 3756 4031 gene locus_tag LOCUS_09610 3756 4031 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_09610 5321 4035 gene locus_tag LOCUS_09620 5321 4035 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_09620 6457 5318 gene locus_tag LOCUS_09630 gene aroB 6457 5318 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_09630 7097 6504 gene locus_tag LOCUS_09640 gene aroK 7097 6504 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 protein_id gnl|my_center|LOCUS_09640 7338 7478 gene locus_tag LOCUS_09650 7338 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence096 2041 569 gene locus_tag LOCUS_09660 2041 569 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_09660 2937 2269 gene locus_tag LOCUS_09670 2937 2269 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531278.1 protein_id gnl|my_center|LOCUS_09670 3163 3236 gene locus_tag LOCUS_t00120 3163 3236 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3761 3294 gene locus_tag LOCUS_09680 3761 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3802 3877 gene locus_tag LOCUS_t00130 3802 3877 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4339 3965 gene locus_tag LOCUS_09690 4339 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4507 5133 gene locus_tag LOCUS_09700 4507 5133 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090892.1 protein_id gnl|my_center|LOCUS_09700 5179 6198 gene locus_tag LOCUS_09710 5179 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114465.1 protein_id gnl|my_center|LOCUS_09710 6208 7068 gene locus_tag LOCUS_09720 6208 7068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114458.1 protein_id gnl|my_center|LOCUS_09720 7065 7895 gene locus_tag LOCUS_09730 7065 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence097 1388 375 gene locus_tag LOCUS_09740 1388 375 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530708.1 protein_id gnl|my_center|LOCUS_09740 2344 1463 gene locus_tag LOCUS_09750 2344 1463 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_09750 3509 2337 gene locus_tag LOCUS_09760 3509 2337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_09760 3566 5098 gene locus_tag LOCUS_09770 3566 5098 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976198.1 protein_id gnl|my_center|LOCUS_09770 5727 5284 gene locus_tag LOCUS_09780 5727 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6800 5727 gene locus_tag LOCUS_09790 6800 5727 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence098 417 507 gene locus_tag LOCUS_t00140 417 507 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2817 568 gene locus_tag LOCUS_09800 2817 568 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_09800 3327 2938 gene locus_tag LOCUS_09810 3327 2938 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 protein_id gnl|my_center|LOCUS_09810 4227 3379 gene locus_tag LOCUS_09820 gene tauD 4227 3379 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_09820 4301 4720 gene locus_tag LOCUS_09830 4301 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_09830 6063 4717 gene locus_tag LOCUS_09840 6063 4717 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN2 protein_id gnl|my_center|LOCUS_09840 >Feature sequence099 1345 1719 gene locus_tag LOCUS_09850 1345 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2510 1716 gene locus_tag LOCUS_09860 2510 1716 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919667.1 protein_id gnl|my_center|LOCUS_09860 2977 2510 gene locus_tag LOCUS_09870 2977 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3369 2974 gene locus_tag LOCUS_09880 gene yqjF 3369 2974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261698.1 protein_id gnl|my_center|LOCUS_09880 3812 3738 gene locus_tag LOCUS_t00150 3812 3738 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4092 4292 gene locus_tag LOCUS_09890 4092 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4428 5804 gene locus_tag LOCUS_09900 gene murA 4428 5804 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL93 protein_id gnl|my_center|LOCUS_09900 5820 6275 gene locus_tag LOCUS_09910 5820 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920207.1 protein_id gnl|my_center|LOCUS_09910 6315 7640 gene locus_tag LOCUS_09920 gene hisD 6315 7640 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_09920 >Feature sequence100 261 1247 gene locus_tag LOCUS_09930 261 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1380 3758 gene locus_tag LOCUS_09940 1380 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5073 3772 gene locus_tag LOCUS_09950 5073 3772 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921283.1 protein_id gnl|my_center|LOCUS_09950 5812 5144 gene locus_tag LOCUS_09960 5812 5144 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_09960 5895 7253 gene locus_tag LOCUS_09970 5895 7253 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence101 <1 635 gene locus_tag LOCUS_09980 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968408.1:membrane protein 640 1518 gene locus_tag LOCUS_09990 640 1518 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 protein_id gnl|my_center|LOCUS_09990 1543 2286 gene locus_tag LOCUS_10000 1543 2286 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_10000 3238 2276 gene locus_tag LOCUS_10010 3238 2276 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_10010 3746 3297 gene locus_tag LOCUS_10020 3746 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4559 5083 gene locus_tag LOCUS_10030 4559 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5080 6162 gene locus_tag LOCUS_10040 gene rsmH 5080 6162 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_10040 6159 6518 gene locus_tag LOCUS_10050 6159 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence102 <1 1715 gene locus_tag LOCUS_10060 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088867.1:heme utilization protein 1867 1791 gene locus_tag LOCUS_t00160 1867 1791 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2414 3565 gene locus_tag LOCUS_10070 2414 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_10070 3585 5168 gene locus_tag LOCUS_10080 3585 5168 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_10080 6198 5161 gene locus_tag LOCUS_10090 6198 5161 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920048.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence103 126 356 gene locus_tag LOCUS_10100 126 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 773 432 gene locus_tag LOCUS_10110 773 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1098 766 gene locus_tag LOCUS_10120 1098 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1356 1769 gene locus_tag LOCUS_10130 1356 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1802 2569 gene locus_tag LOCUS_10140 1802 2569 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974360.1 protein_id gnl|my_center|LOCUS_10140 2670 3065 gene locus_tag LOCUS_10150 2670 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3669 3124 gene locus_tag LOCUS_10160 3669 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4382 3807 gene locus_tag LOCUS_10170 4382 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4651 4379 gene locus_tag LOCUS_10180 4651 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4947 4651 gene locus_tag LOCUS_10190 4947 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5050 5292 gene locus_tag LOCUS_10200 5050 5292 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_10200 5359 5538 gene locus_tag LOCUS_10210 5359 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 6635 5901 gene locus_tag LOCUS_10220 6635 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6896 7135 gene locus_tag LOCUS_10230 6896 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence104 <1 1062 gene locus_tag LOCUS_10240 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088866.1:membrane protein 1196 3379 gene locus_tag LOCUS_10250 1196 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3657 4988 gene locus_tag LOCUS_10260 3657 4988 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_10260 5248 4985 gene locus_tag LOCUS_10270 5248 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6114 5473 gene locus_tag LOCUS_10280 6114 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6298 7188 gene locus_tag LOCUS_10290 6298 7188 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence105 1631 504 gene locus_tag LOCUS_10300 1631 504 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_10300 2402 1896 gene locus_tag LOCUS_10310 2402 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2359 2607 gene locus_tag LOCUS_10320 2359 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2543 3691 gene locus_tag LOCUS_10330 2543 3691 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_10330 3706 6819 gene locus_tag LOCUS_10340 3706 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6940 7497 gene locus_tag LOCUS_10350 6940 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence106 3677 1803 gene locus_tag LOCUS_10360 3677 1803 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_10360 4533 3832 gene locus_tag LOCUS_10370 4533 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4832 4584 gene locus_tag LOCUS_10380 4832 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5345 5266 gene locus_tag LOCUS_t00170 5345 5266 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5610 6464 gene locus_tag LOCUS_10390 gene pheA 5610 6464 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_10390 7402 6461 gene locus_tag LOCUS_10400 7402 6461 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence107 408 1433 gene locus_tag LOCUS_10410 408 1433 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_10410 1568 2749 gene locus_tag LOCUS_10420 1568 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707825.1 protein_id gnl|my_center|LOCUS_10420 3402 2746 gene locus_tag LOCUS_10430 3402 2746 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X2 protein_id gnl|my_center|LOCUS_10430 4219 3446 gene locus_tag LOCUS_10440 4219 3446 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085812.1 protein_id gnl|my_center|LOCUS_10440 4341 5543 gene locus_tag LOCUS_10450 4341 5543 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_10450 5983 5675 gene locus_tag LOCUS_10460 5983 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6790 5984 gene locus_tag LOCUS_10470 6790 5984 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_10470 7192 6830 gene locus_tag LOCUS_10480 gene yraH 7192 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07918 protein_id gnl|my_center|LOCUS_10480 >Feature sequence108 1183 1371 gene locus_tag LOCUS_10490 1183 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2370 1717 gene locus_tag LOCUS_10500 2370 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2863 2477 gene locus_tag LOCUS_10510 2863 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3330 2860 gene locus_tag LOCUS_10520 3330 2860 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_10520 3811 4911 gene locus_tag LOCUS_10530 gene rsgA 3811 4911 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB36 protein_id gnl|my_center|LOCUS_10530 5537 5016 gene locus_tag LOCUS_10540 5537 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6373 5768 gene locus_tag LOCUS_10550 gene leuD 6373 5768 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9W6 protein_id gnl|my_center|LOCUS_10550 7047 6403 gene locus_tag LOCUS_10560 7047 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence109 2059 1094 gene locus_tag LOCUS_10570 2059 1094 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX96 protein_id gnl|my_center|LOCUS_10570 2197 3993 gene locus_tag LOCUS_10580 gene mmgC 2197 3993 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_10580 4058 5131 gene locus_tag LOCUS_10590 4058 5131 CDS product zinc metallohydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_10590 6161 5145 gene locus_tag LOCUS_10600 6161 5145 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_10600 6250 7179 gene locus_tag LOCUS_10610 6250 7179 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence110 1222 704 gene locus_tag LOCUS_10620 gene def 1222 704 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_10620 1327 2466 gene locus_tag LOCUS_10630 1327 2466 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_10630 2470 3813 gene locus_tag LOCUS_10640 2470 3813 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_10640 4436 3876 gene locus_tag LOCUS_10650 4436 3876 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_10650 5066 4461 gene locus_tag LOCUS_10660 gene recR 5066 4461 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_10660 5399 5082 gene locus_tag LOCUS_10670 5399 5082 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ43 protein_id gnl|my_center|LOCUS_10670 7324 5399 gene locus_tag LOCUS_10680 7324 5399 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence111 33 353 gene locus_tag LOCUS_10690 33 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 894 394 gene locus_tag LOCUS_10700 894 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4927 881 gene locus_tag LOCUS_10710 4927 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6876 4924 gene locus_tag LOCUS_10720 6876 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence112 334 1932 gene locus_tag LOCUS_10730 gene purH 334 1932 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D3 protein_id gnl|my_center|LOCUS_10730 1953 2273 gene locus_tag LOCUS_10740 1953 2273 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A295 protein_id gnl|my_center|LOCUS_10740 3707 2277 gene locus_tag LOCUS_10750 3707 2277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_10750 5186 3711 gene locus_tag LOCUS_10760 5186 3711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_10760 6689 5262 gene locus_tag LOCUS_10770 6689 5262 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_10770 <7369 6756 gene locus_tag LOCUS_10780 <7369 6756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227915.1:TetR family transcriptional regulator >Feature sequence113 2396 1161 gene locus_tag LOCUS_10790 gene rlmN 2396 1161 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAJ1 protein_id gnl|my_center|LOCUS_10790 2902 2417 gene locus_tag LOCUS_10800 2902 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_10800 3335 3943 gene locus_tag LOCUS_10810 3335 3943 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_10810 3947 4657 gene locus_tag LOCUS_10820 3947 4657 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120276.1 protein_id gnl|my_center|LOCUS_10820 5252 4602 gene locus_tag LOCUS_10830 5252 4602 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_10830 5492 6028 gene locus_tag LOCUS_10840 5492 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6161 7162 gene locus_tag LOCUS_10850 6161 7162 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence114 748 1254 gene locus_tag LOCUS_10860 748 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3168 1282 gene locus_tag LOCUS_10870 3168 1282 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387850.1 protein_id gnl|my_center|LOCUS_10870 6619 3161 gene locus_tag LOCUS_10880 6619 3161 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVC3 protein_id gnl|my_center|LOCUS_10880 6728 6874 gene locus_tag LOCUS_10890 6728 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7328 6987 gene locus_tag LOCUS_10900 7328 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence115 527 204 gene locus_tag LOCUS_10910 527 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1089 694 gene locus_tag LOCUS_10920 1089 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1158 1790 gene locus_tag LOCUS_10930 1158 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1792 2598 gene locus_tag LOCUS_10940 1792 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3870 2779 gene locus_tag LOCUS_10950 3870 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5881 4067 gene locus_tag LOCUS_10960 5881 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 <7312 6179 gene locus_tag LOCUS_10970 <7312 6179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038255.1:lipase/esterase >Feature sequence116 1878 322 gene locus_tag LOCUS_10980 1878 322 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_10980 3897 1885 gene locus_tag LOCUS_10990 3897 1885 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256630.1 protein_id gnl|my_center|LOCUS_10990 3796 4038 gene locus_tag LOCUS_11000 3796 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4035 5054 gene locus_tag LOCUS_11010 gene pldB 4035 5054 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_11010 5869 5051 gene locus_tag LOCUS_11020 5869 5051 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066933.1 protein_id gnl|my_center|LOCUS_11020 <7290 5930 gene locus_tag LOCUS_11030 <7290 5930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918627.1:GTP-binding protein >Feature sequence117 1230 190 gene locus_tag LOCUS_11040 1230 190 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921471.1 protein_id gnl|my_center|LOCUS_11040 1300 3837 gene locus_tag LOCUS_11050 1300 3837 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533673.1 protein_id gnl|my_center|LOCUS_11050 3834 4586 gene locus_tag LOCUS_11060 3834 4586 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 protein_id gnl|my_center|LOCUS_11060 5031 4537 gene locus_tag LOCUS_11070 5031 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_11070 5900 5127 gene locus_tag LOCUS_11080 gene ccdA 5900 5127 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085573.1 protein_id gnl|my_center|LOCUS_11080 6819 6031 gene locus_tag LOCUS_11090 6819 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence118 2154 10 gene locus_tag LOCUS_11100 2154 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2679 2296 gene locus_tag LOCUS_11110 2679 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3305 2841 gene locus_tag LOCUS_11120 3305 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3750 3349 gene locus_tag LOCUS_11130 3750 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4887 3751 gene locus_tag LOCUS_11140 gene flgI1 4887 3751 CDS product flagellar P-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I01 protein_id gnl|my_center|LOCUS_11140 4784 5020 gene locus_tag LOCUS_11150 4784 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5200 5637 gene locus_tag LOCUS_11160 gene fliX 5200 5637 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 protein_id gnl|my_center|LOCUS_11160 5783 6217 gene locus_tag LOCUS_11170 gene dksA 5783 6217 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC05 protein_id gnl|my_center|LOCUS_11170 7149 6391 gene locus_tag LOCUS_11180 gene flgH1 7149 6391 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 protein_id gnl|my_center|LOCUS_11180 >Feature sequence119 <1 1085 gene locus_tag LOCUS_11190 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266176.1:GGDEF domain-containing protein 1173 2366 gene locus_tag LOCUS_11200 gene fadE21 1173 2366 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414139.1 protein_id gnl|my_center|LOCUS_11200 3506 2373 gene locus_tag LOCUS_11210 3506 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_11210 3774 3953 gene locus_tag LOCUS_11220 3774 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4040 4654 gene locus_tag LOCUS_11230 4040 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4654 4896 gene locus_tag LOCUS_11240 4654 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 4909 5865 gene locus_tag LOCUS_11250 4909 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11250 5974 7182 gene locus_tag LOCUS_11260 5974 7182 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence120 <1 1258 gene locus_tag LOCUS_11270 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917969.1:acyl-CoA dehydrogenase 1302 2459 gene locus_tag LOCUS_11280 1302 2459 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917968.1 protein_id gnl|my_center|LOCUS_11280 2527 3732 gene locus_tag LOCUS_11290 2527 3732 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_11290 3816 6080 gene locus_tag LOCUS_11300 3816 6080 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence121 233 1492 gene locus_tag LOCUS_11310 233 1492 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 protein_id gnl|my_center|LOCUS_11310 4047 1489 gene locus_tag LOCUS_11320 4047 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_11320 4158 4829 gene locus_tag LOCUS_11330 4158 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4832 5917 gene locus_tag LOCUS_11340 4832 5917 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_11340 6032 7129 gene locus_tag LOCUS_11350 6032 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence122 70 441 gene locus_tag LOCUS_11360 70 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1694 438 gene locus_tag LOCUS_11370 1694 438 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_11370 1805 3163 gene locus_tag LOCUS_11380 1805 3163 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140029.1 protein_id gnl|my_center|LOCUS_11380 5621 3318 gene locus_tag LOCUS_11390 5621 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6091 6429 gene locus_tag LOCUS_11400 gene glnK 6091 6429 CDS product nitrogen regulatory protein PII 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529649.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence123 <1 1317 gene locus_tag LOCUS_11410 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8U9L9:phosphoglucosamine mutase 1314 2135 gene locus_tag LOCUS_11420 1314 2135 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_11420 2166 2966 gene locus_tag LOCUS_11430 2166 2966 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_11430 3863 2958 gene locus_tag LOCUS_11440 3863 2958 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388147.1 protein_id gnl|my_center|LOCUS_11440 5026 3860 gene locus_tag LOCUS_11450 5026 3860 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_11450 6649 5093 gene locus_tag LOCUS_11460 6649 5093 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence124 <1 511 gene locus_tag LOCUS_11470 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to H7C7G1:bifunctional protein HldE 561 1493 gene locus_tag LOCUS_11480 561 1493 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957732.1 protein_id gnl|my_center|LOCUS_11480 1490 2776 gene locus_tag LOCUS_11490 1490 2776 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957733.1 protein_id gnl|my_center|LOCUS_11490 2769 3647 gene locus_tag LOCUS_11500 2769 3647 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 protein_id gnl|my_center|LOCUS_11500 3724 4908 gene locus_tag LOCUS_11510 gene glf 3724 4908 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125437.1 protein_id gnl|my_center|LOCUS_11510 4973 5749 gene locus_tag LOCUS_11520 4973 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5780 6496 gene locus_tag LOCUS_11530 5780 6496 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence125 <1 738 gene locus_tag LOCUS_11540 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257512.1:transferase 850 978 gene locus_tag LOCUS_11550 850 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1614 1009 gene locus_tag LOCUS_11560 1614 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1954 3756 gene locus_tag LOCUS_11570 1954 3756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087361.1 protein_id gnl|my_center|LOCUS_11570 4521 3934 gene locus_tag LOCUS_11580 4521 3934 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_11580 5112 4594 gene locus_tag LOCUS_11590 5112 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5910 5173 gene locus_tag LOCUS_11600 5910 5173 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538576.1 protein_id gnl|my_center|LOCUS_11600 <6993 5944 gene locus_tag LOCUS_11610 <6993 5944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919707.1:alpha-methylacyl-CoA racemase >Feature sequence126 624 1280 gene locus_tag LOCUS_11620 624 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1897 1277 gene locus_tag LOCUS_11630 1897 1277 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088999.1 protein_id gnl|my_center|LOCUS_11630 1989 2405 gene locus_tag LOCUS_11640 1989 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2402 3124 gene locus_tag LOCUS_11650 2402 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4206 3121 gene locus_tag LOCUS_11660 4206 3121 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_11660 6053 4227 gene locus_tag LOCUS_11670 gene atsA 6053 4227 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_11670 6584 6204 gene locus_tag LOCUS_11680 6584 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6618 6806 gene locus_tag LOCUS_11690 6618 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence127 1182 337 gene locus_tag LOCUS_11700 1182 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2799 1858 gene locus_tag LOCUS_11710 gene wcaG 2799 1858 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_11710 3863 2802 gene locus_tag LOCUS_11720 gene gmd 3863 2802 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_11720 5612 4965 gene locus_tag LOCUS_11730 5612 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6859 6209 gene locus_tag LOCUS_11740 6859 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence128 1459 296 gene locus_tag LOCUS_11750 1459 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3867 1801 gene locus_tag LOCUS_11760 3867 1801 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083486.1 protein_id gnl|my_center|LOCUS_11760 4952 4131 gene locus_tag LOCUS_11770 4952 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5326 5033 gene locus_tag LOCUS_11780 5326 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5356 5832 gene locus_tag LOCUS_11790 5356 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6116 5817 gene locus_tag LOCUS_11800 6116 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6562 6092 gene locus_tag LOCUS_11810 6562 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence129 1506 187 gene locus_tag LOCUS_11820 gene folC 1506 187 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_11820 2452 1511 gene locus_tag LOCUS_11830 gene accD 2452 1511 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBE1 protein_id gnl|my_center|LOCUS_11830 3378 2539 gene locus_tag LOCUS_11840 gene trpA 3378 2539 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_11840 4616 3381 gene locus_tag LOCUS_11850 gene trpB 4616 3381 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E5 protein_id gnl|my_center|LOCUS_11850 5378 4731 gene locus_tag LOCUS_11860 gene trpF 5378 4731 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBD8 protein_id gnl|my_center|LOCUS_11860 6091 5384 gene locus_tag LOCUS_11870 gene pyrF 6091 5384 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_11870 >Feature sequence130 <1 795 gene locus_tag LOCUS_11880 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089740.1:sigma-54-dependent Fis family transcriptional regulator 839 2974 gene locus_tag LOCUS_11890 gene flhA 839 2974 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084995.1 protein_id gnl|my_center|LOCUS_11890 2992 4170 gene locus_tag LOCUS_11900 2992 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4167 4997 gene locus_tag LOCUS_11910 4167 4997 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_11910 5200 5526 gene locus_tag LOCUS_11920 5200 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6028 5603 gene locus_tag LOCUS_11930 6028 5603 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_11930 <6789 6047 gene locus_tag LOCUS_11940 <6789 6047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388284.1:flagellum-specific ATP synthase >Feature sequence131 <1 630 gene locus_tag LOCUS_11950 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000397283.1:acyl-CoA dehydrogenase 701 2416 gene locus_tag LOCUS_11960 701 2416 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_11960 3046 2492 gene locus_tag LOCUS_11970 3046 2492 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS65 protein_id gnl|my_center|LOCUS_11970 3154 3840 gene locus_tag LOCUS_11980 3154 3840 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968227.1 protein_id gnl|my_center|LOCUS_11980 4824 3841 gene locus_tag LOCUS_11990 4824 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4930 6033 gene locus_tag LOCUS_12000 4930 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence132 <1 1267 gene locus_tag LOCUS_12010 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918828.1:acyl-CoA synthetase 1323 2009 gene locus_tag LOCUS_12020 1323 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2108 2560 gene locus_tag LOCUS_12030 2108 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2738 3190 gene locus_tag LOCUS_12040 2738 3190 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_12040 3324 3764 gene locus_tag LOCUS_12050 gene msrB3 3324 3764 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8J6 protein_id gnl|my_center|LOCUS_12050 3770 5848 gene locus_tag LOCUS_12060 gene ptrB 3770 5848 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971235.1 protein_id gnl|my_center|LOCUS_12060 <6690 6138 gene locus_tag LOCUS_12070 <6690 6138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000391771.1:glycosyl hydrolase family 35 >Feature sequence133 452 1558 gene locus_tag LOCUS_12080 452 1558 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_12080 1555 4755 gene locus_tag LOCUS_12090 1555 4755 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_12090 5644 4766 gene locus_tag LOCUS_12100 gene pssA 5644 4766 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_12100 6354 5641 gene locus_tag LOCUS_12110 gene psd 6354 5641 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_12110 >Feature sequence134 3567 1675 gene locus_tag LOCUS_12120 gene dnaG 3567 1675 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TK91 protein_id gnl|my_center|LOCUS_12120 4071 3622 gene locus_tag LOCUS_12130 4071 3622 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 protein_id gnl|my_center|LOCUS_12130 4374 5615 gene locus_tag LOCUS_12140 gene carA 4374 5615 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DR8 protein_id gnl|my_center|LOCUS_12140 5926 5636 gene locus_tag LOCUS_12150 5926 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence135 5 1501 gene locus_tag LOCUS_12160 gene hldE 5 1501 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_12160 1543 2529 gene locus_tag LOCUS_12170 gene hldD 1543 2529 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP72 protein_id gnl|my_center|LOCUS_12170 3107 2526 gene locus_tag LOCUS_12180 gene spdR 3107 2526 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918136.1 protein_id gnl|my_center|LOCUS_12180 4725 3325 gene locus_tag LOCUS_12190 4725 3325 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_12190 4836 5630 gene locus_tag LOCUS_12200 gene nodI 4836 5630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083728.1 protein_id gnl|my_center|LOCUS_12200 5627 6469 gene locus_tag LOCUS_12210 5627 6469 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VY8 protein_id gnl|my_center|LOCUS_12210 >Feature sequence136 535 1047 gene locus_tag LOCUS_12220 535 1047 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG76 protein_id gnl|my_center|LOCUS_12220 1089 2006 gene locus_tag LOCUS_12230 1089 2006 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_12230 2215 2619 gene locus_tag LOCUS_12240 2215 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2809 3156 gene locus_tag LOCUS_12250 2809 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3386 3676 gene locus_tag LOCUS_12260 3386 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4893 3757 gene locus_tag LOCUS_12270 gene mrp 4893 3757 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NU2 protein_id gnl|my_center|LOCUS_12270 5140 6288 gene locus_tag LOCUS_12280 5140 6288 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence137 902 2155 gene locus_tag LOCUS_12290 902 2155 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_12290 3198 2152 gene locus_tag LOCUS_12300 3198 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_12300 3637 3203 gene locus_tag LOCUS_12310 3637 3203 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_12310 3744 4268 gene locus_tag LOCUS_12320 3744 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4392 5540 gene locus_tag LOCUS_12330 4392 5540 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918315.1 protein_id gnl|my_center|LOCUS_12330 5546 6136 gene locus_tag LOCUS_12340 5546 6136 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence138 477 1367 gene locus_tag LOCUS_12350 477 1367 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_12350 2921 1566 gene locus_tag LOCUS_12360 2921 1566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919616.1 protein_id gnl|my_center|LOCUS_12360 4392 2980 gene locus_tag LOCUS_12370 4392 2980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_12370 4715 5581 gene locus_tag LOCUS_12380 4715 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence139 270 10 gene locus_tag LOCUS_12390 270 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 protein_id gnl|my_center|LOCUS_12390 381 2177 gene locus_tag LOCUS_12400 381 2177 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920158.1 protein_id gnl|my_center|LOCUS_12400 3531 2341 gene locus_tag LOCUS_12410 3531 2341 CDS product limonene 1,2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731042.1 protein_id gnl|my_center|LOCUS_12410 4079 3570 gene locus_tag LOCUS_12420 4079 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3960 4184 gene locus_tag LOCUS_12430 3960 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4314 5342 gene locus_tag LOCUS_12440 4314 5342 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_12440 5444 5929 gene locus_tag LOCUS_12450 5444 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence140 2582 759 gene locus_tag LOCUS_12460 gene glmS 2582 759 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 protein_id gnl|my_center|LOCUS_12460 3947 2586 gene locus_tag LOCUS_12470 gene glmU 3947 2586 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_12470 6043 4121 gene locus_tag LOCUS_12480 6043 4121 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence141 42 410 gene locus_tag LOCUS_12490 42 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 568 1482 gene locus_tag LOCUS_12500 gene rpoH 568 1482 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD4 protein_id gnl|my_center|LOCUS_12500 1500 2426 gene locus_tag LOCUS_12510 1500 2426 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921287.1 protein_id gnl|my_center|LOCUS_12510 3135 2431 gene locus_tag LOCUS_12520 3135 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388488.1 protein_id gnl|my_center|LOCUS_12520 3901 3197 gene locus_tag LOCUS_12530 3901 3197 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_12530 4577 3924 gene locus_tag LOCUS_12540 gene msrA 4577 3924 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_12540 5231 4665 gene locus_tag LOCUS_12550 5231 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5286 5714 gene locus_tag LOCUS_12560 5286 5714 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence142 1026 2543 gene locus_tag LOCUS_12570 1026 2543 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_12570 3635 2547 gene locus_tag LOCUS_12580 3635 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3894 4496 gene locus_tag LOCUS_12590 gene trpG 3894 4496 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_12590 4493 5512 gene locus_tag LOCUS_12600 gene trpD 4493 5512 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF3 protein_id gnl|my_center|LOCUS_12600 5515 6300 gene locus_tag LOCUS_12610 gene trpC 5515 6300 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X9 protein_id gnl|my_center|LOCUS_12610 >Feature sequence143 1684 311 gene locus_tag LOCUS_12620 1684 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1899 1684 gene locus_tag LOCUS_12630 1899 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2813 1896 gene locus_tag LOCUS_12640 2813 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3508 2816 gene locus_tag LOCUS_12650 3508 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 3911 3531 gene locus_tag LOCUS_12660 3911 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4247 3915 gene locus_tag LOCUS_12670 4247 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4950 4270 gene locus_tag LOCUS_12680 4950 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5019 5414 gene locus_tag LOCUS_12690 5019 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5863 5420 gene locus_tag LOCUS_12700 5863 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence144 123 614 gene locus_tag LOCUS_12710 123 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1932 640 gene locus_tag LOCUS_12720 gene purA 1932 640 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MI14 protein_id gnl|my_center|LOCUS_12720 3733 2156 gene locus_tag LOCUS_12730 gene serA 3733 2156 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_12730 5014 3824 gene locus_tag LOCUS_12740 5014 3824 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_12740 5213 5707 gene locus_tag LOCUS_12750 5213 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence145 1223 1148 gene locus_tag LOCUS_t00180 1223 1148 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1918 1439 gene locus_tag LOCUS_12760 1918 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2149 3477 gene locus_tag LOCUS_12770 gene aroA 2149 3477 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_12770 3489 4127 gene locus_tag LOCUS_12780 gene cmk 3489 4127 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_12780 4339 6060 gene locus_tag LOCUS_12790 4339 6060 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF46 protein_id gnl|my_center|LOCUS_12790 >Feature sequence146 1438 347 gene locus_tag LOCUS_12800 1438 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_12800 3367 1445 gene locus_tag LOCUS_12810 3367 1445 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 protein_id gnl|my_center|LOCUS_12810 3593 4054 gene locus_tag LOCUS_12820 3593 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4980 4051 gene locus_tag LOCUS_12830 4980 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6197 5010 gene locus_tag LOCUS_12840 gene fadA 6197 5010 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence147 302 823 gene locus_tag LOCUS_12850 302 823 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_12850 909 1265 gene locus_tag LOCUS_12860 909 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1389 1943 gene locus_tag LOCUS_12870 1389 1943 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_12870 3172 2081 gene locus_tag LOCUS_12880 3172 2081 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_12880 4116 3184 gene locus_tag LOCUS_12890 4116 3184 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_12890 4178 5251 gene locus_tag LOCUS_12900 4178 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence148 <1 965 gene locus_tag LOCUS_12910 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001882992.1:C4-dicarboxylate ABC transporter substrate-binding protein 1032 3098 gene locus_tag LOCUS_12920 1032 3098 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459237.1 protein_id gnl|my_center|LOCUS_12920 3258 3725 gene locus_tag LOCUS_12930 3258 3725 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_12930 3974 5056 gene locus_tag LOCUS_12940 3974 5056 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_12940 5533 5075 gene locus_tag LOCUS_12950 5533 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 <6295 5637 gene locus_tag LOCUS_12960 <6295 5637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384548.1:translocation/assembly module TamB >Feature sequence149 1032 439 gene locus_tag LOCUS_12970 gene chaC 1032 439 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UM2 protein_id gnl|my_center|LOCUS_12970 1111 2124 gene locus_tag LOCUS_12980 1111 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3108 2149 gene locus_tag LOCUS_12990 3108 2149 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_12990 4208 3105 gene locus_tag LOCUS_13000 gene hisC2 4208 3105 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL9 protein_id gnl|my_center|LOCUS_13000 5279 4299 gene locus_tag LOCUS_13010 5279 4299 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence150 <1 509 gene locus_tag LOCUS_13020 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186471.1:quinone oxidoreductase 1158 586 gene locus_tag LOCUS_13030 1158 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1933 1214 gene locus_tag LOCUS_13040 1933 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3264 1999 gene locus_tag LOCUS_13050 gene rho 3264 1999 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB68 protein_id gnl|my_center|LOCUS_13050 4173 3727 gene locus_tag LOCUS_13060 4173 3727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_13060 5231 4209 gene locus_tag LOCUS_13070 gene hemH 5231 4209 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN84 protein_id gnl|my_center|LOCUS_13070 <6242 5228 gene locus_tag LOCUS_13080 <6242 5228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN85:uroporphyrinogen decarboxylase >Feature sequence151 860 1096 gene locus_tag LOCUS_13090 860 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1594 2100 gene locus_tag LOCUS_13100 1594 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3186 2128 gene locus_tag LOCUS_13110 3186 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_13110 3338 4555 gene locus_tag LOCUS_13120 3338 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 protein_id gnl|my_center|LOCUS_13120 4643 5572 gene locus_tag LOCUS_13130 4643 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence152 1300 569 gene locus_tag LOCUS_13140 gene hisA 1300 569 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM5 protein_id gnl|my_center|LOCUS_13140 1970 1305 gene locus_tag LOCUS_13150 gene hisH 1970 1305 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58788 protein_id gnl|my_center|LOCUS_13150 2776 1967 gene locus_tag LOCUS_13160 2776 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3403 2792 gene locus_tag LOCUS_13170 gene hisB 3403 2792 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 protein_id gnl|my_center|LOCUS_13170 3570 4073 gene locus_tag LOCUS_13180 3570 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4389 4946 gene locus_tag LOCUS_13190 gene hslV 4389 4946 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_13190 >Feature sequence153 1754 135 gene locus_tag LOCUS_13200 1754 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084223.1 protein_id gnl|my_center|LOCUS_13200 2236 1805 gene locus_tag LOCUS_13210 2236 1805 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975290.1 protein_id gnl|my_center|LOCUS_13210 3437 2247 gene locus_tag LOCUS_13220 3437 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_13220 4231 3488 gene locus_tag LOCUS_13230 4231 3488 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 protein_id gnl|my_center|LOCUS_13230 4700 4233 gene locus_tag LOCUS_13240 4700 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_13240 4796 5839 gene locus_tag LOCUS_13250 gene aguA 4796 5839 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK4 protein_id gnl|my_center|LOCUS_13250 >Feature sequence154 <1 1411 gene locus_tag LOCUS_13260 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099328.1:MFS transporter 2465 1419 gene locus_tag LOCUS_13270 2465 1419 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_13270 2691 4049 gene locus_tag LOCUS_13280 2691 4049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_13280 5206 4043 gene locus_tag LOCUS_13290 5206 4043 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_13290 5816 5268 gene locus_tag LOCUS_13300 5816 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence155 443 919 gene locus_tag LOCUS_13310 443 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1487 990 gene locus_tag LOCUS_13320 1487 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2002 1601 gene locus_tag LOCUS_13330 2002 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2440 2030 gene locus_tag LOCUS_13340 2440 2030 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640519.1 protein_id gnl|my_center|LOCUS_13340 2889 2401 gene locus_tag LOCUS_13350 2889 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2938 3381 gene locus_tag LOCUS_13360 2938 3381 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971133.1 protein_id gnl|my_center|LOCUS_13360 3802 3374 gene locus_tag LOCUS_13370 3802 3374 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_13370 4125 3802 gene locus_tag LOCUS_13380 4125 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_13380 4406 4128 gene locus_tag LOCUS_13390 4406 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_13390 4335 4505 gene locus_tag LOCUS_13400 4335 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4570 4989 gene locus_tag LOCUS_13410 4570 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6012 5002 gene locus_tag LOCUS_13420 gene gpsA 6012 5002 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58141 protein_id gnl|my_center|LOCUS_13420 >Feature sequence156 171 1034 gene locus_tag LOCUS_13430 171 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1093 2049 gene locus_tag LOCUS_13440 1093 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919444.1 protein_id gnl|my_center|LOCUS_13440 3034 2033 gene locus_tag LOCUS_13450 3034 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3141 3878 gene locus_tag LOCUS_13460 3141 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5528 3918 gene locus_tag LOCUS_13470 5528 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence157 604 56 gene locus_tag LOCUS_13480 gene ssuE 604 56 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817465.1 protein_id gnl|my_center|LOCUS_13480 1163 675 gene locus_tag LOCUS_13490 1163 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1605 1195 gene locus_tag LOCUS_13500 1605 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2065 1649 gene locus_tag LOCUS_13510 2065 1649 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 protein_id gnl|my_center|LOCUS_13510 2782 2219 gene locus_tag LOCUS_13520 2782 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407692.1 protein_id gnl|my_center|LOCUS_13520 3961 2786 gene locus_tag LOCUS_13530 3961 2786 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228619.1 protein_id gnl|my_center|LOCUS_13530 4637 4008 gene locus_tag LOCUS_13540 4637 4008 CDS product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703312.1 protein_id gnl|my_center|LOCUS_13540 <6056 4796 gene locus_tag LOCUS_13550 <6056 4796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387955.1:phospholipase D >Feature sequence158 <1 1221 gene locus_tag LOCUS_13560 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TCU2:putative protein kinase UbiB 1352 2554 gene locus_tag LOCUS_13570 1352 2554 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_13570 2569 3045 gene locus_tag LOCUS_13580 gene dut 2569 3045 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_13580 3050 3586 gene locus_tag LOCUS_13590 3050 3586 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_13590 3638 4585 gene locus_tag LOCUS_13600 gene cysK 3638 4585 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_13600 4595 5128 gene locus_tag LOCUS_13610 4595 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13610 5138 5350 gene locus_tag LOCUS_13620 5138 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13620 5469 6005 gene locus_tag LOCUS_13630 5469 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence159 322 819 gene locus_tag LOCUS_13640 322 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 847 1740 gene locus_tag LOCUS_13650 847 1740 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 protein_id gnl|my_center|LOCUS_13650 1854 3086 gene locus_tag LOCUS_13660 1854 3086 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708951.1 protein_id gnl|my_center|LOCUS_13660 3083 3616 gene locus_tag LOCUS_13670 3083 3616 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_13670 3616 4488 gene locus_tag LOCUS_13680 3616 4488 CDS product CDP-4-dehydro-6-deoxy-D-gulose 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110257.1 protein_id gnl|my_center|LOCUS_13680 5099 4518 gene locus_tag LOCUS_13690 gene gmhA1 5099 4518 CDS product phosphoheptose isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNE6 protein_id gnl|my_center|LOCUS_13690 <6033 5342 gene locus_tag LOCUS_13700 <6033 5342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33197:isocitrate dehydrogenase [NADP] >Feature sequence160 2982 1345 gene locus_tag LOCUS_13710 2982 1345 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 protein_id gnl|my_center|LOCUS_13710 5848 3074 gene locus_tag LOCUS_13720 gene glnE 5848 3074 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QJ5 protein_id gnl|my_center|LOCUS_13720 >Feature sequence161 281 640 gene locus_tag LOCUS_13730 281 640 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533616.1 protein_id gnl|my_center|LOCUS_13730 637 1707 gene locus_tag LOCUS_13740 637 1707 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C744 protein_id gnl|my_center|LOCUS_13740 1722 2069 gene locus_tag LOCUS_13750 1722 2069 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_13750 3428 2079 gene locus_tag LOCUS_13760 3428 2079 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_13760 4020 3418 gene locus_tag LOCUS_13770 4020 3418 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_13770 4546 4073 gene locus_tag LOCUS_13780 4546 4073 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_13780 5087 4551 gene locus_tag LOCUS_13790 5087 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 >Feature sequence162 <1 884 gene locus_tag LOCUS_13800 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087550.1:pyruvate dehydrogenase complex E1 component subunit beta 894 2264 gene locus_tag LOCUS_13810 894 2264 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8F0 protein_id gnl|my_center|LOCUS_13810 2276 2638 gene locus_tag LOCUS_13820 2276 2638 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_13820 2653 4047 gene locus_tag LOCUS_13830 2653 4047 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 protein_id gnl|my_center|LOCUS_13830 4224 4706 gene locus_tag LOCUS_13840 4224 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4798 5529 gene locus_tag LOCUS_13850 4798 5529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence163 3439 812 gene locus_tag LOCUS_13860 3439 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4142 5494 gene locus_tag LOCUS_13870 4142 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence164 1466 477 gene locus_tag LOCUS_13880 1466 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2135 1491 gene locus_tag LOCUS_13890 2135 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2226 2819 gene locus_tag LOCUS_13900 2226 2819 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 protein_id gnl|my_center|LOCUS_13900 3461 2934 gene locus_tag LOCUS_13910 gene ppa 3461 2934 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LH1 protein_id gnl|my_center|LOCUS_13910 3591 5030 gene locus_tag LOCUS_13920 3591 5030 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_13920 <5905 5027 gene locus_tag LOCUS_13930 <5905 5027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MAJ3:argininosuccinate synthase >Feature sequence165 4245 1108 gene locus_tag LOCUS_13940 4245 1108 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 protein_id gnl|my_center|LOCUS_13940 5430 4270 gene locus_tag LOCUS_13950 5430 4270 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence166 336 91 gene locus_tag LOCUS_13960 336 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1384 479 gene locus_tag LOCUS_13970 1384 479 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_13970 2369 1518 gene locus_tag LOCUS_13980 2369 1518 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_13980 3622 2372 gene locus_tag LOCUS_13990 3622 2372 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_13990 4943 3747 gene locus_tag LOCUS_14000 4943 3747 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 protein_id gnl|my_center|LOCUS_14000 <5886 4986 gene locus_tag LOCUS_14010 <5886 4986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87Q14:polyamine-transporting ATPase >Feature sequence167 430 1434 gene locus_tag LOCUS_14020 430 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1425 2798 gene locus_tag LOCUS_14030 1425 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2945 4918 gene locus_tag LOCUS_14040 gene ftsH 2945 4918 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C810 protein_id gnl|my_center|LOCUS_14040 5005 5817 gene locus_tag LOCUS_14050 5005 5817 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN56 protein_id gnl|my_center|LOCUS_14050 >Feature sequence168 <1 949 gene locus_tag LOCUS_14060 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CJB5:Lon protease 1280 1555 gene locus_tag LOCUS_14070 1280 1555 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_14070 1783 1858 gene locus_tag LOCUS_t00190 1783 1858 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2022 4505 gene locus_tag LOCUS_14080 2022 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4575 4651 gene locus_tag LOCUS_t00200 4575 4651 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5169 5534 gene locus_tag LOCUS_14090 gene nuoA 5169 5534 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJB3 protein_id gnl|my_center|LOCUS_14090 >Feature sequence169 1783 422 gene locus_tag LOCUS_14100 1783 422 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338715.1 protein_id gnl|my_center|LOCUS_14100 3297 1780 gene locus_tag LOCUS_14110 3297 1780 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090216.1 protein_id gnl|my_center|LOCUS_14110 4058 3462 gene locus_tag LOCUS_14120 4058 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_14120 4693 4136 gene locus_tag LOCUS_14130 gene lspA 4693 4136 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DF7 protein_id gnl|my_center|LOCUS_14130 <5826 4698 gene locus_tag LOCUS_14140 <5826 4698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0E2:isoleucine--tRNA ligase >Feature sequence170 803 1606 gene locus_tag LOCUS_14150 803 1606 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_14150 1654 2847 gene locus_tag LOCUS_14160 1654 2847 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_14160 2959 3603 gene locus_tag LOCUS_14170 2959 3603 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107299.1 protein_id gnl|my_center|LOCUS_14170 3691 4506 gene locus_tag LOCUS_14180 3691 4506 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808686.1 protein_id gnl|my_center|LOCUS_14180 4554 5321 gene locus_tag LOCUS_14190 4554 5321 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_14190 5429 5761 gene locus_tag LOCUS_14200 5429 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence171 <1 631 gene locus_tag LOCUS_14210 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TH84:NADH-quinone oxidoreductase subunit C 628 1851 gene locus_tag LOCUS_14220 gene nuoD 628 1851 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJA9 protein_id gnl|my_center|LOCUS_14220 1848 2474 gene locus_tag LOCUS_14230 1848 2474 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087680.1 protein_id gnl|my_center|LOCUS_14230 2477 3781 gene locus_tag LOCUS_14240 2477 3781 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence172 <1 1394 gene locus_tag LOCUS_14250 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527948.1:ATP-dependent DNA ligase 1546 1818 gene locus_tag LOCUS_14260 1546 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1853 2917 gene locus_tag LOCUS_14270 1853 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3443 2910 gene locus_tag LOCUS_14280 3443 2910 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709628.1 protein_id gnl|my_center|LOCUS_14280 4262 3456 gene locus_tag LOCUS_14290 4262 3456 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_14290 4333 5064 gene locus_tag LOCUS_14300 4333 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5486 5073 gene locus_tag LOCUS_14310 5486 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence173 <1 855 gene locus_tag LOCUS_14320 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein 1850 888 gene locus_tag LOCUS_14330 1850 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_14330 2014 3162 gene locus_tag LOCUS_14340 2014 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3159 4319 gene locus_tag LOCUS_14350 3159 4319 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_14350 4449 5123 gene locus_tag LOCUS_14360 4449 5123 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887576.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence174 858 208 gene locus_tag LOCUS_14370 858 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1041 1319 gene locus_tag LOCUS_14380 1041 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1420 1698 gene locus_tag LOCUS_14390 1420 1698 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 protein_id gnl|my_center|LOCUS_14390 1757 2650 gene locus_tag LOCUS_14400 gene folD 1757 2650 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_14400 2682 3743 gene locus_tag LOCUS_14410 2682 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3743 5269 gene locus_tag LOCUS_14420 3743 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence175 <1 513 gene locus_tag LOCUS_14430 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066900.1:oligoendopeptidase F 516 1874 gene locus_tag LOCUS_14440 516 1874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_14440 1955 2425 gene locus_tag LOCUS_14450 1955 2425 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_14450 2544 2705 gene locus_tag LOCUS_14460 2544 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2851 3990 gene locus_tag LOCUS_14470 gene pntAA 2851 3990 CDS product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 protein_id gnl|my_center|LOCUS_14470 3990 4304 gene locus_tag LOCUS_14480 3990 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4317 5723 gene locus_tag LOCUS_14490 4317 5723 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU9 protein_id gnl|my_center|LOCUS_14490 >Feature sequence176 2707 1046 gene locus_tag LOCUS_14500 2707 1046 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_14500 3777 2914 gene locus_tag LOCUS_14510 3777 2914 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391075.1 protein_id gnl|my_center|LOCUS_14510 4636 3878 gene locus_tag LOCUS_14520 4636 3878 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184941.1 protein_id gnl|my_center|LOCUS_14520 4815 4633 gene locus_tag LOCUS_14530 4815 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4884 5501 gene locus_tag LOCUS_14540 4884 5501 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531341.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence177 479 2395 gene locus_tag LOCUS_14550 479 2395 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_14550 2395 3540 gene locus_tag LOCUS_14560 gene rodA 2395 3540 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_14560 3700 3775 gene locus_tag LOCUS_t00210 3700 3775 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3837 5270 gene locus_tag LOCUS_14570 gene eutB 3837 5270 CDS product ethanolamine ammonia-lyase heavy chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence178 898 1851 gene locus_tag LOCUS_14580 898 1851 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390592.1 protein_id gnl|my_center|LOCUS_14580 2946 1852 gene locus_tag LOCUS_14590 2946 1852 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_14590 3442 4578 gene locus_tag LOCUS_14600 3442 4578 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence179 3 893 gene locus_tag LOCUS_14610 3 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1138 1551 gene locus_tag LOCUS_14620 1138 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1632 2630 gene locus_tag LOCUS_14630 gene dhaA 1632 2630 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222141.1 protein_id gnl|my_center|LOCUS_14630 2642 3508 gene locus_tag LOCUS_14640 2642 3508 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_14640 3542 3949 gene locus_tag LOCUS_14650 3542 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4075 3896 gene locus_tag LOCUS_14660 4075 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4061 4585 gene locus_tag LOCUS_14670 4061 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 5440 4667 gene locus_tag LOCUS_14680 5440 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14680 >Feature sequence180 838 1476 gene locus_tag LOCUS_14690 gene gmk 838 1476 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_14690 2531 1482 gene locus_tag LOCUS_14700 2531 1482 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086875.1 protein_id gnl|my_center|LOCUS_14700 3717 2584 gene locus_tag LOCUS_14710 gene gbd 3717 2584 CDS product NAD-dependent 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064272.1 protein_id gnl|my_center|LOCUS_14710 4712 3882 gene locus_tag LOCUS_14720 gene rsmA 4712 3882 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X4 protein_id gnl|my_center|LOCUS_14720 <5719 4709 gene locus_tag LOCUS_14730 <5719 4709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92QZ0:4-hydroxythreonine-4-phosphate dehydrogenase 1 >Feature sequence181 126 623 gene locus_tag LOCUS_14740 126 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 655 1059 gene locus_tag LOCUS_14750 655 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1592 1134 gene locus_tag LOCUS_14760 1592 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1853 2770 gene locus_tag LOCUS_14770 1853 2770 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_14770 2773 3864 gene locus_tag LOCUS_14780 2773 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3968 4276 gene locus_tag LOCUS_14790 3968 4276 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_14790 4387 5235 gene locus_tag LOCUS_14800 4387 5235 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence182 682 1152 gene locus_tag LOCUS_14810 682 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1280 2236 gene locus_tag LOCUS_14820 gene lipA 1280 2236 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8F5 protein_id gnl|my_center|LOCUS_14820 2236 2748 gene locus_tag LOCUS_14830 2236 2748 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719940.1 protein_id gnl|my_center|LOCUS_14830 3206 2751 gene locus_tag LOCUS_14840 3206 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3764 3264 gene locus_tag LOCUS_14850 gene pgpA 3764 3264 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2K7 protein_id gnl|my_center|LOCUS_14850 4360 3761 gene locus_tag LOCUS_14860 4360 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4367 4552 gene locus_tag LOCUS_14870 4367 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4562 4744 gene locus_tag LOCUS_14880 4562 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4784 5002 gene locus_tag LOCUS_14890 4784 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence183 1028 369 gene locus_tag LOCUS_14900 gene cvpA 1028 369 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086837.1 protein_id gnl|my_center|LOCUS_14900 2467 1073 gene locus_tag LOCUS_14910 gene radA 2467 1073 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ5 protein_id gnl|my_center|LOCUS_14910 3157 2483 gene locus_tag LOCUS_14920 3157 2483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_14920 4101 3289 gene locus_tag LOCUS_14930 4101 3289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_14930 5203 4103 gene locus_tag LOCUS_14940 5203 4103 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLZ9 protein_id gnl|my_center|LOCUS_14940 >Feature sequence184 84 1589 gene locus_tag LOCUS_14950 84 1589 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_14950 1589 2482 gene locus_tag LOCUS_14960 gene prpB 1589 2482 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6R7 protein_id gnl|my_center|LOCUS_14960 2544 3689 gene locus_tag LOCUS_14970 gene prpc 2544 3689 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2G4 protein_id gnl|my_center|LOCUS_14970 3822 4556 gene locus_tag LOCUS_14980 3822 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence185 <1 625 gene locus_tag LOCUS_14990 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188391.1:Fe-S oxidoreductase 625 2055 gene locus_tag LOCUS_15000 625 2055 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_15000 2052 2732 gene locus_tag LOCUS_15010 2052 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_15010 3604 2840 gene locus_tag LOCUS_15020 3604 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4600 3695 gene locus_tag LOCUS_15030 4600 3695 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_15030 5254 4604 gene locus_tag LOCUS_15040 5254 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence186 1346 2215 gene locus_tag LOCUS_15050 1346 2215 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_15050 2269 3585 gene locus_tag LOCUS_15060 2269 3585 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_15060 3696 4190 gene locus_tag LOCUS_15070 3696 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 <5606 4334 gene locus_tag LOCUS_15080 <5606 4334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C7J3:xanthan biosynthesis protein XanB >Feature sequence187 676 329 gene locus_tag LOCUS_15090 676 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 protein_id gnl|my_center|LOCUS_15090 1267 788 gene locus_tag LOCUS_15100 1267 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1673 1260 gene locus_tag LOCUS_15110 1673 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1755 2186 gene locus_tag LOCUS_15120 1755 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_15120 2710 2228 gene locus_tag LOCUS_15130 2710 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3122 4306 gene locus_tag LOCUS_15140 3122 4306 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 protein_id gnl|my_center|LOCUS_15140 4454 5281 gene locus_tag LOCUS_15150 4454 5281 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence188 4098 865 gene locus_tag LOCUS_15160 gene hsdR 4098 865 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_15160 5223 4117 gene locus_tag LOCUS_15170 5223 4117 CDS product type I restriction-modification system subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_15170 5550 5227 gene locus_tag LOCUS_15180 5550 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence189 1727 1227 gene locus_tag LOCUS_15190 1727 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 3736 1730 gene locus_tag LOCUS_15200 gene cycK 3736 1730 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971300.1 protein_id gnl|my_center|LOCUS_15200 4191 3733 gene locus_tag LOCUS_15210 gene ccmE 4191 3733 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_15210 5227 4292 gene locus_tag LOCUS_15220 5227 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence190 633 184 gene locus_tag LOCUS_15230 gene aroQ 633 184 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_15230 885 1145 gene locus_tag LOCUS_15240 885 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1189 2013 gene locus_tag LOCUS_15250 gene thiG 1189 2013 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A746 protein_id gnl|my_center|LOCUS_15250 2807 2010 gene locus_tag LOCUS_15260 2807 2010 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707679.1 protein_id gnl|my_center|LOCUS_15260 4317 2851 gene locus_tag LOCUS_15270 4317 2851 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640355.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence191 357 100 gene locus_tag LOCUS_15280 357 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 594 1262 gene locus_tag LOCUS_15290 594 1262 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_15290 1246 2280 gene locus_tag LOCUS_15300 1246 2280 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_15300 2270 2950 gene locus_tag LOCUS_15310 2270 2950 CDS product nicotinamide N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067171.1 protein_id gnl|my_center|LOCUS_15310 2993 3385 gene locus_tag LOCUS_15320 2993 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4166 3411 gene locus_tag LOCUS_15330 4166 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence192 <1 890 gene locus_tag LOCUS_15340 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529949.1:membrane protein 943 1476 gene locus_tag LOCUS_15350 943 1476 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706625.1 protein_id gnl|my_center|LOCUS_15350 1728 2285 gene locus_tag LOCUS_15360 1728 2285 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_15360 2344 2877 gene locus_tag LOCUS_15370 2344 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103756.1 protein_id gnl|my_center|LOCUS_15370 2893 3486 gene locus_tag LOCUS_15380 gene rutE 2893 3486 CDS product putative malonic semialdehyde reductase RutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJW1 protein_id gnl|my_center|LOCUS_15380 3501 4238 gene locus_tag LOCUS_15390 3501 4238 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_15390 4231 4731 gene locus_tag LOCUS_15400 gene rimI 4231 4731 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 protein_id gnl|my_center|LOCUS_15400 4802 5227 gene locus_tag LOCUS_15410 4802 5227 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence193 419 673 gene locus_tag LOCUS_15420 gene grxC 419 673 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024389.1 protein_id gnl|my_center|LOCUS_15420 677 1537 gene locus_tag LOCUS_15430 677 1537 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_15430 1534 2001 gene locus_tag LOCUS_15440 1534 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337454.1 protein_id gnl|my_center|LOCUS_15440 2033 2401 gene locus_tag LOCUS_15450 2033 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3188 2409 gene locus_tag LOCUS_15460 gene ubiG 3188 2409 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAL7 protein_id gnl|my_center|LOCUS_15460 3379 4650 gene locus_tag LOCUS_15470 3379 4650 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM0 protein_id gnl|my_center|LOCUS_15470 >Feature sequence194 <1 726 gene locus_tag LOCUS_15480 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919201.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase 719 1969 gene locus_tag LOCUS_15490 gene TrmA 719 1969 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_15490 2169 3047 gene locus_tag LOCUS_15500 2169 3047 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 protein_id gnl|my_center|LOCUS_15500 3605 3054 gene locus_tag LOCUS_15510 3605 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 4768 3641 gene locus_tag LOCUS_15520 gene aroC 4768 3641 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3W7 protein_id gnl|my_center|LOCUS_15520 <5446 4806 gene locus_tag LOCUS_15530 <5446 4806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y3U2:enoyl-[acyl-carrier-protein] reductase [NADH] >Feature sequence195 1223 456 gene locus_tag LOCUS_15540 1223 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2095 1769 gene locus_tag LOCUS_15550 2095 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3167 2340 gene locus_tag LOCUS_15560 3167 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3359 5437 gene locus_tag LOCUS_15570 3359 5437 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence196 <1 532 gene locus_tag LOCUS_15580 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TI50:50S ribosomal protein L25 619 1263 gene locus_tag LOCUS_15590 gene pth 619 1263 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ9 protein_id gnl|my_center|LOCUS_15590 1263 2360 gene locus_tag LOCUS_15600 gene ychF 1263 2360 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 protein_id gnl|my_center|LOCUS_15600 2386 2859 gene locus_tag LOCUS_15610 2386 2859 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972161.1 protein_id gnl|my_center|LOCUS_15610 2863 3345 gene locus_tag LOCUS_15620 2863 3345 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090171.1 protein_id gnl|my_center|LOCUS_15620 3376 4074 gene locus_tag LOCUS_15630 3376 4074 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_15630 4483 4079 gene locus_tag LOCUS_15640 4483 4079 CDS product diadenosine tetraphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970651.1 protein_id gnl|my_center|LOCUS_15640 5133 4480 gene locus_tag LOCUS_15650 gene fucA 5133 4480 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337432.1 protein_id gnl|my_center|LOCUS_15650 5441 5130 gene locus_tag LOCUS_15660 5441 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence197 <1 752 gene locus_tag LOCUS_15670 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001101563.1:type I-F CRISPR-associated helicase Cas3 868 2205 gene locus_tag LOCUS_15680 868 2205 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 protein_id gnl|my_center|LOCUS_15680 2202 3218 gene locus_tag LOCUS_15690 2202 3218 CDS product CRISPR type I-F system protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 protein_id gnl|my_center|LOCUS_15690 3245 4273 gene locus_tag LOCUS_15700 3245 4273 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_15700 4279 4848 gene locus_tag LOCUS_15710 4279 4848 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_15710 4979 5426 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcataggcagctcagaaa >Feature sequence198 2131 1415 gene locus_tag LOCUS_15720 2131 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2212 2772 gene locus_tag LOCUS_15730 2212 2772 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703376.1 protein_id gnl|my_center|LOCUS_15730 2837 3709 gene locus_tag LOCUS_15740 2837 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3740 4567 gene locus_tag LOCUS_15750 3740 4567 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence199 325 681 gene locus_tag LOCUS_15760 325 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 800 1126 gene locus_tag LOCUS_15770 800 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1682 1419 gene locus_tag LOCUS_15780 1682 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2580 3257 gene locus_tag LOCUS_15790 2580 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3481 4233 gene locus_tag LOCUS_15800 3481 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4411 5391 gene locus_tag LOCUS_15810 4411 5391 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WT9 protein_id gnl|my_center|LOCUS_15810 >Feature sequence200 1050 301 gene locus_tag LOCUS_15820 gene sufC 1050 301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537716.1 protein_id gnl|my_center|LOCUS_15820 1201 1052 gene locus_tag LOCUS_15830 1201 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2661 1201 gene locus_tag LOCUS_15840 gene sufB 2661 1201 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919730.1 protein_id gnl|my_center|LOCUS_15840 3872 2670 gene locus_tag LOCUS_15850 gene nifS 3872 2670 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_15850 4476 3925 gene locus_tag LOCUS_15860 4476 3925 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence201 <1 2519 gene locus_tag LOCUS_15870 <1 2519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532626.1:aminopeptidase N 2759 4990 gene locus_tag LOCUS_15880 2759 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence202 725 114 gene locus_tag LOCUS_15890 725 114 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_15890 2474 738 gene locus_tag LOCUS_15900 2474 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2698 2453 gene locus_tag LOCUS_15910 2698 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3289 3011 gene locus_tag LOCUS_15920 3289 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919798.1 protein_id gnl|my_center|LOCUS_15920 4998 3313 gene locus_tag LOCUS_15930 4998 3313 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence203 69 929 gene locus_tag LOCUS_15940 69 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 protein_id gnl|my_center|LOCUS_15940 853 2436 gene locus_tag LOCUS_15950 853 2436 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709669.1 protein_id gnl|my_center|LOCUS_15950 3209 2469 gene locus_tag LOCUS_15960 3209 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3418 3206 gene locus_tag LOCUS_15970 3418 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence204 1817 2695 gene locus_tag LOCUS_15980 gene dapA 1817 2695 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT80 protein_id gnl|my_center|LOCUS_15980 2723 3205 gene locus_tag LOCUS_15990 gene smpB 2723 3205 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMJ6 protein_id gnl|my_center|LOCUS_15990 3888 3202 gene locus_tag LOCUS_16000 3888 3202 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_16000 4508 3897 gene locus_tag LOCUS_16010 4508 3897 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_16010 4620 5159 gene locus_tag LOCUS_16020 4620 5159 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence205 <1 716 gene locus_tag LOCUS_16030 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027282.1:alkyldihydroxyacetonephosphate synthase 1900 950 gene locus_tag LOCUS_16040 1900 950 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_16040 2498 1944 gene locus_tag LOCUS_16050 2498 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919983.1 protein_id gnl|my_center|LOCUS_16050 2884 2486 gene locus_tag LOCUS_16060 2884 2486 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_16060 2999 3493 gene locus_tag LOCUS_16070 2999 3493 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_16070 <5379 3591 gene locus_tag LOCUS_16080 <5379 3591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921167.1:acyl-CoA synthetase >Feature sequence206 1640 1556 gene locus_tag LOCUS_t00220 1640 1556 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2784 1750 gene locus_tag LOCUS_16090 2784 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701235.1 protein_id gnl|my_center|LOCUS_16090 3186 2806 gene locus_tag LOCUS_16100 3186 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3276 4022 gene locus_tag LOCUS_16110 3276 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4530 4033 gene locus_tag LOCUS_16120 gene bar 4530 4033 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21861 protein_id gnl|my_center|LOCUS_16120 4745 4530 gene locus_tag LOCUS_16130 4745 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5325 4738 gene locus_tag LOCUS_16140 5325 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence207 1185 2066 gene locus_tag LOCUS_16150 1185 2066 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_16150 3386 2325 gene locus_tag LOCUS_16160 gene hemB 3386 2325 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_16160 3450 4100 gene locus_tag LOCUS_16170 3450 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404044.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence208 1116 199 gene locus_tag LOCUS_16180 1116 199 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_16180 1938 1147 gene locus_tag LOCUS_16190 1938 1147 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 protein_id gnl|my_center|LOCUS_16190 2518 1952 gene locus_tag LOCUS_16200 2518 1952 CDS product hypothetical carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705211.1 protein_id gnl|my_center|LOCUS_16200 3628 2648 gene locus_tag LOCUS_16210 3628 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4194 3649 gene locus_tag LOCUS_16220 4194 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086710.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence209 1232 507 gene locus_tag LOCUS_16230 1232 507 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ9 protein_id gnl|my_center|LOCUS_16230 1582 1229 gene locus_tag LOCUS_16240 1582 1229 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_16240 2513 1659 gene locus_tag LOCUS_16250 2513 1659 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_16250 3205 2624 gene locus_tag LOCUS_16260 gene ctaG 3205 2624 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_16260 3401 3222 gene locus_tag LOCUS_16270 3401 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4388 3414 gene locus_tag LOCUS_16280 gene ctaB 4388 3414 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RM98 protein_id gnl|my_center|LOCUS_16280 <5288 4417 gene locus_tag LOCUS_16290 <5288 4417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MHJ2:cytochrome c oxidase subunit 1 >Feature sequence210 1942 1346 gene locus_tag LOCUS_16300 1942 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2042 3310 gene locus_tag LOCUS_16310 2042 3310 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726802.1 protein_id gnl|my_center|LOCUS_16310 3307 4332 gene locus_tag LOCUS_16320 3307 4332 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528548.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence211 1619 1302 gene locus_tag LOCUS_16330 1619 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1698 3722 gene locus_tag LOCUS_16340 1698 3722 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_16340 3883 4581 gene locus_tag LOCUS_16350 3883 4581 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence212 1506 490 gene locus_tag LOCUS_16360 1506 490 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_16360 2507 1503 gene locus_tag LOCUS_16370 2507 1503 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_16370 3377 2598 gene locus_tag LOCUS_16380 3377 2598 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XZ4 protein_id gnl|my_center|LOCUS_16380 3956 3396 gene locus_tag LOCUS_16390 3956 3396 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DM6 protein_id gnl|my_center|LOCUS_16390 4534 3950 gene locus_tag LOCUS_16400 4534 3950 CDS product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence213 680 12 gene locus_tag LOCUS_16410 680 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 817 1383 gene locus_tag LOCUS_16420 817 1383 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027459.1 protein_id gnl|my_center|LOCUS_16420 1823 1455 gene locus_tag LOCUS_16430 1823 1455 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_16430 2341 1973 gene locus_tag LOCUS_16440 2341 1973 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918047.1 protein_id gnl|my_center|LOCUS_16440 3303 2521 gene locus_tag LOCUS_16450 3303 2521 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_16450 3565 3969 gene locus_tag LOCUS_16460 3565 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4995 4075 gene locus_tag LOCUS_16470 4995 4075 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence214 953 672 gene locus_tag LOCUS_16480 953 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2705 1032 gene locus_tag LOCUS_16490 2705 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4646 2712 gene locus_tag LOCUS_16500 4646 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4765 4932 gene locus_tag LOCUS_16510 4765 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence215 644 1810 gene locus_tag LOCUS_16520 644 1810 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083815.1 protein_id gnl|my_center|LOCUS_16520 1872 2192 gene locus_tag LOCUS_16530 1872 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2308 2727 gene locus_tag LOCUS_16540 2308 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920928.1 protein_id gnl|my_center|LOCUS_16540 2771 4492 gene locus_tag LOCUS_16550 2771 4492 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_16550 <5157 4497 gene locus_tag LOCUS_16560 <5157 4497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083373.1:restriction endonuclease >Feature sequence216 674 60 gene locus_tag LOCUS_16570 674 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1668 757 gene locus_tag LOCUS_16580 1668 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1993 1721 gene locus_tag LOCUS_16590 1993 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2234 3622 gene locus_tag LOCUS_16600 2234 3622 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405421.1 protein_id gnl|my_center|LOCUS_16600 <5150 3655 gene locus_tag LOCUS_16610 <5150 3655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064414.1:O-acetyltransferase >Feature sequence217 1751 1374 gene locus_tag LOCUS_16620 1751 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2191 1781 gene locus_tag LOCUS_16630 2191 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_16630 3197 2220 gene locus_tag LOCUS_16640 3197 2220 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_16640 4768 3230 gene locus_tag LOCUS_16650 4768 3230 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228608.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence218 736 122 gene locus_tag LOCUS_16660 736 122 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_16660 1119 733 gene locus_tag LOCUS_16670 1119 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1334 1116 gene locus_tag LOCUS_16680 1334 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1713 1324 gene locus_tag LOCUS_16690 1713 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2315 1710 gene locus_tag LOCUS_16700 2315 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2959 2315 gene locus_tag LOCUS_16710 2959 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 <5138 3025 gene locus_tag LOCUS_16720 <5138 3025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070968.1:transposase >Feature sequence219 3768 2977 gene locus_tag LOCUS_16730 3768 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3985 4530 gene locus_tag LOCUS_16740 3985 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence220 353 811 gene locus_tag LOCUS_16750 353 811 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_16750 1228 833 gene locus_tag LOCUS_16760 1228 833 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640257.1 protein_id gnl|my_center|LOCUS_16760 1428 1646 gene locus_tag LOCUS_16770 gene infA 1428 1646 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 protein_id gnl|my_center|LOCUS_16770 1663 2265 gene locus_tag LOCUS_16780 1663 2265 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF3 protein_id gnl|my_center|LOCUS_16780 2354 3874 gene locus_tag LOCUS_16790 gene cafA 2354 3874 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_16790 3880 4068 gene locus_tag LOCUS_16800 gene yacG 3880 4068 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA41 protein_id gnl|my_center|LOCUS_16800 4282 4357 gene locus_tag LOCUS_t00230 4282 4357 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5104 4661 gene locus_tag LOCUS_16810 5104 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence221 614 1036 gene locus_tag LOCUS_16820 614 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715958.1 protein_id gnl|my_center|LOCUS_16820 1033 1917 gene locus_tag LOCUS_16830 1033 1917 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194784.1 protein_id gnl|my_center|LOCUS_16830 1987 2430 gene locus_tag LOCUS_16840 1987 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2441 2590 gene locus_tag LOCUS_16850 2441 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_16850 2612 4450 gene locus_tag LOCUS_16860 2612 4450 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence222 1508 600 gene locus_tag LOCUS_16870 1508 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2099 1518 gene locus_tag LOCUS_16880 2099 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3232 2210 gene locus_tag LOCUS_16890 gene asd 3232 2210 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWX8 protein_id gnl|my_center|LOCUS_16890 3496 3356 gene locus_tag LOCUS_16900 3496 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4278 3613 gene locus_tag LOCUS_16910 4278 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4474 4734 gene locus_tag LOCUS_16920 4474 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4744 5046 gene locus_tag LOCUS_16930 4744 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence223 1097 546 gene locus_tag LOCUS_16940 1097 546 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975773.1 protein_id gnl|my_center|LOCUS_16940 1207 1119 gene locus_tag LOCUS_t00240 1207 1119 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2495 1287 gene locus_tag LOCUS_16950 2495 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3458 2703 gene locus_tag LOCUS_16960 3458 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731482.1 protein_id gnl|my_center|LOCUS_16960 3638 4279 gene locus_tag LOCUS_16970 3638 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4803 4402 gene locus_tag LOCUS_16980 4803 4402 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086934.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence224 <1 586 gene locus_tag LOCUS_16990 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389829.1:methyl-accepting chemotaxis protein 2342 717 gene locus_tag LOCUS_17000 gene ftsZ1 2342 717 CDS product cell division protein FtsZ 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30327 protein_id gnl|my_center|LOCUS_17000 3911 2544 gene locus_tag LOCUS_17010 gene ftsA 3911 2544 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_17010 4720 3908 gene locus_tag LOCUS_17020 4720 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence225 388 798 gene locus_tag LOCUS_17030 388 798 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_17030 817 1515 gene locus_tag LOCUS_17040 817 1515 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_17040 3897 1576 gene locus_tag LOCUS_17050 3897 1576 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531774.1 protein_id gnl|my_center|LOCUS_17050 4370 3990 gene locus_tag LOCUS_17060 gene clpS 4370 3990 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8I7 protein_id gnl|my_center|LOCUS_17060 4947 4516 gene locus_tag LOCUS_17070 4947 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence226 95 1540 gene locus_tag LOCUS_17080 gene murD 95 1540 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 protein_id gnl|my_center|LOCUS_17080 1537 2718 gene locus_tag LOCUS_17090 gene ftsW 1537 2718 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_17090 2715 3821 gene locus_tag LOCUS_17100 gene murG 2715 3821 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF54 protein_id gnl|my_center|LOCUS_17100 >Feature sequence227 1402 614 gene locus_tag LOCUS_17110 1402 614 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525174.1 protein_id gnl|my_center|LOCUS_17110 3332 1407 gene locus_tag LOCUS_17120 3332 1407 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 protein_id gnl|my_center|LOCUS_17120 3437 4234 gene locus_tag LOCUS_17130 3437 4234 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_17130 4721 4215 gene locus_tag LOCUS_17140 4721 4215 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence228 2627 1782 gene locus_tag LOCUS_17150 2627 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085836.1 protein_id gnl|my_center|LOCUS_17150 2741 3376 gene locus_tag LOCUS_17160 2741 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3384 4139 gene locus_tag LOCUS_17170 3384 4139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707173.1 protein_id gnl|my_center|LOCUS_17170 <5020 4136 gene locus_tag LOCUS_17180 <5020 4136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040801.1:MFS transporter >Feature sequence229 <1 1340 gene locus_tag LOCUS_17190 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086538.1:glutathione-disulfide reductase 1515 2894 gene locus_tag LOCUS_17200 1515 2894 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 protein_id gnl|my_center|LOCUS_17200 3094 4971 gene locus_tag LOCUS_17210 3094 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence230 3115 2030 gene locus_tag LOCUS_17220 gene flhB 3115 2030 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_17220 3907 3137 gene locus_tag LOCUS_17230 gene fliR 3907 3137 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 protein_id gnl|my_center|LOCUS_17230 4189 3923 gene locus_tag LOCUS_17240 gene fliQ 4189 3923 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_17240 4594 4265 gene locus_tag LOCUS_17250 gene fliE 4594 4265 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9M3 protein_id gnl|my_center|LOCUS_17250 >Feature sequence231 2212 1118 gene locus_tag LOCUS_17260 gene adh 2212 1118 CDS product putative alcohol dehydrogenase adh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQC3 protein_id gnl|my_center|LOCUS_17260 2370 2948 gene locus_tag LOCUS_17270 2370 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702776.1 protein_id gnl|my_center|LOCUS_17270 2985 3833 gene locus_tag LOCUS_17280 2985 3833 CDS product putative dehydrogenase/dehydratase, MaoC family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701373.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence232 <1 1012 gene locus_tag LOCUS_17290 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388020.1:lytic transglycosylase 1772 1161 gene locus_tag LOCUS_17300 1772 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 protein_id gnl|my_center|LOCUS_17300 2196 1819 gene locus_tag LOCUS_17310 2196 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3000 2299 gene locus_tag LOCUS_17320 gene wcaA 3000 2299 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_17320 3128 4441 gene locus_tag LOCUS_17330 3128 4441 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence233 1057 152 gene locus_tag LOCUS_17340 gene dltE 1057 152 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_17340 1359 2891 gene locus_tag LOCUS_17350 1359 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3022 4764 gene locus_tag LOCUS_17360 3022 4764 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence234 392 1336 gene locus_tag LOCUS_17370 392 1336 CDS product sulfur metabolism-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204243.1 protein_id gnl|my_center|LOCUS_17370 2711 1365 gene locus_tag LOCUS_17380 2711 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3277 2762 gene locus_tag LOCUS_17390 3277 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3369 4247 gene locus_tag LOCUS_17400 3369 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728818.1 protein_id gnl|my_center|LOCUS_17400 <4951 4253 gene locus_tag LOCUS_17410 <4951 4253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939245.1:diguanylate phosphodiesterase >Feature sequence235 2 745 gene locus_tag LOCUS_17420 2 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 742 1833 gene locus_tag LOCUS_17430 742 1833 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_17430 1840 4230 gene locus_tag LOCUS_17440 gene lptD 1840 4230 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 protein_id gnl|my_center|LOCUS_17440 >Feature sequence236 1734 1279 gene locus_tag LOCUS_17450 1734 1279 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_17450 3913 1982 gene locus_tag LOCUS_17460 3913 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_17460 4150 4812 gene locus_tag LOCUS_17470 4150 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence237 <1 1794 gene locus_tag LOCUS_17480 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532590.1:GTP pyrophosphokinase 1835 2479 gene locus_tag LOCUS_17490 gene pyrE 1835 2479 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 protein_id gnl|my_center|LOCUS_17490 2547 3314 gene locus_tag LOCUS_17500 gene pdxJ 2547 3314 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_17500 3307 3726 gene locus_tag LOCUS_17510 gene acpS 3307 3726 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ6 protein_id gnl|my_center|LOCUS_17510 3740 4678 gene locus_tag LOCUS_17520 3740 4678 CDS product UPF0176 protein R02887 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LX6 protein_id gnl|my_center|LOCUS_17520 >Feature sequence238 790 1413 gene locus_tag LOCUS_17530 790 1413 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_17530 2258 1410 gene locus_tag LOCUS_17540 2258 1410 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0B8 protein_id gnl|my_center|LOCUS_17540 2793 2308 gene locus_tag LOCUS_17550 2793 2308 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886775.1 protein_id gnl|my_center|LOCUS_17550 3455 2985 gene locus_tag LOCUS_17560 3455 2985 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085470.1 protein_id gnl|my_center|LOCUS_17560 3552 4571 gene locus_tag LOCUS_17570 gene qor 3552 4571 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225780.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence239 891 115 gene locus_tag LOCUS_17580 891 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_17580 1723 1328 gene locus_tag LOCUS_17590 1723 1328 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 protein_id gnl|my_center|LOCUS_17590 2609 1821 gene locus_tag LOCUS_17600 2609 1821 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920507.1 protein_id gnl|my_center|LOCUS_17600 2708 3106 gene locus_tag LOCUS_17610 2708 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061701.1 protein_id gnl|my_center|LOCUS_17610 3121 3723 gene locus_tag LOCUS_17620 3121 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531186.1 protein_id gnl|my_center|LOCUS_17620 3917 4585 gene locus_tag LOCUS_17630 3917 4585 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17630 >Feature sequence240 2420 4192 gene locus_tag LOCUS_17640 2420 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence241 1047 1607 gene locus_tag LOCUS_17650 gene atpH 1047 1607 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S4 protein_id gnl|my_center|LOCUS_17650 1607 3136 gene locus_tag LOCUS_17660 gene atpA 1607 3136 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X72 protein_id gnl|my_center|LOCUS_17660 3172 4050 gene locus_tag LOCUS_17670 gene atpG 3172 4050 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL32 protein_id gnl|my_center|LOCUS_17670 >Feature sequence242 454 89 gene locus_tag LOCUS_17680 454 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 482 1435 gene locus_tag LOCUS_17690 482 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1432 1911 gene locus_tag LOCUS_17700 1432 1911 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975288.1 protein_id gnl|my_center|LOCUS_17700 2472 1939 gene locus_tag LOCUS_17710 2472 1939 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920716.1 protein_id gnl|my_center|LOCUS_17710 2616 3482 gene locus_tag LOCUS_17720 2616 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099950.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence243 345 1556 gene locus_tag LOCUS_17730 345 1556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707651.1 protein_id gnl|my_center|LOCUS_17730 1677 1844 gene locus_tag LOCUS_17740 gene rpmG 1677 1844 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S1 protein_id gnl|my_center|LOCUS_17740 3950 2577 gene locus_tag LOCUS_17750 gene pleD 3950 2577 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_17750 4341 3976 gene locus_tag LOCUS_17760 4341 3976 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920321.1 protein_id gnl|my_center|LOCUS_17760 4546 4809 gene locus_tag LOCUS_17770 4546 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence244 1271 1414 gene locus_tag LOCUS_17780 1271 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1599 1967 gene locus_tag LOCUS_17790 1599 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2335 2622 gene locus_tag LOCUS_17800 2335 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2595 3362 gene locus_tag LOCUS_17810 2595 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3398 3607 gene locus_tag LOCUS_17820 3398 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3694 3924 gene locus_tag LOCUS_17830 3694 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3948 4079 gene locus_tag LOCUS_17840 3948 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4453 4377 gene locus_tag LOCUS_t00250 4453 4377 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence245 190 798 gene locus_tag LOCUS_17850 190 798 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_17850 889 2007 gene locus_tag LOCUS_17860 889 2007 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_17860 2027 2494 gene locus_tag LOCUS_17870 gene ribH 2027 2494 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7P7 protein_id gnl|my_center|LOCUS_17870 2554 2979 gene locus_tag LOCUS_17880 gene nusB 2554 2979 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG69 protein_id gnl|my_center|LOCUS_17880 2979 3974 gene locus_tag LOCUS_17890 gene thiL 2979 3974 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 protein_id gnl|my_center|LOCUS_17890 4046 4654 gene locus_tag LOCUS_17900 4046 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence246 <1 1180 gene locus_tag LOCUS_17910 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973356.1:integrase 1173 1949 gene locus_tag LOCUS_17920 1173 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2104 2298 gene locus_tag LOCUS_17930 2104 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2314 2523 gene locus_tag LOCUS_17940 2314 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2523 3056 gene locus_tag LOCUS_17950 2523 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931436.1 protein_id gnl|my_center|LOCUS_17950 3049 3936 gene locus_tag LOCUS_17960 3049 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3929 4129 gene locus_tag LOCUS_17970 3929 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 4113 4364 gene locus_tag LOCUS_17980 4113 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence247 1563 2357 gene locus_tag LOCUS_17990 1563 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2462 3907 gene locus_tag LOCUS_18000 2462 3907 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063896.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence248 <1 2331 gene locus_tag LOCUS_18010 <1 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6U5G1:bifunctional uridylyltransferase/uridylyl-removing enzyme 2373 3932 gene locus_tag LOCUS_18020 2373 3932 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_18020 >Feature sequence249 <1 659 gene locus_tag LOCUS_18030 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918576.1:acyl-CoA dehydrogenase 908 1549 gene locus_tag LOCUS_18040 908 1549 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532130.1 protein_id gnl|my_center|LOCUS_18040 3540 1600 gene locus_tag LOCUS_18050 3540 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4746 3682 gene locus_tag LOCUS_18060 4746 3682 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence250 1486 1875 gene locus_tag LOCUS_18070 1486 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267535.1 protein_id gnl|my_center|LOCUS_18070 2676 1888 gene locus_tag LOCUS_18080 2676 1888 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_18080 2675 3640 gene locus_tag LOCUS_18090 gene ubiA 2675 3640 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ43 protein_id gnl|my_center|LOCUS_18090 4164 4364 gene locus_tag LOCUS_18100 4164 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence251 1224 1982 gene locus_tag LOCUS_18110 gene cbbJ 1224 1982 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J536 protein_id gnl|my_center|LOCUS_18110 2105 2485 gene locus_tag LOCUS_18120 2105 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2599 4227 gene locus_tag LOCUS_18130 gene pyrG 2599 4227 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEY5 protein_id gnl|my_center|LOCUS_18130 >Feature sequence252 446 1447 gene locus_tag LOCUS_18140 gene yedY 446 1447 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_18140 1764 3047 gene locus_tag LOCUS_18150 1764 3047 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_18150 3478 3053 gene locus_tag LOCUS_18160 3478 3053 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088400.1 protein_id gnl|my_center|LOCUS_18160 <4774 3903 gene locus_tag LOCUS_18170 <4774 3903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390649.1:LysR family transcriptional regulator >Feature sequence253 679 1773 gene locus_tag LOCUS_18180 679 1773 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_18180 1949 2743 gene locus_tag LOCUS_18190 1949 2743 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 protein_id gnl|my_center|LOCUS_18190 2780 3592 gene locus_tag LOCUS_18200 2780 3592 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_18200 4074 3628 gene locus_tag LOCUS_18210 4074 3628 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918289.1 protein_id gnl|my_center|LOCUS_18210 4479 4102 gene locus_tag LOCUS_18220 4479 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence254 1161 178 gene locus_tag LOCUS_18230 1161 178 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968174.1 protein_id gnl|my_center|LOCUS_18230 1194 1859 gene locus_tag LOCUS_18240 gene azoR 1194 1859 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN28 protein_id gnl|my_center|LOCUS_18240 2642 3811 gene locus_tag LOCUS_18250 2642 3811 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038088.1 protein_id gnl|my_center|LOCUS_18250 3812 4282 gene locus_tag LOCUS_18260 3812 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038089.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence255 361 948 gene locus_tag LOCUS_18270 gene rimJ 361 948 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_18270 1183 4329 gene locus_tag LOCUS_18280 1183 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence256 1865 1101 gene locus_tag LOCUS_18290 1865 1101 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229264.1 protein_id gnl|my_center|LOCUS_18290 3119 2661 gene locus_tag LOCUS_18300 3119 2661 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919971.1 protein_id gnl|my_center|LOCUS_18300 4380 3112 gene locus_tag LOCUS_18310 4380 3112 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFB8 protein_id gnl|my_center|LOCUS_18310 >Feature sequence257 1977 715 gene locus_tag LOCUS_18320 1977 715 CDS product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU14 protein_id gnl|my_center|LOCUS_18320 2730 2005 gene locus_tag LOCUS_18330 2730 2005 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 protein_id gnl|my_center|LOCUS_18330 2982 3563 gene locus_tag LOCUS_18340 2982 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 3674 4204 gene locus_tag LOCUS_18350 gene secB 3674 4204 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE7 protein_id gnl|my_center|LOCUS_18350 >Feature sequence258 2114 900 gene locus_tag LOCUS_18360 2114 900 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_18360 2479 2850 gene locus_tag LOCUS_18370 2479 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4115 2847 gene locus_tag LOCUS_18380 4115 2847 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence259 783 424 gene locus_tag LOCUS_18390 783 424 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971364.1 protein_id gnl|my_center|LOCUS_18390 897 1316 gene locus_tag LOCUS_18400 897 1316 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_18400 1403 1804 gene locus_tag LOCUS_18410 1403 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1851 2447 gene locus_tag LOCUS_18420 1851 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3302 2517 gene locus_tag LOCUS_18430 3302 2517 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_18430 3786 3358 gene locus_tag LOCUS_18440 3786 3358 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532564.1 protein_id gnl|my_center|LOCUS_18440 4268 3783 gene locus_tag LOCUS_18450 4268 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence260 <1 709 gene locus_tag LOCUS_18460 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89MS0:polyphosphate kinase 785 2308 gene locus_tag LOCUS_18470 785 2308 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_18470 3489 2320 gene locus_tag LOCUS_18480 gene rnd 3489 2320 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_18480 >Feature sequence261 1359 211 gene locus_tag LOCUS_18490 gene aapM 1359 211 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707871.1 protein_id gnl|my_center|LOCUS_18490 2571 1363 gene locus_tag LOCUS_18500 2571 1363 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_18500 3713 2652 gene locus_tag LOCUS_18510 3713 2652 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence262 330 1367 gene locus_tag LOCUS_18520 330 1367 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_18520 1444 2814 gene locus_tag LOCUS_18530 1444 2814 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_18530 2814 4109 gene locus_tag LOCUS_18540 2814 4109 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence263 1121 147 gene locus_tag LOCUS_18550 1121 147 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918655.1 protein_id gnl|my_center|LOCUS_18550 2186 1164 gene locus_tag LOCUS_18560 2186 1164 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918656.1 protein_id gnl|my_center|LOCUS_18560 2829 2227 gene locus_tag LOCUS_18570 2829 2227 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 protein_id gnl|my_center|LOCUS_18570 4486 3077 gene locus_tag LOCUS_18580 4486 3077 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918659.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence264 146 3175 gene locus_tag LOCUS_18590 146 3175 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence265 1956 1639 gene locus_tag LOCUS_18600 1956 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529562.1 protein_id gnl|my_center|LOCUS_18600 2943 2131 gene locus_tag LOCUS_18610 2943 2131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_18610 3713 2940 gene locus_tag LOCUS_18620 3713 2940 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_18620 4536 3736 gene locus_tag LOCUS_18630 4536 3736 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence266 412 651 gene locus_tag LOCUS_18640 412 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1314 715 gene locus_tag LOCUS_18650 1314 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1358 1819 gene locus_tag LOCUS_18660 1358 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_18660 1915 2826 gene locus_tag LOCUS_18670 1915 2826 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_18670 3333 2896 gene locus_tag LOCUS_18680 3333 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3647 4351 gene locus_tag LOCUS_18690 3647 4351 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58113 protein_id gnl|my_center|LOCUS_18690 >Feature sequence267 89 1501 gene locus_tag LOCUS_18700 89 1501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919616.1 protein_id gnl|my_center|LOCUS_18700 1610 2152 gene locus_tag LOCUS_18710 1610 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391168.1 protein_id gnl|my_center|LOCUS_18710 2164 2610 gene locus_tag LOCUS_18720 2164 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2660 3829 gene locus_tag LOCUS_18730 2660 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence268 1556 651 gene locus_tag LOCUS_18740 gene glyQ 1556 651 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S70 protein_id gnl|my_center|LOCUS_18740 1932 1726 gene locus_tag LOCUS_18750 1932 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2892 1969 gene locus_tag LOCUS_18760 2892 1969 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974664.1 protein_id gnl|my_center|LOCUS_18760 3709 2918 gene locus_tag LOCUS_18770 3709 2918 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_18770 3939 3706 gene locus_tag LOCUS_18780 3939 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974662.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence269 787 104 gene locus_tag LOCUS_18790 gene satA 787 104 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_18790 918 1538 gene locus_tag LOCUS_18800 gene pmtA 918 1538 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_18800 1954 1535 gene locus_tag LOCUS_18810 1954 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2544 2083 gene locus_tag LOCUS_18820 2544 2083 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528644.1 protein_id gnl|my_center|LOCUS_18820 3030 2650 gene locus_tag LOCUS_18830 3030 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3677 3213 gene locus_tag LOCUS_18840 3677 3213 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_18840 4460 3777 gene locus_tag LOCUS_18850 4460 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence270 410 1195 gene locus_tag LOCUS_18860 gene sipF 410 1195 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K52 protein_id gnl|my_center|LOCUS_18860 1258 1917 gene locus_tag LOCUS_18870 gene rnc 1258 1917 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 protein_id gnl|my_center|LOCUS_18870 1914 2831 gene locus_tag LOCUS_18880 gene era 1914 2831 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 protein_id gnl|my_center|LOCUS_18880 2998 3726 gene locus_tag LOCUS_18890 gene recO 2998 3726 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V8 protein_id gnl|my_center|LOCUS_18890 4016 3723 gene locus_tag LOCUS_18900 4016 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence271 225 150 gene locus_tag LOCUS_t00260 225 150 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1502 363 gene locus_tag LOCUS_18910 gene tgt 1502 363 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 protein_id gnl|my_center|LOCUS_18910 2617 1499 gene locus_tag LOCUS_18920 gene queA 2617 1499 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD31 protein_id gnl|my_center|LOCUS_18920 3068 2601 gene locus_tag LOCUS_18930 gene ppiB 3068 2601 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_18930 3713 3108 gene locus_tag LOCUS_18940 3713 3108 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Y1 protein_id gnl|my_center|LOCUS_18940 4284 3760 gene locus_tag LOCUS_18950 gene coaD 4284 3760 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 protein_id gnl|my_center|LOCUS_18950 >Feature sequence272 1226 2176 gene locus_tag LOCUS_18960 1226 2176 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_18960 4126 2180 gene locus_tag LOCUS_18970 4126 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence273 957 598 gene locus_tag LOCUS_18980 957 598 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 protein_id gnl|my_center|LOCUS_18980 1239 976 gene locus_tag LOCUS_18990 1239 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535987.1 protein_id gnl|my_center|LOCUS_18990 1611 3647 gene locus_tag LOCUS_19000 1611 3647 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7F2 protein_id gnl|my_center|LOCUS_19000 >Feature sequence274 <1 908 gene locus_tag LOCUS_19010 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TKA4:dihydroxy-acid dehydratase 889 1614 gene locus_tag LOCUS_19020 889 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1702 2223 gene locus_tag LOCUS_19030 1702 2223 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_19030 2220 3149 gene locus_tag LOCUS_19040 gene rimK 2220 3149 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_19040 3142 4209 gene locus_tag LOCUS_19050 3142 4209 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence275 1195 1013 gene locus_tag LOCUS_19060 1195 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2643 1192 gene locus_tag LOCUS_19070 gene argH 2643 1192 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 protein_id gnl|my_center|LOCUS_19070 2606 3277 gene locus_tag LOCUS_19080 2606 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3794 3282 gene locus_tag LOCUS_19090 3794 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence276 <1 804 gene locus_tag LOCUS_19100 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89XV0:peptidylprolyl isomerase 865 2337 gene locus_tag LOCUS_19110 gene argJ 865 2337 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59610 protein_id gnl|my_center|LOCUS_19110 2474 2893 gene locus_tag LOCUS_19120 gene mutT 2474 2893 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_19120 2890 3057 gene locus_tag LOCUS_19130 2890 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3995 3084 gene locus_tag LOCUS_19140 gene bioC 3995 3084 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence277 505 2511 gene locus_tag LOCUS_19150 505 2511 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388476.1 protein_id gnl|my_center|LOCUS_19150 4102 2576 gene locus_tag LOCUS_19160 gene ytcI 4102 2576 CDS product putative acyl--CoA ligase YtcI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SPB0 protein_id gnl|my_center|LOCUS_19160 >Feature sequence278 549 1295 gene locus_tag LOCUS_19170 549 1295 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U83 protein_id gnl|my_center|LOCUS_19170 1319 1864 gene locus_tag LOCUS_19180 gene ruvC 1319 1864 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U82 protein_id gnl|my_center|LOCUS_19180 1861 2481 gene locus_tag LOCUS_19190 gene ruvA 1861 2481 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K5 protein_id gnl|my_center|LOCUS_19190 2503 3540 gene locus_tag LOCUS_19200 gene ruvB 2503 3540 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN03 protein_id gnl|my_center|LOCUS_19200 3628 4101 gene locus_tag LOCUS_19210 3628 4101 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973275.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence279 2354 900 gene locus_tag LOCUS_19220 gene murF 2354 900 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 protein_id gnl|my_center|LOCUS_19220 3826 2360 gene locus_tag LOCUS_19230 gene murE 3826 2360 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT9 protein_id gnl|my_center|LOCUS_19230 <4345 3831 gene locus_tag LOCUS_19240 <4345 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388711.1:peptidoglycan glycosyltransferase >Feature sequence280 2215 611 gene locus_tag LOCUS_19250 2215 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19250 2639 2265 gene locus_tag LOCUS_19260 2639 2265 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_19260 2865 3749 gene locus_tag LOCUS_19270 2865 3749 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_19270 <4340 3756 gene locus_tag LOCUS_19280 <4340 3756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389520.1:peptidase M23 >Feature sequence281 1983 787 gene locus_tag LOCUS_19290 1983 787 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_19290 2341 3531 gene locus_tag LOCUS_19300 2341 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence282 719 231 gene locus_tag LOCUS_19310 gene zur 719 231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383758.1 protein_id gnl|my_center|LOCUS_19310 789 1889 gene locus_tag LOCUS_19320 789 1889 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975839.1 protein_id gnl|my_center|LOCUS_19320 2741 1896 gene locus_tag LOCUS_19330 2741 1896 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7Y0 protein_id gnl|my_center|LOCUS_19330 2899 3555 gene locus_tag LOCUS_19340 2899 3555 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896256.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence283 2209 1523 gene locus_tag LOCUS_19350 2209 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2746 2276 gene locus_tag LOCUS_19360 2746 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3057 2743 gene locus_tag LOCUS_19370 3057 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338442.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence284 2536 197 gene locus_tag LOCUS_19380 2536 197 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_19380 2784 2533 gene locus_tag LOCUS_19390 2784 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 <4317 3661 gene locus_tag LOCUS_19400 <4317 3661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056617.1:membrane protein >Feature sequence285 <1 1161 gene locus_tag LOCUS_19410 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89MY2:amidophosphoribosyltransferase 1164 1874 gene locus_tag LOCUS_19420 1164 1874 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_19420 3352 1871 gene locus_tag LOCUS_19430 gene der 3352 1871 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7R6 protein_id gnl|my_center|LOCUS_19430 <4313 3401 gene locus_tag LOCUS_19440 <4313 3401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886Y7:outer membrane protein assembly factor BamB >Feature sequence286 2130 349 gene locus_tag LOCUS_19450 2130 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_19450 2123 2377 gene locus_tag LOCUS_19460 2123 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2494 3234 gene locus_tag LOCUS_19470 2494 3234 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_19470 <4310 3244 gene locus_tag LOCUS_19480 <4310 3244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530360.1:AMP-binding protein >Feature sequence287 784 140 gene locus_tag LOCUS_19490 784 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 945 2759 gene locus_tag LOCUS_19500 gene atuA 945 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence288 1829 366 gene locus_tag LOCUS_19510 gene gatB 1829 366 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK5 protein_id gnl|my_center|LOCUS_19510 3307 1829 gene locus_tag LOCUS_19520 gene gatA 3307 1829 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U819 protein_id gnl|my_center|LOCUS_19520 3591 3304 gene locus_tag LOCUS_19530 gene gatC 3591 3304 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 protein_id gnl|my_center|LOCUS_19530 3759 4235 gene locus_tag LOCUS_19540 3759 4235 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K24 protein_id gnl|my_center|LOCUS_19540 >Feature sequence289 747 325 gene locus_tag LOCUS_19550 747 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 958 1749 gene locus_tag LOCUS_19560 gene fadB 958 1749 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_19560 2664 1915 gene locus_tag LOCUS_19570 2664 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315519.1 protein_id gnl|my_center|LOCUS_19570 3372 3085 gene locus_tag LOCUS_19580 3372 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 <4265 3689 gene locus_tag LOCUS_19590 <4265 3689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389754.1:membrane protein >Feature sequence290 1583 507 gene locus_tag LOCUS_19600 1583 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 3423 1585 gene locus_tag LOCUS_19610 3423 1585 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_19610 <4254 3429 gene locus_tag LOCUS_19620 <4254 3429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972417.1:UDP-N-acetyl-D-glucosamine dehydrogenase >Feature sequence291 1303 371 gene locus_tag LOCUS_19630 1303 371 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_19630 1691 2116 gene locus_tag LOCUS_19640 1691 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2146 2955 gene locus_tag LOCUS_19650 2146 2955 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence292 <1 506 gene locus_tag LOCUS_19660 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528760.1:amidase 473 2035 gene locus_tag LOCUS_19670 473 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2041 2286 gene locus_tag LOCUS_19680 2041 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2531 3928 gene locus_tag LOCUS_19690 gene trmFO 2531 3928 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKD4 protein_id gnl|my_center|LOCUS_19690 >Feature sequence293 1298 48 gene locus_tag LOCUS_19700 1298 48 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_19700 1606 1295 gene locus_tag LOCUS_19710 1606 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2904 1825 gene locus_tag LOCUS_19720 2904 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence294 1067 2725 gene locus_tag LOCUS_19730 1067 2725 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_19730 3644 2733 gene locus_tag LOCUS_19740 3644 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705031.1 protein_id gnl|my_center|LOCUS_19740 <4182 3645 gene locus_tag LOCUS_19750 <4182 3645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919061.1:transcriptional regulator >Feature sequence295 250 1275 gene locus_tag LOCUS_19760 250 1275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_19760 1458 3587 gene locus_tag LOCUS_19770 gene glcB1 1458 3587 CDS product malate synthase G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AB2 protein_id gnl|my_center|LOCUS_19770 >Feature sequence296 2054 1032 gene locus_tag LOCUS_19780 2054 1032 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_19780 3746 2067 gene locus_tag LOCUS_19790 gene glpA 3746 2067 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence297 2049 1096 gene locus_tag LOCUS_19800 2049 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_19800 3089 2091 gene locus_tag LOCUS_19810 3089 2091 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085252.1 protein_id gnl|my_center|LOCUS_19810 3221 3835 gene locus_tag LOCUS_19820 3221 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence298 <1 2149 gene locus_tag LOCUS_19830 <1 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083732.1:penicillin-binding protein 3136 2153 gene locus_tag LOCUS_19840 3136 2153 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222803.1 protein_id gnl|my_center|LOCUS_19840 3973 3176 gene locus_tag LOCUS_19850 3973 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence299 825 1022 gene locus_tag LOCUS_19860 gene rpmI 825 1022 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M2 protein_id gnl|my_center|LOCUS_19860 1060 1416 gene locus_tag LOCUS_19870 gene rplT 1060 1416 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_19870 1590 2684 gene locus_tag LOCUS_19880 gene pheS 1590 2684 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIN5 protein_id gnl|my_center|LOCUS_19880 >Feature sequence300 315 2165 gene locus_tag LOCUS_19890 315 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_19890 3250 2174 gene locus_tag LOCUS_19900 3250 2174 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 protein_id gnl|my_center|LOCUS_19900 <4134 3325 gene locus_tag LOCUS_19910 <4134 3325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528656.1:multidrug ABC transporter ATP-binding protein >Feature sequence301 1504 377 gene locus_tag LOCUS_19920 1504 377 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_19920 3303 1525 gene locus_tag LOCUS_19930 3303 1525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970184.1 protein_id gnl|my_center|LOCUS_19930 3640 3858 gene locus_tag LOCUS_19940 gene rpmE 3640 3858 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 protein_id gnl|my_center|LOCUS_19940 >Feature sequence302 378 1463 gene locus_tag LOCUS_19950 gene prfA 378 1463 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ5 protein_id gnl|my_center|LOCUS_19950 1460 2341 gene locus_tag LOCUS_19960 gene prmC 1460 2341 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE0 protein_id gnl|my_center|LOCUS_19960 2826 3410 gene locus_tag LOCUS_19970 2826 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 <4118 3438 gene locus_tag LOCUS_19980 <4118 3438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084220.1:molybdenum cofactor sulfurase >Feature sequence303 1298 477 gene locus_tag LOCUS_19990 1298 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1440 2279 gene locus_tag LOCUS_20000 gene cysE 1440 2279 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 protein_id gnl|my_center|LOCUS_20000 2706 2395 gene locus_tag LOCUS_20010 2706 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2814 3641 gene locus_tag LOCUS_20020 2814 3641 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence304 489 1283 gene locus_tag LOCUS_20030 489 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2408 1302 gene locus_tag LOCUS_20040 2408 1302 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_20040 3582 4004 gene locus_tag LOCUS_20050 3582 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence305 1 132 gene locus_tag LOCUS_20060 1 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 133 1008 gene locus_tag LOCUS_20070 133 1008 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_20070 >Feature sequence306 1298 348 gene locus_tag LOCUS_20080 gene hemC 1298 348 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV6 protein_id gnl|my_center|LOCUS_20080 1405 2499 gene locus_tag LOCUS_20090 gene tsaD 1405 2499 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_20090 3193 3050 gene locus_tag LOCUS_20100 3193 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence307 2938 1616 gene locus_tag LOCUS_20110 gene noeK 2938 1616 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331334.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence308 114 1139 gene locus_tag LOCUS_20120 gene nuoH 114 1139 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH90 protein_id gnl|my_center|LOCUS_20120 1154 1645 gene locus_tag LOCUS_20130 gene nuoI 1154 1645 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ6 protein_id gnl|my_center|LOCUS_20130 1732 2346 gene locus_tag LOCUS_20140 gene nuoJ 1732 2346 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 protein_id gnl|my_center|LOCUS_20140 2359 2670 gene locus_tag LOCUS_20150 gene nuoK 2359 2670 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ8 protein_id gnl|my_center|LOCUS_20150 >Feature sequence309 <1 891 gene locus_tag LOCUS_20160 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T7E9:phosphoglycerate kinase 954 1598 gene locus_tag LOCUS_20170 gene thiE 954 1598 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_20170 1591 2697 gene locus_tag LOCUS_20180 1591 2697 CDS product Sel1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975735.1 protein_id gnl|my_center|LOCUS_20180 2809 3372 gene locus_tag LOCUS_20190 gene efp 2809 3372 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_20190 >Feature sequence310 878 24 gene locus_tag LOCUS_20200 gene coxB 878 24 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6E5 protein_id gnl|my_center|LOCUS_20200 1342 1794 gene locus_tag LOCUS_20210 1342 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1859 3283 gene locus_tag LOCUS_20220 1859 3283 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532782.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence311 1893 589 gene locus_tag LOCUS_20230 1893 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3086 1890 gene locus_tag LOCUS_20240 3086 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4032 3079 gene locus_tag LOCUS_20250 4032 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence312 171 509 gene locus_tag LOCUS_20260 171 509 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_20260 978 1541 gene locus_tag LOCUS_20270 978 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1849 2688 gene locus_tag LOCUS_20280 1849 2688 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE57 protein_id gnl|my_center|LOCUS_20280 <4031 2701 gene locus_tag LOCUS_20290 <4031 2701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529171.1:metalloprotease >Feature sequence313 165 650 gene locus_tag LOCUS_20300 gene bfrB 165 650 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_20300 971 765 gene locus_tag LOCUS_20310 971 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1421 1194 gene locus_tag LOCUS_20320 1421 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2029 1520 gene locus_tag LOCUS_20330 2029 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2281 3669 gene locus_tag LOCUS_20340 gene aofH 2281 3669 CDS product putative flavin-containing monoamine oxidase AofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63534 protein_id gnl|my_center|LOCUS_20340 >Feature sequence314 2299 662 gene locus_tag LOCUS_20350 gene rpoN2 2299 662 CDS product RNA polymerase sigma-54 factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30333 protein_id gnl|my_center|LOCUS_20350 3122 2319 gene locus_tag LOCUS_20360 3122 2319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_20360 3907 3239 gene locus_tag LOCUS_20370 3907 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence315 458 306 gene locus_tag LOCUS_20380 458 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 796 506 gene locus_tag LOCUS_20390 796 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1558 1268 gene locus_tag LOCUS_20400 1558 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence316 1488 1009 gene locus_tag LOCUS_20410 1488 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1685 2839 gene locus_tag LOCUS_20420 1685 2839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 protein_id gnl|my_center|LOCUS_20420 2842 3627 gene locus_tag LOCUS_20430 2842 3627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence317 992 222 gene locus_tag LOCUS_20440 gene gloB 992 222 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCK2 protein_id gnl|my_center|LOCUS_20440 1514 1080 gene locus_tag LOCUS_20450 1514 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639951.1 protein_id gnl|my_center|LOCUS_20450 1652 2413 gene locus_tag LOCUS_20460 1652 2413 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_20460 2531 2875 gene locus_tag LOCUS_20470 gene glnK 2531 2875 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_20470 3539 2892 gene locus_tag LOCUS_20480 3539 2892 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence318 955 239 gene locus_tag LOCUS_20490 955 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1219 959 gene locus_tag LOCUS_20500 1219 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20500 2797 1256 gene locus_tag LOCUS_20510 gene copA 2797 1256 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20510 3507 2872 gene locus_tag LOCUS_20520 3507 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3962 3600 gene locus_tag LOCUS_20530 3962 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence319 1369 737 gene locus_tag LOCUS_20540 1369 737 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_20540 1368 2057 gene locus_tag LOCUS_20550 1368 2057 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_20550 2590 2054 gene locus_tag LOCUS_20560 2590 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_20560 3442 2645 gene locus_tag LOCUS_20570 3442 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence320 660 1373 gene locus_tag LOCUS_20580 660 1373 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_20580 1522 2127 gene locus_tag LOCUS_20590 1522 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2341 2922 gene locus_tag LOCUS_20600 2341 2922 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence321 370 1584 gene locus_tag LOCUS_20610 370 1584 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence322 1557 259 gene locus_tag LOCUS_20620 1557 259 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_20620 2357 1554 gene locus_tag LOCUS_20630 gene trmJ 2357 1554 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_20630 2636 3859 gene locus_tag LOCUS_20640 gene icd 2636 3859 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD89 protein_id gnl|my_center|LOCUS_20640 >Feature sequence323 520 918 gene locus_tag LOCUS_20650 520 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2757 943 gene locus_tag LOCUS_20660 gene atsA 2757 943 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_20660 3806 2949 gene locus_tag LOCUS_20670 3806 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence324 2239 3414 gene locus_tag LOCUS_20680 2239 3414 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence325 228 704 gene locus_tag LOCUS_20690 228 704 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_20690 757 1191 gene locus_tag LOCUS_20700 757 1191 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937587.1 protein_id gnl|my_center|LOCUS_20700 1327 2058 gene locus_tag LOCUS_20710 1327 2058 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 protein_id gnl|my_center|LOCUS_20710 2170 2550 gene locus_tag LOCUS_20720 2170 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2793 2554 gene locus_tag LOCUS_20730 2793 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3144 2839 gene locus_tag LOCUS_20740 3144 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083321.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence326 <1 735 gene locus_tag LOCUS_20750 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TNF0:GTPase HflX 1827 739 gene locus_tag LOCUS_20760 1827 739 CDS product vtpJ-therm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878319.1 protein_id gnl|my_center|LOCUS_20760 2676 1858 gene locus_tag LOCUS_20770 2676 1858 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_20770 <3928 2680 gene locus_tag LOCUS_20780 <3928 2680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919616.1:MFS transporter >Feature sequence327 <1 1354 gene locus_tag LOCUS_20790 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207317.1:aldehyde dehydrogenase 2524 1415 gene locus_tag LOCUS_20800 gene adhC 2524 1415 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 protein_id gnl|my_center|LOCUS_20800 3696 2602 gene locus_tag LOCUS_20810 3696 2602 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7Y0 protein_id gnl|my_center|LOCUS_20810 >Feature sequence328 1497 280 gene locus_tag LOCUS_20820 gene dxr 1497 280 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_20820 2282 1494 gene locus_tag LOCUS_20830 2282 1494 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 protein_id gnl|my_center|LOCUS_20830 2992 2387 gene locus_tag LOCUS_20840 gene lpxD 2992 2387 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBQ6 protein_id gnl|my_center|LOCUS_20840 3839 3270 gene locus_tag LOCUS_20850 gene frr 3839 3270 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X4 protein_id gnl|my_center|LOCUS_20850 >Feature sequence329 <1 574 gene locus_tag LOCUS_20860 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929865.1:enoyl-CoA hydratase 1378 581 gene locus_tag LOCUS_20870 1378 581 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 protein_id gnl|my_center|LOCUS_20870 2041 1391 gene locus_tag LOCUS_20880 2041 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence330 475 1725 gene locus_tag LOCUS_20890 475 1725 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087096.1 protein_id gnl|my_center|LOCUS_20890 1706 2302 gene locus_tag LOCUS_20900 1706 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3358 2390 gene locus_tag LOCUS_20910 gene prfB 3358 2390 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QJ2 protein_id gnl|my_center|LOCUS_20910 >Feature sequence331 1592 2125 gene locus_tag LOCUS_20920 1592 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2184 2756 gene locus_tag LOCUS_20930 2184 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3100 2843 gene locus_tag LOCUS_20940 3100 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3472 3248 gene locus_tag LOCUS_20950 3472 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3881 3591 gene locus_tag LOCUS_20960 3881 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence332 3307 3603 gene locus_tag LOCUS_20970 3307 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence333 1191 1009 gene locus_tag LOCUS_20980 1191 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1418 1645 gene locus_tag LOCUS_20990 1418 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_20990 2427 1678 gene locus_tag LOCUS_21000 gene dgcA 2427 1678 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_21000 2759 3265 gene locus_tag LOCUS_21010 gene purE 2759 3265 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3C0 protein_id gnl|my_center|LOCUS_21010 >Feature sequence334 2105 468 gene locus_tag LOCUS_21020 2105 468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_21020 3205 2102 gene locus_tag LOCUS_21030 3205 2102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084244.1 protein_id gnl|my_center|LOCUS_21030 <3845 3209 gene locus_tag LOCUS_21040 <3845 3209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527941.1:microcin C ABC transporter permease YejB >Feature sequence335 <1 757 gene locus_tag LOCUS_21050 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971628.1:PAS domain-containing sensor histidine kinase 779 2047 gene locus_tag LOCUS_21060 gene ntrX 779 2047 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315356.1 protein_id gnl|my_center|LOCUS_21060 2231 3607 gene locus_tag LOCUS_21070 gene trkA 2231 3607 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence336 <1 509 gene locus_tag LOCUS_21080 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C9U3:ribosomal protein L11 methyltransferase 550 2397 gene locus_tag LOCUS_21090 550 2397 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530971.1 protein_id gnl|my_center|LOCUS_21090 <3826 2394 gene locus_tag LOCUS_21100 <3826 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MEL9:DNA ligase >Feature sequence337 764 1684 gene locus_tag LOCUS_21110 764 1684 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_21110 2188 1694 gene locus_tag LOCUS_21120 2188 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3419 2247 gene locus_tag LOCUS_21130 3419 2247 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence338 513 82 gene locus_tag LOCUS_21140 513 82 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_21140 833 2149 gene locus_tag LOCUS_21150 833 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2153 2812 gene locus_tag LOCUS_21160 2153 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 protein_id gnl|my_center|LOCUS_21160 3211 2870 gene locus_tag LOCUS_21170 3211 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence339 82 1107 gene locus_tag LOCUS_21180 82 1107 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 protein_id gnl|my_center|LOCUS_21180 1108 1971 gene locus_tag LOCUS_21190 gene sseA 1108 1971 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708039.1 protein_id gnl|my_center|LOCUS_21190 1995 2525 gene locus_tag LOCUS_21200 1995 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21200 <3803 3137 gene locus_tag LOCUS_21210 <3803 3137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707870.1:ATPase >Feature sequence340 863 147 gene locus_tag LOCUS_21220 gene rpiA 863 147 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8V2 protein_id gnl|my_center|LOCUS_21220 2344 863 gene locus_tag LOCUS_21230 gene gabD 2344 863 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772866.1 protein_id gnl|my_center|LOCUS_21230 2570 3694 gene locus_tag LOCUS_21240 2570 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064658.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence341 1592 339 gene locus_tag LOCUS_21250 gene dnaC 1592 339 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086848.1 protein_id gnl|my_center|LOCUS_21250 2378 1752 gene locus_tag LOCUS_21260 gene rplI 2378 1752 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 protein_id gnl|my_center|LOCUS_21260 3546 2485 gene locus_tag LOCUS_21270 3546 2485 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence342 89 370 gene locus_tag LOCUS_21280 89 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 348 584 gene locus_tag LOCUS_21290 348 584 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681198.1 protein_id gnl|my_center|LOCUS_21290 694 891 gene locus_tag LOCUS_21300 694 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 888 1127 gene locus_tag LOCUS_21310 888 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1221 1580 gene locus_tag LOCUS_21320 1221 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1697 2422 gene locus_tag LOCUS_21330 1697 2422 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143847.1 protein_id gnl|my_center|LOCUS_21330 2528 2887 gene locus_tag LOCUS_21340 2528 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2979 3536 gene locus_tag LOCUS_21350 2979 3536 CDS product ribosomal-protein-L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704795.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence343 230 1195 gene locus_tag LOCUS_21360 gene dhaA 230 1195 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222141.1 protein_id gnl|my_center|LOCUS_21360 1694 1341 gene locus_tag LOCUS_21370 1694 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2267 3697 gene locus_tag LOCUS_21380 2267 3697 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence344 212 850 gene locus_tag LOCUS_21390 212 850 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_21390 1448 867 gene locus_tag LOCUS_21400 gene coq7 1448 867 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8N7 protein_id gnl|my_center|LOCUS_21400 1972 1445 gene locus_tag LOCUS_21410 1972 1445 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529434.1 protein_id gnl|my_center|LOCUS_21410 2585 1977 gene locus_tag LOCUS_21420 gene exoD 2585 1977 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772526.1 protein_id gnl|my_center|LOCUS_21420 2803 2889 gene locus_tag LOCUS_t00270 2803 2889 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence345 160 891 gene locus_tag LOCUS_21430 160 891 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_21430 895 2028 gene locus_tag LOCUS_21440 895 2028 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_21440 2613 1987 gene locus_tag LOCUS_21450 2613 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 protein_id gnl|my_center|LOCUS_21450 2728 3210 gene locus_tag LOCUS_21460 2728 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 <3764 3232 gene locus_tag LOCUS_21470 <3764 3232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920941.1:serine/threonine dehydratase >Feature sequence346 903 520 gene locus_tag LOCUS_21480 903 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1390 893 gene locus_tag LOCUS_21490 1390 893 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_21490 1686 2318 gene locus_tag LOCUS_21500 gene folE 1686 2318 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY3 protein_id gnl|my_center|LOCUS_21500 2410 2904 gene locus_tag LOCUS_21510 gene hisI 2410 2904 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 protein_id gnl|my_center|LOCUS_21510 3605 3066 gene locus_tag LOCUS_21520 3605 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence347 2056 665 gene locus_tag LOCUS_21530 2056 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_21530 2227 2757 gene locus_tag LOCUS_21540 2227 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2993 2760 gene locus_tag LOCUS_21550 2993 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3517 3047 gene locus_tag LOCUS_21560 3517 3047 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R297 protein_id gnl|my_center|LOCUS_21560 >Feature sequence348 358 678 gene locus_tag LOCUS_21570 358 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 850 1221 gene locus_tag LOCUS_21580 850 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1404 3386 gene locus_tag LOCUS_21590 1404 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636070.2 protein_id gnl|my_center|LOCUS_21590 >Feature sequence349 <1 1425 gene locus_tag LOCUS_21600 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S69:glycine--tRNA ligase beta subunit >Feature sequence350 <1 1773 gene locus_tag LOCUS_21610 <1 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C981:valine--tRNA ligase 1776 2963 gene locus_tag LOCUS_21620 1776 2963 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228175.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence351 1134 139 gene locus_tag LOCUS_21630 1134 139 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_21630 2214 1240 gene locus_tag LOCUS_21640 gene xerD 2214 1240 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME3 protein_id gnl|my_center|LOCUS_21640 >Feature sequence352 1331 354 gene locus_tag LOCUS_21650 1331 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2181 1342 gene locus_tag LOCUS_21660 2181 1342 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_21660 2832 2242 gene locus_tag LOCUS_21670 2832 2242 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence353 436 1359 gene locus_tag LOCUS_21680 436 1359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_21680 1356 2789 gene locus_tag LOCUS_21690 1356 2789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence354 1222 1845 gene locus_tag LOCUS_21700 1222 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2442 1852 gene locus_tag LOCUS_21710 2442 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_21710 <3635 2503 gene locus_tag LOCUS_21720 <3635 2503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004548886.1:ferredoxin >Feature sequence355 2071 1058 gene locus_tag LOCUS_21730 gene lpxC 2071 1058 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence356 <1 1206 gene locus_tag LOCUS_21740 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083408.1:MFS transporter 1280 1939 gene locus_tag LOCUS_21750 1280 1939 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_21750 >Feature sequence357 384 1628 gene locus_tag LOCUS_21760 384 1628 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084588.1 protein_id gnl|my_center|LOCUS_21760 2086 2544 gene locus_tag LOCUS_21770 2086 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2541 2966 gene locus_tag LOCUS_21780 2541 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 <3605 3072 gene locus_tag LOCUS_21790 <3605 3072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770966.1:3-oxoacyl-ACP reductase >Feature sequence358 606 1601 gene locus_tag LOCUS_21800 606 1601 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence359 <1 526 gene locus_tag LOCUS_21810 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387829.1:alpha/beta hydrolase 584 1846 gene locus_tag LOCUS_21820 584 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21820 1904 2266 gene locus_tag LOCUS_21830 1904 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2303 2911 gene locus_tag LOCUS_21840 2303 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 3012 2938 gene locus_tag LOCUS_t00280 3012 2938 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence360 357 1163 gene locus_tag LOCUS_21850 357 1163 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704891.1 protein_id gnl|my_center|LOCUS_21850 1198 2277 gene locus_tag LOCUS_21860 1198 2277 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_21860 3143 2412 gene locus_tag LOCUS_21870 3143 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence361 441 1289 gene locus_tag LOCUS_21880 441 1289 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 protein_id gnl|my_center|LOCUS_21880 1325 1951 gene locus_tag LOCUS_21890 1325 1951 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEF4 protein_id gnl|my_center|LOCUS_21890 1948 2826 gene locus_tag LOCUS_21900 gene aroE 1948 2826 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_21900 2826 3446 gene locus_tag LOCUS_21910 gene coaE 2826 3446 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I0 protein_id gnl|my_center|LOCUS_21910 >Feature sequence362 603 2213 gene locus_tag LOCUS_21920 gene lysS 603 2213 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VB4 protein_id gnl|my_center|LOCUS_21920 2276 3082 gene locus_tag LOCUS_21930 2276 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence363 1660 224 gene locus_tag LOCUS_21940 1660 224 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 protein_id gnl|my_center|LOCUS_21940 2166 1765 gene locus_tag LOCUS_21950 gene ectC 2166 1765 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 protein_id gnl|my_center|LOCUS_21950 3372 2191 gene locus_tag LOCUS_21960 gene ectB 3372 2191 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence364 1991 1095 gene locus_tag LOCUS_21970 1991 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence365 374 1006 gene locus_tag LOCUS_21980 374 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1095 2276 gene locus_tag LOCUS_21990 1095 2276 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_21990 2288 3505 gene locus_tag LOCUS_22000 2288 3505 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence366 821 222 gene locus_tag LOCUS_22010 821 222 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706247.1 protein_id gnl|my_center|LOCUS_22010 1583 828 gene locus_tag LOCUS_22020 1583 828 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_22020 2857 1637 gene locus_tag LOCUS_22030 2857 1637 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_22030 3345 2854 gene locus_tag LOCUS_22040 3345 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence367 150 1811 gene locus_tag LOCUS_22050 gene nadE 150 1811 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969513.1 protein_id gnl|my_center|LOCUS_22050 1801 3132 gene locus_tag LOCUS_22060 gene gltX1 1801 3132 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 protein_id gnl|my_center|LOCUS_22060 >Feature sequence368 794 297 gene locus_tag LOCUS_22070 794 297 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_22070 924 1853 gene locus_tag LOCUS_22080 924 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1929 3287 gene locus_tag LOCUS_22090 1929 3287 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703385.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence369 <1 828 gene locus_tag LOCUS_22100 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TLU9:transcription termination/antitermination protein NusA 828 1565 gene locus_tag LOCUS_22110 828 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence370 1054 1563 gene locus_tag LOCUS_22120 1054 1563 CDS product GcrA cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533644.1 protein_id gnl|my_center|LOCUS_22120 2367 1666 gene locus_tag LOCUS_22130 gene phoB 2367 1666 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_22130 3155 2421 gene locus_tag LOCUS_22140 gene phoU 3155 2421 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYG5 protein_id gnl|my_center|LOCUS_22140 >Feature sequence371 1297 752 gene locus_tag LOCUS_22150 1297 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1476 1549 gene locus_tag LOCUS_t00290 1476 1549 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2291 2031 gene locus_tag LOCUS_22160 2291 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence372 2 1933 gene locus_tag LOCUS_22170 2 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3115 1961 gene locus_tag LOCUS_22180 3115 1961 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531362.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence373 1165 2679 gene locus_tag LOCUS_22190 gene tacA 1165 2679 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_22190 2973 2722 gene locus_tag LOCUS_22200 2973 2722 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK2 protein_id gnl|my_center|LOCUS_22200 3393 3064 gene locus_tag LOCUS_22210 3393 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529201.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence374 603 85 gene locus_tag LOCUS_22220 603 85 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529316.1 protein_id gnl|my_center|LOCUS_22220 1169 735 gene locus_tag LOCUS_22230 1169 735 CDS product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_22230 2153 1263 gene locus_tag LOCUS_22240 2153 1263 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_22240 3275 2232 gene locus_tag LOCUS_22250 3275 2232 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence375 2519 594 gene locus_tag LOCUS_22260 2519 594 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974923.1 protein_id gnl|my_center|LOCUS_22260 <3453 2661 gene locus_tag LOCUS_22270 <3453 2661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391333.1:peptidoglycan-binding protein LysM >Feature sequence376 1966 998 gene locus_tag LOCUS_22280 gene argC 1966 998 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 protein_id gnl|my_center|LOCUS_22280 2853 2062 gene locus_tag LOCUS_22290 2853 2062 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_22290 3200 2967 gene locus_tag LOCUS_22300 3200 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence377 697 62 gene locus_tag LOCUS_22310 697 62 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_22310 865 1200 gene locus_tag LOCUS_22320 865 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1822 1208 gene locus_tag LOCUS_22330 1822 1208 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_22330 2844 1825 gene locus_tag LOCUS_22340 2844 1825 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence378 878 324 gene locus_tag LOCUS_22350 878 324 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 protein_id gnl|my_center|LOCUS_22350 1076 2365 gene locus_tag LOCUS_22360 gene tipF 1076 2365 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_22360 2447 3352 gene locus_tag LOCUS_22370 2447 3352 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090211.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence379 100 906 gene locus_tag LOCUS_22380 100 906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_22380 1490 903 gene locus_tag LOCUS_22390 1490 903 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968053.1 protein_id gnl|my_center|LOCUS_22390 1553 2008 gene locus_tag LOCUS_22400 1553 2008 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968054.1 protein_id gnl|my_center|LOCUS_22400 2072 3322 gene locus_tag LOCUS_22410 2072 3322 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence380 439 1098 gene locus_tag LOCUS_22420 439 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1474 1151 gene locus_tag LOCUS_22430 1474 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_22430 1623 2474 gene locus_tag LOCUS_22440 gene purC 1623 2474 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD65 protein_id gnl|my_center|LOCUS_22440 2635 2880 gene locus_tag LOCUS_22450 gene purS 2635 2880 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_22450 >Feature sequence381 1333 461 gene locus_tag LOCUS_22460 1333 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2272 1358 gene locus_tag LOCUS_22470 2272 1358 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_22470 3114 2272 gene locus_tag LOCUS_22480 3114 2272 CDS product transketolase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228762.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence382 227 1633 gene locus_tag LOCUS_22490 227 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1690 2523 gene locus_tag LOCUS_22500 gene rfbF 1690 2523 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551345.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence383 548 1846 gene locus_tag LOCUS_22510 548 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2408 1878 gene locus_tag LOCUS_22520 2408 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2960 2427 gene locus_tag LOCUS_22530 2960 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence384 <1 615 gene locus_tag LOCUS_22540 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390513.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 713 788 gene locus_tag LOCUS_t00300 713 788 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 851 2548 gene locus_tag LOCUS_22550 851 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3206 2568 gene locus_tag LOCUS_22560 3206 2568 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_22560 3371 3213 gene locus_tag LOCUS_22570 3371 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence385 461 1690 gene locus_tag LOCUS_22580 461 1690 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 protein_id gnl|my_center|LOCUS_22580 1696 1920 gene locus_tag LOCUS_22590 1696 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2292 1924 gene locus_tag LOCUS_22600 2292 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2860 2417 gene locus_tag LOCUS_22610 2860 2417 CDS product ROS/MUCR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265704.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence386 1 873 gene locus_tag LOCUS_22620 1 873 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_22620 2202 1069 gene locus_tag LOCUS_22630 2202 1069 CDS product DUF3066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence387 125 1045 gene locus_tag LOCUS_22640 gene kce 125 1045 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX2 protein_id gnl|my_center|LOCUS_22640 1718 1074 gene locus_tag LOCUS_22650 1718 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence388 <1 966 gene locus_tag LOCUS_22660 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706077.1:two-component system sensor histidine kinase/response regulator >Feature sequence389 >Feature sequence390 1979 315 gene locus_tag LOCUS_22670 gene ilvB 1979 315 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_22670 2542 2129 gene locus_tag LOCUS_22680 2542 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence391 867 511 gene locus_tag LOCUS_22690 867 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1854 892 gene locus_tag LOCUS_22700 gene fabD 1854 892 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MW0 protein_id gnl|my_center|LOCUS_22700 2670 3179 gene locus_tag LOCUS_22710 2670 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence392 458 601 gene locus_tag LOCUS_22720 458 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 617 1384 gene locus_tag LOCUS_22730 617 1384 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974360.1 protein_id gnl|my_center|LOCUS_22730 1613 1377 gene locus_tag LOCUS_22740 1613 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2414 1797 gene locus_tag LOCUS_22750 2414 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2647 2411 gene locus_tag LOCUS_22760 2647 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence393 1511 2920 gene locus_tag LOCUS_22770 1511 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence394 951 187 gene locus_tag LOCUS_22780 gene tam 951 187 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085533.1 protein_id gnl|my_center|LOCUS_22780 2466 970 gene locus_tag LOCUS_22790 2466 970 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090818.1 protein_id gnl|my_center|LOCUS_22790 <3299 2514 gene locus_tag LOCUS_22800 <3299 2514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947814.1:mercuric reductase >Feature sequence395 <1 969 gene locus_tag LOCUS_22810 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TJQ8:60 kDa chaperonin 1092 1484 gene locus_tag LOCUS_22820 1092 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2398 1493 gene locus_tag LOCUS_22830 2398 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 protein_id gnl|my_center|LOCUS_22830 <3295 2466 gene locus_tag LOCUS_22840 <3295 2466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89DB4:ATP phosphoribosyltransferase >Feature sequence396 158 790 gene locus_tag LOCUS_22850 158 790 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970944.1 protein_id gnl|my_center|LOCUS_22850 1454 834 gene locus_tag LOCUS_22860 1454 834 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974531.1 protein_id gnl|my_center|LOCUS_22860 1583 2260 gene locus_tag LOCUS_22870 1583 2260 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315869.1 protein_id gnl|my_center|LOCUS_22870 2765 2562 gene locus_tag LOCUS_22880 2765 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence397 1203 661 gene locus_tag LOCUS_22890 gene apt 1203 661 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD91 protein_id gnl|my_center|LOCUS_22890 2127 1216 gene locus_tag LOCUS_22900 gene mtnP 2127 1216 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VT5 protein_id gnl|my_center|LOCUS_22900 3002 2205 gene locus_tag LOCUS_22910 3002 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence398 1046 9 gene locus_tag LOCUS_22920 1046 9 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969070.1 protein_id gnl|my_center|LOCUS_22920 2385 1111 gene locus_tag LOCUS_22930 gene fabF 2385 1111 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 protein_id gnl|my_center|LOCUS_22930 2746 2507 gene locus_tag LOCUS_22940 gene acpP 2746 2507 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3L2 protein_id gnl|my_center|LOCUS_22940 >Feature sequence399 >Feature sequence400 1251 778 gene locus_tag LOCUS_22950 1251 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1365 2294 gene locus_tag LOCUS_22960 1365 2294 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_22960 2376 3236 gene locus_tag LOCUS_22970 2376 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence401 <1 2429 gene locus_tag LOCUS_22980 <1 2429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083225.1:ATPase 2426 3043 gene locus_tag LOCUS_22990 2426 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence402 312 935 gene locus_tag LOCUS_23000 312 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 932 1138 gene locus_tag LOCUS_23010 932 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1135 2043 gene locus_tag LOCUS_23020 1135 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence403 1036 644 gene locus_tag LOCUS_23030 1036 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_23030 2362 1118 gene locus_tag LOCUS_23040 2362 1118 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289198.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence404 2006 963 gene locus_tag LOCUS_23050 2006 963 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_23050 2416 2033 gene locus_tag LOCUS_23060 2416 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2694 3113 gene locus_tag LOCUS_23070 2694 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence405 1142 261 gene locus_tag LOCUS_23080 1142 261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_23080 1263 1574 gene locus_tag LOCUS_23090 1263 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919711.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence406 <1 2760 gene locus_tag LOCUS_23100 <1 2760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082991.1:helicase 2766 3155 gene locus_tag LOCUS_23110 2766 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence407 1447 1178 gene locus_tag LOCUS_23120 gene rpsO 1447 1178 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_23120 2465 1503 gene locus_tag LOCUS_23130 gene truB 2465 1503 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB1 protein_id gnl|my_center|LOCUS_23130 2825 2469 gene locus_tag LOCUS_23140 gene rbfA 2825 2469 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6P6 protein_id gnl|my_center|LOCUS_23140 >Feature sequence408 1923 316 gene locus_tag LOCUS_23150 1923 316 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532556.1 protein_id gnl|my_center|LOCUS_23150 <3164 1936 gene locus_tag LOCUS_23160 <3164 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWK2:cysteine--tRNA ligase >Feature sequence409 704 117 gene locus_tag LOCUS_23170 704 117 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_23170 830 2026 gene locus_tag LOCUS_23180 830 2026 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_23180 2151 2651 gene locus_tag LOCUS_23190 2151 2651 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence410 >Feature sequence411 3001 2051 gene locus_tag LOCUS_23200 3001 2051 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_23200 >Feature sequence412 2642 1536 gene locus_tag LOCUS_23210 gene pip 2642 1536 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 protein_id gnl|my_center|LOCUS_23210 >Feature sequence413 272 844 gene locus_tag LOCUS_23220 272 844 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_23220 975 2045 gene locus_tag LOCUS_23230 975 2045 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969045.1 protein_id gnl|my_center|LOCUS_23230 2803 2186 gene locus_tag LOCUS_23240 2803 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence414 2430 535 gene locus_tag LOCUS_23250 gene mutL 2430 535 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H173 protein_id gnl|my_center|LOCUS_23250 <3118 2436 gene locus_tag LOCUS_23260 <3118 2436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B9S4:glucose-6-phosphate isomerase >Feature sequence415 278 1717 gene locus_tag LOCUS_23270 gene manC 278 1717 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088660.1 protein_id gnl|my_center|LOCUS_23270 1902 1678 gene locus_tag LOCUS_23280 1902 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1816 2700 gene locus_tag LOCUS_23290 1816 2700 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088745.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence416 >Feature sequence417 2051 984 gene locus_tag LOCUS_23300 2051 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence418 <1 812 gene locus_tag LOCUS_23310 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ83:malate dehydrogenase 1884 964 gene locus_tag LOCUS_23320 1884 964 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence419 2022 2492 gene locus_tag LOCUS_23330 2022 2492 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532169.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence420 <1 675 gene locus_tag LOCUS_23340 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390999.1:A/G-specific adenine glycosylase 1844 672 gene locus_tag LOCUS_23350 1844 672 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_23350 2594 1965 gene locus_tag LOCUS_23360 gene rnhB 2594 1965 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZ34 protein_id gnl|my_center|LOCUS_23360 >Feature sequence421 1190 390 gene locus_tag LOCUS_23370 1190 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1267 1512 gene locus_tag LOCUS_23380 1267 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1790 1560 gene locus_tag LOCUS_23390 1790 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2894 1794 gene locus_tag LOCUS_23400 2894 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence422 2100 1021 gene locus_tag LOCUS_23410 2100 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 3023 2184 gene locus_tag LOCUS_23420 3023 2184 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969133.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence423 301 483 gene locus_tag LOCUS_23430 301 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1577 666 gene locus_tag LOCUS_23440 gene hemF 1577 666 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC2 protein_id gnl|my_center|LOCUS_23440 2095 1574 gene locus_tag LOCUS_23450 gene trmL 2095 1574 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH5 protein_id gnl|my_center|LOCUS_23450 2409 2987 gene locus_tag LOCUS_23460 2409 2987 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9Q3 protein_id gnl|my_center|LOCUS_23460 >Feature sequence424 547 708 gene locus_tag LOCUS_23470 547 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1126 2472 gene locus_tag LOCUS_23480 1126 2472 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707530.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence425 <1 1147 gene locus_tag LOCUS_23490 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391181.1:double-strand break repair helicase AddA 1330 1650 gene locus_tag LOCUS_23500 1330 1650 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_23500 >Feature sequence426 1553 336 gene locus_tag LOCUS_23510 gene metZ 1553 336 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE2 protein_id gnl|my_center|LOCUS_23510 1797 3002 gene locus_tag LOCUS_23520 1797 3002 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence427 410 282 gene locus_tag LOCUS_23530 410 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1217 453 gene locus_tag LOCUS_23540 1217 453 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987003.1 protein_id gnl|my_center|LOCUS_23540 2049 1210 gene locus_tag LOCUS_23550 2049 1210 CDS product sugar nucleotide oxidoreductaseepimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976075.1 protein_id gnl|my_center|LOCUS_23550 <3030 2059 gene locus_tag LOCUS_23560 <3030 2059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122208.1:nodulation protein noeI- methyltransferase >Feature sequence428 <1 686 gene locus_tag LOCUS_23570 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031412.1:NADPH-dependent 2,4-dienoyl-CoA reductase 735 1535 gene locus_tag LOCUS_23580 735 1535 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808642.1 protein_id gnl|my_center|LOCUS_23580 1927 1532 gene locus_tag LOCUS_23590 1927 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 2126 1938 gene locus_tag LOCUS_23600 2126 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2553 2149 gene locus_tag LOCUS_23610 2553 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence429 1498 494 gene locus_tag LOCUS_23620 gene uge 1498 494 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_23620 2826 1528 gene locus_tag LOCUS_23630 gene wbpO 2826 1528 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039948.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence430 1705 185 gene locus_tag LOCUS_23640 1705 185 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404324.1 protein_id gnl|my_center|LOCUS_23640 2560 1766 gene locus_tag LOCUS_23650 2560 1766 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708296.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence431 2497 1343 gene locus_tag LOCUS_23660 2497 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946040.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence432 157 2421 gene locus_tag LOCUS_23670 gene purL 157 2421 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC0 protein_id gnl|my_center|LOCUS_23670 2475 2708 gene locus_tag LOCUS_23680 2475 2708 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence433 211 1647 gene locus_tag LOCUS_23690 211 1647 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975188.1 protein_id gnl|my_center|LOCUS_23690 2637 1741 gene locus_tag LOCUS_23700 gene gltI 2637 1741 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082934.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence434 2753 861 gene locus_tag LOCUS_23710 2753 861 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2R4 protein_id gnl|my_center|LOCUS_23710 >Feature sequence435 2848 2564 gene locus_tag LOCUS_23720 2848 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence436 569 57 gene locus_tag LOCUS_23730 569 57 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_23730 >Feature sequence437 <1 1258 gene locus_tag LOCUS_23740 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CKU4:Trk system potassium uptake protein 1268 2161 gene locus_tag LOCUS_23750 1268 2161 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_23750 2324 2575 gene locus_tag LOCUS_23760 gene hfq 2324 2575 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ2 protein_id gnl|my_center|LOCUS_23760 >Feature sequence438 >Feature sequence439 1640 156 gene locus_tag LOCUS_23770 1640 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 <2942 1756 gene locus_tag LOCUS_23780 <2942 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IWD2:histidine--tRNA ligase >Feature sequence440 1381 800 gene locus_tag LOCUS_23790 1381 800 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_23790 2381 1395 gene locus_tag LOCUS_23800 2381 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 <2938 2384 gene locus_tag LOCUS_23810 <2938 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919833.1:acetyl-CoA acetyltransferase >Feature sequence441 1966 1157 gene locus_tag LOCUS_23820 gene tatC 1966 1157 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_23820 2292 1963 gene locus_tag LOCUS_23830 2292 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2539 2297 gene locus_tag LOCUS_23840 2539 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence442 <2927 2005 gene locus_tag LOCUS_23850 <2927 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UFL7:putative zinc metalloprotease >Feature sequence443 458 1366 gene locus_tag LOCUS_23860 458 1366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_23860 1413 2318 gene locus_tag LOCUS_23870 1413 2318 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence444 115 2883 gene locus_tag LOCUS_23880 gene acnA 115 2883 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70920 protein_id gnl|my_center|LOCUS_23880 >Feature sequence445 <2911 1712 gene locus_tag LOCUS_23890 <2911 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UFY5:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence446 1056 28 gene locus_tag LOCUS_23900 1056 28 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_23900 2136 1123 gene locus_tag LOCUS_23910 2136 1123 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence447 2393 1074 gene locus_tag LOCUS_23920 2393 1074 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_23920 <2894 2390 gene locus_tag LOCUS_23930 <2894 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RRN4:aminotransferase >Feature sequence448 927 505 gene locus_tag LOCUS_23940 927 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1216 2076 gene locus_tag LOCUS_23950 1216 2076 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence449 1269 523 gene locus_tag LOCUS_23960 gene queC 1269 523 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MS6 protein_id gnl|my_center|LOCUS_23960 2862 1327 gene locus_tag LOCUS_23970 2862 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence450 2221 1343 gene locus_tag LOCUS_23980 gene dhaA 2221 1343 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_23980 >Feature sequence451 1034 492 gene locus_tag LOCUS_23990 1034 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2592 1039 gene locus_tag LOCUS_24000 gene fixG 2592 1039 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971694.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence452 1816 959 gene locus_tag LOCUS_24010 1816 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 <2828 1889 gene locus_tag LOCUS_24020 <2828 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89WI2:phenylalanine--tRNA ligase beta subunit >Feature sequence453 <1 1118 gene locus_tag LOCUS_24030 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RSR3:tyrosine--tRNA ligase >Feature sequence454 1671 1519 gene locus_tag LOCUS_24040 1671 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 <2811 1632 gene locus_tag LOCUS_24050 <2811 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938819.1:integrase >Feature sequence455 <1 640 gene locus_tag LOCUS_24060 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086599.1:ATPase 1499 645 gene locus_tag LOCUS_24070 1499 645 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_24070 <2810 1502 gene locus_tag LOCUS_24080 <2810 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331455.1:sodium-independent anion transporter >Feature sequence456 1120 545 gene locus_tag LOCUS_24090 1120 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2464 1418 gene locus_tag LOCUS_24100 2464 1418 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence457 46 1299 gene locus_tag LOCUS_24110 46 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 1344 2147 gene locus_tag LOCUS_24120 1344 2147 CDS product TIGR03084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_24120 <2790 2161 gene locus_tag LOCUS_24130 <2790 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918720.1:DEAD/DEAH box helicase >Feature sequence458 505 708 gene locus_tag LOCUS_24140 505 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 806 1318 gene locus_tag LOCUS_24150 806 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2361 1357 gene locus_tag LOCUS_24160 2361 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence459 <1 770 gene locus_tag LOCUS_24170 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338605.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 767 1828 gene locus_tag LOCUS_24180 767 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1825 2448 gene locus_tag LOCUS_24190 1825 2448 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30961 protein_id gnl|my_center|LOCUS_24190 >Feature sequence460 352 1212 gene locus_tag LOCUS_24200 352 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1363 2352 gene locus_tag LOCUS_24210 1363 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence461 2210 1704 gene locus_tag LOCUS_24220 2210 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence462 94 453 gene locus_tag LOCUS_24230 94 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 456 1181 gene locus_tag LOCUS_24240 456 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_24240 1252 1989 gene locus_tag LOCUS_24250 1252 1989 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_24250 <2763 1993 gene locus_tag LOCUS_24260 <2763 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454804.1:transglutaminase >Feature sequence463 587 1246 gene locus_tag LOCUS_24270 587 1246 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224791.1 protein_id gnl|my_center|LOCUS_24270 1659 1243 gene locus_tag LOCUS_24280 1659 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1902 2576 gene locus_tag LOCUS_24290 gene ctpA 1902 2576 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence464 766 290 gene locus_tag LOCUS_24300 766 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 916 1737 gene locus_tag LOCUS_24310 916 1737 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529202.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence465 1706 753 gene locus_tag LOCUS_24320 gene ggpP 1706 753 CDS product geranylgeranyl pyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_24320 <2748 1928 gene locus_tag LOCUS_24330 <2748 1928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919913.1:acyl-CoA dehydrogenase >Feature sequence466 531 618 gene locus_tag LOCUS_t00310 531 618 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 740 1531 gene locus_tag LOCUS_24340 740 1531 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence467 448 230 gene locus_tag LOCUS_24350 448 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 680 1831 gene locus_tag LOCUS_24360 680 1831 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence468 603 1265 gene locus_tag LOCUS_24370 603 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1650 1291 gene locus_tag LOCUS_24380 1650 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2307 1723 gene locus_tag LOCUS_24390 2307 1723 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_24390 2471 2304 gene locus_tag LOCUS_24400 2471 2304 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF3 protein_id gnl|my_center|LOCUS_24400 >Feature sequence469 1475 354 gene locus_tag LOCUS_24410 1475 354 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_24410 1699 2361 gene locus_tag LOCUS_24420 1699 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence470 547 1293 gene locus_tag LOCUS_24430 gene etfB 547 1293 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 protein_id gnl|my_center|LOCUS_24430 1293 2231 gene locus_tag LOCUS_24440 gene etfA 1293 2231 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53573 protein_id gnl|my_center|LOCUS_24440 >Feature sequence471 1082 558 gene locus_tag LOCUS_24450 1082 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1182 1535 gene locus_tag LOCUS_24460 1182 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1532 2260 gene locus_tag LOCUS_24470 1532 2260 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403143.1 protein_id gnl|my_center|LOCUS_24470 2358 2282 gene locus_tag LOCUS_t00320 2358 2282 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence472 468 268 gene locus_tag LOCUS_24480 468 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 627 887 gene locus_tag LOCUS_24490 627 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388150.1 protein_id gnl|my_center|LOCUS_24490 1347 904 gene locus_tag LOCUS_24500 1347 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_24500 1435 1947 gene locus_tag LOCUS_24510 1435 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1993 2457 gene locus_tag LOCUS_24520 1993 2457 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence473 <1 2009 gene locus_tag LOCUS_24530 <1 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CJF3:DNA topoisomerase 4 subunit A 2517 2029 gene locus_tag LOCUS_24540 2517 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence474 610 53 gene locus_tag LOCUS_24550 610 53 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312818.1 protein_id gnl|my_center|LOCUS_24550 777 1301 gene locus_tag LOCUS_24560 gene bamE 777 1301 CDS product SmpA/OmlA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 protein_id gnl|my_center|LOCUS_24560 1419 1757 gene locus_tag LOCUS_24570 1419 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 <2691 1993 gene locus_tag LOCUS_24580 <2691 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89K83:K(+)-insensitive pyrophosphate-energized proton pump >Feature sequence475 80 964 gene locus_tag LOCUS_24590 gene ispE 80 964 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_24590 1405 986 gene locus_tag LOCUS_24600 1405 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1564 1950 gene locus_tag LOCUS_24610 1564 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 <2675 2025 gene locus_tag LOCUS_24620 <2675 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085318.1:octaprenyl-diphosphate synthase >Feature sequence476 1791 541 gene locus_tag LOCUS_24630 1791 541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence477 983 360 gene locus_tag LOCUS_24640 983 360 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_24640 1134 1736 gene locus_tag LOCUS_24650 1134 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence478 144 788 gene locus_tag LOCUS_24660 144 788 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925853.1 protein_id gnl|my_center|LOCUS_24660 901 1959 gene locus_tag LOCUS_24670 901 1959 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_24670 2546 1956 gene locus_tag LOCUS_24680 2546 1956 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226549.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence479 >Feature sequence480 3 1031 gene locus_tag LOCUS_24690 gene holA 3 1031 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_24690 1981 1085 gene locus_tag LOCUS_24700 gene parB 1981 1085 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083457.1 protein_id gnl|my_center|LOCUS_24700 2644 2108 gene locus_tag LOCUS_24710 2644 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence481 840 346 gene locus_tag LOCUS_24720 840 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 812 1096 gene locus_tag LOCUS_24730 812 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1777 1100 gene locus_tag LOCUS_24740 1777 1100 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086963.1 protein_id gnl|my_center|LOCUS_24740 1974 1898 gene locus_tag LOCUS_t00330 1974 1898 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2260 2152 gene locus_tag LOCUS_r00010 2260 2152 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence482 >Feature sequence483 633 1052 gene locus_tag LOCUS_24750 633 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24750 1100 2377 gene locus_tag LOCUS_24760 1100 2377 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707601.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence484 <1 966 gene locus_tag LOCUS_24770 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084346.1:aldehyde dehydrogenase 978 1583 gene locus_tag LOCUS_24780 978 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529193.1 protein_id gnl|my_center|LOCUS_24780 2189 1584 gene locus_tag LOCUS_24790 2189 1584 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861442.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence485 485 2299 gene locus_tag LOCUS_24800 485 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence486 137 1477 gene locus_tag LOCUS_24810 137 1477 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_24810 1492 2166 gene locus_tag LOCUS_24820 gene aat 1492 2166 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A741 protein_id gnl|my_center|LOCUS_24820 2543 2103 gene locus_tag LOCUS_24830 2543 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence487 1985 546 gene locus_tag LOCUS_24840 1985 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 <2595 1982 gene locus_tag LOCUS_24850 <2595 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228507.1:TetR family transcriptional regulator >Feature sequence488 1352 516 gene locus_tag LOCUS_24860 1352 516 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337475.1 protein_id gnl|my_center|LOCUS_24860 2306 1356 gene locus_tag LOCUS_24870 2306 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719571.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence489 979 368 gene locus_tag LOCUS_24880 gene birA 979 368 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531861.1 protein_id gnl|my_center|LOCUS_24880 <2579 1156 gene locus_tag LOCUS_24890 <2579 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6U7X8:NADH-quinone oxidoreductase subunit N >Feature sequence490 314 1915 gene locus_tag LOCUS_24900 314 1915 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969214.1 protein_id gnl|my_center|LOCUS_24900 2539 1961 gene locus_tag LOCUS_24910 2539 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence491 <1 1137 gene locus_tag LOCUS_24920 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3M9Z5:error-prone DNA polymerase 1176 1778 gene locus_tag LOCUS_24930 gene nahD 1176 1778 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537802.1 protein_id gnl|my_center|LOCUS_24930 2200 1775 gene locus_tag LOCUS_24940 2200 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence492 <1 693 gene locus_tag LOCUS_24950 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920336.1:acyl-CoA dehydrogenase 1936 755 gene locus_tag LOCUS_24960 1936 755 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_24960 2471 1953 gene locus_tag LOCUS_24970 gene moaB 2471 1953 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3L0 protein_id gnl|my_center|LOCUS_24970 >Feature sequence493 367 825 gene locus_tag LOCUS_24980 gene queF 367 825 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N45 protein_id gnl|my_center|LOCUS_24980 1859 822 gene locus_tag LOCUS_24990 1859 822 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence494 <1 756 gene locus_tag LOCUS_25000 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89G50:ketol-acid reductoisomerase (NADP(+)) 819 1511 gene locus_tag LOCUS_25010 819 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1947 1495 gene locus_tag LOCUS_25020 1947 1495 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence495 1725 385 gene locus_tag LOCUS_25030 1725 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_25030 1829 2272 gene locus_tag LOCUS_25040 1829 2272 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence496 926 357 gene locus_tag LOCUS_25050 926 357 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_25050 1322 942 gene locus_tag LOCUS_25060 1322 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2080 1478 gene locus_tag LOCUS_25070 2080 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence497 1489 629 gene locus_tag LOCUS_25080 1489 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence498 1423 2097 gene locus_tag LOCUS_25090 gene djlA 1423 2097 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384971.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence499 1369 875 gene locus_tag LOCUS_25100 gene rfaH 1369 875 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRG4 protein_id gnl|my_center|LOCUS_25100 1603 1725 gene locus_tag LOCUS_25110 1603 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2521 1802 gene locus_tag LOCUS_25120 gene epsD 2521 1802 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence500 <1 852 gene locus_tag LOCUS_25130 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S63:quinolinate synthase A 885 2510 gene locus_tag LOCUS_25140 gene nadB 885 2510 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S64 protein_id gnl|my_center|LOCUS_25140 >Feature sequence501 1321 443 gene locus_tag LOCUS_25150 gene tauD 1321 443 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_25150 1888 1424 gene locus_tag LOCUS_25160 1888 1424 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 protein_id gnl|my_center|LOCUS_25160 <2517 1901 gene locus_tag LOCUS_25170 <2517 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921204.1:paraslipin >Feature sequence502 <1 709 gene locus_tag LOCUS_25180 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262947.1:TetR family transcriptional regulator 706 2457 gene locus_tag LOCUS_25190 706 2457 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071595.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence503 190 810 gene locus_tag LOCUS_25200 190 810 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528303.1 protein_id gnl|my_center|LOCUS_25200 807 1394 gene locus_tag LOCUS_25210 807 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1745 1401 gene locus_tag LOCUS_25220 1745 1401 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_25220 2370 1729 gene locus_tag LOCUS_25230 2370 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence504 967 8 gene locus_tag LOCUS_25240 gene accA 967 8 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9U5 protein_id gnl|my_center|LOCUS_25240 1188 1051 gene locus_tag LOCUS_25250 1188 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1175 1753 gene locus_tag LOCUS_25260 1175 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence505 2 325 gene locus_tag LOCUS_25270 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 487 1107 gene locus_tag LOCUS_25280 487 1107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_25280 1797 1192 gene locus_tag LOCUS_25290 gene sodB 1797 1192 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_25290 >Feature sequence506 <2486 825 gene locus_tag LOCUS_25300 <2486 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89I89:alanine--tRNA ligase >Feature sequence507 <1 727 gene locus_tag LOCUS_25310 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085241.1:transcriptional regulator 2169 1030 gene locus_tag LOCUS_25320 2169 1030 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence508 112 2367 gene locus_tag LOCUS_25330 gene katG 112 2367 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62H74 protein_id gnl|my_center|LOCUS_25330 >Feature sequence509 >Feature sequence510 459 34 gene locus_tag LOCUS_25340 459 34 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_25340 554 1195 gene locus_tag LOCUS_25350 554 1195 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_25350 1412 1339 gene locus_tag LOCUS_t00340 1412 1339 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2158 1475 gene locus_tag LOCUS_25360 2158 1475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence511 1601 180 gene locus_tag LOCUS_25370 1601 180 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_25370 2277 1624 gene locus_tag LOCUS_25380 2277 1624 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence512 396 581 gene locus_tag LOCUS_25390 396 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_25390 873 2342 gene locus_tag LOCUS_25400 873 2342 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence513 >Feature sequence514 484 398 gene locus_tag LOCUS_t00350 484 398 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 594 1103 gene locus_tag LOCUS_25410 594 1103 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 protein_id gnl|my_center|LOCUS_25410 1197 1622 gene locus_tag LOCUS_25420 1197 1622 CDS product PaaI thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265983.1 protein_id gnl|my_center|LOCUS_25420 <2370 1619 gene locus_tag LOCUS_25430 <2370 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P53554:biotin biosynthesis cytochrome P450 >Feature sequence515 <1 914 gene locus_tag LOCUS_25440 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087113.1:Fe-S cluster assembly protein SufD 911 2176 gene locus_tag LOCUS_25450 gene nifS 911 2176 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYG4 protein_id gnl|my_center|LOCUS_25450 >Feature sequence516 384 839 gene locus_tag LOCUS_25460 384 839 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence517 <1 2351 gene locus_tag LOCUS_25470 <1 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112417.1:pyruvate carboxylase >Feature sequence518 596 48 gene locus_tag LOCUS_25480 596 48 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX9 protein_id gnl|my_center|LOCUS_25480 1884 838 gene locus_tag LOCUS_25490 1884 838 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923333.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence519 1321 389 gene locus_tag LOCUS_25500 1321 389 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_25500 1420 2043 gene locus_tag LOCUS_25510 1420 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence520 806 105 gene locus_tag LOCUS_25520 806 105 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_25520 917 1945 gene locus_tag LOCUS_25530 917 1945 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918286.1 protein_id gnl|my_center|LOCUS_25530 1970 2272 gene locus_tag LOCUS_25540 1970 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence521 953 288 gene locus_tag LOCUS_25550 953 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1990 983 gene locus_tag LOCUS_25560 1990 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence522 1296 145 gene locus_tag LOCUS_25570 1296 145 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063639.1 protein_id gnl|my_center|LOCUS_25570 2180 1374 gene locus_tag LOCUS_25580 2180 1374 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence523 1375 404 gene locus_tag LOCUS_25590 1375 404 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889510.1 protein_id gnl|my_center|LOCUS_25590 1455 2087 gene locus_tag LOCUS_25600 1455 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2311 2096 gene locus_tag LOCUS_25610 2311 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence524 <2308 328 gene locus_tag LOCUS_25620 <2308 328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972100.1:methionine synthase >Feature sequence525 645 1052 gene locus_tag LOCUS_25630 645 1052 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_25630 2019 1129 gene locus_tag LOCUS_25640 2019 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence526 <1 743 gene locus_tag LOCUS_25650 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92PL6:UPF0758 protein R01728 740 1132 gene locus_tag LOCUS_25660 740 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1186 1605 gene locus_tag LOCUS_25670 1186 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 <2294 1746 gene locus_tag LOCUS_25680 <2294 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388796.1:LysR family transcriptional regulator >Feature sequence527 <1 646 gene locus_tag LOCUS_25690 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089890.1:Tol-Pal system subunit TolQ 649 1119 gene locus_tag LOCUS_25700 649 1119 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_25700 1129 2007 gene locus_tag LOCUS_25710 1129 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence528 218 1102 gene locus_tag LOCUS_25720 gene surE 218 1102 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 protein_id gnl|my_center|LOCUS_25720 1099 1761 gene locus_tag LOCUS_25730 gene pcm 1099 1761 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_25730 >Feature sequence529 860 444 gene locus_tag LOCUS_25740 860 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence530 844 446 gene locus_tag LOCUS_25750 844 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_25750 1978 950 gene locus_tag LOCUS_25760 1978 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence531 313 1128 gene locus_tag LOCUS_25770 313 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_25770 1362 1135 gene locus_tag LOCUS_25780 1362 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 <2263 1362 gene locus_tag LOCUS_25790 <2263 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391071.1:copper-translocating P-type ATPase >Feature sequence532 >Feature sequence533 1433 153 gene locus_tag LOCUS_25800 1433 153 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970796.1 protein_id gnl|my_center|LOCUS_25800 1592 1461 gene locus_tag LOCUS_25810 1592 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence534 1034 435 gene locus_tag LOCUS_25820 1034 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1762 1085 gene locus_tag LOCUS_25830 1762 1085 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence535 942 754 gene locus_tag LOCUS_25840 942 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1039 2037 gene locus_tag LOCUS_25850 1039 2037 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence536 318 1076 gene locus_tag LOCUS_25860 318 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1460 1092 gene locus_tag LOCUS_25870 1460 1092 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406588.1 protein_id gnl|my_center|LOCUS_25870 1702 2007 gene locus_tag LOCUS_25880 gene groES 1702 2007 CDS product co-chaperonin GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001314660.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence537 >Feature sequence538 881 363 gene locus_tag LOCUS_25890 881 363 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965822.1 protein_id gnl|my_center|LOCUS_25890 903 1355 gene locus_tag LOCUS_25900 903 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence539 >Feature sequence540 566 877 gene locus_tag LOCUS_25910 566 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 949 1971 gene locus_tag LOCUS_25920 949 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence541 >Feature sequence542 <1 1177 gene locus_tag LOCUS_25930 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89WB3:polyribonucleotide nucleotidyltransferase 1289 1894 gene locus_tag LOCUS_25940 1289 1894 CDS product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531172.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence543 338 1678 gene locus_tag LOCUS_25950 gene tolB 338 1678 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L4 protein_id gnl|my_center|LOCUS_25950 >Feature sequence544 <1 1677 gene locus_tag LOCUS_25960 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969884.1:RNA-binding protein >Feature sequence545 1909 677 gene locus_tag LOCUS_25970 gene argD 1909 677 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB6 protein_id gnl|my_center|LOCUS_25970 >Feature sequence546 491 1630 gene locus_tag LOCUS_25980 491 1630 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence547 1602 709 gene locus_tag LOCUS_25990 1602 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 <2153 1599 gene locus_tag LOCUS_26000 <2153 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707924.1:segregation and condensation protein A >Feature sequence548 322 993 gene locus_tag LOCUS_26010 322 993 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_26010 1032 1292 gene locus_tag LOCUS_26020 1032 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1304 1675 gene locus_tag LOCUS_26030 1304 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence549 3 293 gene locus_tag LOCUS_26040 3 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 412 1044 gene locus_tag LOCUS_26050 412 1044 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_26050 1041 1997 gene locus_tag LOCUS_26060 1041 1997 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence550 <1 845 gene locus_tag LOCUS_26070 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640427.1:glutathione S-transferase 876 1754 gene locus_tag LOCUS_26080 876 1754 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence551 1753 1064 gene locus_tag LOCUS_26090 1753 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence552 315 980 gene locus_tag LOCUS_26100 315 980 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence553 1191 577 gene locus_tag LOCUS_26110 1191 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence554 <1 779 gene locus_tag LOCUS_26120 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P688:alpha,alpha-trehalose-phosphate synthase (UDP-forming) 780 1763 gene locus_tag LOCUS_26130 780 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence555 >Feature sequence556 956 66 gene locus_tag LOCUS_26140 956 66 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533547.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence557 1546 344 gene locus_tag LOCUS_26150 1546 344 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_26150 1986 1612 gene locus_tag LOCUS_26160 1986 1612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263219.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence558 369 247 gene locus_tag LOCUS_26170 369 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence559 1 1131 gene locus_tag LOCUS_26180 1 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1228 1464 gene locus_tag LOCUS_26190 1228 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1474 1878 gene locus_tag LOCUS_26200 1474 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence560 688 1206 gene locus_tag LOCUS_26210 688 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1254 1955 gene locus_tag LOCUS_26220 1254 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence561 30 1487 gene locus_tag LOCUS_26230 30 1487 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_26230 >Feature sequence562 1703 594 gene locus_tag LOCUS_26240 gene pdhA 1703 594 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMJ2 protein_id gnl|my_center|LOCUS_26240 >Feature sequence563 935 279 gene locus_tag LOCUS_26250 935 279 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919067.1 protein_id gnl|my_center|LOCUS_26250 1693 962 gene locus_tag LOCUS_26260 1693 962 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence564 385 1038 gene locus_tag LOCUS_26270 385 1038 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920077.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence565 131 1039 gene locus_tag LOCUS_26280 gene miaA 131 1039 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G43 protein_id gnl|my_center|LOCUS_26280 >Feature sequence566 1615 614 gene locus_tag LOCUS_26290 gene ldhA 1615 614 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522216.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence567 >Feature sequence568 1064 297 gene locus_tag LOCUS_26300 1064 297 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_26300 <1956 1195 gene locus_tag LOCUS_26310 <1956 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968641.1:acyl-CoA dehydrogenase >Feature sequence569 258 1223 gene locus_tag LOCUS_26320 gene thrB 258 1223 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA8 protein_id gnl|my_center|LOCUS_26320 1223 1657 gene locus_tag LOCUS_26330 gene rnhA 1223 1657 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_26330 >Feature sequence570 74 1714 gene locus_tag LOCUS_26340 gene cysS 74 1714 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7D9 protein_id gnl|my_center|LOCUS_26340 >Feature sequence571 490 95 gene locus_tag LOCUS_26350 gene rpsH 490 95 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V7 protein_id gnl|my_center|LOCUS_26350 815 510 gene locus_tag LOCUS_26360 gene rpsN 815 510 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q24 protein_id gnl|my_center|LOCUS_26360 1365 829 gene locus_tag LOCUS_26370 gene rplE 1365 829 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER4 protein_id gnl|my_center|LOCUS_26370 1691 1377 gene locus_tag LOCUS_26380 gene rplX 1691 1377 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK58 protein_id gnl|my_center|LOCUS_26380 1936 1691 gene locus_tag LOCUS_26390 1936 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence572 <1 970 gene locus_tag LOCUS_26400 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810589.1:MBL fold metallo-hydrolase 1821 1057 gene locus_tag LOCUS_26410 1821 1057 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528046.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence573 52 882 gene locus_tag LOCUS_26420 52 882 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_26420 1744 938 gene locus_tag LOCUS_26430 1744 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence574 <1 815 gene locus_tag LOCUS_26440 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083381.1:enoyl-CoA hydratase >Feature sequence575 1516 695 gene locus_tag LOCUS_26450 gene atuE 1516 695 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence576 <1 1111 gene locus_tag LOCUS_26460 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086892.1:ATP-binding protein 1557 1108 gene locus_tag LOCUS_26470 1557 1108 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence577 >Feature sequence578 <1889 424 gene locus_tag LOCUS_26480 <1889 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92L89:DNA translocase FtsK >Feature sequence579 186 1226 gene locus_tag LOCUS_26490 186 1226 CDS product KpsF/GutQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387775.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence580 <1886 1019 gene locus_tag LOCUS_26500 <1886 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390165.1:membrane protein >Feature sequence581 200 940 gene locus_tag LOCUS_26510 200 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1737 949 gene locus_tag LOCUS_26520 1737 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence582 380 1546 gene locus_tag LOCUS_26530 380 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence583 505 768 gene locus_tag LOCUS_26540 505 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1187 765 gene locus_tag LOCUS_26550 1187 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1868 1308 gene locus_tag LOCUS_26560 1868 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence584 >Feature sequence585 >Feature sequence586 1760 633 gene locus_tag LOCUS_26570 1760 633 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence587 158 661 gene locus_tag LOCUS_26580 158 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 663 1043 gene locus_tag LOCUS_26590 663 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1043 1705 gene locus_tag LOCUS_26600 1043 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence588 335 1321 gene locus_tag LOCUS_26610 335 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence589 448 921 gene locus_tag LOCUS_26620 448 921 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_26620 932 1270 gene locus_tag LOCUS_26630 932 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1267 1620 gene locus_tag LOCUS_26640 1267 1620 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence590 1610 423 gene locus_tag LOCUS_26650 1610 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence591 >Feature sequence592 1299 763 gene locus_tag LOCUS_26660 1299 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence593 <1799 119 gene locus_tag LOCUS_26670 <1799 119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390161.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence594 <1 947 gene locus_tag LOCUS_26680 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707124.1:threonine synthase >Feature sequence595 >Feature sequence596 >Feature sequence597 <1768 154 gene locus_tag LOCUS_26690 <1768 154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972796.1:oxidoreductase >Feature sequence598 441 1304 gene locus_tag LOCUS_26700 441 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence599 347 219 gene locus_tag LOCUS_26710 347 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 599 423 gene locus_tag LOCUS_26720 599 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 <1736 805 gene locus_tag LOCUS_26730 <1736 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388499.1:histidine kinase >Feature sequence600 <1735 539 gene locus_tag LOCUS_26740 <1735 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229261.1:acyl-CoA dehydrogenase >Feature sequence601 <1727 618 gene locus_tag LOCUS_26750 <1727 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917952.1:cytochrome P450 >Feature sequence602 489 40 gene locus_tag LOCUS_26760 489 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1205 495 gene locus_tag LOCUS_26770 1205 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence603 >Feature sequence604 497 1117 gene locus_tag LOCUS_26780 497 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1711 1136 gene locus_tag LOCUS_26790 1711 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence605 1604 657 gene locus_tag LOCUS_26800 1604 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence606 191 51 gene locus_tag LOCUS_26810 191 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 <1691 287 gene locus_tag LOCUS_26820 <1691 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086638.1:monooxygenase >Feature sequence607 <1690 947 gene locus_tag LOCUS_26830 <1690 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528519.1:gamma-glutamyltransferase >Feature sequence608 741 1244 gene locus_tag LOCUS_26840 741 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence609 454 1227 gene locus_tag LOCUS_26850 454 1227 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence610 >Feature sequence611 189 977 gene locus_tag LOCUS_26860 189 977 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_26860 988 1440 gene locus_tag LOCUS_26870 988 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence612 <1 837 gene locus_tag LOCUS_26880 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721383.1:ATPase >Feature sequence613 263 982 gene locus_tag LOCUS_26890 263 982 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974611.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence614 349 648 gene locus_tag LOCUS_26900 349 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence615 993 352 gene locus_tag LOCUS_26910 gene agmR 993 352 CDS product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 protein_id gnl|my_center|LOCUS_26910 >Feature sequence616 271 1089 gene locus_tag LOCUS_26920 gene rarD 271 1089 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 protein_id gnl|my_center|LOCUS_26920 <1657 1086 gene locus_tag LOCUS_26930 <1657 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXI3:cytokinin riboside 5'-monophosphate phosphoribohydrolase >Feature sequence617 >Feature sequence618 >Feature sequence619 <1621 1004 gene locus_tag LOCUS_26940 <1621 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQF5:flagellar basal-body rod protein FlgG >Feature sequence620 <1619 940 gene locus_tag LOCUS_26950 <1619 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886881.1:6-aminohexanoate-cyclic-dimer hydrolase >Feature sequence621 405 1268 gene locus_tag LOCUS_26960 405 1268 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence622 1208 369 gene locus_tag LOCUS_26970 gene mutM 1208 369 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WC9 protein_id gnl|my_center|LOCUS_26970 >Feature sequence623 >Feature sequence624 <1 916 gene locus_tag LOCUS_26980 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088298.1:phospholipase >Feature sequence625 374 168 gene locus_tag LOCUS_26990 374 168 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083407.1 protein_id gnl|my_center|LOCUS_26990 536 1408 gene locus_tag LOCUS_27000 gene htpX 536 1408 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBM5 protein_id gnl|my_center|LOCUS_27000 >Feature sequence626 767 1558 gene locus_tag LOCUS_27010 767 1558 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence627 <1 606 gene locus_tag LOCUS_27020 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63UB8:UPF0276 protein 590 1399 gene locus_tag LOCUS_27030 590 1399 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence628 <1 968 gene locus_tag LOCUS_27040 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640427.1:glutathione S-transferase >Feature sequence629 <1564 905 gene locus_tag LOCUS_27050 <1564 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968934.1:mechanosensitive ion channel protein MscS >Feature sequence630 354 758 gene locus_tag LOCUS_27060 354 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 752 991 gene locus_tag LOCUS_27070 752 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence631 <1 693 gene locus_tag LOCUS_27080 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GW33:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 715 1395 gene locus_tag LOCUS_27090 gene rsmG 715 1395 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH5 protein_id gnl|my_center|LOCUS_27090 >Feature sequence632 <1 1076 gene locus_tag LOCUS_27100 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92PB6:fumarate hydratase class II 1095 1343 gene locus_tag LOCUS_27110 1095 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389863.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence633 <1513 713 gene locus_tag LOCUS_27120 <1513 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974286.1:membrane protein >Feature sequence634 2 280 gene locus_tag LOCUS_27130 2 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1063 269 gene locus_tag LOCUS_27140 gene panC 1063 269 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBK7 protein_id gnl|my_center|LOCUS_27140