>Feature sequence001 1007 126 gene locus_tag LOCUS_00010 1007 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1213 1137 gene locus_tag LOCUS_t00010 1213 1137 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2457 1285 gene locus_tag LOCUS_00020 gene mnmA 2457 1285 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_00020 2782 2471 gene locus_tag LOCUS_00030 2782 2471 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_00030 3962 2868 gene locus_tag LOCUS_00040 3962 2868 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_00040 4465 3959 gene locus_tag LOCUS_00050 4465 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4740 5393 gene locus_tag LOCUS_00060 4740 5393 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_00060 5423 6673 gene locus_tag LOCUS_00070 gene tyrS 5423 6673 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A756 protein_id gnl|my_center|LOCUS_00070 10312 6677 gene locus_tag LOCUS_00080 10312 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10415 10876 gene locus_tag LOCUS_00090 10415 10876 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_00090 11990 10884 gene locus_tag LOCUS_00100 gene prfB 11990 10884 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLD6 protein_id gnl|my_center|LOCUS_00100 14423 12012 gene locus_tag LOCUS_00110 14423 12012 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_00110 15780 14470 gene locus_tag LOCUS_00120 15780 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16148 18343 gene locus_tag LOCUS_00130 16148 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18359 19078 gene locus_tag LOCUS_00140 gene com1 18359 19078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947567.1 protein_id gnl|my_center|LOCUS_00140 19115 19561 gene locus_tag LOCUS_00150 gene aroQ 19115 19561 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_00150 19548 20027 gene locus_tag LOCUS_00160 19548 20027 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531358.1 protein_id gnl|my_center|LOCUS_00160 20048 21391 gene locus_tag LOCUS_00170 20048 21391 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_00170 21468 22076 gene locus_tag LOCUS_00180 gene aat 21468 22076 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAB3 protein_id gnl|my_center|LOCUS_00180 22426 22019 gene locus_tag LOCUS_00190 22426 22019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533068.1 protein_id gnl|my_center|LOCUS_00190 22869 22423 gene locus_tag LOCUS_00200 22869 22423 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_00200 23236 22862 gene locus_tag LOCUS_00210 23236 22862 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531353.1 protein_id gnl|my_center|LOCUS_00210 23521 27126 gene locus_tag LOCUS_00220 23521 27126 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_00220 27149 27610 gene locus_tag LOCUS_00230 27149 27610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_00230 27665 28855 gene locus_tag LOCUS_00240 27665 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971570.1 protein_id gnl|my_center|LOCUS_00240 31175 28869 gene locus_tag LOCUS_00250 31175 28869 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_00250 31531 31175 gene locus_tag LOCUS_00260 gene clpS 31531 31175 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 protein_id gnl|my_center|LOCUS_00260 31823 33106 gene locus_tag LOCUS_00270 31823 33106 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640422.1 protein_id gnl|my_center|LOCUS_00270 33155 34162 gene locus_tag LOCUS_00280 33155 34162 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_00280 34169 35164 gene locus_tag LOCUS_00290 34169 35164 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240519.1 protein_id gnl|my_center|LOCUS_00290 36465 35179 gene locus_tag LOCUS_00300 36465 35179 CDS product SOS mutagenesis and repair UmuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947430.1 protein_id gnl|my_center|LOCUS_00300 36909 36484 gene locus_tag LOCUS_00310 36909 36484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37101 37340 gene locus_tag LOCUS_00320 37101 37340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37341 37994 gene locus_tag LOCUS_00330 gene pyrE 37341 37994 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J555 protein_id gnl|my_center|LOCUS_00330 39175 38006 gene locus_tag LOCUS_00340 39175 38006 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088437.1 protein_id gnl|my_center|LOCUS_00340 39335 40579 gene locus_tag LOCUS_00350 39335 40579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_00350 40601 41899 gene locus_tag LOCUS_00360 gene soxB 40601 41899 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 protein_id gnl|my_center|LOCUS_00360 41918 42268 gene locus_tag LOCUS_00370 41918 42268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42265 45282 gene locus_tag LOCUS_00380 gene soxA2 42265 45282 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970242.1 protein_id gnl|my_center|LOCUS_00380 45272 45895 gene locus_tag LOCUS_00390 45272 45895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47436 45892 gene locus_tag LOCUS_00400 47436 45892 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_00400 <48916 47460 gene locus_tag LOCUS_00410 <48916 47460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971758.1:dimethylglycine dehydrogenase >Feature sequence002 208 459 gene locus_tag LOCUS_00420 208 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 724 1827 gene locus_tag LOCUS_00430 724 1827 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU9 protein_id gnl|my_center|LOCUS_00430 1845 2198 gene locus_tag LOCUS_00440 gene gcvH 1845 2198 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMP5 protein_id gnl|my_center|LOCUS_00440 2220 5039 gene locus_tag LOCUS_00450 gene gcvP 2220 5039 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887L5 protein_id gnl|my_center|LOCUS_00450 5950 5030 gene locus_tag LOCUS_00460 5950 5030 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_00460 6131 7414 gene locus_tag LOCUS_00470 gene hmgA 6131 7414 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4F5 protein_id gnl|my_center|LOCUS_00470 7426 8442 gene locus_tag LOCUS_00480 7426 8442 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532316.1 protein_id gnl|my_center|LOCUS_00480 8800 10629 gene locus_tag LOCUS_00490 8800 10629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537492.1 protein_id gnl|my_center|LOCUS_00490 10675 11334 gene locus_tag LOCUS_00500 10675 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 11883 11344 gene locus_tag LOCUS_00510 11883 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_00510 12177 13943 gene locus_tag LOCUS_00520 12177 13943 CDS product guanylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886700.1 protein_id gnl|my_center|LOCUS_00520 14676 13945 gene locus_tag LOCUS_00530 14676 13945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_00530 15066 16295 gene locus_tag LOCUS_00540 15066 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888070.1 protein_id gnl|my_center|LOCUS_00540 17438 16299 gene locus_tag LOCUS_00550 17438 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 18253 17447 gene locus_tag LOCUS_00560 gene hpaH2 18253 17447 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888083.1 protein_id gnl|my_center|LOCUS_00560 19113 18250 gene locus_tag LOCUS_00570 19113 18250 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528546.1 protein_id gnl|my_center|LOCUS_00570 20113 19133 gene locus_tag LOCUS_00580 20113 19133 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_00580 21714 20203 gene locus_tag LOCUS_00590 gene hpaE 21714 20203 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888079.1 protein_id gnl|my_center|LOCUS_00590 22104 21718 gene locus_tag LOCUS_00600 gene hpcD 22104 21718 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085753.1 protein_id gnl|my_center|LOCUS_00600 22879 22136 gene locus_tag LOCUS_00610 22879 22136 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_00610 24045 22930 gene locus_tag LOCUS_00620 24045 22930 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385437.1 protein_id gnl|my_center|LOCUS_00620 24174 25406 gene locus_tag LOCUS_00630 24174 25406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888070.1 protein_id gnl|my_center|LOCUS_00630 25448 26290 gene locus_tag LOCUS_00640 25448 26290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 26283 27779 gene locus_tag LOCUS_00650 26283 27779 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 protein_id gnl|my_center|LOCUS_00650 27837 28334 gene locus_tag LOCUS_00660 27837 28334 CDS product 2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390622.1 protein_id gnl|my_center|LOCUS_00660 28367 29851 gene locus_tag LOCUS_00670 28367 29851 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888067.1 protein_id gnl|my_center|LOCUS_00670 29885 31237 gene locus_tag LOCUS_00680 29885 31237 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888072.1 protein_id gnl|my_center|LOCUS_00680 31250 32557 gene locus_tag LOCUS_00690 31250 32557 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_00690 32607 34187 gene locus_tag LOCUS_00700 32607 34187 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114996.1 protein_id gnl|my_center|LOCUS_00700 34198 34881 gene locus_tag LOCUS_00710 34198 34881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 34881 36371 gene locus_tag LOCUS_00720 34881 36371 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_00720 36386 37318 gene locus_tag LOCUS_00730 36386 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929913.1 protein_id gnl|my_center|LOCUS_00730 37365 38084 gene locus_tag LOCUS_00740 37365 38084 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 protein_id gnl|my_center|LOCUS_00740 38085 39320 gene locus_tag LOCUS_00750 38085 39320 CDS product cytochrome P450 steroid C27-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_00750 39366 40637 gene locus_tag LOCUS_00760 39366 40637 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868727.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence003 <1 805 gene locus_tag LOCUS_00770 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974599.1:ABC transporter permease 802 1728 gene locus_tag LOCUS_00780 802 1728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974600.1 protein_id gnl|my_center|LOCUS_00780 1721 3340 gene locus_tag LOCUS_00790 1721 3340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708689.1 protein_id gnl|my_center|LOCUS_00790 5343 3352 gene locus_tag LOCUS_00800 5343 3352 CDS product peptidase S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 protein_id gnl|my_center|LOCUS_00800 6292 5348 gene locus_tag LOCUS_00810 6292 5348 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083255.1 protein_id gnl|my_center|LOCUS_00810 6352 7287 gene locus_tag LOCUS_00820 6352 7287 CDS product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528299.1 protein_id gnl|my_center|LOCUS_00820 8106 7348 gene locus_tag LOCUS_00830 8106 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8244 9164 gene locus_tag LOCUS_00840 8244 9164 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_00840 9170 10075 gene locus_tag LOCUS_00850 9170 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 10181 11398 gene locus_tag LOCUS_00860 10181 11398 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_00860 11490 12395 gene locus_tag LOCUS_00870 11490 12395 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_00870 12392 13444 gene locus_tag LOCUS_00880 12392 13444 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085708.1 protein_id gnl|my_center|LOCUS_00880 13448 14191 gene locus_tag LOCUS_00890 13448 14191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 protein_id gnl|my_center|LOCUS_00890 14191 15051 gene locus_tag LOCUS_00900 14191 15051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_00900 15822 15058 gene locus_tag LOCUS_00910 15822 15058 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_00910 15915 17141 gene locus_tag LOCUS_00920 15915 17141 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_00920 18074 17280 gene locus_tag LOCUS_00930 gene fadB 18074 17280 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089105.1 protein_id gnl|my_center|LOCUS_00930 18250 19407 gene locus_tag LOCUS_00940 18250 19407 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_00940 19432 19803 gene locus_tag LOCUS_00950 19432 19803 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_00950 19843 20505 gene locus_tag LOCUS_00960 19843 20505 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099185.1 protein_id gnl|my_center|LOCUS_00960 21366 20554 gene locus_tag LOCUS_00970 21366 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 22451 21402 gene locus_tag LOCUS_00980 22451 21402 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530831.1 protein_id gnl|my_center|LOCUS_00980 23166 22441 gene locus_tag LOCUS_00990 23166 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_00990 23288 24940 gene locus_tag LOCUS_01000 23288 24940 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 protein_id gnl|my_center|LOCUS_01000 25000 25740 gene locus_tag LOCUS_01010 25000 25740 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_01010 26287 25766 gene locus_tag LOCUS_01020 26287 25766 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458833.1 protein_id gnl|my_center|LOCUS_01020 26379 27242 gene locus_tag LOCUS_01030 26379 27242 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017112.1 protein_id gnl|my_center|LOCUS_01030 27242 28150 gene locus_tag LOCUS_01040 27242 28150 CDS product branched-chain amino acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_01040 28261 29853 gene locus_tag LOCUS_01050 28261 29853 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_01050 29965 30951 gene locus_tag LOCUS_01060 29965 30951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815564.1 protein_id gnl|my_center|LOCUS_01060 30953 31786 gene locus_tag LOCUS_01070 30953 31786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084028.1 protein_id gnl|my_center|LOCUS_01070 31783 33402 gene locus_tag LOCUS_01080 31783 33402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084027.1 protein_id gnl|my_center|LOCUS_01080 33463 34908 gene locus_tag LOCUS_01090 33463 34908 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_01090 >Feature sequence004 1988 381 gene locus_tag LOCUS_01100 1988 381 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_01100 2171 2824 gene locus_tag LOCUS_01110 gene cynT 2171 2824 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B61 protein_id gnl|my_center|LOCUS_01110 2940 3932 gene locus_tag LOCUS_01120 2940 3932 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_01120 4015 5580 gene locus_tag LOCUS_01130 4015 5580 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 protein_id gnl|my_center|LOCUS_01130 5598 7496 gene locus_tag LOCUS_01140 5598 7496 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_01140 7507 9102 gene locus_tag LOCUS_01150 7507 9102 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 protein_id gnl|my_center|LOCUS_01150 9349 9104 gene locus_tag LOCUS_01160 9349 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 11588 9342 gene locus_tag LOCUS_01170 11588 9342 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_01170 12067 11591 gene locus_tag LOCUS_01180 12067 11591 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_01180 12927 12064 gene locus_tag LOCUS_01190 12927 12064 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_01190 13218 13027 gene locus_tag LOCUS_01200 13218 13027 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_01200 13359 13898 gene locus_tag LOCUS_01210 13359 13898 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246986.1 protein_id gnl|my_center|LOCUS_01210 13961 14995 gene locus_tag LOCUS_01220 13961 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088829.1 protein_id gnl|my_center|LOCUS_01220 14995 15789 gene locus_tag LOCUS_01230 14995 15789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088824.1 protein_id gnl|my_center|LOCUS_01230 15811 17064 gene locus_tag LOCUS_01240 15811 17064 CDS product BEC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 protein_id gnl|my_center|LOCUS_01240 17051 18556 gene locus_tag LOCUS_01250 17051 18556 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_01250 19885 18557 gene locus_tag LOCUS_01260 19885 18557 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_01260 20459 19878 gene locus_tag LOCUS_01270 20459 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 21509 20481 gene locus_tag LOCUS_01280 21509 20481 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_01280 22255 21659 gene locus_tag LOCUS_01290 22255 21659 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_01290 22542 23534 gene locus_tag LOCUS_01300 22542 23534 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_01300 24703 23531 gene locus_tag LOCUS_01310 gene pobA 24703 23531 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085125.1 protein_id gnl|my_center|LOCUS_01310 26004 24778 gene locus_tag LOCUS_01320 26004 24778 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_01320 26075 26539 gene locus_tag LOCUS_01330 26075 26539 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975277.1 protein_id gnl|my_center|LOCUS_01330 26536 28674 gene locus_tag LOCUS_01340 26536 28674 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_01340 28671 29150 gene locus_tag LOCUS_01350 28671 29150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 30035 29199 gene locus_tag LOCUS_01360 30035 29199 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809927.1 protein_id gnl|my_center|LOCUS_01360 33089 30054 gene locus_tag LOCUS_01370 33089 30054 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_01370 33977 33108 gene locus_tag LOCUS_01380 33977 33108 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_01380 34836 33994 gene locus_tag LOCUS_01390 34836 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence005 573 1877 gene locus_tag LOCUS_01400 573 1877 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_01400 2334 1885 gene locus_tag LOCUS_01410 2334 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2425 2577 gene locus_tag LOCUS_01420 2425 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 2722 3162 gene locus_tag LOCUS_01430 2722 3162 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_01430 3322 3780 gene locus_tag LOCUS_01440 3322 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4534 3782 gene locus_tag LOCUS_01450 gene pcs 4534 3782 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_01450 4677 5396 gene locus_tag LOCUS_01460 4677 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_01460 7112 5445 gene locus_tag LOCUS_01470 gene betA 7112 5445 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E8 protein_id gnl|my_center|LOCUS_01470 7211 8116 gene locus_tag LOCUS_01480 7211 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8152 9084 gene locus_tag LOCUS_01490 8152 9084 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_01490 9156 10316 gene locus_tag LOCUS_01500 9156 10316 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_01500 10336 12786 gene locus_tag LOCUS_01510 10336 12786 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_01510 13218 13000 gene locus_tag LOCUS_01520 13218 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 13420 13959 gene locus_tag LOCUS_01530 13420 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14047 14973 gene locus_tag LOCUS_01540 14047 14973 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_01540 15006 15455 gene locus_tag LOCUS_01550 15006 15455 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_01550 17489 15465 gene locus_tag LOCUS_01560 17489 15465 CDS product methylamine inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_01560 17710 17501 gene locus_tag LOCUS_01570 17710 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 18918 17710 gene locus_tag LOCUS_01580 18918 17710 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_01580 20477 18918 gene locus_tag LOCUS_01590 20477 18918 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_01590 22095 20464 gene locus_tag LOCUS_01600 22095 20464 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_01600 22264 23334 gene locus_tag LOCUS_01610 22264 23334 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 protein_id gnl|my_center|LOCUS_01610 24216 23626 gene locus_tag LOCUS_01620 24216 23626 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_01620 25367 24213 gene locus_tag LOCUS_01630 25367 24213 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_01630 26252 25389 gene locus_tag LOCUS_01640 26252 25389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 protein_id gnl|my_center|LOCUS_01640 27544 26303 gene locus_tag LOCUS_01650 27544 26303 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_01650 27625 28725 gene locus_tag LOCUS_01660 27625 28725 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_01660 29205 28735 gene locus_tag LOCUS_01670 29205 28735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 30322 29231 gene locus_tag LOCUS_01680 30322 29231 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J201 protein_id gnl|my_center|LOCUS_01680 31071 30319 gene locus_tag LOCUS_01690 31071 30319 CDS product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_01690 32027 31140 gene locus_tag LOCUS_01700 32027 31140 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_01700 32113 33555 gene locus_tag LOCUS_01710 gene selA 32113 33555 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58226 protein_id gnl|my_center|LOCUS_01710 >Feature sequence006 <1 767 gene locus_tag LOCUS_01720 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006315769.1:NAD-dependent succinate-semialdehyde dehydrogenase 1792 890 gene locus_tag LOCUS_01730 gene yihU 1792 890 CDS product 3-sulfolactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFI1 protein_id gnl|my_center|LOCUS_01730 2671 1832 gene locus_tag LOCUS_01740 2671 1832 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_01740 3459 2689 gene locus_tag LOCUS_01750 3459 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3607 4617 gene locus_tag LOCUS_01760 3607 4617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888316.1 protein_id gnl|my_center|LOCUS_01760 4688 5203 gene locus_tag LOCUS_01770 4688 5203 CDS product TRAP transporter small permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113811.1 protein_id gnl|my_center|LOCUS_01770 5196 6530 gene locus_tag LOCUS_01780 5196 6530 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 protein_id gnl|my_center|LOCUS_01780 6552 8885 gene locus_tag LOCUS_01790 6552 8885 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_01790 8898 10499 gene locus_tag LOCUS_01800 gene alkJ 8898 10499 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063697.1 protein_id gnl|my_center|LOCUS_01800 10550 11362 gene locus_tag LOCUS_01810 gene bacC 10550 11362 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39640 protein_id gnl|my_center|LOCUS_01810 11481 12788 gene locus_tag LOCUS_01820 gene hisD 11481 12788 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R401 protein_id gnl|my_center|LOCUS_01820 12793 13554 gene locus_tag LOCUS_01830 12793 13554 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_01830 13551 14546 gene locus_tag LOCUS_01840 13551 14546 CDS product galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106007.1 protein_id gnl|my_center|LOCUS_01840 14560 14850 gene locus_tag LOCUS_01850 14560 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_01850 14862 16043 gene locus_tag LOCUS_01860 14862 16043 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_01860 16058 16438 gene locus_tag LOCUS_01870 16058 16438 CDS product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 protein_id gnl|my_center|LOCUS_01870 17531 16470 gene locus_tag LOCUS_01880 gene ltaA 17531 16470 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_01880 18343 17552 gene locus_tag LOCUS_01890 gene nadX 18343 17552 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LV9 protein_id gnl|my_center|LOCUS_01890 19370 18363 gene locus_tag LOCUS_01900 gene cysK2 19370 18363 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708041.1 protein_id gnl|my_center|LOCUS_01900 21649 19388 gene locus_tag LOCUS_01910 21649 19388 CDS product dimethylsulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268538.1 protein_id gnl|my_center|LOCUS_01910 21913 23187 gene locus_tag LOCUS_01920 21913 23187 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_01920 24368 23184 gene locus_tag LOCUS_01930 24368 23184 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706103.1 protein_id gnl|my_center|LOCUS_01930 25168 24401 gene locus_tag LOCUS_01940 25168 24401 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456023.1 protein_id gnl|my_center|LOCUS_01940 25917 25177 gene locus_tag LOCUS_01950 25917 25177 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971063.1 protein_id gnl|my_center|LOCUS_01950 26096 26371 gene locus_tag LOCUS_01960 26096 26371 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_01960 26395 27168 gene locus_tag LOCUS_01970 26395 27168 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 protein_id gnl|my_center|LOCUS_01970 27242 27814 gene locus_tag LOCUS_01980 27242 27814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 28800 27835 gene locus_tag LOCUS_01990 28800 27835 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_01990 29156 28815 gene locus_tag LOCUS_02000 29156 28815 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I69 protein_id gnl|my_center|LOCUS_02000 >Feature sequence007 <1 632 gene locus_tag LOCUS_02010 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140219.1:formimidoylglutamate deiminase 880 665 gene locus_tag LOCUS_02020 880 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2367 916 gene locus_tag LOCUS_02030 2367 916 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_02030 4515 2371 gene locus_tag LOCUS_02040 gene ppk 4515 2371 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJJ7 protein_id gnl|my_center|LOCUS_02040 5040 4537 gene locus_tag LOCUS_02050 5040 4537 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_02050 5257 6291 gene locus_tag LOCUS_02060 gene gap3 5257 6291 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA88 protein_id gnl|my_center|LOCUS_02060 6284 7477 gene locus_tag LOCUS_02070 gene proP 6284 7477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125726.1 protein_id gnl|my_center|LOCUS_02070 7500 9053 gene locus_tag LOCUS_02080 7500 9053 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G3 protein_id gnl|my_center|LOCUS_02080 9459 9031 gene locus_tag LOCUS_02090 9459 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 10290 9481 gene locus_tag LOCUS_02100 10290 9481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_02100 11597 10287 gene locus_tag LOCUS_02110 gene cysD 11597 10287 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_02110 12737 11691 gene locus_tag LOCUS_02120 12737 11691 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975909.1 protein_id gnl|my_center|LOCUS_02120 13078 13365 gene locus_tag LOCUS_02130 13078 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 13474 14433 gene locus_tag LOCUS_02140 13474 14433 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_02140 15818 14487 gene locus_tag LOCUS_02150 15818 14487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227893.1 protein_id gnl|my_center|LOCUS_02150 16767 15922 gene locus_tag LOCUS_02160 16767 15922 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_02160 17884 16760 gene locus_tag LOCUS_02170 17884 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18932 18027 gene locus_tag LOCUS_02180 18932 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970319.1 protein_id gnl|my_center|LOCUS_02180 19316 18933 gene locus_tag LOCUS_02190 19316 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 20188 19322 gene locus_tag LOCUS_02200 20188 19322 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527134.1 protein_id gnl|my_center|LOCUS_02200 20368 21870 gene locus_tag LOCUS_02210 gene mmsA-3 20368 21870 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104588.1 protein_id gnl|my_center|LOCUS_02210 22500 21901 gene locus_tag LOCUS_02220 22500 21901 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_02220 22667 25159 gene locus_tag LOCUS_02230 22667 25159 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708706.1 protein_id gnl|my_center|LOCUS_02230 25162 27633 gene locus_tag LOCUS_02240 25162 27633 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887734.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence008 1186 254 gene locus_tag LOCUS_02250 1186 254 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815555.1 protein_id gnl|my_center|LOCUS_02250 2590 1214 gene locus_tag LOCUS_02260 2590 1214 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_02260 3243 2608 gene locus_tag LOCUS_02270 3243 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086116.1 protein_id gnl|my_center|LOCUS_02270 3402 4097 gene locus_tag LOCUS_02280 3402 4097 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723456.1 protein_id gnl|my_center|LOCUS_02280 5644 4139 gene locus_tag LOCUS_02290 gene glpD 5644 4139 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LM5 protein_id gnl|my_center|LOCUS_02290 5748 6323 gene locus_tag LOCUS_02300 5748 6323 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 protein_id gnl|my_center|LOCUS_02300 6347 6703 gene locus_tag LOCUS_02310 6347 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7024 6698 gene locus_tag LOCUS_02320 7024 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 7219 8394 gene locus_tag LOCUS_02330 7219 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8467 9411 gene locus_tag LOCUS_02340 8467 9411 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971872.1 protein_id gnl|my_center|LOCUS_02340 12582 9439 gene locus_tag LOCUS_02350 12582 9439 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_02350 14147 12582 gene locus_tag LOCUS_02360 14147 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 15499 14204 gene locus_tag LOCUS_02370 15499 14204 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_02370 16509 15496 gene locus_tag LOCUS_02380 16509 15496 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_02380 17215 16511 gene locus_tag LOCUS_02390 17215 16511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_02390 18007 17216 gene locus_tag LOCUS_02400 18007 17216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_02400 19266 18076 gene locus_tag LOCUS_02410 19266 18076 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_02410 20984 19623 gene locus_tag LOCUS_02420 20984 19623 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105418.1 protein_id gnl|my_center|LOCUS_02420 21089 22372 gene locus_tag LOCUS_02430 21089 22372 CDS product gamma-glutamylputrescine oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706797.1 protein_id gnl|my_center|LOCUS_02430 23699 22374 gene locus_tag LOCUS_02440 23699 22374 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 protein_id gnl|my_center|LOCUS_02440 24669 23692 gene locus_tag LOCUS_02450 gene speB 24669 23692 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_02450 24961 25194 gene locus_tag LOCUS_02460 24961 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 25327 26709 gene locus_tag LOCUS_02470 25327 26709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence009 2197 1373 gene locus_tag LOCUS_02480 2197 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3219 2284 gene locus_tag LOCUS_02490 gene lpxC 3219 2284 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Q6 protein_id gnl|my_center|LOCUS_02490 4999 3314 gene locus_tag LOCUS_02500 4999 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 6365 5094 gene locus_tag LOCUS_02510 gene ftsA 6365 5094 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF59 protein_id gnl|my_center|LOCUS_02510 7192 6380 gene locus_tag LOCUS_02520 gene ftsQ 7192 6380 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS5 protein_id gnl|my_center|LOCUS_02520 8055 7183 gene locus_tag LOCUS_02530 gene ddl 8055 7183 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDN3 protein_id gnl|my_center|LOCUS_02530 8992 8069 gene locus_tag LOCUS_02540 gene murB 8992 8069 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS7 protein_id gnl|my_center|LOCUS_02540 10413 8989 gene locus_tag LOCUS_02550 gene murC 10413 8989 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 protein_id gnl|my_center|LOCUS_02550 11498 10410 gene locus_tag LOCUS_02560 gene murG 11498 10410 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_02560 12628 11498 gene locus_tag LOCUS_02570 12628 11498 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_02570 13950 12625 gene locus_tag LOCUS_02580 gene murD 13950 12625 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF52 protein_id gnl|my_center|LOCUS_02580 15047 13959 gene locus_tag LOCUS_02590 gene mraY 15047 13959 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_02590 16461 15037 gene locus_tag LOCUS_02600 gene murF 16461 15037 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIA7 protein_id gnl|my_center|LOCUS_02600 17932 16463 gene locus_tag LOCUS_02610 gene murE 17932 16463 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_02610 19613 17919 gene locus_tag LOCUS_02620 19613 17919 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_02620 19970 19614 gene locus_tag LOCUS_02630 19970 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 20941 19970 gene locus_tag LOCUS_02640 gene rsmH 20941 19970 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_02640 21396 20938 gene locus_tag LOCUS_02650 gene mraZ 21396 20938 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58768 protein_id gnl|my_center|LOCUS_02650 22153 23553 gene locus_tag LOCUS_02660 22153 23553 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_02660 23550 23795 gene locus_tag LOCUS_02670 23550 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_02670 24157 23801 gene locus_tag LOCUS_02680 24157 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 24195 24890 gene locus_tag LOCUS_02690 24195 24890 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338448.1 protein_id gnl|my_center|LOCUS_02690 24927 25340 gene locus_tag LOCUS_02700 24927 25340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_02700 25375 25578 gene locus_tag LOCUS_02710 25375 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 25708 25932 gene locus_tag LOCUS_02720 25708 25932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 26571 25933 gene locus_tag LOCUS_02730 26571 25933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 <27295 26568 gene locus_tag LOCUS_02740 <27295 26568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970851.1:nucleoside hydrolase >Feature sequence010 1047 355 gene locus_tag LOCUS_02750 1047 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1390 1034 gene locus_tag LOCUS_02760 1390 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2425 1430 gene locus_tag LOCUS_02770 2425 1430 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704302.1 protein_id gnl|my_center|LOCUS_02770 3775 2450 gene locus_tag LOCUS_02780 3775 2450 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969917.1 protein_id gnl|my_center|LOCUS_02780 5135 3825 gene locus_tag LOCUS_02790 5135 3825 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_02790 6492 5152 gene locus_tag LOCUS_02800 6492 5152 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969941.1 protein_id gnl|my_center|LOCUS_02800 7618 6635 gene locus_tag LOCUS_02810 7618 6635 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709004.1 protein_id gnl|my_center|LOCUS_02810 8717 7638 gene locus_tag LOCUS_02820 8717 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 9601 8720 gene locus_tag LOCUS_02830 9601 8720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066594.1 protein_id gnl|my_center|LOCUS_02830 10409 9618 gene locus_tag LOCUS_02840 10409 9618 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_02840 11902 10445 gene locus_tag LOCUS_02850 gene dht 11902 10445 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708999.1 protein_id gnl|my_center|LOCUS_02850 13177 11927 gene locus_tag LOCUS_02860 13177 11927 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 protein_id gnl|my_center|LOCUS_02860 14749 13265 gene locus_tag LOCUS_02870 gene prpD 14749 13265 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_02870 15901 14777 gene locus_tag LOCUS_02880 gene prpC 15901 14777 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E3 protein_id gnl|my_center|LOCUS_02880 16811 15936 gene locus_tag LOCUS_02890 gene prpB 16811 15936 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW1 protein_id gnl|my_center|LOCUS_02890 17127 16819 gene locus_tag LOCUS_02900 17127 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 17710 17144 gene locus_tag LOCUS_02910 17710 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_02910 18069 19076 gene locus_tag LOCUS_02920 18069 19076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706301.1 protein_id gnl|my_center|LOCUS_02920 19138 20655 gene locus_tag LOCUS_02930 19138 20655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706300.1 protein_id gnl|my_center|LOCUS_02930 20648 21718 gene locus_tag LOCUS_02940 20648 21718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 protein_id gnl|my_center|LOCUS_02940 21715 22665 gene locus_tag LOCUS_02950 21715 22665 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706298.1 protein_id gnl|my_center|LOCUS_02950 22684 23952 gene locus_tag LOCUS_02960 22684 23952 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 protein_id gnl|my_center|LOCUS_02960 24268 23999 gene locus_tag LOCUS_02970 24268 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 24351 25166 gene locus_tag LOCUS_02980 24351 25166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 25185 25403 gene locus_tag LOCUS_02990 25185 25403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 25430 25711 gene locus_tag LOCUS_03000 25430 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 25736 25942 gene locus_tag LOCUS_03010 25736 25942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 26393 25950 gene locus_tag LOCUS_03020 26393 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence011 623 1630 gene locus_tag LOCUS_03030 623 1630 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_03030 2354 1635 gene locus_tag LOCUS_03040 gene moeB 2354 1635 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_03040 2842 2408 gene locus_tag LOCUS_03050 gene dut 2842 2408 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66592 protein_id gnl|my_center|LOCUS_03050 4250 2826 gene locus_tag LOCUS_03060 4250 2826 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921539.1 protein_id gnl|my_center|LOCUS_03060 5799 4294 gene locus_tag LOCUS_03070 5799 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6549 5803 gene locus_tag LOCUS_03080 gene ubiE 6549 5803 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY65 protein_id gnl|my_center|LOCUS_03080 6634 7452 gene locus_tag LOCUS_03090 gene mutM 6634 7452 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44948 protein_id gnl|my_center|LOCUS_03090 7529 7795 gene locus_tag LOCUS_03100 gene rpsT 7529 7795 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMP9 protein_id gnl|my_center|LOCUS_03100 8206 9633 gene locus_tag LOCUS_03110 gene dnaA 8206 9633 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59758 protein_id gnl|my_center|LOCUS_03110 9753 10859 gene locus_tag LOCUS_03120 9753 10859 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_03120 10911 12071 gene locus_tag LOCUS_03130 gene recF 10911 12071 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 protein_id gnl|my_center|LOCUS_03130 12104 14539 gene locus_tag LOCUS_03140 gene gyrB 12104 14539 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE4 protein_id gnl|my_center|LOCUS_03140 14600 15511 gene locus_tag LOCUS_03150 gene ilvE2 14600 15511 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_03150 15520 16254 gene locus_tag LOCUS_03160 15520 16254 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_03160 16251 17489 gene locus_tag LOCUS_03170 16251 17489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 protein_id gnl|my_center|LOCUS_03170 17502 19451 gene locus_tag LOCUS_03180 17502 19451 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_03180 19469 21310 gene locus_tag LOCUS_03190 19469 21310 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974923.1 protein_id gnl|my_center|LOCUS_03190 21333 22226 gene locus_tag LOCUS_03200 21333 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 22228 23148 gene locus_tag LOCUS_03210 22228 23148 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 protein_id gnl|my_center|LOCUS_03210 23278 23913 gene locus_tag LOCUS_03220 23278 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 24300 23917 gene locus_tag LOCUS_03230 24300 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 25446 24364 gene locus_tag LOCUS_03240 25446 24364 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106295.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence012 2254 1097 gene locus_tag LOCUS_03250 2254 1097 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391123.1 protein_id gnl|my_center|LOCUS_03250 2309 3097 gene locus_tag LOCUS_03260 2309 3097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_03260 3991 3098 gene locus_tag LOCUS_03270 3991 3098 CDS product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066770.1 protein_id gnl|my_center|LOCUS_03270 5084 3993 gene locus_tag LOCUS_03280 gene hisC 5084 3993 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9W3 protein_id gnl|my_center|LOCUS_03280 5628 5101 gene locus_tag LOCUS_03290 5628 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 6407 5685 gene locus_tag LOCUS_03300 6407 5685 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066772.1 protein_id gnl|my_center|LOCUS_03300 6468 7247 gene locus_tag LOCUS_03310 gene gloB 6468 7247 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9I3 protein_id gnl|my_center|LOCUS_03310 7355 7750 gene locus_tag LOCUS_03320 7355 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8141 7767 gene locus_tag LOCUS_03330 8141 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8942 8148 gene locus_tag LOCUS_03340 8942 8148 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_03340 9940 8978 gene locus_tag LOCUS_03350 9940 8978 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 protein_id gnl|my_center|LOCUS_03350 10106 11884 gene locus_tag LOCUS_03360 gene xsc 10106 11884 CDS product putative sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UW6 protein_id gnl|my_center|LOCUS_03360 12766 11888 gene locus_tag LOCUS_03370 12766 11888 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016960.1 protein_id gnl|my_center|LOCUS_03370 12800 13936 gene locus_tag LOCUS_03380 12800 13936 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817F7 protein_id gnl|my_center|LOCUS_03380 15119 13956 gene locus_tag LOCUS_03390 15119 13956 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887432.1 protein_id gnl|my_center|LOCUS_03390 16298 15120 gene locus_tag LOCUS_03400 16298 15120 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975703.1 protein_id gnl|my_center|LOCUS_03400 16439 17560 gene locus_tag LOCUS_03410 16439 17560 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_03410 17591 19120 gene locus_tag LOCUS_03420 17591 19120 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706287.1 protein_id gnl|my_center|LOCUS_03420 20322 19117 gene locus_tag LOCUS_03430 gene wecE 20322 19117 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 protein_id gnl|my_center|LOCUS_03430 21487 20339 gene locus_tag LOCUS_03440 21487 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 21681 22523 gene locus_tag LOCUS_03450 21681 22523 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 protein_id gnl|my_center|LOCUS_03450 22537 24144 gene locus_tag LOCUS_03460 22537 24144 CDS product thiamine pyrophosphate-requiring enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339087.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence013 1925 435 gene locus_tag LOCUS_03470 gene ffh 1925 435 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV60 protein_id gnl|my_center|LOCUS_03470 2097 3005 gene locus_tag LOCUS_03480 gene dapF 2097 3005 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y853 protein_id gnl|my_center|LOCUS_03480 2998 4287 gene locus_tag LOCUS_03490 2998 4287 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338605.1 protein_id gnl|my_center|LOCUS_03490 4284 5204 gene locus_tag LOCUS_03500 4284 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 6040 5252 gene locus_tag LOCUS_03510 6040 5252 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 protein_id gnl|my_center|LOCUS_03510 6692 6102 gene locus_tag LOCUS_03520 6692 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8616 6679 gene locus_tag LOCUS_03530 8616 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 8615 8752 gene locus_tag LOCUS_03540 8615 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 10172 8976 gene locus_tag LOCUS_03550 10172 8976 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391453.1 protein_id gnl|my_center|LOCUS_03550 10304 11503 gene locus_tag LOCUS_03560 10304 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 11863 11516 gene locus_tag LOCUS_03570 11863 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 12057 11860 gene locus_tag LOCUS_03580 12057 11860 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_03580 12685 12041 gene locus_tag LOCUS_03590 12685 12041 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336781.1 protein_id gnl|my_center|LOCUS_03590 13614 12697 gene locus_tag LOCUS_03600 13614 12697 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_03600 14236 13697 gene locus_tag LOCUS_03610 14236 13697 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528772.1 protein_id gnl|my_center|LOCUS_03610 16902 14260 gene locus_tag LOCUS_03620 16902 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 17915 16905 gene locus_tag LOCUS_03630 17915 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 19083 17989 gene locus_tag LOCUS_03640 19083 17989 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_03640 19339 19413 gene locus_tag LOCUS_t00020 19339 19413 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20867 19443 gene locus_tag LOCUS_03650 20867 19443 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_03650 >Feature sequence014 174 764 gene locus_tag LOCUS_03660 gene PSrp1 174 764 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_03660 782 1426 gene locus_tag LOCUS_03670 782 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1551 1838 gene locus_tag LOCUS_03680 1551 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3339 1858 gene locus_tag LOCUS_03690 gene cxp 3339 1858 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384469.1 protein_id gnl|my_center|LOCUS_03690 4725 3361 gene locus_tag LOCUS_03700 4725 3361 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249516.1 protein_id gnl|my_center|LOCUS_03700 4869 5711 gene locus_tag LOCUS_03710 4869 5711 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 protein_id gnl|my_center|LOCUS_03710 5750 6931 gene locus_tag LOCUS_03720 5750 6931 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 protein_id gnl|my_center|LOCUS_03720 6980 8137 gene locus_tag LOCUS_03730 6980 8137 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_03730 8159 8950 gene locus_tag LOCUS_03740 8159 8950 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_03740 8961 10283 gene locus_tag LOCUS_03750 8961 10283 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_03750 10709 10290 gene locus_tag LOCUS_03760 10709 10290 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_03760 10858 10712 gene locus_tag LOCUS_03770 10858 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 12531 10930 gene locus_tag LOCUS_03780 12531 10930 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_03780 12844 12608 gene locus_tag LOCUS_03790 12844 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 14295 12841 gene locus_tag LOCUS_03800 14295 12841 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_03800 15800 14295 gene locus_tag LOCUS_03810 15800 14295 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_03810 16168 15797 gene locus_tag LOCUS_03820 16168 15797 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_03820 16589 16158 gene locus_tag LOCUS_03830 16589 16158 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_03830 17127 16582 gene locus_tag LOCUS_03840 17127 16582 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_03840 17461 17120 gene locus_tag LOCUS_03850 17461 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 17727 17461 gene locus_tag LOCUS_03860 17727 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 18296 17727 gene locus_tag LOCUS_03870 18296 17727 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118368.1 protein_id gnl|my_center|LOCUS_03870 18348 19607 gene locus_tag LOCUS_03880 18348 19607 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_03880 19629 20114 gene locus_tag LOCUS_03890 19629 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 20159 20235 gene locus_tag LOCUS_t00030 20159 20235 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 691 50 gene locus_tag LOCUS_03900 691 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391022.1 protein_id gnl|my_center|LOCUS_03900 1600 692 gene locus_tag LOCUS_03910 gene hslO 1600 692 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB8 protein_id gnl|my_center|LOCUS_03910 2504 1587 gene locus_tag LOCUS_03920 gene argF 2504 1587 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE8 protein_id gnl|my_center|LOCUS_03920 3685 2501 gene locus_tag LOCUS_03930 gene argD 3685 2501 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI71 protein_id gnl|my_center|LOCUS_03930 4824 3706 gene locus_tag LOCUS_03940 4824 3706 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 protein_id gnl|my_center|LOCUS_03940 4900 5478 gene locus_tag LOCUS_03950 4900 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5545 7488 gene locus_tag LOCUS_03960 gene acsA 5545 7488 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_03960 7505 8458 gene locus_tag LOCUS_03970 7505 8458 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_03970 8490 9071 gene locus_tag LOCUS_03980 gene tdk 8490 9071 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXF9 protein_id gnl|my_center|LOCUS_03980 9132 9380 gene locus_tag LOCUS_03990 9132 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9472 10365 gene locus_tag LOCUS_04000 gene folD 9472 10365 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_04000 10375 10566 gene locus_tag LOCUS_04010 10375 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10575 11150 gene locus_tag LOCUS_04020 10575 11150 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_04020 11178 11927 gene locus_tag LOCUS_04030 gene etfB 11178 11927 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039481.1 protein_id gnl|my_center|LOCUS_04030 11942 12871 gene locus_tag LOCUS_04040 11942 12871 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_04040 13734 13114 gene locus_tag LOCUS_04050 13734 13114 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_04050 15560 13731 gene locus_tag LOCUS_04060 15560 13731 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 protein_id gnl|my_center|LOCUS_04060 15738 16733 gene locus_tag LOCUS_04070 15738 16733 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528364.1 protein_id gnl|my_center|LOCUS_04070 17522 16737 gene locus_tag LOCUS_04080 17522 16737 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528365.1 protein_id gnl|my_center|LOCUS_04080 18649 17522 gene locus_tag LOCUS_04090 18649 17522 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_04090 19452 18670 gene locus_tag LOCUS_04100 19452 18670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013333.1 protein_id gnl|my_center|LOCUS_04100 <19969 19454 gene locus_tag LOCUS_04110 <19969 19454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896031.1:ribose ABC transporter permease >Feature sequence016 1154 213 gene locus_tag LOCUS_04120 1154 213 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_04120 1839 1255 gene locus_tag LOCUS_04130 1839 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2684 1836 gene locus_tag LOCUS_04140 2684 1836 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_04140 3100 2687 gene locus_tag LOCUS_04150 3100 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4467 3112 gene locus_tag LOCUS_04160 4467 3112 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010914750.1 protein_id gnl|my_center|LOCUS_04160 5347 4478 gene locus_tag LOCUS_04170 5347 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6270 5335 gene locus_tag LOCUS_04180 6270 5335 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_04180 7795 6314 gene locus_tag LOCUS_04190 7795 6314 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_04190 9182 7842 gene locus_tag LOCUS_04200 9182 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 9409 10131 gene locus_tag LOCUS_04210 9409 10131 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_04210 10856 10137 gene locus_tag LOCUS_04220 10856 10137 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_04220 11791 10853 gene locus_tag LOCUS_04230 gene glxA 11791 10853 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973658.1 protein_id gnl|my_center|LOCUS_04230 11887 13137 gene locus_tag LOCUS_04240 gene soxB 11887 13137 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973657.1 protein_id gnl|my_center|LOCUS_04240 13146 13427 gene locus_tag LOCUS_04250 13146 13427 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532908.1 protein_id gnl|my_center|LOCUS_04250 13428 16421 gene locus_tag LOCUS_04260 13428 16421 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_04260 16414 16983 gene locus_tag LOCUS_04270 16414 16983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 17047 18015 gene locus_tag LOCUS_04280 17047 18015 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066613.1 protein_id gnl|my_center|LOCUS_04280 18023 19306 gene locus_tag LOCUS_04290 18023 19306 CDS product D-glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1S1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence017 <1 653 gene locus_tag LOCUS_04300 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8U9F7:ferrochelatase 710 783 gene locus_tag LOCUS_t00040 710 783 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4247 816 gene locus_tag LOCUS_04310 4247 816 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_04310 4947 4240 gene locus_tag LOCUS_04320 gene lolD 4947 4240 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFV7 protein_id gnl|my_center|LOCUS_04320 6187 4940 gene locus_tag LOCUS_04330 6187 4940 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_04330 7499 6189 gene locus_tag LOCUS_04340 gene proS 7499 6189 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU19 protein_id gnl|my_center|LOCUS_04340 7676 8695 gene locus_tag LOCUS_04350 gene hemB 7676 8695 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_04350 8809 10026 gene locus_tag LOCUS_04360 8809 10026 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_04360 10041 10763 gene locus_tag LOCUS_04370 gene ate 10041 10763 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J340 protein_id gnl|my_center|LOCUS_04370 12989 10755 gene locus_tag LOCUS_04380 gene parC 12989 10755 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_04380 13766 13014 gene locus_tag LOCUS_04390 gene recO 13766 13014 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT96 protein_id gnl|my_center|LOCUS_04390 14682 13759 gene locus_tag LOCUS_04400 gene era 14682 13759 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69162 protein_id gnl|my_center|LOCUS_04400 15334 14672 gene locus_tag LOCUS_04410 gene rnc 15334 14672 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ4 protein_id gnl|my_center|LOCUS_04410 16106 15351 gene locus_tag LOCUS_04420 16106 15351 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_04420 16560 16153 gene locus_tag LOCUS_04430 gene acpS 16560 16153 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S2 protein_id gnl|my_center|LOCUS_04430 17303 16557 gene locus_tag LOCUS_04440 gene pdxJ 17303 16557 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP2 protein_id gnl|my_center|LOCUS_04440 17778 17305 gene locus_tag LOCUS_04450 17778 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 <19017 17800 gene locus_tag LOCUS_04460 <19017 17800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389609.1:GTP pyrophosphokinase >Feature sequence018 1665 715 gene locus_tag LOCUS_04470 gene mdh 1665 715 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV34 protein_id gnl|my_center|LOCUS_04470 2842 1751 gene locus_tag LOCUS_04480 2842 1751 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338896.1 protein_id gnl|my_center|LOCUS_04480 4421 2856 gene locus_tag LOCUS_04490 4421 2856 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_04490 4520 5377 gene locus_tag LOCUS_04500 4520 5377 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709493.1 protein_id gnl|my_center|LOCUS_04500 5400 6251 gene locus_tag LOCUS_04510 5400 6251 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_04510 6285 7043 gene locus_tag LOCUS_04520 gene pcaD 6285 7043 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973944.1 protein_id gnl|my_center|LOCUS_04520 7052 7444 gene locus_tag LOCUS_04530 7052 7444 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888188.1 protein_id gnl|my_center|LOCUS_04530 7446 8150 gene locus_tag LOCUS_04540 gene pcaH 7446 8150 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524239.1 protein_id gnl|my_center|LOCUS_04540 8154 8729 gene locus_tag LOCUS_04550 gene pcaG 8154 8729 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184553.1 protein_id gnl|my_center|LOCUS_04550 8748 9608 gene locus_tag LOCUS_04560 8748 9608 CDS product 3-oxoadipate--succinyl-CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528952.1 protein_id gnl|my_center|LOCUS_04560 9601 10383 gene locus_tag LOCUS_04570 9601 10383 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528953.1 protein_id gnl|my_center|LOCUS_04570 10383 11588 gene locus_tag LOCUS_04580 gene pcaF 10383 11588 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976289.1 protein_id gnl|my_center|LOCUS_04580 11602 12735 gene locus_tag LOCUS_04590 11602 12735 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_04590 13697 12780 gene locus_tag LOCUS_04600 gene yihU 13697 12780 CDS product 3-sulfolactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFI1 protein_id gnl|my_center|LOCUS_04600 14306 13716 gene locus_tag LOCUS_04610 14306 13716 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085642.1 protein_id gnl|my_center|LOCUS_04610 14830 14300 gene locus_tag LOCUS_04620 14830 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14970 16172 gene locus_tag LOCUS_04630 gene pgk 14970 16172 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M79 protein_id gnl|my_center|LOCUS_04630 16222 17727 gene locus_tag LOCUS_04640 16222 17727 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 protein_id gnl|my_center|LOCUS_04640 18523 17747 gene locus_tag LOCUS_04650 gene sdhB 18523 17747 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LI4 protein_id gnl|my_center|LOCUS_04650 >Feature sequence019 993 208 gene locus_tag LOCUS_04660 993 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2228 1059 gene locus_tag LOCUS_04670 gene sat 2228 1059 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_04670 2818 2279 gene locus_tag LOCUS_04680 2818 2279 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I057 protein_id gnl|my_center|LOCUS_04680 3245 2838 gene locus_tag LOCUS_04690 3245 2838 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207891.1 protein_id gnl|my_center|LOCUS_04690 3346 4095 gene locus_tag LOCUS_04700 3346 4095 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_04700 4115 4546 gene locus_tag LOCUS_04710 4115 4546 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709217.1 protein_id gnl|my_center|LOCUS_04710 4539 5537 gene locus_tag LOCUS_04720 4539 5537 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528438.1 protein_id gnl|my_center|LOCUS_04720 5611 7152 gene locus_tag LOCUS_04730 5611 7152 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_04730 7145 8191 gene locus_tag LOCUS_04740 7145 8191 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_04740 9969 8200 gene locus_tag LOCUS_04750 9969 8200 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927003.1 protein_id gnl|my_center|LOCUS_04750 10726 9980 gene locus_tag LOCUS_04760 10726 9980 CDS product sorbitol 6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_04760 11750 10731 gene locus_tag LOCUS_04770 11750 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 12700 11750 gene locus_tag LOCUS_04780 gene acoA 12700 11750 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4N0 protein_id gnl|my_center|LOCUS_04780 13145 12687 gene locus_tag LOCUS_04790 13145 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 13912 13145 gene locus_tag LOCUS_04800 13912 13145 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_04800 14685 13909 gene locus_tag LOCUS_04810 14685 13909 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727772.1 protein_id gnl|my_center|LOCUS_04810 15596 14781 gene locus_tag LOCUS_04820 15596 14781 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_04820 17199 15808 gene locus_tag LOCUS_04830 17199 15808 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence020 38 1402 gene locus_tag LOCUS_04840 gene agaL2 38 1402 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976337.1 protein_id gnl|my_center|LOCUS_04840 2595 1399 gene locus_tag LOCUS_04850 2595 1399 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 protein_id gnl|my_center|LOCUS_04850 3719 2637 gene locus_tag LOCUS_04860 3719 2637 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKP8 protein_id gnl|my_center|LOCUS_04860 4758 3712 gene locus_tag LOCUS_04870 4758 3712 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WF7 protein_id gnl|my_center|LOCUS_04870 4889 5347 gene locus_tag LOCUS_04880 4889 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6828 5353 gene locus_tag LOCUS_04890 gene glpK2 6828 5353 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_04890 7623 6901 gene locus_tag LOCUS_04900 gene glpQ 7623 6901 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_04900 7708 8223 gene locus_tag LOCUS_04910 gene ppiB 7708 8223 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_04910 8714 8229 gene locus_tag LOCUS_04920 8714 8229 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_04920 9493 8741 gene locus_tag LOCUS_04930 9493 8741 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083972.1 protein_id gnl|my_center|LOCUS_04930 10371 9490 gene locus_tag LOCUS_04940 10371 9490 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 protein_id gnl|my_center|LOCUS_04940 10551 11015 gene locus_tag LOCUS_04950 10551 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11019 11645 gene locus_tag LOCUS_04960 11019 11645 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 protein_id gnl|my_center|LOCUS_04960 11648 11902 gene locus_tag LOCUS_04970 11648 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 11921 13132 gene locus_tag LOCUS_04980 gene papS 11921 13132 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972173.1 protein_id gnl|my_center|LOCUS_04980 13199 14047 gene locus_tag LOCUS_04990 gene hemF 13199 14047 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC86 protein_id gnl|my_center|LOCUS_04990 14190 14711 gene locus_tag LOCUS_05000 14190 14711 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_05000 14722 15972 gene locus_tag LOCUS_05010 14722 15972 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH7 protein_id gnl|my_center|LOCUS_05010 15987 16754 gene locus_tag LOCUS_05020 15987 16754 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_05020 <17309 16762 gene locus_tag LOCUS_05030 <17309 16762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92N65:ribosome-binding ATPase YchF >Feature sequence021 89 766 gene locus_tag LOCUS_05040 gene atrA 89 766 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967498.1 protein_id gnl|my_center|LOCUS_05040 846 2921 gene locus_tag LOCUS_05050 846 2921 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_05050 2922 4685 gene locus_tag LOCUS_05060 2922 4685 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_05060 5990 4689 gene locus_tag LOCUS_05070 5990 4689 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 protein_id gnl|my_center|LOCUS_05070 7278 6013 gene locus_tag LOCUS_05080 7278 6013 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878820.1 protein_id gnl|my_center|LOCUS_05080 7416 8411 gene locus_tag LOCUS_05090 gene siaP 7416 8411 CDS product sialic acid-binding periplasmic protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44542 protein_id gnl|my_center|LOCUS_05090 9781 8480 gene locus_tag LOCUS_05100 9781 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 10246 9782 gene locus_tag LOCUS_05110 10246 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05110 10389 10706 gene locus_tag LOCUS_05120 10389 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 10769 11698 gene locus_tag LOCUS_05130 10769 11698 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_05130 13294 11702 gene locus_tag LOCUS_05140 13294 11702 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085017.1 protein_id gnl|my_center|LOCUS_05140 13378 14046 gene locus_tag LOCUS_05150 13378 14046 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368435.1 protein_id gnl|my_center|LOCUS_05150 15338 14043 gene locus_tag LOCUS_05160 15338 14043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_05160 15715 15341 gene locus_tag LOCUS_05170 15715 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16917 15919 gene locus_tag LOCUS_05180 gene siaP 16917 15919 CDS product sialic acid-binding periplasmic protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44542 protein_id gnl|my_center|LOCUS_05180 >Feature sequence022 27 1055 gene locus_tag LOCUS_05190 27 1055 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170557.1 protein_id gnl|my_center|LOCUS_05190 2017 1079 gene locus_tag LOCUS_05200 2017 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2136 4199 gene locus_tag LOCUS_05210 2136 4199 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538204.1 protein_id gnl|my_center|LOCUS_05210 4196 5869 gene locus_tag LOCUS_05220 4196 5869 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_05220 5951 6946 gene locus_tag LOCUS_05230 5951 6946 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537995.1 protein_id gnl|my_center|LOCUS_05230 7005 7505 gene locus_tag LOCUS_05240 7005 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7506 8819 gene locus_tag LOCUS_05250 7506 8819 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 protein_id gnl|my_center|LOCUS_05250 9651 8833 gene locus_tag LOCUS_05260 9651 8833 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967744.1 protein_id gnl|my_center|LOCUS_05260 9719 10591 gene locus_tag LOCUS_05270 9719 10591 CDS product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_05270 10591 13029 gene locus_tag LOCUS_05280 10591 13029 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_05280 14348 13038 gene locus_tag LOCUS_05290 gene melA 14348 13038 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986598.1 protein_id gnl|my_center|LOCUS_05290 15358 14381 gene locus_tag LOCUS_05300 15358 14381 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 protein_id gnl|my_center|LOCUS_05300 16113 15367 gene locus_tag LOCUS_05310 16113 15367 CDS product sugar ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_05310 <17163 16187 gene locus_tag LOCUS_05320 <17163 16187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530992.1:sugar ABC transporter substrate-binding protein >Feature sequence023 2003 489 gene locus_tag LOCUS_05330 gene argH2 2003 489 CDS product argininosuccinate lyase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U705 protein_id gnl|my_center|LOCUS_05330 2854 2006 gene locus_tag LOCUS_05340 gene ugpE 2854 2006 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CGY5 protein_id gnl|my_center|LOCUS_05340 3753 2851 gene locus_tag LOCUS_05350 3753 2851 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974047.1 protein_id gnl|my_center|LOCUS_05350 5058 3805 gene locus_tag LOCUS_05360 5058 3805 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974048.1 protein_id gnl|my_center|LOCUS_05360 5234 7681 gene locus_tag LOCUS_05370 5234 7681 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_05370 7929 8576 gene locus_tag LOCUS_05380 7929 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8593 9033 gene locus_tag LOCUS_05390 8593 9033 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_05390 9051 9566 gene locus_tag LOCUS_05400 gene apt 9051 9566 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFM9 protein_id gnl|my_center|LOCUS_05400 9769 9563 gene locus_tag LOCUS_05410 9769 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9936 10223 gene locus_tag LOCUS_05420 9936 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10301 11983 gene locus_tag LOCUS_05430 10301 11983 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_05430 12075 13556 gene locus_tag LOCUS_05440 12075 13556 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707191.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence024 616 1254 gene locus_tag LOCUS_05450 616 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1445 2047 gene locus_tag LOCUS_05460 1445 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195773.1 protein_id gnl|my_center|LOCUS_05460 2226 3107 gene locus_tag LOCUS_05470 2226 3107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336870.1 protein_id gnl|my_center|LOCUS_05470 3122 4045 gene locus_tag LOCUS_05480 3122 4045 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_05480 4654 4214 gene locus_tag LOCUS_05490 4654 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4851 5087 gene locus_tag LOCUS_05500 4851 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 5068 5433 gene locus_tag LOCUS_05510 5068 5433 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_05510 5577 5987 gene locus_tag LOCUS_05520 5577 5987 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_05520 6347 7405 gene locus_tag LOCUS_05530 6347 7405 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063679.1 protein_id gnl|my_center|LOCUS_05530 7606 7905 gene locus_tag LOCUS_05540 7606 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8232 9038 gene locus_tag LOCUS_05550 8232 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9054 9479 gene locus_tag LOCUS_05560 9054 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 9550 9921 gene locus_tag LOCUS_05570 9550 9921 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_05570 9951 10796 gene locus_tag LOCUS_05580 9951 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 10862 11512 gene locus_tag LOCUS_05590 10862 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 11527 12489 gene locus_tag LOCUS_05600 gene gpsA 11527 12489 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXG6 protein_id gnl|my_center|LOCUS_05600 12592 12891 gene locus_tag LOCUS_05610 12592 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 13577 12981 gene locus_tag LOCUS_05620 13577 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 13971 13807 gene locus_tag LOCUS_05630 13971 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 14431 14132 gene locus_tag LOCUS_05640 14431 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 14507 15172 gene locus_tag LOCUS_05650 14507 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 15557 15222 gene locus_tag LOCUS_05660 15557 15222 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_05660 15931 16254 gene locus_tag LOCUS_05670 15931 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16329 16619 gene locus_tag LOCUS_05680 16329 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence025 <1 712 gene locus_tag LOCUS_05690 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090137.1:phosphoserine aminotransferase 724 2328 gene locus_tag LOCUS_05700 gene serA 724 2328 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_05700 2390 3676 gene locus_tag LOCUS_05710 gene purA 2390 3676 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_05710 4566 3682 gene locus_tag LOCUS_05720 gene rpoH 4566 3682 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 protein_id gnl|my_center|LOCUS_05720 5662 4613 gene locus_tag LOCUS_05730 5662 4613 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DV1 protein_id gnl|my_center|LOCUS_05730 5681 6058 gene locus_tag LOCUS_05740 5681 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6108 7784 gene locus_tag LOCUS_05750 6108 7784 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_05750 8428 7787 gene locus_tag LOCUS_05760 8428 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9161 8403 gene locus_tag LOCUS_05770 9161 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9269 11479 gene locus_tag LOCUS_05780 9269 11479 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A836 protein_id gnl|my_center|LOCUS_05780 11476 12363 gene locus_tag LOCUS_05790 gene prmA 11476 12363 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FW1 protein_id gnl|my_center|LOCUS_05790 12371 14131 gene locus_tag LOCUS_05800 12371 14131 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067249.1 protein_id gnl|my_center|LOCUS_05800 16212 14137 gene locus_tag LOCUS_05810 gene ligA 16212 14137 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV5 protein_id gnl|my_center|LOCUS_05810 >Feature sequence026 178 843 gene locus_tag LOCUS_05820 178 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1512 844 gene locus_tag LOCUS_05830 1512 844 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_05830 2091 1546 gene locus_tag LOCUS_05840 2091 1546 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563763.1 protein_id gnl|my_center|LOCUS_05840 3568 2126 gene locus_tag LOCUS_05850 3568 2126 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064802.1 protein_id gnl|my_center|LOCUS_05850 8215 3572 gene locus_tag LOCUS_05860 gene gltB 8215 3572 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_05860 8394 9191 gene locus_tag LOCUS_05870 gene uppP1 8394 9191 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_05870 10140 9175 gene locus_tag LOCUS_05880 10140 9175 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_05880 10345 10965 gene locus_tag LOCUS_05890 10345 10965 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597621.1 protein_id gnl|my_center|LOCUS_05890 10986 11588 gene locus_tag LOCUS_05900 10986 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 11606 12388 gene locus_tag LOCUS_05910 11606 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 12405 13169 gene locus_tag LOCUS_05920 12405 13169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_05920 13278 13203 gene locus_tag LOCUS_t00050 13278 13203 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13691 13299 gene locus_tag LOCUS_05930 13691 13299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 13805 15142 gene locus_tag LOCUS_05940 gene aroA 13805 15142 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SV5 protein_id gnl|my_center|LOCUS_05940 15139 15786 gene locus_tag LOCUS_05950 gene cmk 15139 15786 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187C4 protein_id gnl|my_center|LOCUS_05950 >Feature sequence027 739 170 gene locus_tag LOCUS_05960 739 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1206 1847 gene locus_tag LOCUS_05970 1206 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1834 2589 gene locus_tag LOCUS_05980 1834 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2700 3242 gene locus_tag LOCUS_05990 gene nbaC 2700 3242 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_05990 3255 4208 gene locus_tag LOCUS_06000 3255 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4220 5131 gene locus_tag LOCUS_06010 4220 5131 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_06010 5128 6081 gene locus_tag LOCUS_06020 gene kynA 5128 6081 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP5 protein_id gnl|my_center|LOCUS_06020 6095 7288 gene locus_tag LOCUS_06030 gene kynU 6095 7288 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MN3 protein_id gnl|my_center|LOCUS_06030 7310 8002 gene locus_tag LOCUS_06040 7310 8002 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_06040 8014 8886 gene locus_tag LOCUS_06050 8014 8886 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_06050 10243 8990 gene locus_tag LOCUS_06060 10243 8990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 protein_id gnl|my_center|LOCUS_06060 10413 11423 gene locus_tag LOCUS_06070 gene gapB 10413 11423 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J265 protein_id gnl|my_center|LOCUS_06070 12110 11418 gene locus_tag LOCUS_06080 12110 11418 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 protein_id gnl|my_center|LOCUS_06080 12312 13310 gene locus_tag LOCUS_06090 gene tbpA 12312 13310 CDS product thiamine transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261085.1 protein_id gnl|my_center|LOCUS_06090 13755 13450 gene locus_tag LOCUS_06100 13755 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13952 14941 gene locus_tag LOCUS_06110 13952 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14934 15551 gene locus_tag LOCUS_06120 gene thiQ 14934 15551 CDS product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBY6 protein_id gnl|my_center|LOCUS_06120 15956 15552 gene locus_tag LOCUS_06130 gene fur 15956 15552 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384848.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence028 832 236 gene locus_tag LOCUS_06140 832 236 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976089.1 protein_id gnl|my_center|LOCUS_06140 1591 860 gene locus_tag LOCUS_06150 1591 860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_06150 2285 1578 gene locus_tag LOCUS_06160 2285 1578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_06160 3193 2369 gene locus_tag LOCUS_06170 3193 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3292 3486 gene locus_tag LOCUS_06180 3292 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3509 3697 gene locus_tag LOCUS_06190 3509 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3912 3694 gene locus_tag LOCUS_06200 3912 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4596 3937 gene locus_tag LOCUS_06210 4596 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720183.1 protein_id gnl|my_center|LOCUS_06210 4985 4596 gene locus_tag LOCUS_06220 4985 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720184.1 protein_id gnl|my_center|LOCUS_06220 5141 5944 gene locus_tag LOCUS_06230 5141 5944 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_06230 6352 5954 gene locus_tag LOCUS_06240 6352 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 7086 6382 gene locus_tag LOCUS_06250 gene fliA 7086 6382 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720175.1 protein_id gnl|my_center|LOCUS_06250 7890 7114 gene locus_tag LOCUS_06260 gene fleN 7890 7114 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884V8 protein_id gnl|my_center|LOCUS_06260 9043 7916 gene locus_tag LOCUS_06270 9043 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11155 9047 gene locus_tag LOCUS_06280 gene flhA 11155 9047 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337939.1 protein_id gnl|my_center|LOCUS_06280 11486 12061 gene locus_tag LOCUS_06290 11486 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 12078 13226 gene locus_tag LOCUS_06300 12078 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 13223 13684 gene locus_tag LOCUS_06310 13223 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 13687 14409 gene locus_tag LOCUS_06320 13687 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 14464 14772 gene locus_tag LOCUS_06330 14464 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 14813 15118 gene locus_tag LOCUS_06340 14813 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 15137 15574 gene locus_tag LOCUS_06350 15137 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 15925 15578 gene locus_tag LOCUS_06360 15925 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence029 3 1028 gene locus_tag LOCUS_06370 3 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1103 1516 gene locus_tag LOCUS_06380 1103 1516 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727821.1 protein_id gnl|my_center|LOCUS_06380 1541 2707 gene locus_tag LOCUS_06390 1541 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2712 3389 gene locus_tag LOCUS_06400 2712 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_06400 4548 3394 gene locus_tag LOCUS_06410 4548 3394 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8J8 protein_id gnl|my_center|LOCUS_06410 5490 4624 gene locus_tag LOCUS_06420 5490 4624 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460847.1 protein_id gnl|my_center|LOCUS_06420 5697 6050 gene locus_tag LOCUS_06430 5697 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6050 6310 gene locus_tag LOCUS_06440 6050 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 6737 6318 gene locus_tag LOCUS_06450 6737 6318 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_06450 6845 8689 gene locus_tag LOCUS_06460 6845 8689 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384433.1 protein_id gnl|my_center|LOCUS_06460 8705 10405 gene locus_tag LOCUS_06470 gene ade 8705 10405 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ66 protein_id gnl|my_center|LOCUS_06470 10407 11405 gene locus_tag LOCUS_06480 10407 11405 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_06480 11519 12901 gene locus_tag LOCUS_06490 11519 12901 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_06490 12894 13667 gene locus_tag LOCUS_06500 12894 13667 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_06500 13678 14631 gene locus_tag LOCUS_06510 gene gpuA 13678 14631 CDS product guanidinopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6K2 protein_id gnl|my_center|LOCUS_06510 15331 14624 gene locus_tag LOCUS_06520 15331 14624 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_06520 <15951 15347 gene locus_tag LOCUS_06530 <15951 15347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016733.1:spore photoproduct lyase >Feature sequence030 1041 1844 gene locus_tag LOCUS_06540 1041 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1856 3058 gene locus_tag LOCUS_06550 1856 3058 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523407.1 protein_id gnl|my_center|LOCUS_06550 3055 3945 gene locus_tag LOCUS_06560 3055 3945 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_06560 4837 3950 gene locus_tag LOCUS_06570 gene ytcP 4837 3950 CDS product putative ABC transporter permease protein YtcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53561 protein_id gnl|my_center|LOCUS_06570 5553 4831 gene locus_tag LOCUS_06580 5553 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5520 5678 gene locus_tag LOCUS_06590 5520 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6111 7511 gene locus_tag LOCUS_06600 6111 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 7527 8675 gene locus_tag LOCUS_06610 7527 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_06610 10852 8765 gene locus_tag LOCUS_06620 10852 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 11049 12221 gene locus_tag LOCUS_06630 11049 12221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_06630 12403 13230 gene locus_tag LOCUS_06640 12403 13230 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_06640 13232 14230 gene locus_tag LOCUS_06650 13232 14230 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_06650 14234 14983 gene locus_tag LOCUS_06660 14234 14983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_06660 14988 15686 gene locus_tag LOCUS_06670 14988 15686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence031 1283 699 gene locus_tag LOCUS_06680 1283 699 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_06680 1503 1973 gene locus_tag LOCUS_06690 1503 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_06690 3008 1980 gene locus_tag LOCUS_06700 3008 1980 CDS product DNA recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970845.1 protein_id gnl|my_center|LOCUS_06700 3165 3692 gene locus_tag LOCUS_06710 gene def 3165 3692 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_06710 3685 4638 gene locus_tag LOCUS_06720 gene fmt 3685 4638 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH6 protein_id gnl|my_center|LOCUS_06720 4655 5410 gene locus_tag LOCUS_06730 gene truA 4655 5410 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNZ9 protein_id gnl|my_center|LOCUS_06730 5996 5415 gene locus_tag LOCUS_06740 5996 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7146 5986 gene locus_tag LOCUS_06750 gene dapE 7146 5986 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF28 protein_id gnl|my_center|LOCUS_06750 8013 7153 gene locus_tag LOCUS_06760 gene dapD 8013 7153 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM2 protein_id gnl|my_center|LOCUS_06760 8758 8096 gene locus_tag LOCUS_06770 8758 8096 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706659.1 protein_id gnl|my_center|LOCUS_06770 9670 8774 gene locus_tag LOCUS_06780 gene argB 9670 8774 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_06780 10433 9735 gene locus_tag LOCUS_06790 gene engB 10433 9735 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_06790 12106 10391 gene locus_tag LOCUS_06800 gene yidC 12106 10391 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_06800 13038 12286 gene locus_tag LOCUS_06810 13038 12286 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_06810 13386 13042 gene locus_tag LOCUS_06820 13386 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 13649 14353 gene locus_tag LOCUS_06830 13649 14353 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022397.1 protein_id gnl|my_center|LOCUS_06830 14976 14500 gene locus_tag LOCUS_06840 gene gpt 14976 14500 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D63 protein_id gnl|my_center|LOCUS_06840 15135 15211 gene locus_tag LOCUS_t00060 15135 15211 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 238 1275 gene locus_tag LOCUS_06850 238 1275 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974485.1 protein_id gnl|my_center|LOCUS_06850 1284 2087 gene locus_tag LOCUS_06860 gene caiD 1284 2087 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59395 protein_id gnl|my_center|LOCUS_06860 2116 3054 gene locus_tag LOCUS_06870 gene lcdH 2116 3054 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RX5 protein_id gnl|my_center|LOCUS_06870 3086 3979 gene locus_tag LOCUS_06880 3086 3979 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186835.1 protein_id gnl|my_center|LOCUS_06880 4005 5159 gene locus_tag LOCUS_06890 4005 5159 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_06890 5156 7267 gene locus_tag LOCUS_06900 5156 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114528.1 protein_id gnl|my_center|LOCUS_06900 7268 8659 gene locus_tag LOCUS_06910 7268 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528441.1 protein_id gnl|my_center|LOCUS_06910 8763 10052 gene locus_tag LOCUS_06920 8763 10052 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 protein_id gnl|my_center|LOCUS_06920 10077 10958 gene locus_tag LOCUS_06930 10077 10958 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_06930 10955 11890 gene locus_tag LOCUS_06940 10955 11890 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 protein_id gnl|my_center|LOCUS_06940 11887 12603 gene locus_tag LOCUS_06950 11887 12603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_06950 12603 13298 gene locus_tag LOCUS_06960 12603 13298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 protein_id gnl|my_center|LOCUS_06960 13927 13295 gene locus_tag LOCUS_06970 gene pncA 13927 13295 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_06970 14086 14913 gene locus_tag LOCUS_06980 14086 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence033 604 1593 gene locus_tag LOCUS_06990 gene pdxA 604 1593 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V808 protein_id gnl|my_center|LOCUS_06990 1764 3140 gene locus_tag LOCUS_07000 1764 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088687.1 protein_id gnl|my_center|LOCUS_07000 3745 3161 gene locus_tag LOCUS_07010 3745 3161 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL02 protein_id gnl|my_center|LOCUS_07010 3878 4582 gene locus_tag LOCUS_07020 3878 4582 CDS product UPF0173 metal-dependent hydrolase R01310 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK9 protein_id gnl|my_center|LOCUS_07020 5694 4579 gene locus_tag LOCUS_07030 5694 4579 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_07030 6955 5795 gene locus_tag LOCUS_07040 6955 5795 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975280.1 protein_id gnl|my_center|LOCUS_07040 7139 8155 gene locus_tag LOCUS_07050 7139 8155 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_07050 8262 9083 gene locus_tag LOCUS_07060 8262 9083 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_07060 9124 10797 gene locus_tag LOCUS_07070 gene fadD 9124 10797 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072530.1 protein_id gnl|my_center|LOCUS_07070 10790 11932 gene locus_tag LOCUS_07080 10790 11932 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_07080 11929 14253 gene locus_tag LOCUS_07090 11929 14253 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence034 83 703 gene locus_tag LOCUS_07100 83 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 781 1488 gene locus_tag LOCUS_07110 781 1488 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_07110 1491 2438 gene locus_tag LOCUS_07120 gene ghrA 1491 2438 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRR3 protein_id gnl|my_center|LOCUS_07120 3859 2435 gene locus_tag LOCUS_07130 3859 2435 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_07130 5235 3886 gene locus_tag LOCUS_07140 gene dinF 5235 3886 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262808.1 protein_id gnl|my_center|LOCUS_07140 5465 7120 gene locus_tag LOCUS_07150 5465 7120 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_07150 7197 7958 gene locus_tag LOCUS_07160 gene dpm1 7197 7958 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_07160 7955 8326 gene locus_tag LOCUS_07170 7955 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8742 8323 gene locus_tag LOCUS_07180 8742 8323 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_07180 9921 8836 gene locus_tag LOCUS_07190 gene tsaD 9921 8836 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV5 protein_id gnl|my_center|LOCUS_07190 10036 10938 gene locus_tag LOCUS_07200 gene hemC 10036 10938 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16616 protein_id gnl|my_center|LOCUS_07200 10925 11662 gene locus_tag LOCUS_07210 10925 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 11667 12686 gene locus_tag LOCUS_07220 11667 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 12683 13987 gene locus_tag LOCUS_07230 12683 13987 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 protein_id gnl|my_center|LOCUS_07230 14580 14011 gene locus_tag LOCUS_07240 14580 14011 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence035 1197 2336 gene locus_tag LOCUS_07250 1197 2336 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_07250 2336 3196 gene locus_tag LOCUS_07260 2336 3196 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_07260 3309 4793 gene locus_tag LOCUS_07270 3309 4793 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_07270 5712 4810 gene locus_tag LOCUS_07280 gene serB 5712 4810 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338897.1 protein_id gnl|my_center|LOCUS_07280 5742 6668 gene locus_tag LOCUS_07290 gene miaA 5742 6668 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6J5 protein_id gnl|my_center|LOCUS_07290 6832 8607 gene locus_tag LOCUS_07300 6832 8607 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 protein_id gnl|my_center|LOCUS_07300 8624 9157 gene locus_tag LOCUS_07310 gene ilvH 8624 9157 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_07310 9245 10264 gene locus_tag LOCUS_07320 gene ilvC 9245 10264 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G50 protein_id gnl|my_center|LOCUS_07320 10328 11365 gene locus_tag LOCUS_07330 10328 11365 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_07330 11516 12352 gene locus_tag LOCUS_07340 11516 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 12352 12885 gene locus_tag LOCUS_07350 gene mreD 12352 12885 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44476 protein_id gnl|my_center|LOCUS_07350 >Feature sequence036 1995 85 gene locus_tag LOCUS_07360 1995 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3197 2142 gene locus_tag LOCUS_07370 3197 2142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_07370 4220 3267 gene locus_tag LOCUS_07380 4220 3267 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_07380 5526 4369 gene locus_tag LOCUS_07390 gene gcvT 5526 4369 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZN9 protein_id gnl|my_center|LOCUS_07390 5654 6568 gene locus_tag LOCUS_07400 5654 6568 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_07400 7883 6618 gene locus_tag LOCUS_07410 7883 6618 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846343.1 protein_id gnl|my_center|LOCUS_07410 8870 7902 gene locus_tag LOCUS_07420 8870 7902 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_07420 10039 8912 gene locus_tag LOCUS_07430 10039 8912 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886817.1 protein_id gnl|my_center|LOCUS_07430 10173 11027 gene locus_tag LOCUS_07440 10173 11027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 protein_id gnl|my_center|LOCUS_07440 11113 11775 gene locus_tag LOCUS_07450 11113 11775 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 protein_id gnl|my_center|LOCUS_07450 11783 12496 gene locus_tag LOCUS_07460 11783 12496 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389052.1 protein_id gnl|my_center|LOCUS_07460 12493 13272 gene locus_tag LOCUS_07470 12493 13272 CDS product polar amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081262.1 protein_id gnl|my_center|LOCUS_07470 13278 14240 gene locus_tag LOCUS_07480 13278 14240 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence037 1150 86 gene locus_tag LOCUS_07490 1150 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2070 1189 gene locus_tag LOCUS_07500 2070 1189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970044.1 protein_id gnl|my_center|LOCUS_07500 2873 2073 gene locus_tag LOCUS_07510 2873 2073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_07510 3667 2975 gene locus_tag LOCUS_07520 3667 2975 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_07520 4700 3735 gene locus_tag LOCUS_07530 4700 3735 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929890.1 protein_id gnl|my_center|LOCUS_07530 5395 4700 gene locus_tag LOCUS_07540 5395 4700 CDS product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_07540 5872 6090 gene locus_tag LOCUS_07550 5872 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6127 6375 gene locus_tag LOCUS_07560 6127 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6493 6735 gene locus_tag LOCUS_07570 6493 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 7101 6742 gene locus_tag LOCUS_07580 7101 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7901 7113 gene locus_tag LOCUS_07590 7901 7113 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_07590 9232 8057 gene locus_tag LOCUS_07600 9232 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709053.1 protein_id gnl|my_center|LOCUS_07600 10357 9236 gene locus_tag LOCUS_07610 10357 9236 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533412.1 protein_id gnl|my_center|LOCUS_07610 10989 10387 gene locus_tag LOCUS_07620 10989 10387 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967417.1 protein_id gnl|my_center|LOCUS_07620 11922 11002 gene locus_tag LOCUS_07630 11922 11002 CDS product oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550412.1 protein_id gnl|my_center|LOCUS_07630 12772 11972 gene locus_tag LOCUS_07640 12772 11972 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_07640 13164 12775 gene locus_tag LOCUS_07650 13164 12775 CDS product translation initiation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973436.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence038 12 1121 gene locus_tag LOCUS_07660 12 1121 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_07660 1537 1142 gene locus_tag LOCUS_07670 1537 1142 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_07670 2033 1557 gene locus_tag LOCUS_07680 2033 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2104 3042 gene locus_tag LOCUS_07690 gene ttdA 2104 3042 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 protein_id gnl|my_center|LOCUS_07690 3030 3707 gene locus_tag LOCUS_07700 gene ttdB 3030 3707 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_07700 3732 5105 gene locus_tag LOCUS_07710 3732 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973435.1 protein_id gnl|my_center|LOCUS_07710 5196 6218 gene locus_tag LOCUS_07720 5196 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6252 6764 gene locus_tag LOCUS_07730 6252 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6764 8032 gene locus_tag LOCUS_07740 6764 8032 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_07740 8056 9219 gene locus_tag LOCUS_07750 8056 9219 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089749.1 protein_id gnl|my_center|LOCUS_07750 9735 9277 gene locus_tag LOCUS_07760 9735 9277 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_07760 10738 9884 gene locus_tag LOCUS_07770 10738 9884 CDS product protein involved in biosynthesis of mitomycin antibiotics/polyketide fumonisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_07770 11676 10798 gene locus_tag LOCUS_07780 11676 10798 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 protein_id gnl|my_center|LOCUS_07780 12417 11677 gene locus_tag LOCUS_07790 12417 11677 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_07790 13421 12507 gene locus_tag LOCUS_07800 gene psuG 13421 12507 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I109 protein_id gnl|my_center|LOCUS_07800 14349 13411 gene locus_tag LOCUS_07810 14349 13411 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence039 752 2077 gene locus_tag LOCUS_07820 752 2077 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532985.1 protein_id gnl|my_center|LOCUS_07820 2114 2914 gene locus_tag LOCUS_07830 2114 2914 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_07830 3810 2980 gene locus_tag LOCUS_07840 3810 2980 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337924.1 protein_id gnl|my_center|LOCUS_07840 7020 3913 gene locus_tag LOCUS_07850 7020 3913 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_07850 8224 7013 gene locus_tag LOCUS_07860 8224 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 8506 9138 gene locus_tag LOCUS_07870 gene upp 8506 9138 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCU5 protein_id gnl|my_center|LOCUS_07870 10658 9192 gene locus_tag LOCUS_07880 gene zwf 10658 9192 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_07880 10865 11986 gene locus_tag LOCUS_07890 10865 11986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_07890 13043 12174 gene locus_tag LOCUS_07900 13043 12174 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_07900 13078 13722 gene locus_tag LOCUS_07910 13078 13722 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_07910 13789 14337 gene locus_tag LOCUS_07920 13789 14337 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence040 1204 1452 gene locus_tag LOCUS_07930 1204 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1864 1439 gene locus_tag LOCUS_07940 1864 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2108 2869 gene locus_tag LOCUS_07950 gene motA 2108 2869 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338091.1 protein_id gnl|my_center|LOCUS_07950 2902 4077 gene locus_tag LOCUS_07960 gene motB 2902 4077 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338090.1 protein_id gnl|my_center|LOCUS_07960 4209 7643 gene locus_tag LOCUS_07970 4209 7643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528208.1 protein_id gnl|my_center|LOCUS_07970 7661 8629 gene locus_tag LOCUS_07980 7661 8629 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 protein_id gnl|my_center|LOCUS_07980 9518 8622 gene locus_tag LOCUS_07990 9518 8622 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971710.1 protein_id gnl|my_center|LOCUS_07990 9637 10782 gene locus_tag LOCUS_08000 9637 10782 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530347.1 protein_id gnl|my_center|LOCUS_08000 10878 11225 gene locus_tag LOCUS_08010 10878 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 12877 11222 gene locus_tag LOCUS_08020 12877 11222 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_08020 13881 12871 gene locus_tag LOCUS_08030 13881 12871 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence041 78 557 gene locus_tag LOCUS_08040 78 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 617 2173 gene locus_tag LOCUS_08050 gene nusA 617 2173 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_08050 2219 4696 gene locus_tag LOCUS_08060 gene infB 2219 4696 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN5 protein_id gnl|my_center|LOCUS_08060 4709 5080 gene locus_tag LOCUS_08070 4709 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5094 5999 gene locus_tag LOCUS_08080 gene truB 5094 5999 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5T2 protein_id gnl|my_center|LOCUS_08080 6034 6303 gene locus_tag LOCUS_08090 gene rpsO 6034 6303 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU3 protein_id gnl|my_center|LOCUS_08090 6383 8482 gene locus_tag LOCUS_08100 gene pnp 6383 8482 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR6 protein_id gnl|my_center|LOCUS_08100 9269 8487 gene locus_tag LOCUS_08110 9269 8487 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT9 protein_id gnl|my_center|LOCUS_08110 10511 9270 gene locus_tag LOCUS_08120 gene fabB 10511 9270 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339105.1 protein_id gnl|my_center|LOCUS_08120 11029 10508 gene locus_tag LOCUS_08130 gene fabA 11029 10508 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMS5 protein_id gnl|my_center|LOCUS_08130 11157 11558 gene locus_tag LOCUS_08140 gene irr 11157 11558 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_08140 11695 13830 gene locus_tag LOCUS_08150 gene katG 11695 13830 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_08150 >Feature sequence042 382 900 gene locus_tag LOCUS_08160 382 900 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_08160 915 1874 gene locus_tag LOCUS_08170 915 1874 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_08170 3943 1883 gene locus_tag LOCUS_08180 3943 1883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_08180 5097 3946 gene locus_tag LOCUS_08190 5097 3946 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530884.1 protein_id gnl|my_center|LOCUS_08190 5990 5100 gene locus_tag LOCUS_08200 5990 5100 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 protein_id gnl|my_center|LOCUS_08200 7782 6112 gene locus_tag LOCUS_08210 7782 6112 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_08210 9955 7955 gene locus_tag LOCUS_08220 9955 7955 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861490.1 protein_id gnl|my_center|LOCUS_08220 9918 10097 gene locus_tag LOCUS_08230 9918 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 10132 11280 gene locus_tag LOCUS_08240 10132 11280 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_08240 11318 12148 gene locus_tag LOCUS_08250 gene fadB 11318 12148 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085820.1 protein_id gnl|my_center|LOCUS_08250 12166 13122 gene locus_tag LOCUS_08260 12166 13122 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_08260 13160 13408 gene locus_tag LOCUS_08270 gene xseB 13160 13408 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 protein_id gnl|my_center|LOCUS_08270 >Feature sequence043 439 1302 gene locus_tag LOCUS_08280 439 1302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_08280 1759 1310 gene locus_tag LOCUS_08290 1759 1310 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_08290 1999 3012 gene locus_tag LOCUS_08300 1999 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3022 4347 gene locus_tag LOCUS_08310 gene pobA 3022 4347 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814754.1 protein_id gnl|my_center|LOCUS_08310 4369 5292 gene locus_tag LOCUS_08320 4369 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462116.1 protein_id gnl|my_center|LOCUS_08320 6730 5330 gene locus_tag LOCUS_08330 6730 5330 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_08330 8006 6759 gene locus_tag LOCUS_08340 gene aspC 8006 6759 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H3 protein_id gnl|my_center|LOCUS_08340 8241 9236 gene locus_tag LOCUS_08350 8241 9236 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_08350 9288 11651 gene locus_tag LOCUS_08360 9288 11651 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_08360 13188 11674 gene locus_tag LOCUS_08370 gene fliC 13188 11674 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U0 protein_id gnl|my_center|LOCUS_08370 >Feature sequence044 1073 381 gene locus_tag LOCUS_08380 1073 381 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_08380 1259 2053 gene locus_tag LOCUS_08390 1259 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2168 2689 gene locus_tag LOCUS_08400 2168 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2710 5268 gene locus_tag LOCUS_08410 gene leuS 2710 5268 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 protein_id gnl|my_center|LOCUS_08410 5258 5752 gene locus_tag LOCUS_08420 5258 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5757 6794 gene locus_tag LOCUS_08430 5757 6794 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310932.1 protein_id gnl|my_center|LOCUS_08430 6800 7582 gene locus_tag LOCUS_08440 6800 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9118 7574 gene locus_tag LOCUS_08450 9118 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10027 9149 gene locus_tag LOCUS_08460 gene spo0J 10027 9149 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_08460 10808 10017 gene locus_tag LOCUS_08470 10808 10017 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_08470 11445 10828 gene locus_tag LOCUS_08480 11445 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13301 11445 gene locus_tag LOCUS_08490 gene mnmG 13301 11445 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE90 protein_id gnl|my_center|LOCUS_08490 >Feature sequence045 1541 2377 gene locus_tag LOCUS_08500 gene ctaC 1541 2377 CDS product putative cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC6 protein_id gnl|my_center|LOCUS_08500 2405 3997 gene locus_tag LOCUS_08510 gene ctaD 2405 3997 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 protein_id gnl|my_center|LOCUS_08510 4004 4912 gene locus_tag LOCUS_08520 gene ctaB 4004 4912 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_08520 5048 5629 gene locus_tag LOCUS_08530 gene ctaG 5048 5629 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_08530 5649 6428 gene locus_tag LOCUS_08540 gene coxC 5649 6428 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_08540 6485 7216 gene locus_tag LOCUS_08550 gene surf 6485 7216 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D246 protein_id gnl|my_center|LOCUS_08550 7296 8702 gene locus_tag LOCUS_08560 7296 8702 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_08560 9260 8703 gene locus_tag LOCUS_08570 9260 8703 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_08570 9344 11257 gene locus_tag LOCUS_08580 gene scsB 9344 11257 CDS product protein-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972986.1 protein_id gnl|my_center|LOCUS_08580 11733 11284 gene locus_tag LOCUS_08590 gene rnhA 11733 11284 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIS7 protein_id gnl|my_center|LOCUS_08590 12689 11730 gene locus_tag LOCUS_08600 gene thrB 12689 11730 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU7 protein_id gnl|my_center|LOCUS_08600 >Feature sequence046 128 1141 gene locus_tag LOCUS_08610 gene moaA 128 1141 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_08610 1526 1164 gene locus_tag LOCUS_08620 1526 1164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709483.1 protein_id gnl|my_center|LOCUS_08620 1608 2717 gene locus_tag LOCUS_08630 1608 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3943 2702 gene locus_tag LOCUS_08640 3943 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4642 3944 gene locus_tag LOCUS_08650 4642 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4666 5298 gene locus_tag LOCUS_08660 4666 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6834 5506 gene locus_tag LOCUS_08670 6834 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088233.1 protein_id gnl|my_center|LOCUS_08670 7999 6935 gene locus_tag LOCUS_08680 7999 6935 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 protein_id gnl|my_center|LOCUS_08680 8209 8015 gene locus_tag LOCUS_08690 8209 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 8921 8328 gene locus_tag LOCUS_08700 gene fdhB 8921 8328 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_08700 11825 8934 gene locus_tag LOCUS_08710 gene fdnG 11825 8934 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261956.1 protein_id gnl|my_center|LOCUS_08710 12036 11848 gene locus_tag LOCUS_08720 12036 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 12719 12102 gene locus_tag LOCUS_08730 12719 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence047 556 1419 gene locus_tag LOCUS_08740 556 1419 CDS product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533090.1 protein_id gnl|my_center|LOCUS_08740 2582 1479 gene locus_tag LOCUS_08750 2582 1479 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_08750 2691 2846 gene locus_tag LOCUS_08760 2691 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2837 3775 gene locus_tag LOCUS_08770 2837 3775 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_08770 4256 3852 gene locus_tag LOCUS_08780 4256 3852 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537899.1 protein_id gnl|my_center|LOCUS_08780 4875 4279 gene locus_tag LOCUS_08790 4875 4279 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_08790 5895 4891 gene locus_tag LOCUS_08800 5895 4891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 protein_id gnl|my_center|LOCUS_08800 7350 5983 gene locus_tag LOCUS_08810 7350 5983 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_08810 8595 7381 gene locus_tag LOCUS_08820 8595 7381 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_08820 9422 8595 gene locus_tag LOCUS_08830 9422 8595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_08830 10223 9438 gene locus_tag LOCUS_08840 10223 9438 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_08840 11055 10240 gene locus_tag LOCUS_08850 11055 10240 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence048 664 98 gene locus_tag LOCUS_08860 664 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1910 834 gene locus_tag LOCUS_08870 1910 834 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE0 protein_id gnl|my_center|LOCUS_08870 2679 2032 gene locus_tag LOCUS_08880 gene rnhB 2679 2032 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H3 protein_id gnl|my_center|LOCUS_08880 3217 2681 gene locus_tag LOCUS_08890 3217 2681 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_08890 4982 3252 gene locus_tag LOCUS_08900 4982 3252 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_08900 5794 4979 gene locus_tag LOCUS_08910 5794 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5890 7548 gene locus_tag LOCUS_08920 5890 7548 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_08920 7559 9274 gene locus_tag LOCUS_08930 7559 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974660.1 protein_id gnl|my_center|LOCUS_08930 9264 10160 gene locus_tag LOCUS_08940 gene ispE 9264 10160 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8F4 protein_id gnl|my_center|LOCUS_08940 10174 12372 gene locus_tag LOCUS_08950 gene pglB 10174 12372 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9C8 protein_id gnl|my_center|LOCUS_08950 >Feature sequence049 940 62 gene locus_tag LOCUS_08960 940 62 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 protein_id gnl|my_center|LOCUS_08960 1391 2161 gene locus_tag LOCUS_08970 1391 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2945 2211 gene locus_tag LOCUS_08980 2945 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252936.1 protein_id gnl|my_center|LOCUS_08980 3822 2929 gene locus_tag LOCUS_08990 3822 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 protein_id gnl|my_center|LOCUS_08990 3927 4436 gene locus_tag LOCUS_09000 3927 4436 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_09000 4920 4459 gene locus_tag LOCUS_09010 gene queF 4920 4459 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A515 protein_id gnl|my_center|LOCUS_09010 5064 6422 gene locus_tag LOCUS_09020 5064 6422 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_09020 6501 7874 gene locus_tag LOCUS_09030 6501 7874 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 protein_id gnl|my_center|LOCUS_09030 7908 9035 gene locus_tag LOCUS_09040 7908 9035 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 protein_id gnl|my_center|LOCUS_09040 9063 10730 gene locus_tag LOCUS_09050 gene nadE 9063 10730 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969513.1 protein_id gnl|my_center|LOCUS_09050 10738 12072 gene locus_tag LOCUS_09060 gene gltX1 10738 12072 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 protein_id gnl|my_center|LOCUS_09060 >Feature sequence050 1238 804 gene locus_tag LOCUS_09070 1238 804 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_09070 1431 2249 gene locus_tag LOCUS_09080 gene pcaD 1431 2249 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538214.1 protein_id gnl|my_center|LOCUS_09080 3248 2301 gene locus_tag LOCUS_09090 3248 2301 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083524.1 protein_id gnl|my_center|LOCUS_09090 4435 3245 gene locus_tag LOCUS_09100 4435 3245 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083523.1 protein_id gnl|my_center|LOCUS_09100 4926 4850 gene locus_tag LOCUS_t00070 4926 4850 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5015 4940 gene locus_tag LOCUS_t00080 5015 4940 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5354 5079 gene locus_tag LOCUS_09110 5354 5079 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_09110 7900 5486 gene locus_tag LOCUS_09120 gene lon 7900 5486 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 protein_id gnl|my_center|LOCUS_09120 9270 8005 gene locus_tag LOCUS_09130 gene clpX 9270 8005 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 protein_id gnl|my_center|LOCUS_09130 10032 9382 gene locus_tag LOCUS_09140 gene clpP2 10032 9382 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG1 protein_id gnl|my_center|LOCUS_09140 11479 10100 gene locus_tag LOCUS_09150 gene tig 11479 10100 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_09150 11658 11497 gene locus_tag LOCUS_09160 11658 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 11914 11738 gene locus_tag LOCUS_09170 11914 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12008 11932 gene locus_tag LOCUS_t00090 12008 11932 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 277 1152 gene locus_tag LOCUS_09180 277 1152 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_09180 1606 1142 gene locus_tag LOCUS_09190 gene moaE 1606 1142 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_09190 1861 1610 gene locus_tag LOCUS_09200 gene moaD 1861 1610 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7K6 protein_id gnl|my_center|LOCUS_09200 3642 1858 gene locus_tag LOCUS_09210 3642 1858 CDS product bifunctional molybdopterin-guanine dinucleotide biosynthesis protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561940.1 protein_id gnl|my_center|LOCUS_09210 4186 3647 gene locus_tag LOCUS_09220 gene pgsA 4186 3647 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 protein_id gnl|my_center|LOCUS_09220 5998 4217 gene locus_tag LOCUS_09230 gene uvrC 5998 4217 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX6 protein_id gnl|my_center|LOCUS_09230 7400 6402 gene locus_tag LOCUS_09240 7400 6402 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946632.1 protein_id gnl|my_center|LOCUS_09240 9447 7441 gene locus_tag LOCUS_09250 9447 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9597 10799 gene locus_tag LOCUS_09260 gene aatA 9597 10799 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090151.1 protein_id gnl|my_center|LOCUS_09260 10805 11758 gene locus_tag LOCUS_09270 gene yedY 10805 11758 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_09270 <12311 11792 gene locus_tag LOCUS_09280 <12311 11792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920689.1:nucleoside-diphosphate sugar epimerase >Feature sequence052 1404 865 gene locus_tag LOCUS_09290 gene nusB 1404 865 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J3 protein_id gnl|my_center|LOCUS_09290 1777 1358 gene locus_tag LOCUS_09300 gene ribH2 1777 1358 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_09300 2396 1800 gene locus_tag LOCUS_09310 2396 1800 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_09310 3542 2415 gene locus_tag LOCUS_09320 3542 2415 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_09320 4003 3545 gene locus_tag LOCUS_09330 gene nrdR 4003 3545 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_09330 5311 4037 gene locus_tag LOCUS_09340 gene glyA2 5311 4037 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB8 protein_id gnl|my_center|LOCUS_09340 5781 5341 gene locus_tag LOCUS_09350 5781 5341 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_09350 6100 5873 gene locus_tag LOCUS_09360 6100 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7765 6110 gene locus_tag LOCUS_09370 7765 6110 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_09370 8556 7777 gene locus_tag LOCUS_09380 gene coaX 8556 7777 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 protein_id gnl|my_center|LOCUS_09380 9295 8540 gene locus_tag LOCUS_09390 9295 8540 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886314.1 protein_id gnl|my_center|LOCUS_09390 10713 9292 gene locus_tag LOCUS_09400 gene nuoN 10713 9292 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_09400 <12106 10725 gene locus_tag LOCUS_09410 <12106 10725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531101.1:NADH-quinone oxidoreductase subunit M >Feature sequence053 1480 509 gene locus_tag LOCUS_09420 1480 509 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268040.1 protein_id gnl|my_center|LOCUS_09420 1548 3110 gene locus_tag LOCUS_09430 1548 3110 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_09430 3097 3273 gene locus_tag LOCUS_09440 3097 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3279 4568 gene locus_tag LOCUS_09450 3279 4568 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888073.1 protein_id gnl|my_center|LOCUS_09450 4570 5514 gene locus_tag LOCUS_09460 4570 5514 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888074.1 protein_id gnl|my_center|LOCUS_09460 5652 7409 gene locus_tag LOCUS_09470 5652 7409 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090391.1 protein_id gnl|my_center|LOCUS_09470 7692 8516 gene locus_tag LOCUS_09480 7692 8516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 protein_id gnl|my_center|LOCUS_09480 8595 8519 gene locus_tag LOCUS_t00100 8595 8519 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9006 8611 gene locus_tag LOCUS_09490 9006 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 9310 9017 gene locus_tag LOCUS_09500 gene ihfA 9310 9017 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THC4 protein_id gnl|my_center|LOCUS_09500 10328 9348 gene locus_tag LOCUS_09510 gene fabH2 10328 9348 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9J6 protein_id gnl|my_center|LOCUS_09510 11406 10381 gene locus_tag LOCUS_09520 gene plsX 11406 10381 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 protein_id gnl|my_center|LOCUS_09520 >Feature sequence054 172 1191 gene locus_tag LOCUS_09530 gene trpD 172 1191 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94326 protein_id gnl|my_center|LOCUS_09530 1201 2004 gene locus_tag LOCUS_09540 gene trpC 1201 2004 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_09540 1997 2479 gene locus_tag LOCUS_09550 gene moaC 1997 2479 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI5 protein_id gnl|my_center|LOCUS_09550 2472 3713 gene locus_tag LOCUS_09560 gene moeA 2472 3713 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708003.1 protein_id gnl|my_center|LOCUS_09560 3779 4405 gene locus_tag LOCUS_09570 gene lexA 3779 4405 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCJ7 protein_id gnl|my_center|LOCUS_09570 4466 5836 gene locus_tag LOCUS_09580 gene gltX2 4466 5836 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCT8 protein_id gnl|my_center|LOCUS_09580 7054 5891 gene locus_tag LOCUS_09590 gene lpxB2 7054 5891 CDS product lipid-A-disaccharide synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRD7 protein_id gnl|my_center|LOCUS_09590 7866 7051 gene locus_tag LOCUS_09600 7866 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_09600 8662 7859 gene locus_tag LOCUS_09610 gene lpxA 8662 7859 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_09610 9132 8662 gene locus_tag LOCUS_09620 gene fabZ 9132 8662 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_09620 10153 9125 gene locus_tag LOCUS_09630 gene lpxD 10153 9125 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED3 protein_id gnl|my_center|LOCUS_09630 10729 10169 gene locus_tag LOCUS_09640 10729 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 11418 10741 gene locus_tag LOCUS_09650 11418 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence055 337 50 gene locus_tag LOCUS_09660 337 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1265 462 gene locus_tag LOCUS_09670 1265 462 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_09670 2084 1296 gene locus_tag LOCUS_09680 2084 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3497 2262 gene locus_tag LOCUS_09690 3497 2262 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_09690 3595 4026 gene locus_tag LOCUS_09700 3595 4026 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_09700 4026 4445 gene locus_tag LOCUS_09710 4026 4445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_09710 5296 4442 gene locus_tag LOCUS_09720 5296 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5399 5566 gene locus_tag LOCUS_09730 5399 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6152 5568 gene locus_tag LOCUS_09740 6152 5568 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531635.1 protein_id gnl|my_center|LOCUS_09740 6645 6295 gene locus_tag LOCUS_09750 6645 6295 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_09750 7763 6690 gene locus_tag LOCUS_09760 gene metE 7763 6690 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_09760 7909 8391 gene locus_tag LOCUS_09770 gene bfr 7909 8391 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC8 protein_id gnl|my_center|LOCUS_09770 8813 8418 gene locus_tag LOCUS_09780 8813 8418 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975836.1 protein_id gnl|my_center|LOCUS_09780 9640 8837 gene locus_tag LOCUS_09790 gene znuB 9640 8837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971686.1 protein_id gnl|my_center|LOCUS_09790 10383 9640 gene locus_tag LOCUS_09800 gene znuC 10383 9640 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UF79 protein_id gnl|my_center|LOCUS_09800 >Feature sequence056 1060 23 gene locus_tag LOCUS_09810 1060 23 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289858.1 protein_id gnl|my_center|LOCUS_09810 2000 1158 gene locus_tag LOCUS_09820 2000 1158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 protein_id gnl|my_center|LOCUS_09820 3273 2092 gene locus_tag LOCUS_09830 gene yeaW 3273 2092 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067835.1 protein_id gnl|my_center|LOCUS_09830 4850 3294 gene locus_tag LOCUS_09840 4850 3294 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_09840 5732 5076 gene locus_tag LOCUS_09850 5732 5076 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 protein_id gnl|my_center|LOCUS_09850 7409 5742 gene locus_tag LOCUS_09860 gene hutU 7409 5742 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UIH3 protein_id gnl|my_center|LOCUS_09860 8977 7436 gene locus_tag LOCUS_09870 gene hutH 8977 7436 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J289 protein_id gnl|my_center|LOCUS_09870 10194 8974 gene locus_tag LOCUS_09880 gene hutI 10194 8974 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z6 protein_id gnl|my_center|LOCUS_09880 >Feature sequence057 72 1253 gene locus_tag LOCUS_09890 72 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1269 3236 gene locus_tag LOCUS_09900 1269 3236 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0S2 protein_id gnl|my_center|LOCUS_09900 4478 3267 gene locus_tag LOCUS_09910 4478 3267 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_09910 5718 4507 gene locus_tag LOCUS_09920 5718 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5786 6604 gene locus_tag LOCUS_09930 5786 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6610 6954 gene locus_tag LOCUS_09940 6610 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720198.1 protein_id gnl|my_center|LOCUS_09940 7141 7353 gene locus_tag LOCUS_09950 7141 7353 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389274.1 protein_id gnl|my_center|LOCUS_09950 7758 7459 gene locus_tag LOCUS_09960 7758 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8212 7835 gene locus_tag LOCUS_09970 8212 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 8347 8751 gene locus_tag LOCUS_09980 8347 8751 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367306.1 protein_id gnl|my_center|LOCUS_09980 8942 9949 gene locus_tag LOCUS_09990 8942 9949 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_09990 10153 9941 gene locus_tag LOCUS_10000 10153 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence058 1703 2356 gene locus_tag LOCUS_10010 gene tal 1703 2356 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S7 protein_id gnl|my_center|LOCUS_10010 2391 3275 gene locus_tag LOCUS_10020 gene xerC 2391 3275 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV24 protein_id gnl|my_center|LOCUS_10020 4695 3286 gene locus_tag LOCUS_10030 4695 3286 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW3 protein_id gnl|my_center|LOCUS_10030 5929 4715 gene locus_tag LOCUS_10040 gene sucB2 5929 4715 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9T6 protein_id gnl|my_center|LOCUS_10040 8824 5963 gene locus_tag LOCUS_10050 gene sucA 8824 5963 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_426301.2 protein_id gnl|my_center|LOCUS_10050 9778 8903 gene locus_tag LOCUS_10060 9778 8903 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_10060 <10314 9778 gene locus_tag LOCUS_10070 <10314 9778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV33:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence059 1575 268 gene locus_tag LOCUS_10080 gene aglE 1575 268 CDS product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 protein_id gnl|my_center|LOCUS_10080 1773 3104 gene locus_tag LOCUS_10090 1773 3104 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2E9 protein_id gnl|my_center|LOCUS_10090 3157 4119 gene locus_tag LOCUS_10100 3157 4119 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_10100 4122 4781 gene locus_tag LOCUS_10110 4122 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5686 4772 gene locus_tag LOCUS_10120 5686 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970180.1 protein_id gnl|my_center|LOCUS_10120 5758 6831 gene locus_tag LOCUS_10130 5758 6831 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_10130 7452 6835 gene locus_tag LOCUS_10140 7452 6835 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707287.1 protein_id gnl|my_center|LOCUS_10140 8935 7469 gene locus_tag LOCUS_10150 8935 7469 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119535.1 protein_id gnl|my_center|LOCUS_10150 <10307 8951 gene locus_tag LOCUS_10160 <10307 8951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528642.1:C4-dicarboxylate ABC transporter >Feature sequence060 781 20 gene locus_tag LOCUS_10170 781 20 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FX0 protein_id gnl|my_center|LOCUS_10170 1706 786 gene locus_tag LOCUS_10180 1706 786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_10180 2077 1802 gene locus_tag LOCUS_10190 2077 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2167 3957 gene locus_tag LOCUS_10200 gene cya3 2167 3957 CDS product putative adenylate cyclase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q0 protein_id gnl|my_center|LOCUS_10200 4754 3987 gene locus_tag LOCUS_10210 4754 3987 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887392.1 protein_id gnl|my_center|LOCUS_10210 5074 4799 gene locus_tag LOCUS_10220 5074 4799 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 protein_id gnl|my_center|LOCUS_10220 5161 6066 gene locus_tag LOCUS_10230 5161 6066 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_10230 6080 6934 gene locus_tag LOCUS_10240 gene panB 6080 6934 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y071 protein_id gnl|my_center|LOCUS_10240 6935 7738 gene locus_tag LOCUS_10250 6935 7738 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969397.1 protein_id gnl|my_center|LOCUS_10250 7809 8537 gene locus_tag LOCUS_10260 gene djlA 7809 8537 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972066.1 protein_id gnl|my_center|LOCUS_10260 8812 8621 gene locus_tag LOCUS_10270 8812 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9349 8927 gene locus_tag LOCUS_10280 9349 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9882 9424 gene locus_tag LOCUS_10290 9882 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence061 85 2145 gene locus_tag LOCUS_10300 85 2145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_10300 2142 2516 gene locus_tag LOCUS_10310 2142 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2516 4891 gene locus_tag LOCUS_10320 2516 4891 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_10320 4892 6202 gene locus_tag LOCUS_10330 gene ordL 4892 6202 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 protein_id gnl|my_center|LOCUS_10330 6377 6234 gene locus_tag LOCUS_10340 6377 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 7771 6404 gene locus_tag LOCUS_10350 7771 6404 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_10350 8054 9034 gene locus_tag LOCUS_10360 8054 9034 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_10360 10056 9037 gene locus_tag LOCUS_10370 10056 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence062 1581 826 gene locus_tag LOCUS_10380 gene livG 1581 826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930184.1 protein_id gnl|my_center|LOCUS_10380 1711 2169 gene locus_tag LOCUS_10390 gene ytoQ 1711 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_10390 3519 2182 gene locus_tag LOCUS_10400 3519 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10400 4066 3512 gene locus_tag LOCUS_10410 4066 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10410 5486 4179 gene locus_tag LOCUS_10420 5486 4179 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_10420 6821 5490 gene locus_tag LOCUS_10430 6821 5490 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_10430 7518 6829 gene locus_tag LOCUS_10440 gene fwdC 7518 6829 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_10440 8411 7515 gene locus_tag LOCUS_10450 8411 7515 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267556.1 protein_id gnl|my_center|LOCUS_10450 9412 8483 gene locus_tag LOCUS_10460 9412 8483 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336870.1 protein_id gnl|my_center|LOCUS_10460 <9994 9409 gene locus_tag LOCUS_10470 <9994 9409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706349.1:malonyl-CoA synthase >Feature sequence063 2697 1204 gene locus_tag LOCUS_10480 gene glpK1 2697 1204 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X049 protein_id gnl|my_center|LOCUS_10480 3923 2694 gene locus_tag LOCUS_10490 gene glpB 3923 2694 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLJ6 protein_id gnl|my_center|LOCUS_10490 5479 3920 gene locus_tag LOCUS_10500 5479 3920 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ20 protein_id gnl|my_center|LOCUS_10500 6894 5488 gene locus_tag LOCUS_10510 6894 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6893 7345 gene locus_tag LOCUS_10520 6893 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8498 7524 gene locus_tag LOCUS_10530 8498 7524 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_10530 8659 9453 gene locus_tag LOCUS_10540 8659 9453 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418385.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence064 130 1380 gene locus_tag LOCUS_10550 130 1380 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_10550 1607 1395 gene locus_tag LOCUS_10560 1607 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1492 2625 gene locus_tag LOCUS_10570 1492 2625 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_10570 2730 3473 gene locus_tag LOCUS_10580 gene fixR 2730 3473 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_10580 3466 4854 gene locus_tag LOCUS_10590 3466 4854 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_10590 5996 4851 gene locus_tag LOCUS_10600 5996 4851 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708668.1 protein_id gnl|my_center|LOCUS_10600 6134 6601 gene locus_tag LOCUS_10610 6134 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6657 7289 gene locus_tag LOCUS_10620 6657 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7441 8187 gene locus_tag LOCUS_10630 7441 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 9149 8232 gene locus_tag LOCUS_10640 9149 8232 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338180.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence065 38 478 gene locus_tag LOCUS_10650 38 478 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJL2 protein_id gnl|my_center|LOCUS_10650 1392 703 gene locus_tag LOCUS_10660 1392 703 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_10660 1623 2906 gene locus_tag LOCUS_10670 1623 2906 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_10670 2924 3688 gene locus_tag LOCUS_10680 2924 3688 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_10680 3704 4894 gene locus_tag LOCUS_10690 3704 4894 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919303.1 protein_id gnl|my_center|LOCUS_10690 5388 4903 gene locus_tag LOCUS_10700 5388 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_10700 6134 5370 gene locus_tag LOCUS_10710 6134 5370 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969349.1 protein_id gnl|my_center|LOCUS_10710 6216 6794 gene locus_tag LOCUS_10720 6216 6794 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087070.1 protein_id gnl|my_center|LOCUS_10720 7424 6807 gene locus_tag LOCUS_10730 7424 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7618 8223 gene locus_tag LOCUS_10740 7618 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 8237 8737 gene locus_tag LOCUS_10750 8237 8737 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388088.1 protein_id gnl|my_center|LOCUS_10750 9391 8738 gene locus_tag LOCUS_10760 9391 8738 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_10760 >Feature sequence066 707 1129 gene locus_tag LOCUS_10770 707 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064846.1 protein_id gnl|my_center|LOCUS_10770 1122 1463 gene locus_tag LOCUS_10780 1122 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968652.1 protein_id gnl|my_center|LOCUS_10780 1499 1915 gene locus_tag LOCUS_10790 1499 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_10790 1945 2844 gene locus_tag LOCUS_10800 1945 2844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_10800 3327 2845 gene locus_tag LOCUS_10810 3327 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4318 3317 gene locus_tag LOCUS_10820 4318 3317 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_10820 4408 5376 gene locus_tag LOCUS_10830 4408 5376 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_10830 6160 5390 gene locus_tag LOCUS_10840 6160 5390 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964727.1 protein_id gnl|my_center|LOCUS_10840 6439 7398 gene locus_tag LOCUS_10850 6439 7398 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_10850 7935 7426 gene locus_tag LOCUS_10860 7935 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 8280 8204 gene locus_tag LOCUS_t00110 8280 8204 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8411 8944 gene locus_tag LOCUS_10870 8411 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 9256 8951 gene locus_tag LOCUS_10880 9256 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence067 77 1060 gene locus_tag LOCUS_10890 77 1060 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948143.1 protein_id gnl|my_center|LOCUS_10890 1071 1865 gene locus_tag LOCUS_10900 gene sspA 1071 1865 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815819.1 protein_id gnl|my_center|LOCUS_10900 2849 1872 gene locus_tag LOCUS_10910 2849 1872 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846779.1 protein_id gnl|my_center|LOCUS_10910 3221 2856 gene locus_tag LOCUS_10920 3221 2856 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814045.1 protein_id gnl|my_center|LOCUS_10920 4043 3228 gene locus_tag LOCUS_10930 4043 3228 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459450.1 protein_id gnl|my_center|LOCUS_10930 5091 4030 gene locus_tag LOCUS_10940 5091 4030 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459458.1 protein_id gnl|my_center|LOCUS_10940 5188 6330 gene locus_tag LOCUS_10950 5188 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6343 7098 gene locus_tag LOCUS_10960 6343 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 7181 7741 gene locus_tag LOCUS_10970 7181 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 7775 9052 gene locus_tag LOCUS_10980 7775 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence068 <1 507 gene locus_tag LOCUS_10990 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TCQ6:RNA polymerase sigma-54 factor 837 517 gene locus_tag LOCUS_11000 837 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1184 834 gene locus_tag LOCUS_11010 1184 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2716 1235 gene locus_tag LOCUS_11020 2716 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3155 2889 gene locus_tag LOCUS_11030 3155 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3320 3724 gene locus_tag LOCUS_11040 3320 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3724 4137 gene locus_tag LOCUS_11050 3724 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4130 4447 gene locus_tag LOCUS_11060 4130 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4752 4453 gene locus_tag LOCUS_11070 4752 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5230 4745 gene locus_tag LOCUS_11080 5230 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5494 6018 gene locus_tag LOCUS_11090 5494 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6041 6433 gene locus_tag LOCUS_11100 6041 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6506 8218 gene locus_tag LOCUS_11110 6506 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 8385 9266 gene locus_tag LOCUS_11120 8385 9266 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence069 416 1342 gene locus_tag LOCUS_11130 416 1342 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_11130 2206 1346 gene locus_tag LOCUS_11140 2206 1346 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_11140 3174 2209 gene locus_tag LOCUS_11150 3174 2209 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_11150 4182 3178 gene locus_tag LOCUS_11160 4182 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 protein_id gnl|my_center|LOCUS_11160 5367 4258 gene locus_tag LOCUS_11170 gene queG 5367 4258 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFC0 protein_id gnl|my_center|LOCUS_11170 6501 5374 gene locus_tag LOCUS_11180 gene tgt 6501 5374 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR0 protein_id gnl|my_center|LOCUS_11180 7435 6494 gene locus_tag LOCUS_11190 gene queA 7435 6494 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y2 protein_id gnl|my_center|LOCUS_11190 8471 7530 gene locus_tag LOCUS_11200 gene kpsF 8471 7530 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_11200 9125 8526 gene locus_tag LOCUS_11210 gene mobA 9125 8526 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence070 <1 921 gene locus_tag LOCUS_11220 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336965.1:succinyl-diaminopimelate desuccinylase 1007 2491 gene locus_tag LOCUS_11230 1007 2491 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_11230 2544 3494 gene locus_tag LOCUS_11240 2544 3494 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_11240 3491 4357 gene locus_tag LOCUS_11250 3491 4357 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_11250 4354 5952 gene locus_tag LOCUS_11260 4354 5952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 protein_id gnl|my_center|LOCUS_11260 5963 7423 gene locus_tag LOCUS_11270 5963 7423 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_11270 7416 8174 gene locus_tag LOCUS_11280 7416 8174 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533144.1 protein_id gnl|my_center|LOCUS_11280 8220 9041 gene locus_tag LOCUS_11290 8220 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9352 9083 gene locus_tag LOCUS_11300 9352 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence071 1124 1627 gene locus_tag LOCUS_11310 1124 1627 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617356.1 protein_id gnl|my_center|LOCUS_11310 1749 2069 gene locus_tag LOCUS_11320 1749 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2434 2132 gene locus_tag LOCUS_11330 2434 2132 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_11330 2579 3079 gene locus_tag LOCUS_11340 2579 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3224 4378 gene locus_tag LOCUS_11350 3224 4378 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_11350 4442 4852 gene locus_tag LOCUS_11360 4442 4852 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_11360 5017 5424 gene locus_tag LOCUS_11370 5017 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 6244 5516 gene locus_tag LOCUS_11380 6244 5516 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261606.1 protein_id gnl|my_center|LOCUS_11380 6317 7300 gene locus_tag LOCUS_11390 6317 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 7293 7910 gene locus_tag LOCUS_11400 7293 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_11400 7956 8807 gene locus_tag LOCUS_11410 7956 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8928 9110 gene locus_tag LOCUS_11420 8928 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence072 1022 534 gene locus_tag LOCUS_11430 gene greA 1022 534 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_11430 4355 1101 gene locus_tag LOCUS_11440 4355 1101 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_11440 5577 4342 gene locus_tag LOCUS_11450 gene carA 5577 4342 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DR8 protein_id gnl|my_center|LOCUS_11450 5733 6194 gene locus_tag LOCUS_11460 5733 6194 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_11460 6244 7902 gene locus_tag LOCUS_11470 6244 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence073 1215 280 gene locus_tag LOCUS_11480 1215 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1342 2238 gene locus_tag LOCUS_11490 1342 2238 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971315.1 protein_id gnl|my_center|LOCUS_11490 2303 3514 gene locus_tag LOCUS_11500 2303 3514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_11500 3570 4214 gene locus_tag LOCUS_11510 3570 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4301 5410 gene locus_tag LOCUS_11520 4301 5410 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_11520 5410 6246 gene locus_tag LOCUS_11530 5410 6246 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH14 protein_id gnl|my_center|LOCUS_11530 6292 7194 gene locus_tag LOCUS_11540 6292 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_11540 8213 7209 gene locus_tag LOCUS_11550 8213 7209 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_11550 <9137 8308 gene locus_tag LOCUS_11560 <9137 8308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q813A5:UPF0061 protein >Feature sequence074 1041 193 gene locus_tag LOCUS_11570 1041 193 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_11570 1119 1736 gene locus_tag LOCUS_11580 1119 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3817 1733 gene locus_tag LOCUS_11590 gene recG 3817 1733 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PS7 protein_id gnl|my_center|LOCUS_11590 3867 4136 gene locus_tag LOCUS_11600 3867 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4133 7552 gene locus_tag LOCUS_11610 gene mfd 4133 7552 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC49 protein_id gnl|my_center|LOCUS_11610 8040 7549 gene locus_tag LOCUS_11620 8040 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 8737 8153 gene locus_tag LOCUS_11630 8737 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence075 <1 1173 gene locus_tag LOCUS_11640 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MFQ8:formate--tetrahydrofolate ligase 1181 1984 gene locus_tag LOCUS_11650 1181 1984 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919071.1 protein_id gnl|my_center|LOCUS_11650 2883 1981 gene locus_tag LOCUS_11660 2883 1981 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_11660 5450 2901 gene locus_tag LOCUS_11670 5450 2901 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531196.1 protein_id gnl|my_center|LOCUS_11670 7081 5492 gene locus_tag LOCUS_11680 gene pgi1 7081 5492 CDS product glucose-6-phosphate isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYX3 protein_id gnl|my_center|LOCUS_11680 7168 7995 gene locus_tag LOCUS_11690 7168 7995 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_11690 8867 7992 gene locus_tag LOCUS_11700 gene wcaG 8867 7992 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124185.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence076 1875 400 gene locus_tag LOCUS_11710 gene xseA 1875 400 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SR7 protein_id gnl|my_center|LOCUS_11710 2338 1877 gene locus_tag LOCUS_11720 gene codA 2338 1877 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ0 protein_id gnl|my_center|LOCUS_11720 2437 3171 gene locus_tag LOCUS_11730 2437 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3173 3730 gene locus_tag LOCUS_11740 3173 3730 CDS product methyltransferase small inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_11740 5533 3737 gene locus_tag LOCUS_11750 gene mutL 5533 3737 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC88 protein_id gnl|my_center|LOCUS_11750 6014 5550 gene locus_tag LOCUS_11760 6014 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6532 6059 gene locus_tag LOCUS_11770 gene lspA 6532 6059 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 protein_id gnl|my_center|LOCUS_11770 <8939 6546 gene locus_tag LOCUS_11780 <8939 6546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ34:isoleucine--tRNA ligase >Feature sequence077 652 1356 gene locus_tag LOCUS_11790 gene sfsA 652 1356 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4Z6 protein_id gnl|my_center|LOCUS_11790 1399 2190 gene locus_tag LOCUS_11800 gene map 1399 2190 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_11800 2445 2203 gene locus_tag LOCUS_11810 2445 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2544 3839 gene locus_tag LOCUS_11820 2544 3839 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K7 protein_id gnl|my_center|LOCUS_11820 3955 4188 gene locus_tag LOCUS_11830 3955 4188 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_11830 4202 4534 gene locus_tag LOCUS_11840 gene grlA 4202 4534 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 protein_id gnl|my_center|LOCUS_11840 5172 4543 gene locus_tag LOCUS_11850 gene rpsD 5172 4543 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ0 protein_id gnl|my_center|LOCUS_11850 6118 5321 gene locus_tag LOCUS_11860 gene trmJ 6118 5321 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD88 protein_id gnl|my_center|LOCUS_11860 7724 6123 gene locus_tag LOCUS_11870 7724 6123 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_11870 <8913 7809 gene locus_tag LOCUS_11880 <8913 7809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWK2:cysteine--tRNA ligase >Feature sequence078 651 250 gene locus_tag LOCUS_11890 651 250 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390319.1 protein_id gnl|my_center|LOCUS_11890 1915 656 gene locus_tag LOCUS_11900 gene csd 1915 656 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PL2 protein_id gnl|my_center|LOCUS_11900 3081 1918 gene locus_tag LOCUS_11910 3081 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3823 3071 gene locus_tag LOCUS_11920 3823 3071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087112.1 protein_id gnl|my_center|LOCUS_11920 5290 3839 gene locus_tag LOCUS_11930 5290 3839 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_11930 5828 5373 gene locus_tag LOCUS_11940 5828 5373 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_11940 6342 5962 gene locus_tag LOCUS_11950 6342 5962 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 protein_id gnl|my_center|LOCUS_11950 6549 6364 gene locus_tag LOCUS_11960 gene rpmF 6549 6364 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ26 protein_id gnl|my_center|LOCUS_11960 6812 6737 gene locus_tag LOCUS_t00120 6812 6737 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7723 6884 gene locus_tag LOCUS_11970 7723 6884 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455357.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence079 1935 892 gene locus_tag LOCUS_11980 1935 892 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929807.1 protein_id gnl|my_center|LOCUS_11980 2404 1940 gene locus_tag LOCUS_11990 gene trmL 2404 1940 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K199 protein_id gnl|my_center|LOCUS_11990 2763 2404 gene locus_tag LOCUS_12000 2763 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2853 3836 gene locus_tag LOCUS_12010 2853 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_12010 5248 3839 gene locus_tag LOCUS_12020 5248 3839 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085698.1 protein_id gnl|my_center|LOCUS_12020 5951 5484 gene locus_tag LOCUS_12030 5951 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6230 5952 gene locus_tag LOCUS_12040 6230 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6118 6726 gene locus_tag LOCUS_12050 6118 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7833 6718 gene locus_tag LOCUS_12060 7833 6718 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_12060 8208 8816 gene locus_tag LOCUS_12070 8208 8816 CDS product DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence080 115 846 gene locus_tag LOCUS_12080 115 846 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709723.1 protein_id gnl|my_center|LOCUS_12080 1972 893 gene locus_tag LOCUS_12090 gene nahG 1972 893 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337635.1 protein_id gnl|my_center|LOCUS_12090 2071 3021 gene locus_tag LOCUS_12100 gene iunH 2071 3021 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971730.1 protein_id gnl|my_center|LOCUS_12100 3944 3054 gene locus_tag LOCUS_12110 gene pyrF 3944 3054 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_12110 4224 3934 gene locus_tag LOCUS_12120 4224 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709340.1 protein_id gnl|my_center|LOCUS_12120 4387 4815 gene locus_tag LOCUS_12130 4387 4815 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_12130 6244 4817 gene locus_tag LOCUS_12140 6244 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_12140 6337 6765 gene locus_tag LOCUS_12150 gene sufE 6337 6765 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_12150 7714 6755 gene locus_tag LOCUS_12160 gene gbdR 7714 6755 CDS product protein GbdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence081 <1 1011 gene locus_tag LOCUS_12170 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TE96:fructose-1,6-bisphosphatase class 1 1087 3096 gene locus_tag LOCUS_12180 1087 3096 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE98 protein_id gnl|my_center|LOCUS_12180 3149 4213 gene locus_tag LOCUS_12190 3149 4213 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921083.1 protein_id gnl|my_center|LOCUS_12190 5206 4247 gene locus_tag LOCUS_12200 5206 4247 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_12200 5315 6220 gene locus_tag LOCUS_12210 gene dapA 5315 6220 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT80 protein_id gnl|my_center|LOCUS_12210 6235 6714 gene locus_tag LOCUS_12220 gene smpB 6235 6714 CDS product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT81 protein_id gnl|my_center|LOCUS_12220 7348 6698 gene locus_tag LOCUS_12230 7348 6698 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_12230 7454 7963 gene locus_tag LOCUS_12240 7454 7963 CDS product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence082 318 1556 gene locus_tag LOCUS_12250 318 1556 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061555.1 protein_id gnl|my_center|LOCUS_12250 1553 2461 gene locus_tag LOCUS_12260 1553 2461 CDS product chitin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765316.1 protein_id gnl|my_center|LOCUS_12260 2461 3468 gene locus_tag LOCUS_12270 gene alc1 2461 3468 CDS product putative allantoicase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T53 protein_id gnl|my_center|LOCUS_12270 3468 3980 gene locus_tag LOCUS_12280 gene allA 3468 3980 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_12280 3995 5407 gene locus_tag LOCUS_12290 3995 5407 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_12290 5407 7716 gene locus_tag LOCUS_12300 gene xdhB 5407 7716 CDS product xanthine dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence083 4913 3153 gene locus_tag LOCUS_12310 gene hxuB 4913 3153 CDS product hemolysin secretion protein ShlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214693.1 protein_id gnl|my_center|LOCUS_12310 5616 5050 gene locus_tag LOCUS_12320 5616 5050 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 protein_id gnl|my_center|LOCUS_12320 6737 5925 gene locus_tag LOCUS_12330 6737 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970001.1 protein_id gnl|my_center|LOCUS_12330 7761 6778 gene locus_tag LOCUS_12340 7761 6778 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence084 462 656 gene locus_tag LOCUS_12350 gene rpmC 462 656 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QG2 protein_id gnl|my_center|LOCUS_12350 660 914 gene locus_tag LOCUS_12360 gene rpsQ 660 914 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW9 protein_id gnl|my_center|LOCUS_12360 927 1295 gene locus_tag LOCUS_12370 gene rplN 927 1295 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 protein_id gnl|my_center|LOCUS_12370 1295 1609 gene locus_tag LOCUS_12380 gene rplX 1295 1609 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRH1 protein_id gnl|my_center|LOCUS_12380 1635 2180 gene locus_tag LOCUS_12390 gene rplE 1635 2180 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPP6 protein_id gnl|my_center|LOCUS_12390 2188 2493 gene locus_tag LOCUS_12400 gene rpsN 2188 2493 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIG1 protein_id gnl|my_center|LOCUS_12400 2513 2911 gene locus_tag LOCUS_12410 gene rpsH 2513 2911 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_12410 2922 3455 gene locus_tag LOCUS_12420 gene rplF 2922 3455 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYX4 protein_id gnl|my_center|LOCUS_12420 3468 3830 gene locus_tag LOCUS_12430 gene rplR 3468 3830 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX6 protein_id gnl|my_center|LOCUS_12430 3855 4400 gene locus_tag LOCUS_12440 gene rpsE 3855 4400 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA1 protein_id gnl|my_center|LOCUS_12440 4424 4633 gene locus_tag LOCUS_12450 gene rpmD 4424 4633 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 protein_id gnl|my_center|LOCUS_12450 4648 5124 gene locus_tag LOCUS_12460 gene rplO 4648 5124 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 protein_id gnl|my_center|LOCUS_12460 5149 6474 gene locus_tag LOCUS_12470 gene secY 5149 6474 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_12470 6471 7049 gene locus_tag LOCUS_12480 gene adk 6471 7049 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE31 protein_id gnl|my_center|LOCUS_12480 7096 7464 gene locus_tag LOCUS_12490 gene rpsM 7096 7464 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_12490 7475 7870 gene locus_tag LOCUS_12500 gene rpsK 7475 7870 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_12500 >Feature sequence085 <1 2116 gene locus_tag LOCUS_12510 <1 2116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89QJ5:glutamate-ammonia-ligase adenylyltransferase 2135 3079 gene locus_tag LOCUS_12520 2135 3079 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_12520 4544 3087 gene locus_tag LOCUS_12530 gene gatB 4544 3087 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH5 protein_id gnl|my_center|LOCUS_12530 6038 4563 gene locus_tag LOCUS_12540 gene gatA 6038 4563 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U819 protein_id gnl|my_center|LOCUS_12540 6322 6035 gene locus_tag LOCUS_12550 gene gatC 6322 6035 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH3 protein_id gnl|my_center|LOCUS_12550 6376 6858 gene locus_tag LOCUS_12560 6376 6858 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QL0 protein_id gnl|my_center|LOCUS_12560 6845 7795 gene locus_tag LOCUS_12570 gene pyrB 6845 7795 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFT9 protein_id gnl|my_center|LOCUS_12570 >Feature sequence086 2434 1073 gene locus_tag LOCUS_12580 gene tilS 2434 1073 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZEA3 protein_id gnl|my_center|LOCUS_12580 3668 2427 gene locus_tag LOCUS_12590 3668 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4390 3800 gene locus_tag LOCUS_12600 4390 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5957 4617 gene locus_tag LOCUS_12610 gene tolB 5957 4617 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_12610 7084 5990 gene locus_tag LOCUS_12620 7084 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7502 7074 gene locus_tag LOCUS_12630 7502 7074 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066848.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence087 562 32 gene locus_tag LOCUS_12640 gene HPRT 562 32 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719939.1 protein_id gnl|my_center|LOCUS_12640 803 2170 gene locus_tag LOCUS_12650 803 2170 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_12650 2177 3010 gene locus_tag LOCUS_12660 gene ureD 2177 3010 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U544 protein_id gnl|my_center|LOCUS_12660 3014 3316 gene locus_tag LOCUS_12670 gene ureA 3014 3316 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCS6 protein_id gnl|my_center|LOCUS_12670 3328 3636 gene locus_tag LOCUS_12680 gene ureB 3328 3636 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J151 protein_id gnl|my_center|LOCUS_12680 3651 5357 gene locus_tag LOCUS_12690 gene ureC 3651 5357 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH9 protein_id gnl|my_center|LOCUS_12690 5357 5803 gene locus_tag LOCUS_12700 gene ureE 5357 5803 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGI0 protein_id gnl|my_center|LOCUS_12700 5809 6489 gene locus_tag LOCUS_12710 gene ureF 5809 6489 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UF8 protein_id gnl|my_center|LOCUS_12710 6486 7097 gene locus_tag LOCUS_12720 6486 7097 CDS product protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309354.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence088 <1 645 gene locus_tag LOCUS_12730 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530014.1:DNA-binding response regulator 647 1951 gene locus_tag LOCUS_12740 647 1951 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_12740 2291 1956 gene locus_tag LOCUS_12750 2291 1956 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_12750 2894 2295 gene locus_tag LOCUS_12760 2894 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3729 2908 gene locus_tag LOCUS_12770 gene proC 3729 2908 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWW7 protein_id gnl|my_center|LOCUS_12770 4134 3802 gene locus_tag LOCUS_12780 4134 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4213 5028 gene locus_tag LOCUS_12790 gene lgt 4213 5028 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDB4 protein_id gnl|my_center|LOCUS_12790 5041 6129 gene locus_tag LOCUS_12800 5041 6129 CDS product succinate dehydrogenase [ubiquinone] iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599715.1 protein_id gnl|my_center|LOCUS_12800 6139 6900 gene locus_tag LOCUS_12810 6139 6900 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP8 protein_id gnl|my_center|LOCUS_12810 >Feature sequence089 1059 64 gene locus_tag LOCUS_12820 gene yhdH 1059 64 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148479.1 protein_id gnl|my_center|LOCUS_12820 1185 2417 gene locus_tag LOCUS_12830 1185 2417 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 protein_id gnl|my_center|LOCUS_12830 3721 2429 gene locus_tag LOCUS_12840 gene ordL 3721 2429 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 protein_id gnl|my_center|LOCUS_12840 3835 4761 gene locus_tag LOCUS_12850 3835 4761 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 protein_id gnl|my_center|LOCUS_12850 5575 4769 gene locus_tag LOCUS_12860 5575 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_12860 5646 6620 gene locus_tag LOCUS_12870 5646 6620 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 protein_id gnl|my_center|LOCUS_12870 <7754 6609 gene locus_tag LOCUS_12880 <7754 6609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706371.1:Bcr/CflA family drug resistance efflux transporter >Feature sequence090 960 694 gene locus_tag LOCUS_12890 gene fliQ 960 694 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720212.1 protein_id gnl|my_center|LOCUS_12890 1745 969 gene locus_tag LOCUS_12900 1745 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2087 1746 gene locus_tag LOCUS_12910 2087 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2569 2219 gene locus_tag LOCUS_12920 gene fliN 2569 2219 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U9 protein_id gnl|my_center|LOCUS_12920 3579 2593 gene locus_tag LOCUS_12930 gene fliM 3579 2593 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337962.1 protein_id gnl|my_center|LOCUS_12930 4227 3628 gene locus_tag LOCUS_12940 gene fliL 4227 3628 CDS product flagellar basal body protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720207.1 protein_id gnl|my_center|LOCUS_12940 5794 4268 gene locus_tag LOCUS_12950 5794 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6275 5868 gene locus_tag LOCUS_12960 6275 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 7607 6282 gene locus_tag LOCUS_12970 gene fliI 7607 6282 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337959.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence091 170 1393 gene locus_tag LOCUS_12980 170 1393 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_12980 1403 2071 gene locus_tag LOCUS_12990 1403 2071 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_12990 2107 3126 gene locus_tag LOCUS_13000 2107 3126 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_13000 3188 4099 gene locus_tag LOCUS_13010 3188 4099 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 protein_id gnl|my_center|LOCUS_13010 4096 5544 gene locus_tag LOCUS_13020 gene lcdH 4096 5544 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3B2 protein_id gnl|my_center|LOCUS_13020 5545 6306 gene locus_tag LOCUS_13030 gene dcaG 5545 6306 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206437.1 protein_id gnl|my_center|LOCUS_13030 6450 7451 gene locus_tag LOCUS_13040 6450 7451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence092 828 73 gene locus_tag LOCUS_13050 828 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1462 854 gene locus_tag LOCUS_13060 1462 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1616 3631 gene locus_tag LOCUS_13070 1616 3631 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088232.1 protein_id gnl|my_center|LOCUS_13070 4634 3633 gene locus_tag LOCUS_13080 4634 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 protein_id gnl|my_center|LOCUS_13080 5143 4664 gene locus_tag LOCUS_13090 5143 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970359.1 protein_id gnl|my_center|LOCUS_13090 5880 5140 gene locus_tag LOCUS_13100 5880 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6996 5902 gene locus_tag LOCUS_13110 6996 5902 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6L9 protein_id gnl|my_center|LOCUS_13110 7207 6998 gene locus_tag LOCUS_13120 7207 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence093 1889 6 gene locus_tag LOCUS_13130 1889 6 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_13130 1963 2808 gene locus_tag LOCUS_13140 1963 2808 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_13140 4205 2805 gene locus_tag LOCUS_13150 4205 2805 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 protein_id gnl|my_center|LOCUS_13150 4974 4282 gene locus_tag LOCUS_13160 4974 4282 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_13160 5139 6101 gene locus_tag LOCUS_13170 5139 6101 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931690.1 protein_id gnl|my_center|LOCUS_13170 6126 6563 gene locus_tag LOCUS_13180 6126 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence094 6351 2173 gene locus_tag LOCUS_13190 gene rpoB 6351 2173 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV3 protein_id gnl|my_center|LOCUS_13190 6846 6466 gene locus_tag LOCUS_13200 gene rplL 6846 6466 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 protein_id gnl|my_center|LOCUS_13200 7404 6901 gene locus_tag LOCUS_13210 gene rplJ 7404 6901 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence095 2565 1297 gene locus_tag LOCUS_13220 gene pdhC 2565 1297 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD20 protein_id gnl|my_center|LOCUS_13220 3913 2573 gene locus_tag LOCUS_13230 3913 2573 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_13230 4913 3918 gene locus_tag LOCUS_13240 gene pdhAa 4913 3918 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I9 protein_id gnl|my_center|LOCUS_13240 5345 5034 gene locus_tag LOCUS_13250 5345 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 6682 5411 gene locus_tag LOCUS_13260 gene eno 6682 5411 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DM31 protein_id gnl|my_center|LOCUS_13260 <7455 6692 gene locus_tag LOCUS_13270 <7455 6692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZE84:2-dehydro-3-deoxyphosphooctonate aldolase >Feature sequence096 257 940 gene locus_tag LOCUS_13280 gene nocM 257 940 CDS product nopaline transport system permease protein NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35113 protein_id gnl|my_center|LOCUS_13280 1057 2535 gene locus_tag LOCUS_13290 1057 2535 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_13290 2551 4245 gene locus_tag LOCUS_13300 2551 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027266.1 protein_id gnl|my_center|LOCUS_13300 4273 4854 gene locus_tag LOCUS_13310 4273 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5647 4961 gene locus_tag LOCUS_13320 5647 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6001 6417 gene locus_tag LOCUS_13330 6001 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence097 258 1124 gene locus_tag LOCUS_13340 258 1124 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_13340 1232 1156 gene locus_tag LOCUS_t00130 1232 1156 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3078 1309 gene locus_tag LOCUS_13350 3078 1309 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_13350 3231 4991 gene locus_tag LOCUS_13360 3231 4991 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529736.1 protein_id gnl|my_center|LOCUS_13360 4991 6355 gene locus_tag LOCUS_13370 4991 6355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence098 1668 298 gene locus_tag LOCUS_13380 gene trmFO 1668 298 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q15 protein_id gnl|my_center|LOCUS_13380 4561 1694 gene locus_tag LOCUS_13390 gene uvrA 4561 1694 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L46 protein_id gnl|my_center|LOCUS_13390 4673 5131 gene locus_tag LOCUS_13400 gene ssb 4673 5131 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAQ8 protein_id gnl|my_center|LOCUS_13400 >Feature sequence099 1366 1656 gene locus_tag LOCUS_13410 1366 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_13410 3507 1666 gene locus_tag LOCUS_13420 3507 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3687 4601 gene locus_tag LOCUS_13430 3687 4601 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP8 protein_id gnl|my_center|LOCUS_13430 4683 4946 gene locus_tag LOCUS_13440 4683 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 6577 4949 gene locus_tag LOCUS_13450 6577 4949 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence100 425 1588 gene locus_tag LOCUS_13460 gene yeaW 425 1588 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067835.1 protein_id gnl|my_center|LOCUS_13460 2160 1735 gene locus_tag LOCUS_13470 2160 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2872 2441 gene locus_tag LOCUS_13480 2872 2441 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_13480 3182 3445 gene locus_tag LOCUS_13490 3182 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4077 3586 gene locus_tag LOCUS_13500 4077 3586 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 protein_id gnl|my_center|LOCUS_13500 4679 4873 gene locus_tag LOCUS_13510 4679 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4881 6248 gene locus_tag LOCUS_13520 4881 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6306 6617 gene locus_tag LOCUS_13530 6306 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence101 873 79 gene locus_tag LOCUS_13540 873 79 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_13540 1448 879 gene locus_tag LOCUS_13550 gene efp 1448 879 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_13550 1625 1807 gene locus_tag LOCUS_13560 1625 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1820 2140 gene locus_tag LOCUS_13570 1820 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2334 2912 gene locus_tag LOCUS_13580 2334 2912 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCU6 protein_id gnl|my_center|LOCUS_13580 2932 3735 gene locus_tag LOCUS_13590 2932 3735 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_13590 3807 4550 gene locus_tag LOCUS_13600 3807 4550 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U83 protein_id gnl|my_center|LOCUS_13600 4583 5134 gene locus_tag LOCUS_13610 gene ruvC 4583 5134 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G6 protein_id gnl|my_center|LOCUS_13610 5148 5750 gene locus_tag LOCUS_13620 gene ruvA 5148 5750 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K5 protein_id gnl|my_center|LOCUS_13620 5757 6794 gene locus_tag LOCUS_13630 gene ruvB 5757 6794 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 protein_id gnl|my_center|LOCUS_13630 >Feature sequence102 <1 975 gene locus_tag LOCUS_13640 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RT17:2-isopropylmalate synthase 3381 976 gene locus_tag LOCUS_13650 gene pheT 3381 976 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SS9 protein_id gnl|my_center|LOCUS_13650 4454 3381 gene locus_tag LOCUS_13660 gene pheS 4454 3381 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_13660 4817 4464 gene locus_tag LOCUS_13670 gene rplT 4817 4464 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_13670 5099 4830 gene locus_tag LOCUS_13680 5099 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5747 5160 gene locus_tag LOCUS_13690 gene infC 5747 5160 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_13690 6711 5722 gene locus_tag LOCUS_13700 6711 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence103 216 1037 gene locus_tag LOCUS_13710 216 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 protein_id gnl|my_center|LOCUS_13710 1116 1322 gene locus_tag LOCUS_13720 1116 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1403 3166 gene locus_tag LOCUS_13730 gene aspS 1403 3166 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 protein_id gnl|my_center|LOCUS_13730 3754 3185 gene locus_tag LOCUS_13740 3754 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4351 5397 gene locus_tag LOCUS_13750 4351 5397 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HV6 protein_id gnl|my_center|LOCUS_13750 5535 5822 gene locus_tag LOCUS_13760 gene groS 5535 5822 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV5 protein_id gnl|my_center|LOCUS_13760 >Feature sequence104 98 583 gene locus_tag LOCUS_13770 98 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1381 680 gene locus_tag LOCUS_13780 1381 680 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535109.1 protein_id gnl|my_center|LOCUS_13780 3088 1424 gene locus_tag LOCUS_13790 gene ilvG 3088 1424 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969768.1 protein_id gnl|my_center|LOCUS_13790 3751 3203 gene locus_tag LOCUS_13800 3751 3203 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_13800 3869 4534 gene locus_tag LOCUS_13810 3869 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5426 4521 gene locus_tag LOCUS_13820 5426 4521 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877777.1 protein_id gnl|my_center|LOCUS_13820 6053 5457 gene locus_tag LOCUS_13830 6053 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence105 3223 2615 gene locus_tag LOCUS_13840 3223 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4591 3224 gene locus_tag LOCUS_13850 gene rsaFb 4591 3224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_13850 5293 4637 gene locus_tag LOCUS_13860 5293 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5552 5319 gene locus_tag LOCUS_13870 5552 5319 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYS0 protein_id gnl|my_center|LOCUS_13870 5900 5697 gene locus_tag LOCUS_13880 5900 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence106 1808 528 gene locus_tag LOCUS_13890 gene serS 1808 528 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH5 protein_id gnl|my_center|LOCUS_13890 2632 1826 gene locus_tag LOCUS_13900 gene tatC 2632 1826 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_13900 3097 2633 gene locus_tag LOCUS_13910 3097 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3327 3118 gene locus_tag LOCUS_13920 gene tatA 3327 3118 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBT9 protein_id gnl|my_center|LOCUS_13920 4499 3435 gene locus_tag LOCUS_13930 4499 3435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_13930 5125 4526 gene locus_tag LOCUS_13940 5125 4526 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB5 protein_id gnl|my_center|LOCUS_13940 5901 5137 gene locus_tag LOCUS_13950 5901 5137 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence107 142 921 gene locus_tag LOCUS_13960 gene fadB 142 921 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_13960 2269 929 gene locus_tag LOCUS_13970 2269 929 CDS product MCD, Malonyl-CoA decarboxylase MCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706350.1 protein_id gnl|my_center|LOCUS_13970 3058 2273 gene locus_tag LOCUS_13980 3058 2273 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969806.1 protein_id gnl|my_center|LOCUS_13980 4272 3112 gene locus_tag LOCUS_13990 4272 3112 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708683.1 protein_id gnl|my_center|LOCUS_13990 4435 6081 gene locus_tag LOCUS_14000 4435 6081 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence108 <1 905 gene locus_tag LOCUS_14010 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339381.1:ABC transporter permease 892 2523 gene locus_tag LOCUS_14020 892 2523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_14020 3688 2513 gene locus_tag LOCUS_14030 3688 2513 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_14030 3915 5525 gene locus_tag LOCUS_14040 3915 5525 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence109 <1 886 gene locus_tag LOCUS_14050 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J1K8:3-hydroxyisobutyrate dehydrogenase 1052 1753 gene locus_tag LOCUS_14060 1052 1753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971130.1 protein_id gnl|my_center|LOCUS_14060 1886 2728 gene locus_tag LOCUS_14070 1886 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 protein_id gnl|my_center|LOCUS_14070 2828 3409 gene locus_tag LOCUS_14080 2828 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3402 4169 gene locus_tag LOCUS_14090 3402 4169 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_14090 5468 4185 gene locus_tag LOCUS_14100 gene dinB 5468 4185 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7Z8 protein_id gnl|my_center|LOCUS_14100 >Feature sequence110 526 230 gene locus_tag LOCUS_14110 526 230 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 protein_id gnl|my_center|LOCUS_14110 627 1838 gene locus_tag LOCUS_14120 gene argG 627 1838 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXL9 protein_id gnl|my_center|LOCUS_14120 2459 1866 gene locus_tag LOCUS_14130 gene recR 2459 1866 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF23 protein_id gnl|my_center|LOCUS_14130 2795 2469 gene locus_tag LOCUS_14140 2795 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4567 2792 gene locus_tag LOCUS_14150 gene dnaX 4567 2792 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_14150 5579 4701 gene locus_tag LOCUS_14160 gene pheA 5579 4701 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_14160 <6360 5604 gene locus_tag LOCUS_14170 <6360 5604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPI7:3-deoxy-manno-octulosonate cytidylyltransferase >Feature sequence111 461 1372 gene locus_tag LOCUS_14180 461 1372 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_14180 3261 1399 gene locus_tag LOCUS_14190 3261 1399 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X7 protein_id gnl|my_center|LOCUS_14190 3318 4106 gene locus_tag LOCUS_14200 gene tpiA 3318 4106 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT6 protein_id gnl|my_center|LOCUS_14200 4168 4482 gene locus_tag LOCUS_14210 4168 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4540 6168 gene locus_tag LOCUS_14220 gene pyrG 4540 6168 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT58 protein_id gnl|my_center|LOCUS_14220 >Feature sequence112 2157 1789 gene locus_tag LOCUS_14230 gene sdhD 2157 1789 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_14230 2576 2169 gene locus_tag LOCUS_14240 2576 2169 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_14240 2740 4359 gene locus_tag LOCUS_14250 2740 4359 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529479.1 protein_id gnl|my_center|LOCUS_14250 5845 4367 gene locus_tag LOCUS_14260 gene puuC 5845 4367 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071494.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence113 592 188 gene locus_tag LOCUS_14270 592 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1004 579 gene locus_tag LOCUS_14280 gene gspG 1004 579 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_14280 2203 1013 gene locus_tag LOCUS_14290 2203 1013 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479682.1 protein_id gnl|my_center|LOCUS_14290 3651 2203 gene locus_tag LOCUS_14300 gene pulE 3651 2203 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918063.1 protein_id gnl|my_center|LOCUS_14300 5598 3661 gene locus_tag LOCUS_14310 gene xcpQ 5598 3661 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_14310 >Feature sequence114 1962 706 gene locus_tag LOCUS_14320 gene lysA 1962 706 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_14320 2162 1959 gene locus_tag LOCUS_14330 2162 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3510 2098 gene locus_tag LOCUS_14340 gene argH 3510 2098 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9L6 protein_id gnl|my_center|LOCUS_14340 3559 4104 gene locus_tag LOCUS_14350 3559 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4945 4109 gene locus_tag LOCUS_14360 4945 4109 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_14360 5784 4942 gene locus_tag LOCUS_14370 5784 4942 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence115 1901 825 gene locus_tag LOCUS_14380 gene prfA 1901 825 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD21 protein_id gnl|my_center|LOCUS_14380 3122 1902 gene locus_tag LOCUS_14390 gene hisS 3122 1902 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_14390 4268 3198 gene locus_tag LOCUS_14400 gene ispG 4268 3198 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 protein_id gnl|my_center|LOCUS_14400 5432 4377 gene locus_tag LOCUS_14410 gene guaC 5432 4377 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMW9 protein_id gnl|my_center|LOCUS_14410 >Feature sequence116 <1 693 gene locus_tag LOCUS_14420 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971394.1:4-amino-4-deoxychorismate lyase 711 1343 gene locus_tag LOCUS_14430 gene gmk 711 1343 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_14430 2217 1357 gene locus_tag LOCUS_14440 gene rsmA 2217 1357 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9C2 protein_id gnl|my_center|LOCUS_14440 3494 2226 gene locus_tag LOCUS_14450 3494 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4614 3520 gene locus_tag LOCUS_14460 4614 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5697 4618 gene locus_tag LOCUS_14470 5697 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence117 733 56 gene locus_tag LOCUS_14480 gene trmB 733 56 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID4 protein_id gnl|my_center|LOCUS_14480 1944 751 gene locus_tag LOCUS_14490 gene metK2 1944 751 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_14490 3535 1994 gene locus_tag LOCUS_14500 gene lnt 3535 1994 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDG3 protein_id gnl|my_center|LOCUS_14500 4388 3522 gene locus_tag LOCUS_14510 4388 3522 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_14510 4922 4395 gene locus_tag LOCUS_14520 gene ybeY 4922 4395 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05960 protein_id gnl|my_center|LOCUS_14520 5895 4930 gene locus_tag LOCUS_14530 5895 4930 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence118 227 703 gene locus_tag LOCUS_14540 227 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1507 827 gene locus_tag LOCUS_14550 1507 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1735 2772 gene locus_tag LOCUS_14560 1735 2772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097420.1 protein_id gnl|my_center|LOCUS_14560 <6040 2779 gene locus_tag LOCUS_14570 <6040 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889758.1:membrane protein >Feature sequence119 <1 536 gene locus_tag LOCUS_14580 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940717.1:DUF159 family protein 1200 529 gene locus_tag LOCUS_14590 gene alkA 1200 529 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_14590 1314 1877 gene locus_tag LOCUS_14600 1314 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2278 1874 gene locus_tag LOCUS_14610 2278 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3307 2288 gene locus_tag LOCUS_14620 gene galM 3307 2288 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_14620 3674 3318 gene locus_tag LOCUS_14630 3674 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5566 3731 gene locus_tag LOCUS_14640 5566 3731 CDS product adenylylsulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence120 82 525 gene locus_tag LOCUS_14650 82 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 582 1985 gene locus_tag LOCUS_14660 gene leuC 582 1985 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L76 protein_id gnl|my_center|LOCUS_14660 2023 2628 gene locus_tag LOCUS_14670 gene leuD 2023 2628 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X27 protein_id gnl|my_center|LOCUS_14670 2662 3771 gene locus_tag LOCUS_14680 gene leuB 2662 3771 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 protein_id gnl|my_center|LOCUS_14680 3791 4819 gene locus_tag LOCUS_14690 gene asd 3791 4819 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C356 protein_id gnl|my_center|LOCUS_14690 >Feature sequence121 <1 1009 gene locus_tag LOCUS_14700 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975446.1:NADH:flavin oxidoreductase 1122 2681 gene locus_tag LOCUS_14710 1122 2681 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931365.1 protein_id gnl|my_center|LOCUS_14710 2806 3744 gene locus_tag LOCUS_14720 2806 3744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815879.1 protein_id gnl|my_center|LOCUS_14720 3741 4664 gene locus_tag LOCUS_14730 3741 4664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040761.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence122 430 1671 gene locus_tag LOCUS_14740 430 1671 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_14740 1692 2993 gene locus_tag LOCUS_14750 1692 2993 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_14750 3025 4014 gene locus_tag LOCUS_14760 gene acoA 3025 4014 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921304.1 protein_id gnl|my_center|LOCUS_14760 4047 5039 gene locus_tag LOCUS_14770 4047 5039 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence123 2211 367 gene locus_tag LOCUS_14780 2211 367 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039705.1 protein_id gnl|my_center|LOCUS_14780 3005 2211 gene locus_tag LOCUS_14790 gene livF 3005 2211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063643.1 protein_id gnl|my_center|LOCUS_14790 4230 3022 gene locus_tag LOCUS_14800 gene livK 4230 3022 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_14800 5350 4283 gene locus_tag LOCUS_14810 gene livM 5350 4283 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence124 210 1370 gene locus_tag LOCUS_14820 gene torF 210 1370 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337955.1 protein_id gnl|my_center|LOCUS_14820 1381 1701 gene locus_tag LOCUS_14830 1381 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1723 3456 gene locus_tag LOCUS_14840 gene fliF1 1723 3456 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V7 protein_id gnl|my_center|LOCUS_14840 3514 4554 gene locus_tag LOCUS_14850 gene fliG 3514 4554 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V6 protein_id gnl|my_center|LOCUS_14850 >Feature sequence125 1895 642 gene locus_tag LOCUS_14860 1895 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2099 3346 gene locus_tag LOCUS_14870 2099 3346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_14870 3441 4250 gene locus_tag LOCUS_14880 3441 4250 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531888.1 protein_id gnl|my_center|LOCUS_14880 4675 4262 gene locus_tag LOCUS_14890 4675 4262 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339404.1 protein_id gnl|my_center|LOCUS_14890 <5576 4754 gene locus_tag LOCUS_14900 <5576 4754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970367.1:tungsten ABC transporter substrate-binding protein >Feature sequence126 305 1129 gene locus_tag LOCUS_14910 305 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_14910 1944 1126 gene locus_tag LOCUS_14920 1944 1126 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086437.1 protein_id gnl|my_center|LOCUS_14920 2046 2837 gene locus_tag LOCUS_14930 2046 2837 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530406.1 protein_id gnl|my_center|LOCUS_14930 3837 2839 gene locus_tag LOCUS_14940 3837 2839 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_14940 3928 4491 gene locus_tag LOCUS_14950 3928 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4511 5290 gene locus_tag LOCUS_14960 4511 5290 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence127 1537 260 gene locus_tag LOCUS_14970 gene proA 1537 260 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_14970 2694 1558 gene locus_tag LOCUS_14980 gene proB 2694 1558 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS0 protein_id gnl|my_center|LOCUS_14980 3784 2765 gene locus_tag LOCUS_14990 gene obg 3784 2765 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_14990 4124 3855 gene locus_tag LOCUS_15000 gene rpmA 4124 3855 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_15000 4677 4159 gene locus_tag LOCUS_15010 4677 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5350 4883 gene locus_tag LOCUS_15020 gene nodN 5350 4883 CDS product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence128 <1 1480 gene locus_tag LOCUS_15030 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102294.1:selenocysteine-specific translation factor 1524 1617 gene locus_tag LOCUS_t00140 1524 1617 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2283 1681 gene locus_tag LOCUS_15040 2283 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2471 2926 gene locus_tag LOCUS_15050 2471 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3062 3706 gene locus_tag LOCUS_15060 3062 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4921 3719 gene locus_tag LOCUS_15070 4921 3719 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence129 194 1765 gene locus_tag LOCUS_15080 194 1765 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_15080 1778 2890 gene locus_tag LOCUS_15090 1778 2890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 protein_id gnl|my_center|LOCUS_15090 2890 3861 gene locus_tag LOCUS_15100 2890 3861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709923.1 protein_id gnl|my_center|LOCUS_15100 3863 4282 gene locus_tag LOCUS_15110 3863 4282 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067542.1 protein_id gnl|my_center|LOCUS_15110 4393 5181 gene locus_tag LOCUS_15120 gene legD1 4393 5181 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_15120 5260 5335 gene locus_tag LOCUS_t00150 5260 5335 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 284 739 gene locus_tag LOCUS_15130 284 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 876 3431 gene locus_tag LOCUS_15140 gene clpB 876 3431 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ2 protein_id gnl|my_center|LOCUS_15140 4816 3434 gene locus_tag LOCUS_15150 4816 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence131 513 2315 gene locus_tag LOCUS_15160 513 2315 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338427.1 protein_id gnl|my_center|LOCUS_15160 2324 3433 gene locus_tag LOCUS_15170 2324 3433 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720885.1 protein_id gnl|my_center|LOCUS_15170 3433 4539 gene locus_tag LOCUS_15180 3433 4539 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561816.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence132 826 584 gene locus_tag LOCUS_15190 gene hfq 826 584 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR1 protein_id gnl|my_center|LOCUS_15190 2273 894 gene locus_tag LOCUS_15200 gene trkA 2273 894 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_15200 3652 2297 gene locus_tag LOCUS_15210 3652 2297 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_15210 <5303 3675 gene locus_tag LOCUS_15220 <5303 3675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389369.1:PAS domain-containing sensor histidine kinase >Feature sequence133 500 2032 gene locus_tag LOCUS_15230 500 2032 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531650.1 protein_id gnl|my_center|LOCUS_15230 2029 3123 gene locus_tag LOCUS_15240 2029 3123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_15240 3116 4027 gene locus_tag LOCUS_15250 3116 4027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314292.1 protein_id gnl|my_center|LOCUS_15250 4167 5234 gene locus_tag LOCUS_15260 4167 5234 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence134 2196 634 gene locus_tag LOCUS_15270 gene secD 2196 634 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 protein_id gnl|my_center|LOCUS_15270 2546 2229 gene locus_tag LOCUS_15280 2546 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2649 3539 gene locus_tag LOCUS_15290 2649 3539 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_15290 4185 3511 gene locus_tag LOCUS_15300 4185 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4865 4236 gene locus_tag LOCUS_15310 gene pcm 4865 4236 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E332 protein_id gnl|my_center|LOCUS_15310 >Feature sequence135 897 136 gene locus_tag LOCUS_15320 897 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2336 930 gene locus_tag LOCUS_15330 2336 930 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_15330 2527 2339 gene locus_tag LOCUS_15340 2527 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3180 2680 gene locus_tag LOCUS_15350 3180 2680 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_15350 3722 3177 gene locus_tag LOCUS_15360 3722 3177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_15360 5105 3768 gene locus_tag LOCUS_15370 5105 3768 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104356.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence136 <1 775 gene locus_tag LOCUS_15380 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704533.1:taurine dioxygenase 1845 772 gene locus_tag LOCUS_15390 1845 772 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 protein_id gnl|my_center|LOCUS_15390 2649 1897 gene locus_tag LOCUS_15400 2649 1897 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_15400 4116 2728 gene locus_tag LOCUS_15410 4116 2728 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339390.1 protein_id gnl|my_center|LOCUS_15410 4656 4210 gene locus_tag LOCUS_15420 4656 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4637 4867 gene locus_tag LOCUS_15430 4637 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence137 87 299 gene locus_tag LOCUS_15440 87 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 831 307 gene locus_tag LOCUS_15450 831 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2294 1053 gene locus_tag LOCUS_15460 gene phnA 2294 1053 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_15460 3739 2327 gene locus_tag LOCUS_15470 3739 2327 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975823.1 protein_id gnl|my_center|LOCUS_15470 4961 3753 gene locus_tag LOCUS_15480 gene phnW 4961 3753 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UV9 protein_id gnl|my_center|LOCUS_15480 >Feature sequence138 131 2674 gene locus_tag LOCUS_15490 gene topA 131 2674 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE8 protein_id gnl|my_center|LOCUS_15490 2752 2919 gene locus_tag LOCUS_15500 gene rpmG 2752 2919 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 protein_id gnl|my_center|LOCUS_15500 2926 3840 gene locus_tag LOCUS_15510 2926 3840 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219311.1 protein_id gnl|my_center|LOCUS_15510 4541 3837 gene locus_tag LOCUS_15520 4541 3837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence139 1591 1175 gene locus_tag LOCUS_15530 1591 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2059 3645 gene locus_tag LOCUS_15540 2059 3645 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_15540 <4996 3651 gene locus_tag LOCUS_15550 <4996 3651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RYB8:chaperone protein HtpG >Feature sequence140 793 131 gene locus_tag LOCUS_15560 793 131 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_15560 1050 2849 gene locus_tag LOCUS_15570 1050 2849 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_15570 2856 3041 gene locus_tag LOCUS_15580 2856 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence141 230 952 gene locus_tag LOCUS_15590 230 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123114.1 protein_id gnl|my_center|LOCUS_15590 957 1580 gene locus_tag LOCUS_15600 957 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1720 3411 gene locus_tag LOCUS_15610 gene cyaC 1720 3411 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708995.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence142 2115 67 gene locus_tag LOCUS_15620 gene glyS 2115 67 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S69 protein_id gnl|my_center|LOCUS_15620 3004 2108 gene locus_tag LOCUS_15630 gene glyQ 3004 2108 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_15630 3253 3053 gene locus_tag LOCUS_15640 3253 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4080 3250 gene locus_tag LOCUS_15650 4080 3250 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532833.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence143 <1 178 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aacaagcccaacatatggcagg 750 965 gene locus_tag LOCUS_15660 750 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 970 1125 gene locus_tag LOCUS_15670 970 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2623 1127 gene locus_tag LOCUS_15680 2623 1127 CDS product 4-hydroxyphenylacetate 3-monooxygenase oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJP8 protein_id gnl|my_center|LOCUS_15680 3413 2925 gene locus_tag LOCUS_15690 3413 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3544 3900 gene locus_tag LOCUS_15700 3544 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4224 3955 gene locus_tag LOCUS_15710 4224 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4514 4602 gene locus_tag LOCUS_t00160 4514 4602 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 1531 1403 gene locus_tag LOCUS_15720 1531 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2023 1577 gene locus_tag LOCUS_15730 2023 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2994 2026 gene locus_tag LOCUS_15740 2994 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4006 3008 gene locus_tag LOCUS_15750 4006 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4569 4003 gene locus_tag LOCUS_15760 4569 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence145 532 870 gene locus_tag LOCUS_15770 532 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1025 1099 gene locus_tag LOCUS_t00170 1025 1099 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1128 3317 gene locus_tag LOCUS_15780 gene ndh 1128 3317 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_15780 3319 4362 gene locus_tag LOCUS_15790 3319 4362 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW76 protein_id gnl|my_center|LOCUS_15790 4417 4491 gene locus_tag LOCUS_t00180 4417 4491 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4727 4653 gene locus_tag LOCUS_t00190 4727 4653 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 <1 2226 gene locus_tag LOCUS_15800 <1 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQV4:DNA-directed RNA polymerase subunit beta' 2420 2791 gene locus_tag LOCUS_15810 gene rpsL 2420 2791 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 protein_id gnl|my_center|LOCUS_15810 2830 3300 gene locus_tag LOCUS_15820 gene rpsG 2830 3300 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV6 protein_id gnl|my_center|LOCUS_15820 >Feature sequence147 1 294 gene locus_tag LOCUS_15830 1 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 298 1428 gene locus_tag LOCUS_15840 298 1428 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886254.1 protein_id gnl|my_center|LOCUS_15840 2318 1425 gene locus_tag LOCUS_15850 2318 1425 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 protein_id gnl|my_center|LOCUS_15850 2407 3657 gene locus_tag LOCUS_15860 gene bacA 2407 3657 CDS product bacteroid development protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08120 protein_id gnl|my_center|LOCUS_15860 <4675 3668 gene locus_tag LOCUS_15870 <4675 3668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89LD7:bifunctional protein GlmU >Feature sequence148 1513 1148 gene locus_tag LOCUS_15880 1513 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15880 1709 2554 gene locus_tag LOCUS_15890 1709 2554 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK1 protein_id gnl|my_center|LOCUS_15890 2558 3790 gene locus_tag LOCUS_15900 gene argJ 2558 3790 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59610 protein_id gnl|my_center|LOCUS_15900 3790 4200 gene locus_tag LOCUS_15910 3790 4200 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709175.1 protein_id gnl|my_center|LOCUS_15910 4662 4204 gene locus_tag LOCUS_15920 4662 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence149 427 1725 gene locus_tag LOCUS_15930 427 1725 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_15930 2053 1727 gene locus_tag LOCUS_15940 2053 1727 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L8 protein_id gnl|my_center|LOCUS_15940 3567 2149 gene locus_tag LOCUS_15950 3567 2149 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082900.1 protein_id gnl|my_center|LOCUS_15950 4060 3602 gene locus_tag LOCUS_15960 4060 3602 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_15960 <4628 4057 gene locus_tag LOCUS_15970 <4628 4057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNQ7:adenosylhomocysteinase >Feature sequence150 1724 1131 gene locus_tag LOCUS_15980 gene pdxH 1724 1131 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Z5 protein_id gnl|my_center|LOCUS_15980 1883 2584 gene locus_tag LOCUS_15990 1883 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2677 3489 gene locus_tag LOCUS_16000 2677 3489 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T839 protein_id gnl|my_center|LOCUS_16000 3498 4580 gene locus_tag LOCUS_16010 gene aroC 3498 4580 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0R6 protein_id gnl|my_center|LOCUS_16010 >Feature sequence151 1031 216 gene locus_tag LOCUS_16020 1031 216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 protein_id gnl|my_center|LOCUS_16020 2097 1105 gene locus_tag LOCUS_16030 2097 1105 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384631.1 protein_id gnl|my_center|LOCUS_16030 3140 2397 gene locus_tag LOCUS_16040 3140 2397 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086078.1 protein_id gnl|my_center|LOCUS_16040 3324 4103 gene locus_tag LOCUS_16050 3324 4103 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086104.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence152 954 1766 gene locus_tag LOCUS_16060 954 1766 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893826.1 protein_id gnl|my_center|LOCUS_16060 1913 3304 gene locus_tag LOCUS_16070 1913 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3315 4028 gene locus_tag LOCUS_16080 3315 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 <4599 4025 gene locus_tag LOCUS_16090 <4599 4025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085824.1:oxidoreductase >Feature sequence153 1017 397 gene locus_tag LOCUS_16100 1017 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2756 1017 gene locus_tag LOCUS_16110 gene argS 2756 1017 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3V3 protein_id gnl|my_center|LOCUS_16110 3871 2756 gene locus_tag LOCUS_16120 3871 2756 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J2 protein_id gnl|my_center|LOCUS_16120 4036 4380 gene locus_tag LOCUS_16130 4036 4380 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence154 <1 1040 gene locus_tag LOCUS_16140 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064349.1:serine/threonine dehydratase 1052 2230 gene locus_tag LOCUS_16150 1052 2230 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533146.1 protein_id gnl|my_center|LOCUS_16150 2258 4003 gene locus_tag LOCUS_16160 2258 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4011 4367 gene locus_tag LOCUS_16170 4011 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence155 <1 694 gene locus_tag LOCUS_16180 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C3D4:primosomal protein N' 813 1361 gene locus_tag LOCUS_16190 gene atpH 813 1361 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL30 protein_id gnl|my_center|LOCUS_16190 1365 2900 gene locus_tag LOCUS_16200 gene atpA 1365 2900 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S3 protein_id gnl|my_center|LOCUS_16200 2933 3826 gene locus_tag LOCUS_16210 gene atpG 2933 3826 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM2 protein_id gnl|my_center|LOCUS_16210 >Feature sequence156 110 1165 gene locus_tag LOCUS_16220 110 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1169 2527 gene locus_tag LOCUS_16230 1169 2527 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_16230 2659 2877 gene locus_tag LOCUS_16240 gene rpmE 2659 2877 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVH2 protein_id gnl|my_center|LOCUS_16240 <4441 2880 gene locus_tag LOCUS_16250 <4441 2880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974750.1:pyruvate, phosphate dikinase >Feature sequence157 <1 764 gene locus_tag LOCUS_16260 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92QV7:ribonuclease D 1457 777 gene locus_tag LOCUS_16270 1457 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2566 1454 gene locus_tag LOCUS_16280 2566 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3264 2848 gene locus_tag LOCUS_16290 gene ndk 3264 2848 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 protein_id gnl|my_center|LOCUS_16290 <4417 3346 gene locus_tag LOCUS_16300 <4417 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX86:putative cytosol aminopeptidase >Feature sequence158 <1 1524 gene locus_tag LOCUS_16310 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389064.1:3-hydroxyacyl-CoA dehydrogenase 1555 3186 gene locus_tag LOCUS_16320 1555 3186 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_16320 3226 3609 gene locus_tag LOCUS_16330 3226 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3646 4287 gene locus_tag LOCUS_16340 3646 4287 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528032.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence159 115 1062 gene locus_tag LOCUS_16350 115 1062 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404855.1 protein_id gnl|my_center|LOCUS_16350 1072 2592 gene locus_tag LOCUS_16360 gene metG 1072 2592 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_16360 2593 3399 gene locus_tag LOCUS_16370 2593 3399 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087286.1 protein_id gnl|my_center|LOCUS_16370 3402 4175 gene locus_tag LOCUS_16380 3402 4175 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087285.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence160 2551 917 gene locus_tag LOCUS_16390 2551 917 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_16390 3209 2523 gene locus_tag LOCUS_16400 3209 2523 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_16400 <4316 3302 gene locus_tag LOCUS_16410 <4316 3302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529547.1:DNA polymerase I >Feature sequence161 <1 1170 gene locus_tag LOCUS_16420 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXV5:protein translocase subunit SecA 1181 1657 gene locus_tag LOCUS_16430 1181 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_16430 2415 1669 gene locus_tag LOCUS_16440 gene ubiG 2415 1669 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XU2 protein_id gnl|my_center|LOCUS_16440 2512 3732 gene locus_tag LOCUS_16450 2512 3732 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_16450 >Feature sequence162 1225 356 gene locus_tag LOCUS_16460 1225 356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_16460 1317 2546 gene locus_tag LOCUS_16470 1317 2546 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391159.1 protein_id gnl|my_center|LOCUS_16470 2558 3046 gene locus_tag LOCUS_16480 2558 3046 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088243.1 protein_id gnl|my_center|LOCUS_16480 3127 3726 gene locus_tag LOCUS_16490 3127 3726 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence163 1023 2822 gene locus_tag LOCUS_16500 gene lepA 1023 2822 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BJ8 protein_id gnl|my_center|LOCUS_16500 3288 3377 gene locus_tag LOCUS_t00200 3288 3377 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence164 <1 814 gene locus_tag LOCUS_16510 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338426.1:peptide ABC transporter ATPase 970 1890 gene locus_tag LOCUS_16520 970 1890 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_16520 2905 1892 gene locus_tag LOCUS_16530 2905 1892 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975643.1 protein_id gnl|my_center|LOCUS_16530 3853 2933 gene locus_tag LOCUS_16540 3853 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence165 2150 834 gene locus_tag LOCUS_16550 2150 834 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704085.1 protein_id gnl|my_center|LOCUS_16550 3298 2156 gene locus_tag LOCUS_16560 3298 2156 CDS product alpha-glucoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706895.1 protein_id gnl|my_center|LOCUS_16560 4109 3288 gene locus_tag LOCUS_16570 4109 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence166 1367 1047 gene locus_tag LOCUS_16580 1367 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2458 1412 gene locus_tag LOCUS_16590 2458 1412 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 protein_id gnl|my_center|LOCUS_16590 3341 2451 gene locus_tag LOCUS_16600 3341 2451 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706548.1 protein_id gnl|my_center|LOCUS_16600 <4085 3414 gene locus_tag LOCUS_16610 <4085 3414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971233.1:ABC transporter substrate-binding protein >Feature sequence167 <1 614 gene locus_tag LOCUS_16620 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887787.1:fatty acid desaturase 648 2084 gene locus_tag LOCUS_16630 648 2084 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_16630 2093 2881 gene locus_tag LOCUS_16640 2093 2881 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887784.1 protein_id gnl|my_center|LOCUS_16640 3908 2898 gene locus_tag LOCUS_16650 3908 2898 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974500.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence168 <1 1241 gene locus_tag LOCUS_16660 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ABY6:lysine--tRNA ligase 2076 1234 gene locus_tag LOCUS_16670 gene ilvE 2076 1234 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312205.1 protein_id gnl|my_center|LOCUS_16670 2185 3210 gene locus_tag LOCUS_16680 gene pyrD 2185 3210 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VA7 protein_id gnl|my_center|LOCUS_16680 3279 3566 gene locus_tag LOCUS_16690 gene rpmB 3279 3566 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9V8 protein_id gnl|my_center|LOCUS_16690 >Feature sequence169 <1 757 gene locus_tag LOCUS_16700 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085104.1:NADH-quinone oxidoreductase subunit F 767 3511 gene locus_tag LOCUS_16710 767 3511 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence170 <1 2524 gene locus_tag LOCUS_16720 <1 2524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein 2524 3231 gene locus_tag LOCUS_16730 gene rlmE 2524 3231 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6F0 protein_id gnl|my_center|LOCUS_16730 >Feature sequence171 80 1084 gene locus_tag LOCUS_16740 80 1084 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JB7 protein_id gnl|my_center|LOCUS_16740 1090 1782 gene locus_tag LOCUS_16750 1090 1782 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_16750 1785 2498 gene locus_tag LOCUS_16760 1785 2498 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385290.1 protein_id gnl|my_center|LOCUS_16760 2499 2891 gene locus_tag LOCUS_16770 2499 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3605 2907 gene locus_tag LOCUS_16780 gene lipB 3605 2907 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UF44 protein_id gnl|my_center|LOCUS_16780 3667 3754 gene locus_tag LOCUS_t00210 3667 3754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 2063 915 gene locus_tag LOCUS_16790 2063 915 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529988.1 protein_id gnl|my_center|LOCUS_16790 2876 2289 gene locus_tag LOCUS_16800 gene msrA 2876 2289 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_16800 3596 2958 gene locus_tag LOCUS_16810 3596 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 >Feature sequence173 1144 1626 gene locus_tag LOCUS_16820 1144 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1630 2583 gene locus_tag LOCUS_16830 1630 2583 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 protein_id gnl|my_center|LOCUS_16830 3647 2580 gene locus_tag LOCUS_16840 3647 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence174 1547 903 gene locus_tag LOCUS_16850 gene soxD 1547 903 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086301.1 protein_id gnl|my_center|LOCUS_16850 2811 1531 gene locus_tag LOCUS_16860 gene soxC 2811 1531 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_16860 3153 2827 gene locus_tag LOCUS_16870 gene soxZ 3153 2827 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_16870 3633 3169 gene locus_tag LOCUS_16880 gene soxY 3633 3169 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence175 <1 920 gene locus_tag LOCUS_16890 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085877.1:MFS transporter 1121 1960 gene locus_tag LOCUS_16900 1121 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705215.1 protein_id gnl|my_center|LOCUS_16900 1960 2301 gene locus_tag LOCUS_16910 1960 2301 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 protein_id gnl|my_center|LOCUS_16910 2316 3107 gene locus_tag LOCUS_16920 2316 3107 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705213.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence176 3124 953 gene locus_tag LOCUS_16930 3124 953 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence177 967 83 gene locus_tag LOCUS_16940 967 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1720 977 gene locus_tag LOCUS_16950 1720 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1938 1717 gene locus_tag LOCUS_16960 1938 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2147 1935 gene locus_tag LOCUS_16970 2147 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3306 2140 gene locus_tag LOCUS_16980 gene flhB 3306 2140 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337964.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence178 <1 515 gene locus_tag LOCUS_16990 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MI21:ATP-dependent zinc metalloprotease FtsH 524 1627 gene locus_tag LOCUS_17000 524 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1723 3081 gene locus_tag LOCUS_17010 gene glmM 1723 3081 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABV3 protein_id gnl|my_center|LOCUS_17010 >Feature sequence179 <1 1297 gene locus_tag LOCUS_17020 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967298.1:guanylate cyclase 1533 1901 gene locus_tag LOCUS_17030 1533 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1976 2983 gene locus_tag LOCUS_17040 1976 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence180 1005 70 gene locus_tag LOCUS_17050 gene trxB 1005 70 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DQ9 protein_id gnl|my_center|LOCUS_17050 1676 1032 gene locus_tag LOCUS_17060 1676 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2464 1673 gene locus_tag LOCUS_17070 gene cobS 2464 1673 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWM3 protein_id gnl|my_center|LOCUS_17070 3489 2461 gene locus_tag LOCUS_17080 gene cobT 3489 2461 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3P6 protein_id gnl|my_center|LOCUS_17080 >Feature sequence181 772 924 gene locus_tag LOCUS_17090 772 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 935 2194 gene locus_tag LOCUS_17100 gene murA 935 2194 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZB1 protein_id gnl|my_center|LOCUS_17100 2191 2616 gene locus_tag LOCUS_17110 2191 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2694 3167 gene locus_tag LOCUS_17120 2694 3167 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J080 protein_id gnl|my_center|LOCUS_17120 >Feature sequence182 <1 1175 gene locus_tag LOCUS_17130 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXI4:isocitrate dehydrogenase [NADP] <3567 1204 gene locus_tag LOCUS_17140 <3567 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6U9N4:alanine--tRNA ligase >Feature sequence183 1116 526 gene locus_tag LOCUS_17150 1116 526 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_17150 1176 1439 gene locus_tag LOCUS_17160 1176 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2023 1448 gene locus_tag LOCUS_17170 2023 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_17170 3323 2064 gene locus_tag LOCUS_17180 3323 2064 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence184 1539 583 gene locus_tag LOCUS_17190 1539 583 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_17190 2828 1554 gene locus_tag LOCUS_17200 gene wbpA 2828 1554 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence185 <1 704 gene locus_tag LOCUS_17210 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389435.1:NADH-quinone oxidoreductase subunit F 721 2769 gene locus_tag LOCUS_17220 721 2769 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 protein_id gnl|my_center|LOCUS_17220 >Feature sequence186 170 1165 gene locus_tag LOCUS_17230 170 1165 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 protein_id gnl|my_center|LOCUS_17230 1182 2240 gene locus_tag LOCUS_17240 1182 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2262 3407 gene locus_tag LOCUS_17250 2262 3407 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence187 874 1314 gene locus_tag LOCUS_17260 874 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1879 1304 gene locus_tag LOCUS_17270 1879 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2054 2854 gene locus_tag LOCUS_17280 2054 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3036 2857 gene locus_tag LOCUS_17290 3036 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence188 1431 862 gene locus_tag LOCUS_17300 gene aroK 1431 862 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2I9 protein_id gnl|my_center|LOCUS_17300 1663 1800 gene locus_tag LOCUS_17310 1663 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence189 200 1273 gene locus_tag LOCUS_17320 200 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1281 1862 gene locus_tag LOCUS_17330 gene ynjF 1281 1862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 protein_id gnl|my_center|LOCUS_17330 1866 2267 gene locus_tag LOCUS_17340 gene msrB 1866 2267 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7W8 protein_id gnl|my_center|LOCUS_17340 3028 2264 gene locus_tag LOCUS_17350 3028 2264 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU90 protein_id gnl|my_center|LOCUS_17350 >Feature sequence190 1546 479 gene locus_tag LOCUS_17360 gene recA 1546 479 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_17360 2143 1670 gene locus_tag LOCUS_17370 gene dksA 2143 1670 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 protein_id gnl|my_center|LOCUS_17370 >Feature sequence191 682 607 gene locus_tag LOCUS_t00220 682 607 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 970 758 gene locus_tag LOCUS_17380 970 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2236 980 gene locus_tag LOCUS_17390 2236 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2816 2229 gene locus_tag LOCUS_17400 2816 2229 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 protein_id gnl|my_center|LOCUS_17400 3081 2863 gene locus_tag LOCUS_17410 gene infA 3081 2863 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX5 protein_id gnl|my_center|LOCUS_17410 >Feature sequence192 131 1411 gene locus_tag LOCUS_17420 131 1411 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_17420 1417 3207 gene locus_tag LOCUS_17430 1417 3207 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599075.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence193 695 1081 gene locus_tag LOCUS_17440 gene flgB 695 1081 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1S6 protein_id gnl|my_center|LOCUS_17440 1087 1503 gene locus_tag LOCUS_17450 gene flgC 1087 1503 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1S7 protein_id gnl|my_center|LOCUS_17450 1524 2219 gene locus_tag LOCUS_17460 gene flgD 1524 2219 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1S8 protein_id gnl|my_center|LOCUS_17460 >Feature sequence194 <3237 1033 gene locus_tag LOCUS_17470 <3237 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787585.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence195 1159 335 gene locus_tag LOCUS_17480 1159 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1298 1474 gene locus_tag LOCUS_17490 1298 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1590 2006 gene locus_tag LOCUS_17500 1590 2006 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920119.1 protein_id gnl|my_center|LOCUS_17500 2938 2030 gene locus_tag LOCUS_17510 2938 2030 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532051.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence196 745 65 gene locus_tag LOCUS_17520 745 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1574 747 gene locus_tag LOCUS_17530 1574 747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809983.1 protein_id gnl|my_center|LOCUS_17530 1720 2658 gene locus_tag LOCUS_17540 1720 2658 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_17540 >Feature sequence197 1461 505 gene locus_tag LOCUS_17550 1461 505 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_17550 1612 1980 gene locus_tag LOCUS_17560 gene rpsF 1612 1980 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZEA6 protein_id gnl|my_center|LOCUS_17560 2013 2267 gene locus_tag LOCUS_17570 gene rpsR 2013 2267 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVN5 protein_id gnl|my_center|LOCUS_17570 2283 3002 gene locus_tag LOCUS_17580 2283 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence198 <1 650 gene locus_tag LOCUS_17590 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ62:dihydroorotase 2268 652 gene locus_tag LOCUS_17600 2268 652 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I43 protein_id gnl|my_center|LOCUS_17600 2784 2275 gene locus_tag LOCUS_17610 2784 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708585.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence199 159 1181 gene locus_tag LOCUS_17620 gene rpoA 159 1181 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_17620 1203 1628 gene locus_tag LOCUS_17630 gene rplQ 1203 1628 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB04 protein_id gnl|my_center|LOCUS_17630 1710 3002 gene locus_tag LOCUS_17640 1710 3002 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence200 448 678 gene locus_tag LOCUS_17650 448 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 675 1421 gene locus_tag LOCUS_17660 675 1421 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020920.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence201 1473 64 gene locus_tag LOCUS_17670 1473 64 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 protein_id gnl|my_center|LOCUS_17670 1845 1507 gene locus_tag LOCUS_17680 gene glnB 1845 1507 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_17680 <2991 1971 gene locus_tag LOCUS_17690 <2991 1971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529745.1:aspartate aminotransferase >Feature sequence202 871 491 gene locus_tag LOCUS_17700 871 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 932 1327 gene locus_tag LOCUS_17710 gene fliS 932 1327 CDS product flagellar biosynthesis protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337948.1 protein_id gnl|my_center|LOCUS_17710 1324 1614 gene locus_tag LOCUS_17720 1324 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2732 1620 gene locus_tag LOCUS_17730 gene fleQ 2732 1620 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720220.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence203 2 196 gene locus_tag LOCUS_17740 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 204 1274 gene locus_tag LOCUS_17750 204 1274 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_17750 >Feature sequence204 <1 1006 gene locus_tag LOCUS_17760 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086709.1:N,N-dimethylformamidase 1146 1901 gene locus_tag LOCUS_17770 1146 1901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971130.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence205 581 1942 gene locus_tag LOCUS_17780 gene der 581 1942 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MZ0 protein_id gnl|my_center|LOCUS_17780 2637 1939 gene locus_tag LOCUS_17790 2637 1939 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence206 204 1097 gene locus_tag LOCUS_17800 204 1097 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYH8 protein_id gnl|my_center|LOCUS_17800 1894 1109 gene locus_tag LOCUS_17810 1894 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2104 1937 gene locus_tag LOCUS_17820 2104 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 <2859 2221 gene locus_tag LOCUS_17830 <2859 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040762.1:ABC transporter ATP-binding protein >Feature sequence207 1211 90 gene locus_tag LOCUS_17840 gene rlmN 1211 90 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWI1 protein_id gnl|my_center|LOCUS_17840 1713 1201 gene locus_tag LOCUS_17850 1713 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_17850 2415 1885 gene locus_tag LOCUS_17860 2415 1885 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence208 258 1313 gene locus_tag LOCUS_17870 258 1313 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_17870 1314 2294 gene locus_tag LOCUS_17880 1314 2294 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence209 1286 21 gene locus_tag LOCUS_17890 1286 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1952 1431 gene locus_tag LOCUS_17900 1952 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence210 479 1915 gene locus_tag LOCUS_17910 479 1915 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_17910 <2685 1918 gene locus_tag LOCUS_17920 <2685 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946906.1:HcpA family protein >Feature sequence211 289 984 gene locus_tag LOCUS_17930 289 984 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727772.1 protein_id gnl|my_center|LOCUS_17930 1044 2153 gene locus_tag LOCUS_17940 gene ord 1044 2153 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence212 894 625 gene locus_tag LOCUS_17950 894 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 842 1657 gene locus_tag LOCUS_17960 842 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2575 1652 gene locus_tag LOCUS_17970 2575 1652 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence213 1278 457 gene locus_tag LOCUS_17980 1278 457 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence214 2151 1108 gene locus_tag LOCUS_17990 2151 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence215 214 1323 gene locus_tag LOCUS_18000 214 1323 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence216 1771 500 gene locus_tag LOCUS_18010 1771 500 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 protein_id gnl|my_center|LOCUS_18010 2017 1787 gene locus_tag LOCUS_18020 gene acpP 2017 1787 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_18020 >Feature sequence217 365 1549 gene locus_tag LOCUS_18030 365 1549 CDS product aminopeptidase P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546421.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence218 619 1230 gene locus_tag LOCUS_18040 gene chpE 619 1230 CDS product chemotactic transduction protein ChpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87005 protein_id gnl|my_center|LOCUS_18040 >Feature sequence219 1327 296 gene locus_tag LOCUS_18050 gene yhjN 1327 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07568 protein_id gnl|my_center|LOCUS_18050 1440 2306 gene locus_tag LOCUS_18060 1440 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence220 1493 54 gene locus_tag LOCUS_18070 1493 54 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 protein_id gnl|my_center|LOCUS_18070 <2238 1480 gene locus_tag LOCUS_18080 <2238 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707854.1:ATPase >Feature sequence221 1189 1380 gene locus_tag LOCUS_18090 1189 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence222 1608 82 gene locus_tag LOCUS_18100 1608 82 CDS product 4-hydroxyphenylacetate 3-monooxygenase oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJP8 protein_id gnl|my_center|LOCUS_18100 2064 1744 gene locus_tag LOCUS_18110 2064 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence223 <1 945 gene locus_tag LOCUS_18120 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389063.1:acyl-CoA dehydrogenase >Feature sequence224 <1 683 gene locus_tag LOCUS_18130 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54420:asparagine synthetase [glutamine-hydrolyzing] 1 734 1786 gene locus_tag LOCUS_18140 734 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence225 136 222 gene locus_tag LOCUS_t00230 136 222 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 263 784 gene locus_tag LOCUS_18150 263 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061380.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence226 106 846 gene locus_tag LOCUS_18160 106 846 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_18160 853 1059 gene locus_tag LOCUS_18170 853 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 <1974 1056 gene locus_tag LOCUS_18180 <1974 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090615.1:2-hydroxyhepta-2,4-diene-1,7-dioate isomerase >Feature sequence227 >Feature sequence228 1354 413 gene locus_tag LOCUS_18190 gene accA 1354 413 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_18190 >Feature sequence229 1507 503 gene locus_tag LOCUS_18200 1507 503 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence230 >Feature sequence231 941 93 gene locus_tag LOCUS_18210 941 93 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_18210 1579 959 gene locus_tag LOCUS_18220 gene yrdC 1579 959 CDS product putative isochorismatase family protein YrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07081 protein_id gnl|my_center|LOCUS_18220 >Feature sequence232 337 1683 gene locus_tag LOCUS_18230 gene mnmE 337 1683 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WP4 protein_id gnl|my_center|LOCUS_18230 >Feature sequence233 >Feature sequence234 170 961 gene locus_tag LOCUS_18240 gene thyA 170 961 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_18240 962 1513 gene locus_tag LOCUS_18250 gene dfrA 962 1513 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC6 protein_id gnl|my_center|LOCUS_18250 >Feature sequence235 <1671 468 gene locus_tag LOCUS_18260 <1671 468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPF9:dihydroorotase >Feature sequence236 >Feature sequence237