>Feature sequence001 2436 106 gene locus_tag LOCUS_00010 2436 106 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_00010 3906 2437 gene locus_tag LOCUS_00020 3906 2437 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 protein_id gnl|my_center|LOCUS_00020 4270 3917 gene locus_tag LOCUS_00030 4270 3917 CDS product 5-hydroxyisourate hydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UG5 protein_id gnl|my_center|LOCUS_00030 4398 4910 gene locus_tag LOCUS_00040 4398 4910 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_00040 4925 6370 gene locus_tag LOCUS_00050 4925 6370 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 protein_id gnl|my_center|LOCUS_00050 7922 6420 gene locus_tag LOCUS_00060 gene mmsA 7922 6420 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970726.1 protein_id gnl|my_center|LOCUS_00060 8072 8974 gene locus_tag LOCUS_00070 8072 8974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 protein_id gnl|my_center|LOCUS_00070 9788 8985 gene locus_tag LOCUS_00080 9788 8985 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 protein_id gnl|my_center|LOCUS_00080 10278 9781 gene locus_tag LOCUS_00090 10278 9781 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_00090 11402 10434 gene locus_tag LOCUS_00100 11402 10434 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976302.1 protein_id gnl|my_center|LOCUS_00100 11558 12472 gene locus_tag LOCUS_00110 11558 12472 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976303.1 protein_id gnl|my_center|LOCUS_00110 12500 13981 gene locus_tag LOCUS_00120 gene lcdH 12500 13981 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3B2 protein_id gnl|my_center|LOCUS_00120 14026 15195 gene locus_tag LOCUS_00130 14026 15195 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976305.1 protein_id gnl|my_center|LOCUS_00130 15200 17233 gene locus_tag LOCUS_00140 15200 17233 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_00140 17250 18035 gene locus_tag LOCUS_00150 17250 18035 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528298.1 protein_id gnl|my_center|LOCUS_00150 18271 19074 gene locus_tag LOCUS_00160 gene caiD 18271 19074 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59395 protein_id gnl|my_center|LOCUS_00160 19082 20026 gene locus_tag LOCUS_00170 gene lcdH 19082 20026 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RX5 protein_id gnl|my_center|LOCUS_00170 20072 20956 gene locus_tag LOCUS_00180 20072 20956 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523151.1 protein_id gnl|my_center|LOCUS_00180 20973 22133 gene locus_tag LOCUS_00190 20973 22133 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976305.1 protein_id gnl|my_center|LOCUS_00190 22130 24220 gene locus_tag LOCUS_00200 22130 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114528.1 protein_id gnl|my_center|LOCUS_00200 25701 24217 gene locus_tag LOCUS_00210 25701 24217 CDS product carnitine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104137.1 protein_id gnl|my_center|LOCUS_00210 26849 25851 gene locus_tag LOCUS_00220 26849 25851 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267458.1 protein_id gnl|my_center|LOCUS_00220 27892 26846 gene locus_tag LOCUS_00230 27892 26846 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708355.1 protein_id gnl|my_center|LOCUS_00230 28778 27885 gene locus_tag LOCUS_00240 28778 27885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707374.1 protein_id gnl|my_center|LOCUS_00240 29844 28840 gene locus_tag LOCUS_00250 29844 28840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 protein_id gnl|my_center|LOCUS_00250 30851 30117 gene locus_tag LOCUS_00260 30851 30117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_00260 31101 32531 gene locus_tag LOCUS_00270 gene betB 31101 32531 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN4 protein_id gnl|my_center|LOCUS_00270 33690 32533 gene locus_tag LOCUS_00280 33690 32533 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143702.1 protein_id gnl|my_center|LOCUS_00280 34150 33680 gene locus_tag LOCUS_00290 34150 33680 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535303.1 protein_id gnl|my_center|LOCUS_00290 34521 35318 gene locus_tag LOCUS_00300 34521 35318 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970829.1 protein_id gnl|my_center|LOCUS_00300 36157 35327 gene locus_tag LOCUS_00310 gene trmH 36157 35327 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970830.1 protein_id gnl|my_center|LOCUS_00310 36385 37374 gene locus_tag LOCUS_00320 36385 37374 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 protein_id gnl|my_center|LOCUS_00320 37829 37416 gene locus_tag LOCUS_00330 37829 37416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 protein_id gnl|my_center|LOCUS_00330 40035 37864 gene locus_tag LOCUS_00340 40035 37864 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920232.1 protein_id gnl|my_center|LOCUS_00340 41753 40035 gene locus_tag LOCUS_00350 41753 40035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41902 43323 gene locus_tag LOCUS_00360 41902 43323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43769 43329 gene locus_tag LOCUS_00370 43769 43329 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367574.1 protein_id gnl|my_center|LOCUS_00370 43984 44289 gene locus_tag LOCUS_00380 43984 44289 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089871.1 protein_id gnl|my_center|LOCUS_00380 44307 44558 gene locus_tag LOCUS_00390 44307 44558 CDS product UPF0335 protein R02793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M59 protein_id gnl|my_center|LOCUS_00390 44579 45478 gene locus_tag LOCUS_00400 gene pyrF 44579 45478 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA4 protein_id gnl|my_center|LOCUS_00400 45645 46190 gene locus_tag LOCUS_00410 45645 46190 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537601.1 protein_id gnl|my_center|LOCUS_00410 46250 47473 gene locus_tag LOCUS_00420 46250 47473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 protein_id gnl|my_center|LOCUS_00420 48418 47474 gene locus_tag LOCUS_00430 gene trxB1 48418 47474 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W175 protein_id gnl|my_center|LOCUS_00430 48504 49394 gene locus_tag LOCUS_00440 48504 49394 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_00440 49403 50281 gene locus_tag LOCUS_00450 49403 50281 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_00450 51339 50278 gene locus_tag LOCUS_00460 51339 50278 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532055.1 protein_id gnl|my_center|LOCUS_00460 52322 51369 gene locus_tag LOCUS_00470 gene fbp 52322 51369 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE96 protein_id gnl|my_center|LOCUS_00470 53118 52399 gene locus_tag LOCUS_00480 53118 52399 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970505.1 protein_id gnl|my_center|LOCUS_00480 54319 53186 gene locus_tag LOCUS_00490 gene rlmN 54319 53186 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP22 protein_id gnl|my_center|LOCUS_00490 54813 54316 gene locus_tag LOCUS_00500 54813 54316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_00500 55795 55112 gene locus_tag LOCUS_00510 55795 55112 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_00510 56022 56750 gene locus_tag LOCUS_00520 56022 56750 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence002 699 1703 gene locus_tag LOCUS_00530 699 1703 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085923.1 protein_id gnl|my_center|LOCUS_00530 3042 1948 gene locus_tag LOCUS_00540 3042 1948 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925860.1 protein_id gnl|my_center|LOCUS_00540 4050 3232 gene locus_tag LOCUS_00550 4050 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 5053 4115 gene locus_tag LOCUS_00560 5053 4115 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_00560 5815 5066 gene locus_tag LOCUS_00570 5815 5066 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_00570 8700 5812 gene locus_tag LOCUS_00580 8700 5812 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_00580 9274 8876 gene locus_tag LOCUS_00590 9274 8876 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064601.1 protein_id gnl|my_center|LOCUS_00590 9837 9349 gene locus_tag LOCUS_00600 9837 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 12443 10041 gene locus_tag LOCUS_00610 12443 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 12594 12785 gene locus_tag LOCUS_00620 12594 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 12766 13872 gene locus_tag LOCUS_00630 12766 13872 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_00630 14105 14992 gene locus_tag LOCUS_00640 14105 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 15032 15892 gene locus_tag LOCUS_00650 15032 15892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085974.1 protein_id gnl|my_center|LOCUS_00650 15920 16753 gene locus_tag LOCUS_00660 15920 16753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085975.1 protein_id gnl|my_center|LOCUS_00660 16809 17693 gene locus_tag LOCUS_00670 16809 17693 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_00670 17718 18035 gene locus_tag LOCUS_00680 17718 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 18078 18836 gene locus_tag LOCUS_00690 18078 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 18833 21409 gene locus_tag LOCUS_00700 18833 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 22521 21490 gene locus_tag LOCUS_00710 22521 21490 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_00710 23688 22846 gene locus_tag LOCUS_00720 23688 22846 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 protein_id gnl|my_center|LOCUS_00720 24203 23865 gene locus_tag LOCUS_00730 24203 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 25011 24223 gene locus_tag LOCUS_00740 25011 24223 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_00740 25410 25108 gene locus_tag LOCUS_00750 25410 25108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227201.1 protein_id gnl|my_center|LOCUS_00750 26788 25403 gene locus_tag LOCUS_00760 26788 25403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 protein_id gnl|my_center|LOCUS_00760 28299 26788 gene locus_tag LOCUS_00770 28299 26788 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104915.1 protein_id gnl|my_center|LOCUS_00770 28743 28306 gene locus_tag LOCUS_00780 28743 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 29705 28743 gene locus_tag LOCUS_00790 29705 28743 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931690.1 protein_id gnl|my_center|LOCUS_00790 29812 30477 gene locus_tag LOCUS_00800 29812 30477 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339032.1 protein_id gnl|my_center|LOCUS_00800 30474 31892 gene locus_tag LOCUS_00810 gene tctE 30474 31892 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 protein_id gnl|my_center|LOCUS_00810 31862 32914 gene locus_tag LOCUS_00820 gene afuA 31862 32914 CDS product periplasmic iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638696.2 protein_id gnl|my_center|LOCUS_00820 32964 33647 gene locus_tag LOCUS_00830 32964 33647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 33658 33954 gene locus_tag LOCUS_00840 33658 33954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 34370 35173 gene locus_tag LOCUS_00850 34370 35173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 36380 35232 gene locus_tag LOCUS_00860 36380 35232 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 protein_id gnl|my_center|LOCUS_00860 36536 36742 gene locus_tag LOCUS_00870 36536 36742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 36858 38660 gene locus_tag LOCUS_00880 36858 38660 CDS product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389828.1 protein_id gnl|my_center|LOCUS_00880 38772 39119 gene locus_tag LOCUS_00890 38772 39119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070702.1 protein_id gnl|my_center|LOCUS_00890 39148 39990 gene locus_tag LOCUS_00900 39148 39990 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_00900 39998 40669 gene locus_tag LOCUS_00910 39998 40669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 42151 40682 gene locus_tag LOCUS_00920 42151 40682 CDS product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 protein_id gnl|my_center|LOCUS_00920 43216 42350 gene locus_tag LOCUS_00930 43216 42350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888172.1 protein_id gnl|my_center|LOCUS_00930 44984 43389 gene locus_tag LOCUS_00940 44984 43389 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384909.1 protein_id gnl|my_center|LOCUS_00940 45360 45133 gene locus_tag LOCUS_00950 45360 45133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 45461 45961 gene locus_tag LOCUS_00960 45461 45961 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_00960 46391 46023 gene locus_tag LOCUS_00970 46391 46023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 46825 46394 gene locus_tag LOCUS_00980 gene np20 46825 46394 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_00980 47801 46920 gene locus_tag LOCUS_00990 47801 46920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530935.1 protein_id gnl|my_center|LOCUS_00990 48005 48301 gene locus_tag LOCUS_01000 48005 48301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 48679 48314 gene locus_tag LOCUS_01010 48679 48314 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_01010 48806 49099 gene locus_tag LOCUS_01020 48806 49099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 49236 49628 gene locus_tag LOCUS_01030 49236 49628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 49841 49644 gene locus_tag LOCUS_01040 49841 49644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 51203 49854 gene locus_tag LOCUS_01050 51203 49854 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_01050 52606 51242 gene locus_tag LOCUS_01060 52606 51242 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence003 2505 376 gene locus_tag LOCUS_01070 gene pnp 2505 376 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWZ0 protein_id gnl|my_center|LOCUS_01070 3108 2839 gene locus_tag LOCUS_01080 gene rpsO 3108 2839 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWZ1 protein_id gnl|my_center|LOCUS_01080 4064 3126 gene locus_tag LOCUS_01090 gene truB 4064 3126 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR8 protein_id gnl|my_center|LOCUS_01090 4455 4066 gene locus_tag LOCUS_01100 gene rbfA 4455 4066 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 protein_id gnl|my_center|LOCUS_01100 7203 4612 gene locus_tag LOCUS_01110 gene infB 7203 4612 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS0 protein_id gnl|my_center|LOCUS_01110 7874 7290 gene locus_tag LOCUS_01120 7874 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385439.1 protein_id gnl|my_center|LOCUS_01120 9466 7895 gene locus_tag LOCUS_01130 gene nusA 9466 7895 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_01130 10088 9600 gene locus_tag LOCUS_01140 10088 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10959 10222 gene locus_tag LOCUS_01150 gene trmB 10959 10222 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_01150 12237 11059 gene locus_tag LOCUS_01160 gene metK 12237 11059 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9E5 protein_id gnl|my_center|LOCUS_01160 13612 12278 gene locus_tag LOCUS_01170 gene lnt 13612 12278 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_01170 14683 13838 gene locus_tag LOCUS_01180 14683 13838 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_01180 15342 14680 gene locus_tag LOCUS_01190 15342 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 16307 15342 gene locus_tag LOCUS_01200 16307 15342 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_01200 17620 16304 gene locus_tag LOCUS_01210 gene miaB 17620 16304 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMT1 protein_id gnl|my_center|LOCUS_01210 18265 17804 gene locus_tag LOCUS_01220 gene rimI 18265 17804 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XZ97 protein_id gnl|my_center|LOCUS_01220 19050 18265 gene locus_tag LOCUS_01230 19050 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 19200 20234 gene locus_tag LOCUS_01240 19200 20234 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_01240 21517 20336 gene locus_tag LOCUS_01250 21517 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 22107 21547 gene locus_tag LOCUS_01260 22107 21547 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_01260 23376 22348 gene locus_tag LOCUS_01270 gene trpS 23376 22348 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_01270 24999 23467 gene locus_tag LOCUS_01280 24999 23467 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_01280 27935 24996 gene locus_tag LOCUS_01290 gene glnD 27935 24996 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_01290 30670 27932 gene locus_tag LOCUS_01300 gene mutS 30670 27932 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_01300 30882 33146 gene locus_tag LOCUS_01310 30882 33146 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391289.1 protein_id gnl|my_center|LOCUS_01310 34156 33173 gene locus_tag LOCUS_01320 34156 33173 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921560.1 protein_id gnl|my_center|LOCUS_01320 34360 35028 gene locus_tag LOCUS_01330 34360 35028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 35709 35062 gene locus_tag LOCUS_01340 gene nth 35709 35062 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW8 protein_id gnl|my_center|LOCUS_01340 35873 36832 gene locus_tag LOCUS_01350 35873 36832 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 protein_id gnl|my_center|LOCUS_01350 36881 37711 gene locus_tag LOCUS_01360 36881 37711 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707343.1 protein_id gnl|my_center|LOCUS_01360 37813 38808 gene locus_tag LOCUS_01370 37813 38808 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 protein_id gnl|my_center|LOCUS_01370 38827 40443 gene locus_tag LOCUS_01380 38827 40443 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_01380 40440 41564 gene locus_tag LOCUS_01390 40440 41564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709922.1 protein_id gnl|my_center|LOCUS_01390 41557 42543 gene locus_tag LOCUS_01400 41557 42543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529631.1 protein_id gnl|my_center|LOCUS_01400 42544 42966 gene locus_tag LOCUS_01410 42544 42966 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067542.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence004 573 1460 gene locus_tag LOCUS_01420 gene panB 573 1460 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_01420 1709 3385 gene locus_tag LOCUS_01430 gene fhs 1709 3385 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_01430 3688 4050 gene locus_tag LOCUS_01440 3688 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4824 4051 gene locus_tag LOCUS_01450 4824 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5723 4881 gene locus_tag LOCUS_01460 5723 4881 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 protein_id gnl|my_center|LOCUS_01460 5860 7341 gene locus_tag LOCUS_01470 5860 7341 CDS product carnitine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104137.1 protein_id gnl|my_center|LOCUS_01470 7360 8397 gene locus_tag LOCUS_01480 7360 8397 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974485.1 protein_id gnl|my_center|LOCUS_01480 8435 9241 gene locus_tag LOCUS_01490 8435 9241 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246008.1 protein_id gnl|my_center|LOCUS_01490 9274 10962 gene locus_tag LOCUS_01500 9274 10962 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_01500 10968 11369 gene locus_tag LOCUS_01510 10968 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 12907 11366 gene locus_tag LOCUS_01520 gene betC 12907 11366 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_01520 13080 13700 gene locus_tag LOCUS_01530 gene tag 13080 13700 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_01530 13900 14886 gene locus_tag LOCUS_01540 13900 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 15304 16089 gene locus_tag LOCUS_01550 15304 16089 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_01550 16164 17186 gene locus_tag LOCUS_01560 16164 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 17233 18765 gene locus_tag LOCUS_01570 gene crtI 17233 18765 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_01570 18772 19707 gene locus_tag LOCUS_01580 gene crtB 18772 19707 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54905 protein_id gnl|my_center|LOCUS_01580 19697 20812 gene locus_tag LOCUS_01590 19697 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20809 21753 gene locus_tag LOCUS_01600 20809 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404936.1 protein_id gnl|my_center|LOCUS_01600 21746 22822 gene locus_tag LOCUS_01610 gene fni 21746 22822 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGM3 protein_id gnl|my_center|LOCUS_01610 23684 22905 gene locus_tag LOCUS_01620 23684 22905 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_01620 23935 25530 gene locus_tag LOCUS_01630 23935 25530 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814809.1 protein_id gnl|my_center|LOCUS_01630 25527 26144 gene locus_tag LOCUS_01640 25527 26144 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971969.1 protein_id gnl|my_center|LOCUS_01640 26297 27460 gene locus_tag LOCUS_01650 26297 27460 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_01650 27601 29850 gene locus_tag LOCUS_01660 27601 29850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 29862 31154 gene locus_tag LOCUS_01670 gene hisD 29862 31154 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UHG5 protein_id gnl|my_center|LOCUS_01670 31157 31915 gene locus_tag LOCUS_01680 gene gno 31157 31915 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_01680 31912 32904 gene locus_tag LOCUS_01690 31912 32904 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383135.1 protein_id gnl|my_center|LOCUS_01690 32946 33341 gene locus_tag LOCUS_01700 32946 33341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 34130 33360 gene locus_tag LOCUS_01710 gene gloB 34130 33360 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHV7 protein_id gnl|my_center|LOCUS_01710 34582 34142 gene locus_tag LOCUS_01720 34582 34142 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_01720 35344 34673 gene locus_tag LOCUS_01730 35344 34673 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_01730 35508 35936 gene locus_tag LOCUS_01740 35508 35936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 35940 36749 gene locus_tag LOCUS_01750 35940 36749 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067563.1 protein_id gnl|my_center|LOCUS_01750 38110 36746 gene locus_tag LOCUS_01760 38110 36746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 protein_id gnl|my_center|LOCUS_01760 38267 38818 gene locus_tag LOCUS_01770 38267 38818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_01770 39657 38833 gene locus_tag LOCUS_01780 gene murQ 39657 38833 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYU5 protein_id gnl|my_center|LOCUS_01780 39723 40913 gene locus_tag LOCUS_01790 gene anmK 39723 40913 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9I7 protein_id gnl|my_center|LOCUS_01790 41585 40896 gene locus_tag LOCUS_01800 41585 40896 CDS product LmbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528076.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence005 1348 98 gene locus_tag LOCUS_01810 1348 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_01810 2037 1345 gene locus_tag LOCUS_01820 2037 1345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_01820 2666 2046 gene locus_tag LOCUS_01830 2666 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559203.1 protein_id gnl|my_center|LOCUS_01830 3009 4016 gene locus_tag LOCUS_01840 3009 4016 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK15 protein_id gnl|my_center|LOCUS_01840 4032 4466 gene locus_tag LOCUS_01850 4032 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 5461 4502 gene locus_tag LOCUS_01860 5461 4502 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337193.1 protein_id gnl|my_center|LOCUS_01860 7289 5514 gene locus_tag LOCUS_01870 7289 5514 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_01870 8632 7427 gene locus_tag LOCUS_01880 8632 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 10254 8758 gene locus_tag LOCUS_01890 10254 8758 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_01890 12116 10254 gene locus_tag LOCUS_01900 12116 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12384 13127 gene locus_tag LOCUS_01910 gene tpiA 12384 13127 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_01910 13208 13519 gene locus_tag LOCUS_01920 13208 13519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 13660 15288 gene locus_tag LOCUS_01930 gene pyrG 13660 15288 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT58 protein_id gnl|my_center|LOCUS_01930 15298 16113 gene locus_tag LOCUS_01940 gene kdsA 15298 16113 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKN7 protein_id gnl|my_center|LOCUS_01940 16169 17446 gene locus_tag LOCUS_01950 gene eno 16169 17446 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 protein_id gnl|my_center|LOCUS_01950 17623 17943 gene locus_tag LOCUS_01960 17623 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18134 19204 gene locus_tag LOCUS_01970 gene pdhA 18134 19204 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT64 protein_id gnl|my_center|LOCUS_01970 19207 20598 gene locus_tag LOCUS_01980 19207 20598 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_01980 20601 21890 gene locus_tag LOCUS_01990 20601 21890 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT66 protein_id gnl|my_center|LOCUS_01990 21926 23338 gene locus_tag LOCUS_02000 21926 23338 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT67 protein_id gnl|my_center|LOCUS_02000 23392 24345 gene locus_tag LOCUS_02010 gene lipA 23392 24345 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I8 protein_id gnl|my_center|LOCUS_02010 24345 24788 gene locus_tag LOCUS_02020 24345 24788 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_02020 25294 24791 gene locus_tag LOCUS_02030 25294 24791 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 protein_id gnl|my_center|LOCUS_02030 25662 25291 gene locus_tag LOCUS_02040 25662 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 27113 25773 gene locus_tag LOCUS_02050 gene ispDF 27113 25773 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ8 protein_id gnl|my_center|LOCUS_02050 27265 28251 gene locus_tag LOCUS_02060 gene dus 27265 28251 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_02060 28256 29428 gene locus_tag LOCUS_02070 gene ntrB 28256 29428 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315358.1 protein_id gnl|my_center|LOCUS_02070 29428 30867 gene locus_tag LOCUS_02080 gene ntrC 29428 30867 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004441656.1 protein_id gnl|my_center|LOCUS_02080 30934 33123 gene locus_tag LOCUS_02090 30934 33123 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_02090 33126 34562 gene locus_tag LOCUS_02100 33126 34562 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_02100 34559 35938 gene locus_tag LOCUS_02110 gene trkA 34559 35938 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_02110 36047 36310 gene locus_tag LOCUS_02120 gene hfq 36047 36310 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR1 protein_id gnl|my_center|LOCUS_02120 36353 37177 gene locus_tag LOCUS_02130 36353 37177 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708167.1 protein_id gnl|my_center|LOCUS_02130 <37777 37214 gene locus_tag LOCUS_02140 <37777 37214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970538.1:threonine transporter >Feature sequence006 <1 2211 gene locus_tag LOCUS_02150 <1 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:glycine cleavage system protein T 2613 2404 gene locus_tag LOCUS_02160 2613 2404 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389274.1 protein_id gnl|my_center|LOCUS_02160 2860 3846 gene locus_tag LOCUS_02170 gene rarD 2860 3846 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 protein_id gnl|my_center|LOCUS_02170 4358 3843 gene locus_tag LOCUS_02180 gene ppiB 4358 3843 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_02180 4863 4381 gene locus_tag LOCUS_02190 4863 4381 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_02190 5803 4988 gene locus_tag LOCUS_02200 5803 4988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972637.1 protein_id gnl|my_center|LOCUS_02200 6714 5800 gene locus_tag LOCUS_02210 6714 5800 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_02210 7281 6952 gene locus_tag LOCUS_02220 7281 6952 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_02220 8228 7443 gene locus_tag LOCUS_02230 8228 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 8522 9043 gene locus_tag LOCUS_02240 8522 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 protein_id gnl|my_center|LOCUS_02240 9049 9666 gene locus_tag LOCUS_02250 9049 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9666 9950 gene locus_tag LOCUS_02260 9666 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9961 11157 gene locus_tag LOCUS_02270 gene papS 9961 11157 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972173.1 protein_id gnl|my_center|LOCUS_02270 11167 12033 gene locus_tag LOCUS_02280 gene hemF 11167 12033 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZX1 protein_id gnl|my_center|LOCUS_02280 12209 12757 gene locus_tag LOCUS_02290 12209 12757 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_02290 12788 14011 gene locus_tag LOCUS_02300 12788 14011 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH7 protein_id gnl|my_center|LOCUS_02300 14015 14785 gene locus_tag LOCUS_02310 14015 14785 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_02310 15774 14851 gene locus_tag LOCUS_02320 15774 14851 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968408.1 protein_id gnl|my_center|LOCUS_02320 16963 15863 gene locus_tag LOCUS_02330 gene ychF 16963 15863 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV3 protein_id gnl|my_center|LOCUS_02330 17642 17034 gene locus_tag LOCUS_02340 gene pth 17642 17034 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI49 protein_id gnl|my_center|LOCUS_02340 18311 17676 gene locus_tag LOCUS_02350 gene rplY 18311 17676 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDA0 protein_id gnl|my_center|LOCUS_02350 19448 18519 gene locus_tag LOCUS_02360 gene prs 19448 18519 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 protein_id gnl|my_center|LOCUS_02360 20482 19640 gene locus_tag LOCUS_02370 20482 19640 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAE0 protein_id gnl|my_center|LOCUS_02370 21654 20479 gene locus_tag LOCUS_02380 21654 20479 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_02380 22487 21651 gene locus_tag LOCUS_02390 gene lgt 22487 21651 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 protein_id gnl|my_center|LOCUS_02390 22679 23068 gene locus_tag LOCUS_02400 22679 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391027.1 protein_id gnl|my_center|LOCUS_02400 23241 23765 gene locus_tag LOCUS_02410 23241 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090187.1 protein_id gnl|my_center|LOCUS_02410 23762 24604 gene locus_tag LOCUS_02420 gene proC 23762 24604 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP69 protein_id gnl|my_center|LOCUS_02420 24697 25380 gene locus_tag LOCUS_02430 24697 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 25373 25711 gene locus_tag LOCUS_02440 gene csaA 25373 25711 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_02440 27042 25723 gene locus_tag LOCUS_02450 27042 25723 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_02450 27734 27042 gene locus_tag LOCUS_02460 27734 27042 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 protein_id gnl|my_center|LOCUS_02460 28263 27766 gene locus_tag LOCUS_02470 28263 27766 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_02470 28391 29281 gene locus_tag LOCUS_02480 28391 29281 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920766.1 protein_id gnl|my_center|LOCUS_02480 29543 29289 gene locus_tag LOCUS_02490 gene moaD 29543 29289 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKK2 protein_id gnl|my_center|LOCUS_02490 30172 29606 gene locus_tag LOCUS_02500 gene pgsA 30172 29606 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707493.1 protein_id gnl|my_center|LOCUS_02500 <31853 30240 gene locus_tag LOCUS_02510 <31853 30240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYX6:UvrABC system protein C >Feature sequence007 617 150 gene locus_tag LOCUS_02520 617 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_02520 4443 793 gene locus_tag LOCUS_02530 4443 793 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_02530 4912 5268 gene locus_tag LOCUS_02540 4912 5268 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640357.1 protein_id gnl|my_center|LOCUS_02540 5367 5822 gene locus_tag LOCUS_02550 5367 5822 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_02550 5845 6228 gene locus_tag LOCUS_02560 5845 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 6913 6230 gene locus_tag LOCUS_02570 gene aat 6913 6230 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A741 protein_id gnl|my_center|LOCUS_02570 8292 6952 gene locus_tag LOCUS_02580 8292 6952 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_02580 8777 8298 gene locus_tag LOCUS_02590 8777 8298 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_02590 9180 8779 gene locus_tag LOCUS_02600 gene aroQ 9180 8779 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52377 protein_id gnl|my_center|LOCUS_02600 10105 9365 gene locus_tag LOCUS_02610 10105 9365 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_02610 11579 10200 gene locus_tag LOCUS_02620 11579 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_02620 11831 13000 gene locus_tag LOCUS_02630 11831 13000 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390176.1 protein_id gnl|my_center|LOCUS_02630 15608 13068 gene locus_tag LOCUS_02640 15608 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 16124 17551 gene locus_tag LOCUS_02650 16124 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 17786 20212 gene locus_tag LOCUS_02660 17786 20212 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_02660 20281 21390 gene locus_tag LOCUS_02670 gene prfB 20281 21390 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLD6 protein_id gnl|my_center|LOCUS_02670 22276 21443 gene locus_tag LOCUS_02680 22276 21443 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 protein_id gnl|my_center|LOCUS_02680 22760 22302 gene locus_tag LOCUS_02690 22760 22302 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_02690 22907 26602 gene locus_tag LOCUS_02700 22907 26602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 27843 26599 gene locus_tag LOCUS_02710 gene tyrS 27843 26599 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 protein_id gnl|my_center|LOCUS_02710 28559 27897 gene locus_tag LOCUS_02720 28559 27897 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_02720 28706 29419 gene locus_tag LOCUS_02730 gene cysE 28706 29419 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_02730 29456 30556 gene locus_tag LOCUS_02740 29456 30556 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence008 86 1159 gene locus_tag LOCUS_02750 86 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1276 1782 gene locus_tag LOCUS_02760 1276 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1860 4472 gene locus_tag LOCUS_02770 gene leuS 1860 4472 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 protein_id gnl|my_center|LOCUS_02770 4459 4980 gene locus_tag LOCUS_02780 4459 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4977 6011 gene locus_tag LOCUS_02790 4977 6011 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310932.1 protein_id gnl|my_center|LOCUS_02790 7279 6170 gene locus_tag LOCUS_02800 7279 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8061 7279 gene locus_tag LOCUS_02810 gene parA 8061 7279 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV7 protein_id gnl|my_center|LOCUS_02810 8697 8098 gene locus_tag LOCUS_02820 gene rsmG 8697 8098 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_02820 10768 8822 gene locus_tag LOCUS_02830 gene mnmG 10768 8822 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 protein_id gnl|my_center|LOCUS_02830 12631 11288 gene locus_tag LOCUS_02840 gene mnmE 12631 11288 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WP4 protein_id gnl|my_center|LOCUS_02840 12753 13253 gene locus_tag LOCUS_02850 gene ogt 12753 13253 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7F8 protein_id gnl|my_center|LOCUS_02850 14768 13509 gene locus_tag LOCUS_02860 gene rho 14768 13509 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 protein_id gnl|my_center|LOCUS_02860 15339 14908 gene locus_tag LOCUS_02870 15339 14908 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_02870 16400 15375 gene locus_tag LOCUS_02880 gene hemE 16400 15375 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_02880 16790 17614 gene locus_tag LOCUS_02890 16790 17614 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN86 protein_id gnl|my_center|LOCUS_02890 17611 18270 gene locus_tag LOCUS_02900 17611 18270 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU7 protein_id gnl|my_center|LOCUS_02900 18267 18902 gene locus_tag LOCUS_02910 gene coaE 18267 18902 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU5 protein_id gnl|my_center|LOCUS_02910 18933 19691 gene locus_tag LOCUS_02920 18933 19691 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_02920 20214 19702 gene locus_tag LOCUS_02930 gene secB 20214 19702 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN7 protein_id gnl|my_center|LOCUS_02930 20878 20321 gene locus_tag LOCUS_02940 20878 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 21027 21665 gene locus_tag LOCUS_02950 21027 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_02950 21694 22326 gene locus_tag LOCUS_02960 21694 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 22323 22682 gene locus_tag LOCUS_02970 22323 22682 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391348.1 protein_id gnl|my_center|LOCUS_02970 22946 23488 gene locus_tag LOCUS_02980 22946 23488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 23515 23883 gene locus_tag LOCUS_02990 23515 23883 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_02990 24013 25521 gene locus_tag LOCUS_03000 24013 25521 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_03000 26474 25494 gene locus_tag LOCUS_03010 gene gshB 26474 25494 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SN3 protein_id gnl|my_center|LOCUS_03010 27099 26482 gene locus_tag LOCUS_03020 27099 26482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 27597 27190 gene locus_tag LOCUS_03030 27597 27190 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK9 protein_id gnl|my_center|LOCUS_03030 28448 27603 gene locus_tag LOCUS_03040 gene rsmI 28448 27603 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK8 protein_id gnl|my_center|LOCUS_03040 >Feature sequence009 1 276 gene locus_tag LOCUS_03050 1 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 282 635 gene locus_tag LOCUS_03060 282 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1084 650 gene locus_tag LOCUS_03070 1084 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1447 1133 gene locus_tag LOCUS_03080 1447 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1762 1463 gene locus_tag LOCUS_03090 1762 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 2647 1799 gene locus_tag LOCUS_03100 2647 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3101 2658 gene locus_tag LOCUS_03110 3101 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 4285 3098 gene locus_tag LOCUS_03120 4285 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4887 4348 gene locus_tag LOCUS_03130 4887 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5188 7290 gene locus_tag LOCUS_03140 gene flhA 5188 7290 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337939.1 protein_id gnl|my_center|LOCUS_03140 7339 8487 gene locus_tag LOCUS_03150 7339 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 8518 9357 gene locus_tag LOCUS_03160 8518 9357 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MK2 protein_id gnl|my_center|LOCUS_03160 9361 10086 gene locus_tag LOCUS_03170 gene fliA 9361 10086 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720175.1 protein_id gnl|my_center|LOCUS_03170 10079 10531 gene locus_tag LOCUS_03180 10079 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 11358 10549 gene locus_tag LOCUS_03190 gene flgG 11358 10549 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I11 protein_id gnl|my_center|LOCUS_03190 11557 11943 gene locus_tag LOCUS_03200 11557 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720184.1 protein_id gnl|my_center|LOCUS_03200 11989 12603 gene locus_tag LOCUS_03210 11989 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12641 12856 gene locus_tag LOCUS_03220 12641 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 12861 13133 gene locus_tag LOCUS_03230 12861 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 13331 13137 gene locus_tag LOCUS_03240 13331 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03240 14387 13389 gene locus_tag LOCUS_03250 14387 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03250 15723 14479 gene locus_tag LOCUS_03260 15723 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 17069 15939 gene locus_tag LOCUS_03270 17069 15939 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533412.1 protein_id gnl|my_center|LOCUS_03270 17915 17094 gene locus_tag LOCUS_03280 17915 17094 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525151.1 protein_id gnl|my_center|LOCUS_03280 18739 17912 gene locus_tag LOCUS_03290 18739 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089982.1 protein_id gnl|my_center|LOCUS_03290 19986 18796 gene locus_tag LOCUS_03300 19986 18796 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_03300 20167 21795 gene locus_tag LOCUS_03310 20167 21795 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_03310 21856 22398 gene locus_tag LOCUS_03320 21856 22398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 23161 22415 gene locus_tag LOCUS_03330 23161 22415 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338511.1 protein_id gnl|my_center|LOCUS_03330 24471 23326 gene locus_tag LOCUS_03340 24471 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 24856 24461 gene locus_tag LOCUS_03350 24856 24461 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947347.1 protein_id gnl|my_center|LOCUS_03350 25934 24933 gene locus_tag LOCUS_03360 gene gapB 25934 24933 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J265 protein_id gnl|my_center|LOCUS_03360 27475 25973 gene locus_tag LOCUS_03370 gene glpK 27475 25973 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG71 protein_id gnl|my_center|LOCUS_03370 27778 27500 gene locus_tag LOCUS_03380 27778 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 28575 27778 gene locus_tag LOCUS_03390 28575 27778 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 protein_id gnl|my_center|LOCUS_03390 29128 28586 gene locus_tag LOCUS_03400 29128 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence010 1272 187 gene locus_tag LOCUS_03410 gene pheS 1272 187 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_03410 1773 1420 gene locus_tag LOCUS_03420 gene rplT 1773 1420 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCP9 protein_id gnl|my_center|LOCUS_03420 2016 1786 gene locus_tag LOCUS_03430 gene rpmI 2016 1786 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNI0 protein_id gnl|my_center|LOCUS_03430 2828 2340 gene locus_tag LOCUS_03440 gene infC 2828 2340 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_03440 4986 3061 gene locus_tag LOCUS_03450 gene thrS 4986 3061 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_03450 6319 5099 gene locus_tag LOCUS_03460 6319 5099 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391123.1 protein_id gnl|my_center|LOCUS_03460 6362 7138 gene locus_tag LOCUS_03470 6362 7138 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_03470 7820 7155 gene locus_tag LOCUS_03480 7820 7155 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_03480 8455 7961 gene locus_tag LOCUS_03490 8455 7961 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 protein_id gnl|my_center|LOCUS_03490 13078 8531 gene locus_tag LOCUS_03500 13078 8531 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_03500 14532 13081 gene locus_tag LOCUS_03510 14532 13081 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_03510 14846 15661 gene locus_tag LOCUS_03520 gene uppP1 14846 15661 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_03520 16626 15679 gene locus_tag LOCUS_03530 16626 15679 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_03530 16901 16987 gene locus_tag LOCUS_t00010 16901 16987 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17073 17684 gene locus_tag LOCUS_03540 17073 17684 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_03540 17735 18397 gene locus_tag LOCUS_03550 17735 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 18435 19241 gene locus_tag LOCUS_03560 18435 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 19254 20066 gene locus_tag LOCUS_03570 19254 20066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_03570 20238 20702 gene locus_tag LOCUS_03580 20238 20702 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_03580 20870 20795 gene locus_tag LOCUS_t00020 20870 20795 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21398 20991 gene locus_tag LOCUS_03590 21398 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21729 23069 gene locus_tag LOCUS_03600 gene aroA 21729 23069 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_03600 23066 23695 gene locus_tag LOCUS_03610 gene cmk 23066 23695 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_03610 23950 25665 gene locus_tag LOCUS_03620 23950 25665 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 protein_id gnl|my_center|LOCUS_03620 25817 26095 gene locus_tag LOCUS_03630 gene ihfB 25817 26095 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE8 protein_id gnl|my_center|LOCUS_03630 26109 26459 gene locus_tag LOCUS_03640 26109 26459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 26486 27139 gene locus_tag LOCUS_03650 gene trpF 26486 27139 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TD0 protein_id gnl|my_center|LOCUS_03650 27187 28410 gene locus_tag LOCUS_03660 gene trpB 27187 28410 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE5 protein_id gnl|my_center|LOCUS_03660 >Feature sequence011 651 193 gene locus_tag LOCUS_03670 651 193 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_03670 1013 648 gene locus_tag LOCUS_03680 1013 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2365 1010 gene locus_tag LOCUS_03690 2365 1010 CDS product selenium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_03690 2438 3208 gene locus_tag LOCUS_03700 2438 3208 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256009.1 protein_id gnl|my_center|LOCUS_03700 3321 3785 gene locus_tag LOCUS_03710 3321 3785 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 protein_id gnl|my_center|LOCUS_03710 3958 5061 gene locus_tag LOCUS_03720 3958 5061 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708577.1 protein_id gnl|my_center|LOCUS_03720 5165 5359 gene locus_tag LOCUS_03730 5165 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6547 5381 gene locus_tag LOCUS_03740 6547 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_03740 7329 6544 gene locus_tag LOCUS_03750 7329 6544 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_03750 9688 7358 gene locus_tag LOCUS_03760 9688 7358 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_03760 10467 9862 gene locus_tag LOCUS_03770 10467 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 10592 11335 gene locus_tag LOCUS_03780 10592 11335 CDS product branched-chain amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_03780 11332 11673 gene locus_tag LOCUS_03790 11332 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969252.1 protein_id gnl|my_center|LOCUS_03790 12658 11732 gene locus_tag LOCUS_03800 12658 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 12809 13921 gene locus_tag LOCUS_03810 12809 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088829.1 protein_id gnl|my_center|LOCUS_03810 13921 14703 gene locus_tag LOCUS_03820 13921 14703 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088824.1 protein_id gnl|my_center|LOCUS_03820 14711 16003 gene locus_tag LOCUS_03830 14711 16003 CDS product BEC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 protein_id gnl|my_center|LOCUS_03830 16034 17560 gene locus_tag LOCUS_03840 16034 17560 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_03840 18490 17627 gene locus_tag LOCUS_03850 18490 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19404 18514 gene locus_tag LOCUS_03860 gene ygbJ 19404 18514 CDS product putative oxidoreductase YgbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46888 protein_id gnl|my_center|LOCUS_03860 20391 19504 gene locus_tag LOCUS_03870 20391 19504 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462252.1 protein_id gnl|my_center|LOCUS_03870 21264 20407 gene locus_tag LOCUS_03880 21264 20407 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_03880 22328 21282 gene locus_tag LOCUS_03890 gene iolC 22328 21282 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y3Q4 protein_id gnl|my_center|LOCUS_03890 23218 22328 gene locus_tag LOCUS_03900 23218 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 24188 23253 gene locus_tag LOCUS_03910 24188 23253 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 protein_id gnl|my_center|LOCUS_03910 25053 24217 gene locus_tag LOCUS_03920 25053 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 25890 25066 gene locus_tag LOCUS_03930 25890 25066 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_03930 27774 25906 gene locus_tag LOCUS_03940 27774 25906 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528372.1 protein_id gnl|my_center|LOCUS_03940 27961 27776 gene locus_tag LOCUS_03950 27961 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence012 1591 170 gene locus_tag LOCUS_03960 1591 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1761 2894 gene locus_tag LOCUS_03970 1761 2894 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_03970 4267 2936 gene locus_tag LOCUS_03980 4267 2936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_03980 5070 4333 gene locus_tag LOCUS_03990 5070 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 5477 6640 gene locus_tag LOCUS_04000 5477 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 7288 6662 gene locus_tag LOCUS_04010 7288 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7390 8634 gene locus_tag LOCUS_04020 7390 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 8883 9464 gene locus_tag LOCUS_04030 8883 9464 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_04030 9464 10156 gene locus_tag LOCUS_04040 9464 10156 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_04040 10187 10846 gene locus_tag LOCUS_04050 10187 10846 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_04050 11627 10863 gene locus_tag LOCUS_04060 11627 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 12135 11671 gene locus_tag LOCUS_04070 gene moaE 12135 11671 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090206.1 protein_id gnl|my_center|LOCUS_04070 13388 12138 gene locus_tag LOCUS_04080 gene moeA 13388 12138 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_04080 13976 13392 gene locus_tag LOCUS_04090 gene mobB 13976 13392 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_04090 15020 13977 gene locus_tag LOCUS_04100 gene moaA 15020 13977 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C7 protein_id gnl|my_center|LOCUS_04100 15271 15876 gene locus_tag LOCUS_04110 15271 15876 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_04110 16810 15905 gene locus_tag LOCUS_04120 16810 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 17535 16810 gene locus_tag LOCUS_04130 17535 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_04130 18323 17532 gene locus_tag LOCUS_04140 18323 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 18922 18296 gene locus_tag LOCUS_04150 18922 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21167 19128 gene locus_tag LOCUS_04160 21167 19128 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086995.1 protein_id gnl|my_center|LOCUS_04160 21353 21279 gene locus_tag LOCUS_t00030 21353 21279 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21606 22667 gene locus_tag LOCUS_04170 21606 22667 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640054.1 protein_id gnl|my_center|LOCUS_04170 24137 22701 gene locus_tag LOCUS_04180 gene der 24137 22701 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPR6 protein_id gnl|my_center|LOCUS_04180 <25084 24156 gene locus_tag LOCUS_04190 <25084 24156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384150.1:pyrrolo-quinoline quinone >Feature sequence013 903 1910 gene locus_tag LOCUS_04200 903 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_04200 1994 4036 gene locus_tag LOCUS_04210 1994 4036 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 protein_id gnl|my_center|LOCUS_04210 4065 4436 gene locus_tag LOCUS_04220 4065 4436 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 protein_id gnl|my_center|LOCUS_04220 4429 5163 gene locus_tag LOCUS_04230 4429 5163 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_04230 5258 6313 gene locus_tag LOCUS_04240 5258 6313 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 protein_id gnl|my_center|LOCUS_04240 6318 6914 gene locus_tag LOCUS_04250 gene rsmJ 6318 6914 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Q0 protein_id gnl|my_center|LOCUS_04250 7057 7542 gene locus_tag LOCUS_04260 7057 7542 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R1 protein_id gnl|my_center|LOCUS_04260 8651 7578 gene locus_tag LOCUS_04270 8651 7578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 protein_id gnl|my_center|LOCUS_04270 9730 8651 gene locus_tag LOCUS_04280 9730 8651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 protein_id gnl|my_center|LOCUS_04280 10580 9732 gene locus_tag LOCUS_04290 10580 9732 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_04290 11450 10584 gene locus_tag LOCUS_04300 11450 10584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887387.1 protein_id gnl|my_center|LOCUS_04300 13079 11541 gene locus_tag LOCUS_04310 13079 11541 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887389.1 protein_id gnl|my_center|LOCUS_04310 14176 13121 gene locus_tag LOCUS_04320 14176 13121 CDS product D-arabinose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086456.1 protein_id gnl|my_center|LOCUS_04320 14329 16275 gene locus_tag LOCUS_04330 14329 16275 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 protein_id gnl|my_center|LOCUS_04330 16628 16272 gene locus_tag LOCUS_04340 16628 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 17619 16777 gene locus_tag LOCUS_04350 17619 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 protein_id gnl|my_center|LOCUS_04350 18610 17690 gene locus_tag LOCUS_04360 18610 17690 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947995.1 protein_id gnl|my_center|LOCUS_04360 18886 18740 gene locus_tag LOCUS_04370 18886 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 19783 18887 gene locus_tag LOCUS_04380 gene legD1 19783 18887 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_04380 20344 19841 gene locus_tag LOCUS_04390 20344 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 20601 21029 gene locus_tag LOCUS_04400 20601 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_04400 21428 21072 gene locus_tag LOCUS_04410 21428 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 22421 21537 gene locus_tag LOCUS_04420 22421 21537 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 protein_id gnl|my_center|LOCUS_04420 23349 22459 gene locus_tag LOCUS_04430 23349 22459 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_04430 24539 23355 gene locus_tag LOCUS_04440 gene metZ 24539 23355 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQI7 protein_id gnl|my_center|LOCUS_04440 >Feature sequence014 <1 1167 gene locus_tag LOCUS_04450 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387909.1:GTP-binding protein 1276 1956 gene locus_tag LOCUS_04460 gene pyrE 1276 1956 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHF3 protein_id gnl|my_center|LOCUS_04460 1985 2437 gene locus_tag LOCUS_04470 1985 2437 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_04470 2437 2841 gene locus_tag LOCUS_04480 2437 2841 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_04480 2942 4555 gene locus_tag LOCUS_04490 2942 4555 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_04490 4702 5979 gene locus_tag LOCUS_04500 4702 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5976 9107 gene locus_tag LOCUS_04510 5976 9107 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_04510 10532 9150 gene locus_tag LOCUS_04520 10532 9150 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 protein_id gnl|my_center|LOCUS_04520 10634 12292 gene locus_tag LOCUS_04530 gene betA 10634 12292 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN3 protein_id gnl|my_center|LOCUS_04530 12393 13502 gene locus_tag LOCUS_04540 12393 13502 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH13 protein_id gnl|my_center|LOCUS_04540 13502 14326 gene locus_tag LOCUS_04550 13502 14326 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE68 protein_id gnl|my_center|LOCUS_04550 14379 15323 gene locus_tag LOCUS_04560 gene gbuA 14379 15323 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_04560 15335 16525 gene locus_tag LOCUS_04570 15335 16525 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532172.1 protein_id gnl|my_center|LOCUS_04570 16525 17736 gene locus_tag LOCUS_04580 16525 17736 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_04580 17733 18608 gene locus_tag LOCUS_04590 17733 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701428.1 protein_id gnl|my_center|LOCUS_04590 18763 19446 gene locus_tag LOCUS_04600 18763 19446 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGF7 protein_id gnl|my_center|LOCUS_04600 19461 20447 gene locus_tag LOCUS_04610 19461 20447 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 protein_id gnl|my_center|LOCUS_04610 21443 20454 gene locus_tag LOCUS_04620 21443 20454 CDS product UPF0176 protein R02887 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LX6 protein_id gnl|my_center|LOCUS_04620 21632 22237 gene locus_tag LOCUS_04630 gene pncA 21632 22237 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385573.1 protein_id gnl|my_center|LOCUS_04630 23410 22211 gene locus_tag LOCUS_04640 23410 22211 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150113.1 protein_id gnl|my_center|LOCUS_04640 <24506 23495 gene locus_tag LOCUS_04650 <24506 23495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970550.1:aspartate aminotransferase family protein >Feature sequence015 275 664 gene locus_tag LOCUS_04660 gene umuD 275 664 CDS product umuD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940167.1 protein_id gnl|my_center|LOCUS_04660 664 2004 gene locus_tag LOCUS_04670 664 2004 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202620.1 protein_id gnl|my_center|LOCUS_04670 2065 2460 gene locus_tag LOCUS_04680 2065 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 3714 2533 gene locus_tag LOCUS_04690 3714 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4022 4705 gene locus_tag LOCUS_04700 4022 4705 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336836.1 protein_id gnl|my_center|LOCUS_04700 4752 5522 gene locus_tag LOCUS_04710 4752 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5641 6894 gene locus_tag LOCUS_04720 5641 6894 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067192.1 protein_id gnl|my_center|LOCUS_04720 7925 6960 gene locus_tag LOCUS_04730 7925 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8671 7925 gene locus_tag LOCUS_04740 8671 7925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 protein_id gnl|my_center|LOCUS_04740 9732 8668 gene locus_tag LOCUS_04750 9732 8668 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_04750 10634 9729 gene locus_tag LOCUS_04760 10634 9729 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_04760 11913 10702 gene locus_tag LOCUS_04770 11913 10702 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_04770 12899 12114 gene locus_tag LOCUS_04780 12899 12114 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528365.1 protein_id gnl|my_center|LOCUS_04780 13158 13508 gene locus_tag LOCUS_04790 13158 13508 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_04790 14391 13546 gene locus_tag LOCUS_04800 14391 13546 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085595.1 protein_id gnl|my_center|LOCUS_04800 14884 15861 gene locus_tag LOCUS_04810 gene thtR 14884 15861 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975834.1 protein_id gnl|my_center|LOCUS_04810 15891 17051 gene locus_tag LOCUS_04820 15891 17051 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970701.1 protein_id gnl|my_center|LOCUS_04820 17354 19699 gene locus_tag LOCUS_04830 17354 19699 CDS product dimethylsulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103704.1 protein_id gnl|my_center|LOCUS_04830 19993 19709 gene locus_tag LOCUS_04840 19993 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 20914 20003 gene locus_tag LOCUS_04850 20914 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 protein_id gnl|my_center|LOCUS_04850 21437 20976 gene locus_tag LOCUS_04860 21437 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 22154 21477 gene locus_tag LOCUS_04870 22154 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 23643 22447 gene locus_tag LOCUS_04880 gene wecE 23643 22447 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence016 257 1699 gene locus_tag LOCUS_04890 257 1699 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336795.1 protein_id gnl|my_center|LOCUS_04890 2321 1707 gene locus_tag LOCUS_04900 2321 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4021 2324 gene locus_tag LOCUS_04910 4021 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 protein_id gnl|my_center|LOCUS_04910 5020 4040 gene locus_tag LOCUS_04920 5020 4040 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_04920 6471 5023 gene locus_tag LOCUS_04930 6471 5023 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_04930 6894 6523 gene locus_tag LOCUS_04940 6894 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6881 7099 gene locus_tag LOCUS_04950 6881 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7143 8177 gene locus_tag LOCUS_04960 7143 8177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971805.1 protein_id gnl|my_center|LOCUS_04960 9268 8180 gene locus_tag LOCUS_04970 9268 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 9801 9265 gene locus_tag LOCUS_04980 gene cycY 9801 9265 CDS product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30960 protein_id gnl|my_center|LOCUS_04980 11774 9798 gene locus_tag LOCUS_04990 gene cycK 11774 9798 CDS product cytochrome c-type biogenesis protein CycK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45403 protein_id gnl|my_center|LOCUS_04990 12223 11771 gene locus_tag LOCUS_05000 gene ccmE 12223 11771 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_05000 12443 12832 gene locus_tag LOCUS_05010 12443 12832 CDS product cytochrome C protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532062.1 protein_id gnl|my_center|LOCUS_05010 12886 14037 gene locus_tag LOCUS_05020 12886 14037 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533146.1 protein_id gnl|my_center|LOCUS_05020 14062 14589 gene locus_tag LOCUS_05030 14062 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 15064 14600 gene locus_tag LOCUS_05040 15064 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 15179 15493 gene locus_tag LOCUS_05050 15179 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 15564 16178 gene locus_tag LOCUS_05060 15564 16178 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970941.1 protein_id gnl|my_center|LOCUS_05060 16567 16253 gene locus_tag LOCUS_05070 gene brnE 16567 16253 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641216.1 protein_id gnl|my_center|LOCUS_05070 17298 16564 gene locus_tag LOCUS_05080 17298 16564 CDS product branched-chain amino acid transporter AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_05080 17492 17899 gene locus_tag LOCUS_05090 17492 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_05090 18978 17896 gene locus_tag LOCUS_05100 18978 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 19838 19113 gene locus_tag LOCUS_05110 19838 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 20054 21253 gene locus_tag LOCUS_05120 gene pgk 20054 21253 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW9 protein_id gnl|my_center|LOCUS_05120 21316 21954 gene locus_tag LOCUS_05130 gene msrA 21316 21954 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_05130 22084 22644 gene locus_tag LOCUS_05140 22084 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence017 292 1833 gene locus_tag LOCUS_05150 292 1833 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974636.1 protein_id gnl|my_center|LOCUS_05150 2027 2611 gene locus_tag LOCUS_05160 2027 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220370.1 protein_id gnl|my_center|LOCUS_05160 3580 2666 gene locus_tag LOCUS_05170 3580 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532260.1 protein_id gnl|my_center|LOCUS_05170 4735 3725 gene locus_tag LOCUS_05180 gene fldW 4735 3725 CDS product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_05180 5669 4764 gene locus_tag LOCUS_05190 5669 4764 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_05190 6777 5671 gene locus_tag LOCUS_05200 6777 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 protein_id gnl|my_center|LOCUS_05200 7733 6777 gene locus_tag LOCUS_05210 7733 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 8600 7758 gene locus_tag LOCUS_05220 gene pcaH 8600 7758 CDS product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_05220 9003 8593 gene locus_tag LOCUS_05230 gene ligA 9003 8593 CDS product protocatechuate 4,5-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036041.1 protein_id gnl|my_center|LOCUS_05230 9091 9996 gene locus_tag LOCUS_05240 9091 9996 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_05240 10816 10019 gene locus_tag LOCUS_05250 10816 10019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_05250 11891 10803 gene locus_tag LOCUS_05260 11891 10803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_05260 13179 11974 gene locus_tag LOCUS_05270 13179 11974 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 protein_id gnl|my_center|LOCUS_05270 14162 13251 gene locus_tag LOCUS_05280 14162 13251 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_05280 14920 14183 gene locus_tag LOCUS_05290 14920 14183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_05290 15729 15049 gene locus_tag LOCUS_05300 15729 15049 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967736.1 protein_id gnl|my_center|LOCUS_05300 16610 15873 gene locus_tag LOCUS_05310 gene fabG 16610 15873 CDS product short-chain dehydrogenase/reductase SDR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836211.1 protein_id gnl|my_center|LOCUS_05310 17065 16634 gene locus_tag LOCUS_05320 17065 16634 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533031.1 protein_id gnl|my_center|LOCUS_05320 18149 17109 gene locus_tag LOCUS_05330 18149 17109 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089653.1 protein_id gnl|my_center|LOCUS_05330 19684 18149 gene locus_tag LOCUS_05340 19684 18149 CDS product acetate CoA-transferase YdiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQM6 protein_id gnl|my_center|LOCUS_05340 20899 19730 gene locus_tag LOCUS_05350 20899 19730 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_05350 21705 20899 gene locus_tag LOCUS_05360 21705 20899 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086104.1 protein_id gnl|my_center|LOCUS_05360 22653 21709 gene locus_tag LOCUS_05370 22653 21709 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF76 protein_id gnl|my_center|LOCUS_05370 23122 22658 gene locus_tag LOCUS_05380 gene aroQ 23122 22658 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_05380 23929 23135 gene locus_tag LOCUS_05390 23929 23135 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532642.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence018 <1 867 gene locus_tag LOCUS_05400 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58737:alanine racemase, catabolic 929 1705 gene locus_tag LOCUS_05410 929 1705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_05410 1706 2488 gene locus_tag LOCUS_05420 1706 2488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_05420 2488 3858 gene locus_tag LOCUS_05430 gene radA 2488 3858 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_05430 3901 4545 gene locus_tag LOCUS_05440 3901 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4641 6092 gene locus_tag LOCUS_05450 gene purF 4641 6092 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 protein_id gnl|my_center|LOCUS_05450 6113 6838 gene locus_tag LOCUS_05460 6113 6838 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_05460 8670 6856 gene locus_tag LOCUS_05470 gene mnmC 8670 6856 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32DL2 protein_id gnl|my_center|LOCUS_05470 8820 10082 gene locus_tag LOCUS_05480 8820 10082 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_05480 10088 10483 gene locus_tag LOCUS_05490 10088 10483 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 protein_id gnl|my_center|LOCUS_05490 10530 10709 gene locus_tag LOCUS_05500 10530 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 11405 10722 gene locus_tag LOCUS_05510 11405 10722 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_05510 11563 12186 gene locus_tag LOCUS_05520 11563 12186 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383156.1 protein_id gnl|my_center|LOCUS_05520 12887 12189 gene locus_tag LOCUS_05530 12887 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 12997 13626 gene locus_tag LOCUS_05540 12997 13626 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085339.1 protein_id gnl|my_center|LOCUS_05540 13929 13681 gene locus_tag LOCUS_05550 13929 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 14147 14231 gene locus_tag LOCUS_t00040 14147 14231 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15523 14327 gene locus_tag LOCUS_05560 15523 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15694 16575 gene locus_tag LOCUS_05570 15694 16575 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_05570 17347 16583 gene locus_tag LOCUS_05580 17347 16583 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_05580 17563 18354 gene locus_tag LOCUS_05590 gene map 17563 18354 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_05590 18501 19142 gene locus_tag LOCUS_05600 gene radC 18501 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_05600 19361 19167 gene locus_tag LOCUS_05610 19361 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 19469 20761 gene locus_tag LOCUS_05620 19469 20761 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCK6 protein_id gnl|my_center|LOCUS_05620 20771 21532 gene locus_tag LOCUS_05630 gene purC 20771 21532 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 protein_id gnl|my_center|LOCUS_05630 21584 21832 gene locus_tag LOCUS_05640 gene purS 21584 21832 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB02 protein_id gnl|my_center|LOCUS_05640 21841 22545 gene locus_tag LOCUS_05650 gene purQ 21841 22545 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5F3 protein_id gnl|my_center|LOCUS_05650 >Feature sequence019 1347 10 gene locus_tag LOCUS_05660 1347 10 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090251.1 protein_id gnl|my_center|LOCUS_05660 1456 2397 gene locus_tag LOCUS_05670 gene argC 1456 2397 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H555 protein_id gnl|my_center|LOCUS_05670 2390 3232 gene locus_tag LOCUS_05680 2390 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4177 3227 gene locus_tag LOCUS_05690 gene ubiA 4177 3227 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DB8 protein_id gnl|my_center|LOCUS_05690 4295 5056 gene locus_tag LOCUS_05700 4295 5056 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_05700 5102 6466 gene locus_tag LOCUS_05710 5102 6466 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_05710 6546 7745 gene locus_tag LOCUS_05720 6546 7745 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_05720 9181 7742 gene locus_tag LOCUS_05730 9181 7742 CDS product Zn-dependent protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265953.1 protein_id gnl|my_center|LOCUS_05730 9485 10396 gene locus_tag LOCUS_05740 gene ctaC 9485 10396 CDS product putative cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC6 protein_id gnl|my_center|LOCUS_05740 10419 12008 gene locus_tag LOCUS_05750 gene ctaD 10419 12008 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RG9 protein_id gnl|my_center|LOCUS_05750 12059 12979 gene locus_tag LOCUS_05760 gene ctaB 12059 12979 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_05760 12976 13134 gene locus_tag LOCUS_05770 12976 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 13131 13691 gene locus_tag LOCUS_05780 gene ctaG 13131 13691 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_05780 13769 14554 gene locus_tag LOCUS_05790 gene coxC 13769 14554 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_05790 14680 15432 gene locus_tag LOCUS_05800 14680 15432 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6V2 protein_id gnl|my_center|LOCUS_05800 15432 16841 gene locus_tag LOCUS_05810 15432 16841 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_05810 16838 18103 gene locus_tag LOCUS_05820 16838 18103 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971146.1 protein_id gnl|my_center|LOCUS_05820 18722 18126 gene locus_tag LOCUS_05830 18722 18126 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T801 protein_id gnl|my_center|LOCUS_05830 19003 21009 gene locus_tag LOCUS_05840 19003 21009 CDS product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_05840 21081 21566 gene locus_tag LOCUS_05850 21081 21566 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 protein_id gnl|my_center|LOCUS_05850 22012 21575 gene locus_tag LOCUS_05860 gene rnhA 22012 21575 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6V5 protein_id gnl|my_center|LOCUS_05860 22974 22009 gene locus_tag LOCUS_05870 gene thrB 22974 22009 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK2 protein_id gnl|my_center|LOCUS_05870 <23954 22999 gene locus_tag LOCUS_05880 <23954 22999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5X0:4-hydroxy-3-methylbut-2-enyl diphosphate reductase >Feature sequence020 1280 210 gene locus_tag LOCUS_05890 1280 210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067117.1 protein_id gnl|my_center|LOCUS_05890 2413 1289 gene locus_tag LOCUS_05900 2413 1289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709583.1 protein_id gnl|my_center|LOCUS_05900 4304 2568 gene locus_tag LOCUS_05910 4304 2568 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337642.1 protein_id gnl|my_center|LOCUS_05910 4548 5318 gene locus_tag LOCUS_05920 4548 5318 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085220.1 protein_id gnl|my_center|LOCUS_05920 5339 6988 gene locus_tag LOCUS_05930 gene glpD 5339 6988 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J310 protein_id gnl|my_center|LOCUS_05930 7059 7904 gene locus_tag LOCUS_05940 7059 7904 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 protein_id gnl|my_center|LOCUS_05940 7962 8885 gene locus_tag LOCUS_05950 7962 8885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_05950 8890 9651 gene locus_tag LOCUS_05960 8890 9651 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGP9 protein_id gnl|my_center|LOCUS_05960 10505 9666 gene locus_tag LOCUS_05970 gene mvrA 10505 9666 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971635.1 protein_id gnl|my_center|LOCUS_05970 11494 10733 gene locus_tag LOCUS_05980 gene hyi 11494 10733 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63KE1 protein_id gnl|my_center|LOCUS_05980 12187 11591 gene locus_tag LOCUS_05990 12187 11591 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707333.1 protein_id gnl|my_center|LOCUS_05990 12329 13756 gene locus_tag LOCUS_06000 gene uxaC 12329 13756 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0M5 protein_id gnl|my_center|LOCUS_06000 13753 15192 gene locus_tag LOCUS_06010 gene uxuB 13753 15192 CDS product mannitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139922.1 protein_id gnl|my_center|LOCUS_06010 15189 16373 gene locus_tag LOCUS_06020 gene uxuA 15189 16373 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2M8 protein_id gnl|my_center|LOCUS_06020 16377 17297 gene locus_tag LOCUS_06030 gene kdgK 16377 17297 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969920.1 protein_id gnl|my_center|LOCUS_06030 17405 18253 gene locus_tag LOCUS_06040 17405 18253 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_06040 18297 19262 gene locus_tag LOCUS_06050 18297 19262 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731057.1 protein_id gnl|my_center|LOCUS_06050 19786 19274 gene locus_tag LOCUS_06060 gene idnK 19786 19274 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930C7 protein_id gnl|my_center|LOCUS_06060 20874 19789 gene locus_tag LOCUS_06070 gene ugpC 20874 19789 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJF1 protein_id gnl|my_center|LOCUS_06070 21754 20903 gene locus_tag LOCUS_06080 gene ugpE 21754 20903 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYN3 protein_id gnl|my_center|LOCUS_06080 22635 21754 gene locus_tag LOCUS_06090 22635 21754 CDS product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969345.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence021 1339 527 gene locus_tag LOCUS_06100 gene lpxA 1339 527 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_06100 1812 1354 gene locus_tag LOCUS_06110 gene fabZ 1812 1354 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_06110 2863 1826 gene locus_tag LOCUS_06120 gene lpxD 2863 1826 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR0 protein_id gnl|my_center|LOCUS_06120 3460 2873 gene locus_tag LOCUS_06130 3460 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 5915 3636 gene locus_tag LOCUS_06140 gene bamA 5915 3636 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 protein_id gnl|my_center|LOCUS_06140 7095 6013 gene locus_tag LOCUS_06150 7095 6013 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_06150 8331 7129 gene locus_tag LOCUS_06160 gene dxr 8331 7129 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_06160 9105 8344 gene locus_tag LOCUS_06170 gene cdsA 9105 8344 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV8 protein_id gnl|my_center|LOCUS_06170 9821 9105 gene locus_tag LOCUS_06180 9821 9105 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 protein_id gnl|my_center|LOCUS_06180 10491 9934 gene locus_tag LOCUS_06190 gene frr 10491 9934 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM0 protein_id gnl|my_center|LOCUS_06190 11272 10538 gene locus_tag LOCUS_06200 gene pyrH 11272 10538 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A705 protein_id gnl|my_center|LOCUS_06200 12210 11293 gene locus_tag LOCUS_06210 gene tsf 12210 11293 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_06210 13169 12303 gene locus_tag LOCUS_06220 gene rpsB 13169 12303 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU09 protein_id gnl|my_center|LOCUS_06220 16843 13379 gene locus_tag LOCUS_06230 16843 13379 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_06230 17664 16963 gene locus_tag LOCUS_06240 gene lolD1 17664 16963 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_06240 18913 17657 gene locus_tag LOCUS_06250 18913 17657 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_06250 20283 18970 gene locus_tag LOCUS_06260 gene proS 20283 18970 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU19 protein_id gnl|my_center|LOCUS_06260 21486 20401 gene locus_tag LOCUS_06270 21486 20401 CDS product 3-hydroxyisobutyryl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958492.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence022 2055 823 gene locus_tag LOCUS_06280 2055 823 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089330.1 protein_id gnl|my_center|LOCUS_06280 2747 2067 gene locus_tag LOCUS_06290 2747 2067 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_06290 3268 2744 gene locus_tag LOCUS_06300 3268 2744 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969945.1 protein_id gnl|my_center|LOCUS_06300 4009 3548 gene locus_tag LOCUS_06310 4009 3548 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ9 protein_id gnl|my_center|LOCUS_06310 4544 4131 gene locus_tag LOCUS_06320 4544 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6085 4601 gene locus_tag LOCUS_06330 6085 4601 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_06330 6131 6301 gene locus_tag LOCUS_06340 6131 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6286 6732 gene locus_tag LOCUS_06350 6286 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6800 7741 gene locus_tag LOCUS_06360 gene socC 6800 7741 CDS product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_06360 7744 8907 gene locus_tag LOCUS_06370 7744 8907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_06370 9558 8926 gene locus_tag LOCUS_06380 gene eda 9558 8926 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224222.1 protein_id gnl|my_center|LOCUS_06380 11387 9558 gene locus_tag LOCUS_06390 gene edd 11387 9558 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971001.1 protein_id gnl|my_center|LOCUS_06390 12007 11384 gene locus_tag LOCUS_06400 gene pgl 12007 11384 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764047.1 protein_id gnl|my_center|LOCUS_06400 13497 12007 gene locus_tag LOCUS_06410 gene zwf 13497 12007 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_06410 14513 13533 gene locus_tag LOCUS_06420 gene glk 14513 13533 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8Q0 protein_id gnl|my_center|LOCUS_06420 15809 14706 gene locus_tag LOCUS_06430 15809 14706 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709787.1 protein_id gnl|my_center|LOCUS_06430 16705 15815 gene locus_tag LOCUS_06440 16705 15815 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387855.1 protein_id gnl|my_center|LOCUS_06440 17570 16695 gene locus_tag LOCUS_06450 17570 16695 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387854.1 protein_id gnl|my_center|LOCUS_06450 18875 17628 gene locus_tag LOCUS_06460 18875 17628 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387853.1 protein_id gnl|my_center|LOCUS_06460 19101 19838 gene locus_tag LOCUS_06470 19101 19838 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_06470 19838 21292 gene locus_tag LOCUS_06480 19838 21292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence023 187 111 gene locus_tag LOCUS_t00050 187 111 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 534 1016 gene locus_tag LOCUS_06490 gene gpt 534 1016 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D63 protein_id gnl|my_center|LOCUS_06490 2479 1064 gene locus_tag LOCUS_06500 gene regM 2479 1064 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538002.1 protein_id gnl|my_center|LOCUS_06500 2789 2923 gene locus_tag LOCUS_06510 2789 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2946 3305 gene locus_tag LOCUS_06520 gene rnpA 2946 3305 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 protein_id gnl|my_center|LOCUS_06520 3328 3633 gene locus_tag LOCUS_06530 3328 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3638 5416 gene locus_tag LOCUS_06540 gene yidC 3638 5416 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_06540 5353 6042 gene locus_tag LOCUS_06550 gene engB 5353 6042 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY4 protein_id gnl|my_center|LOCUS_06550 6206 7111 gene locus_tag LOCUS_06560 gene argB 6206 7111 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_06560 7121 7813 gene locus_tag LOCUS_06570 7121 7813 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968572.1 protein_id gnl|my_center|LOCUS_06570 7909 8769 gene locus_tag LOCUS_06580 gene dapD 7909 8769 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM2 protein_id gnl|my_center|LOCUS_06580 8773 9951 gene locus_tag LOCUS_06590 gene dapE 8773 9951 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM1 protein_id gnl|my_center|LOCUS_06590 10041 10523 gene locus_tag LOCUS_06600 10041 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 11257 10493 gene locus_tag LOCUS_06610 gene truA 11257 10493 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNZ9 protein_id gnl|my_center|LOCUS_06610 12213 11254 gene locus_tag LOCUS_06620 gene fmt 12213 11254 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF25 protein_id gnl|my_center|LOCUS_06620 12759 12226 gene locus_tag LOCUS_06630 gene def 12759 12226 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5I4 protein_id gnl|my_center|LOCUS_06630 12997 14076 gene locus_tag LOCUS_06640 12997 14076 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_06640 14666 14073 gene locus_tag LOCUS_06650 gene recR 14666 14073 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ6 protein_id gnl|my_center|LOCUS_06650 15039 14716 gene locus_tag LOCUS_06660 15039 14716 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT50 protein_id gnl|my_center|LOCUS_06660 16859 15039 gene locus_tag LOCUS_06670 16859 15039 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 protein_id gnl|my_center|LOCUS_06670 18050 17163 gene locus_tag LOCUS_06680 gene pheA 18050 17163 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_06680 18826 18089 gene locus_tag LOCUS_06690 gene kdsB 18826 18089 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMT3 protein_id gnl|my_center|LOCUS_06690 18999 19583 gene locus_tag LOCUS_06700 18999 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19567 20400 gene locus_tag LOCUS_06710 19567 20400 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence024 3884 1074 gene locus_tag LOCUS_06720 3884 1074 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_06720 5634 3916 gene locus_tag LOCUS_06730 5634 3916 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_06730 5918 5724 gene locus_tag LOCUS_06740 5918 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265963.1 protein_id gnl|my_center|LOCUS_06740 6923 6219 gene locus_tag LOCUS_06750 6923 6219 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 protein_id gnl|my_center|LOCUS_06750 7398 7763 gene locus_tag LOCUS_06760 gene dksA 7398 7763 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 protein_id gnl|my_center|LOCUS_06760 8135 9238 gene locus_tag LOCUS_06770 gene recA 8135 9238 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_06770 9517 12156 gene locus_tag LOCUS_06780 gene alaS1 9517 12156 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD92 protein_id gnl|my_center|LOCUS_06780 13448 12234 gene locus_tag LOCUS_06790 13448 12234 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_06790 14174 13632 gene locus_tag LOCUS_06800 14174 13632 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_06800 14278 15372 gene locus_tag LOCUS_06810 14278 15372 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_06810 15463 16245 gene locus_tag LOCUS_06820 gene psd 15463 16245 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BX0 protein_id gnl|my_center|LOCUS_06820 16245 16883 gene locus_tag LOCUS_06830 gene ynjF 16245 16883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 protein_id gnl|my_center|LOCUS_06830 16914 19226 gene locus_tag LOCUS_06840 16914 19226 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_06840 19282 19692 gene locus_tag LOCUS_06850 gene msrB 19282 19692 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B11 protein_id gnl|my_center|LOCUS_06850 20262 19864 gene locus_tag LOCUS_06860 20262 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence025 715 266 gene locus_tag LOCUS_06870 715 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 833 1567 gene locus_tag LOCUS_06880 833 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1605 2957 gene locus_tag LOCUS_06890 gene TrmA 1605 2957 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_06890 2982 3191 gene locus_tag LOCUS_06900 2982 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3336 4076 gene locus_tag LOCUS_06910 3336 4076 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103822.1 protein_id gnl|my_center|LOCUS_06910 4136 6184 gene locus_tag LOCUS_06920 4136 6184 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528605.1 protein_id gnl|my_center|LOCUS_06920 6878 6207 gene locus_tag LOCUS_06930 6878 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888632.1 protein_id gnl|my_center|LOCUS_06930 6966 7577 gene locus_tag LOCUS_06940 6966 7577 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_06940 8383 7613 gene locus_tag LOCUS_06950 8383 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8628 9662 gene locus_tag LOCUS_06960 8628 9662 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_06960 9845 10501 gene locus_tag LOCUS_06970 gene rhtC 9845 10501 CDS product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764543.1 protein_id gnl|my_center|LOCUS_06970 11156 10569 gene locus_tag LOCUS_06980 11156 10569 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261706.1 protein_id gnl|my_center|LOCUS_06980 12120 11263 gene locus_tag LOCUS_06990 gene ada 12120 11263 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_06990 12441 12365 gene locus_tag LOCUS_t00060 12441 12365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14594 12564 gene locus_tag LOCUS_07000 gene rpoD 14594 12564 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB6 protein_id gnl|my_center|LOCUS_07000 16477 14795 gene locus_tag LOCUS_07010 gene dnaG 16477 14795 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB5 protein_id gnl|my_center|LOCUS_07010 17083 16625 gene locus_tag LOCUS_07020 17083 16625 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_07020 17332 18525 gene locus_tag LOCUS_07030 gene carA 17332 18525 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_07030 >Feature sequence026 1312 689 gene locus_tag LOCUS_07040 gene ruvA 1312 689 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF6 protein_id gnl|my_center|LOCUS_07040 1911 1309 gene locus_tag LOCUS_07050 1911 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2723 1923 gene locus_tag LOCUS_07060 2723 1923 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_07060 3578 2754 gene locus_tag LOCUS_07070 3578 2754 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_07070 4209 3613 gene locus_tag LOCUS_07080 4209 3613 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG0 protein_id gnl|my_center|LOCUS_07080 4729 4406 gene locus_tag LOCUS_07090 4729 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4971 4726 gene locus_tag LOCUS_07100 4971 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5342 7342 gene locus_tag LOCUS_07110 gene tklB 5342 7342 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX58 protein_id gnl|my_center|LOCUS_07110 7438 8448 gene locus_tag LOCUS_07120 gene gapB 7438 8448 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX57 protein_id gnl|my_center|LOCUS_07120 8480 9046 gene locus_tag LOCUS_07130 gene efp 8480 9046 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_07130 9196 9996 gene locus_tag LOCUS_07140 9196 9996 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_07140 10165 11229 gene locus_tag LOCUS_07150 10165 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 11233 12402 gene locus_tag LOCUS_07160 11233 12402 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_07160 12757 13374 gene locus_tag LOCUS_07170 12757 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15193 13379 gene locus_tag LOCUS_07180 15193 13379 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384807.1 protein_id gnl|my_center|LOCUS_07180 15392 15613 gene locus_tag LOCUS_07190 gene rpmE 15392 15613 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVH2 protein_id gnl|my_center|LOCUS_07190 18383 15717 gene locus_tag LOCUS_07200 18383 15717 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 protein_id gnl|my_center|LOCUS_07200 <20069 18502 gene locus_tag LOCUS_07210 <20069 18502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ43:glycine--tRNA ligase beta subunit >Feature sequence027 125 907 gene locus_tag LOCUS_07220 125 907 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_07220 2184 910 gene locus_tag LOCUS_07230 gene rnd 2184 910 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_07230 2287 3048 gene locus_tag LOCUS_07240 2287 3048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 protein_id gnl|my_center|LOCUS_07240 3952 3065 gene locus_tag LOCUS_07250 3952 3065 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_07250 4141 3974 gene locus_tag LOCUS_07260 gene rpmG 4141 3974 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE5 protein_id gnl|my_center|LOCUS_07260 6523 4223 gene locus_tag LOCUS_07270 gene rnr 6523 4223 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE7 protein_id gnl|my_center|LOCUS_07270 9120 6523 gene locus_tag LOCUS_07280 gene topA 9120 6523 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE8 protein_id gnl|my_center|LOCUS_07280 10317 9214 gene locus_tag LOCUS_07290 10317 9214 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_07290 10997 10374 gene locus_tag LOCUS_07300 gene plsY 10997 10374 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G9 protein_id gnl|my_center|LOCUS_07300 12300 11014 gene locus_tag LOCUS_07310 gene pyrC 12300 11014 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 protein_id gnl|my_center|LOCUS_07310 13277 12297 gene locus_tag LOCUS_07320 gene pyrB 13277 12297 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPG0 protein_id gnl|my_center|LOCUS_07320 13833 13354 gene locus_tag LOCUS_07330 13833 13354 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QL0 protein_id gnl|my_center|LOCUS_07330 13839 14177 gene locus_tag LOCUS_07340 gene gatC 13839 14177 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH3 protein_id gnl|my_center|LOCUS_07340 14177 15655 gene locus_tag LOCUS_07350 gene gatA 14177 15655 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK7 protein_id gnl|my_center|LOCUS_07350 15655 17109 gene locus_tag LOCUS_07360 gene gatB 15655 17109 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLB6 protein_id gnl|my_center|LOCUS_07360 17870 17121 gene locus_tag LOCUS_07370 17870 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 18583 17858 gene locus_tag LOCUS_07380 18583 17858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 18962 19053 gene locus_tag LOCUS_t00070 18962 19053 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence028 1210 71 gene locus_tag LOCUS_07390 gene queG 1210 71 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_07390 2373 1240 gene locus_tag LOCUS_07400 gene tgt 2373 1240 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR0 protein_id gnl|my_center|LOCUS_07400 3467 2376 gene locus_tag LOCUS_07410 gene queA 3467 2376 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ9 protein_id gnl|my_center|LOCUS_07410 4413 3472 gene locus_tag LOCUS_07420 4413 3472 CDS product putative arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45313 protein_id gnl|my_center|LOCUS_07420 5237 4605 gene locus_tag LOCUS_07430 gene mobA 5237 4605 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_07430 6136 5234 gene locus_tag LOCUS_07440 gene fdhD 6136 5234 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU0 protein_id gnl|my_center|LOCUS_07440 6321 7079 gene locus_tag LOCUS_07450 gene nadK 6321 7079 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ74 protein_id gnl|my_center|LOCUS_07450 7160 7531 gene locus_tag LOCUS_07460 7160 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7531 8694 gene locus_tag LOCUS_07470 7531 8694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084926.1 protein_id gnl|my_center|LOCUS_07470 9635 8697 gene locus_tag LOCUS_07480 9635 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 11473 9635 gene locus_tag LOCUS_07490 11473 9635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810841.1 protein_id gnl|my_center|LOCUS_07490 11894 11544 gene locus_tag LOCUS_07500 11894 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_07500 12497 11958 gene locus_tag LOCUS_07510 12497 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 13792 12545 gene locus_tag LOCUS_07520 13792 12545 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9I0 protein_id gnl|my_center|LOCUS_07520 15054 13789 gene locus_tag LOCUS_07530 15054 13789 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_07530 15784 15029 gene locus_tag LOCUS_07540 gene SufC 15784 15029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_07540 17256 15805 gene locus_tag LOCUS_07550 17256 15805 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_07550 17835 17323 gene locus_tag LOCUS_07560 17835 17323 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_07560 18382 18053 gene locus_tag LOCUS_07570 18382 18053 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 protein_id gnl|my_center|LOCUS_07570 18451 18600 gene locus_tag LOCUS_07580 18451 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 18789 18604 gene locus_tag LOCUS_07590 gene rpmF 18789 18604 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7K2 protein_id gnl|my_center|LOCUS_07590 >Feature sequence029 709 5 gene locus_tag LOCUS_07600 gene phoR1 709 5 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719748.1 protein_id gnl|my_center|LOCUS_07600 1444 740 gene locus_tag LOCUS_07610 gene phoU 1444 740 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J377 protein_id gnl|my_center|LOCUS_07610 2315 1452 gene locus_tag LOCUS_07620 gene pstB 2315 1452 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 protein_id gnl|my_center|LOCUS_07620 3629 2325 gene locus_tag LOCUS_07630 3629 2325 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_07630 5043 3622 gene locus_tag LOCUS_07640 5043 3622 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_07640 6122 5070 gene locus_tag LOCUS_07650 6122 5070 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_07650 6082 6255 gene locus_tag LOCUS_07660 6082 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7322 6258 gene locus_tag LOCUS_07670 7322 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7862 8836 gene locus_tag LOCUS_07680 7862 8836 CDS product tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088775.1 protein_id gnl|my_center|LOCUS_07680 8924 9415 gene locus_tag LOCUS_07690 8924 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 9427 10947 gene locus_tag LOCUS_07700 9427 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_07700 10960 12513 gene locus_tag LOCUS_07710 10960 12513 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336835.1 protein_id gnl|my_center|LOCUS_07710 12535 13509 gene locus_tag LOCUS_07720 12535 13509 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_07720 14842 13625 gene locus_tag LOCUS_07730 14842 13625 CDS product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709136.1 protein_id gnl|my_center|LOCUS_07730 14991 16397 gene locus_tag LOCUS_07740 14991 16397 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_07740 16731 17807 gene locus_tag LOCUS_07750 16731 17807 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_07750 17808 18701 gene locus_tag LOCUS_07760 17808 18701 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_07760 18946 18857 gene locus_tag LOCUS_t00080 18946 18857 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 498 764 gene locus_tag LOCUS_07770 498 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2421 880 gene locus_tag LOCUS_07780 2421 880 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCQ6 protein_id gnl|my_center|LOCUS_07780 2772 3008 gene locus_tag LOCUS_07790 2772 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3441 2944 gene locus_tag LOCUS_07800 3441 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3634 4398 gene locus_tag LOCUS_07810 gene motA 3634 4398 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338091.1 protein_id gnl|my_center|LOCUS_07810 4461 5615 gene locus_tag LOCUS_07820 gene motB 4461 5615 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338090.1 protein_id gnl|my_center|LOCUS_07820 6956 6078 gene locus_tag LOCUS_07830 6956 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7763 7026 gene locus_tag LOCUS_07840 7763 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8217 7996 gene locus_tag LOCUS_07850 8217 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9374 8217 gene locus_tag LOCUS_07860 gene flhB 9374 8217 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337964.1 protein_id gnl|my_center|LOCUS_07860 10188 9367 gene locus_tag LOCUS_07870 gene fliR 10188 9367 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U5 protein_id gnl|my_center|LOCUS_07870 10463 10197 gene locus_tag LOCUS_07880 gene fliQ 10463 10197 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720212.1 protein_id gnl|my_center|LOCUS_07880 11296 10511 gene locus_tag LOCUS_07890 gene fliP 11296 10511 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U7 protein_id gnl|my_center|LOCUS_07890 11751 11293 gene locus_tag LOCUS_07900 11751 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 12291 11953 gene locus_tag LOCUS_07910 gene fliN 12291 11953 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U9 protein_id gnl|my_center|LOCUS_07910 13324 12350 gene locus_tag LOCUS_07920 gene fliM 13324 12350 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337962.1 protein_id gnl|my_center|LOCUS_07920 13929 13351 gene locus_tag LOCUS_07930 gene fliL 13929 13351 CDS product flagellar basal body protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720207.1 protein_id gnl|my_center|LOCUS_07930 15954 13957 gene locus_tag LOCUS_07940 15954 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 16480 16058 gene locus_tag LOCUS_07950 16480 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 17808 16480 gene locus_tag LOCUS_07960 gene fliI 17808 16480 CDS product flagellum-specific ATP synthase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337959.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence031 937 8 gene locus_tag LOCUS_07970 gene ispE 937 8 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHP8 protein_id gnl|my_center|LOCUS_07970 2782 1010 gene locus_tag LOCUS_07980 2782 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_07980 4543 2900 gene locus_tag LOCUS_07990 4543 2900 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_07990 4900 5832 gene locus_tag LOCUS_08000 4900 5832 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532622.1 protein_id gnl|my_center|LOCUS_08000 5936 7651 gene locus_tag LOCUS_08010 5936 7651 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_08010 7718 8278 gene locus_tag LOCUS_08020 7718 8278 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_08020 8278 8985 gene locus_tag LOCUS_08030 gene rnhB 8278 8985 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE1 protein_id gnl|my_center|LOCUS_08030 9308 10399 gene locus_tag LOCUS_08040 9308 10399 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Z4 protein_id gnl|my_center|LOCUS_08040 10941 10423 gene locus_tag LOCUS_08050 gene apt 10941 10423 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT4 protein_id gnl|my_center|LOCUS_08050 13108 10934 gene locus_tag LOCUS_08060 gene glcB 13108 10934 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBD2 protein_id gnl|my_center|LOCUS_08060 14739 13348 gene locus_tag LOCUS_08070 14739 13348 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_08070 15599 14739 gene locus_tag LOCUS_08080 15599 14739 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_08080 15691 16278 gene locus_tag LOCUS_08090 gene gmhA 15691 16278 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67054 protein_id gnl|my_center|LOCUS_08090 16367 17671 gene locus_tag LOCUS_08100 16367 17671 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_08100 18152 17724 gene locus_tag LOCUS_08110 18152 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence032 141 1007 gene locus_tag LOCUS_08120 gene smoF 141 1007 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337987.1 protein_id gnl|my_center|LOCUS_08120 1018 1848 gene locus_tag LOCUS_08130 gene smoG 1018 1848 CDS product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969939.1 protein_id gnl|my_center|LOCUS_08130 1859 2863 gene locus_tag LOCUS_08140 gene smoK 1859 2863 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 protein_id gnl|my_center|LOCUS_08140 2860 3633 gene locus_tag LOCUS_08150 gene smoS 2860 3633 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708985.1 protein_id gnl|my_center|LOCUS_08150 3621 5135 gene locus_tag LOCUS_08160 gene mtlK 3621 5135 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337991.1 protein_id gnl|my_center|LOCUS_08160 5252 5179 gene locus_tag LOCUS_t00090 5252 5179 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6699 5362 gene locus_tag LOCUS_08170 6699 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917964.1 protein_id gnl|my_center|LOCUS_08170 7820 6699 gene locus_tag LOCUS_08180 7820 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8659 7817 gene locus_tag LOCUS_08190 8659 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 9711 8722 gene locus_tag LOCUS_08200 gene hemC 9711 8722 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF1 protein_id gnl|my_center|LOCUS_08200 9803 10882 gene locus_tag LOCUS_08210 gene tsaD 9803 10882 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_08210 10879 11853 gene locus_tag LOCUS_08220 gene gpsA 10879 11853 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV4 protein_id gnl|my_center|LOCUS_08220 11889 12308 gene locus_tag LOCUS_08230 11889 12308 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_08230 12680 12312 gene locus_tag LOCUS_08240 12680 12312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 13470 12682 gene locus_tag LOCUS_08250 gene dpm1 13470 12682 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_08250 15178 13517 gene locus_tag LOCUS_08260 15178 13517 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_08260 15385 16746 gene locus_tag LOCUS_08270 15385 16746 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704205.1 protein_id gnl|my_center|LOCUS_08270 16767 18173 gene locus_tag LOCUS_08280 16767 18173 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957670.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence033 195 662 gene locus_tag LOCUS_08290 195 662 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_08290 604 939 gene locus_tag LOCUS_08300 604 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1068 1712 gene locus_tag LOCUS_08310 1068 1712 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 protein_id gnl|my_center|LOCUS_08310 1709 3040 gene locus_tag LOCUS_08320 1709 3040 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390577.1 protein_id gnl|my_center|LOCUS_08320 3048 3311 gene locus_tag LOCUS_08330 3048 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3465 3540 gene locus_tag LOCUS_t00100 3465 3540 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3783 4046 gene locus_tag LOCUS_08340 3783 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4597 4088 gene locus_tag LOCUS_08350 4597 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5887 4607 gene locus_tag LOCUS_08360 5887 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 7020 5980 gene locus_tag LOCUS_08370 7020 5980 CDS product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064210.1 protein_id gnl|my_center|LOCUS_08370 7457 8605 gene locus_tag LOCUS_08380 7457 8605 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_08380 8675 10165 gene locus_tag LOCUS_08390 8675 10165 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777126.1 protein_id gnl|my_center|LOCUS_08390 10276 11751 gene locus_tag LOCUS_08400 10276 11751 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_08400 12003 12224 gene locus_tag LOCUS_08410 12003 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 13557 12337 gene locus_tag LOCUS_08420 13557 12337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_08420 14683 14003 gene locus_tag LOCUS_08430 14683 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15837 14701 gene locus_tag LOCUS_08440 15837 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090158.1 protein_id gnl|my_center|LOCUS_08440 17155 15839 gene locus_tag LOCUS_08450 17155 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 17532 17362 gene locus_tag LOCUS_08460 17532 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence034 239 1132 gene locus_tag LOCUS_08470 gene folD 239 1132 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_08470 1179 1379 gene locus_tag LOCUS_08480 1179 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1414 1998 gene locus_tag LOCUS_08490 1414 1998 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_08490 2076 2825 gene locus_tag LOCUS_08500 2076 2825 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529425.1 protein_id gnl|my_center|LOCUS_08500 2828 3760 gene locus_tag LOCUS_08510 gene etfA 2828 3760 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_08510 4389 3757 gene locus_tag LOCUS_08520 4389 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4503 5840 gene locus_tag LOCUS_08530 gene argH 4503 5840 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 protein_id gnl|my_center|LOCUS_08530 5853 5984 gene locus_tag LOCUS_08540 5853 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6033 7292 gene locus_tag LOCUS_08550 gene lysA 6033 7292 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UN3 protein_id gnl|my_center|LOCUS_08550 7434 8057 gene locus_tag LOCUS_08560 7434 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084209.1 protein_id gnl|my_center|LOCUS_08560 8932 8054 gene locus_tag LOCUS_08570 8932 8054 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_08570 9661 8960 gene locus_tag LOCUS_08580 9661 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10481 9759 gene locus_tag LOCUS_08590 10481 9759 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529379.1 protein_id gnl|my_center|LOCUS_08590 11030 10650 gene locus_tag LOCUS_08600 11030 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 12025 11069 gene locus_tag LOCUS_08610 12025 11069 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 protein_id gnl|my_center|LOCUS_08610 12600 12100 gene locus_tag LOCUS_08620 12600 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_08620 12728 13948 gene locus_tag LOCUS_08630 12728 13948 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_08630 14307 14813 gene locus_tag LOCUS_08640 14307 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 14891 15160 gene locus_tag LOCUS_08650 gene rpmA 14891 15160 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_08650 15399 16433 gene locus_tag LOCUS_08660 gene obg 15399 16433 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_08660 16421 17617 gene locus_tag LOCUS_08670 gene proB1 16421 17617 CDS product glutamate 5-kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB3 protein_id gnl|my_center|LOCUS_08670 >Feature sequence035 <1 840 gene locus_tag LOCUS_08680 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:glycine cleavage system protein T 1859 837 gene locus_tag LOCUS_08690 1859 837 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_08690 2020 2922 gene locus_tag LOCUS_08700 gene dapA 2020 2922 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT80 protein_id gnl|my_center|LOCUS_08700 2948 3415 gene locus_tag LOCUS_08710 gene smpB 2948 3415 CDS product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT81 protein_id gnl|my_center|LOCUS_08710 4095 3418 gene locus_tag LOCUS_08720 4095 3418 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_08720 4648 4085 gene locus_tag LOCUS_08730 4648 4085 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_08730 4854 5354 gene locus_tag LOCUS_08740 4854 5354 CDS product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_08740 5461 5871 gene locus_tag LOCUS_08750 gene rpoZ 5461 5871 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT88 protein_id gnl|my_center|LOCUS_08750 5937 8075 gene locus_tag LOCUS_08760 5937 8075 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_08760 8093 8734 gene locus_tag LOCUS_08770 8093 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 protein_id gnl|my_center|LOCUS_08770 8774 9538 gene locus_tag LOCUS_08780 gene pdxJ 8774 9538 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_08780 9535 9945 gene locus_tag LOCUS_08790 gene acpS 9535 9945 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ6 protein_id gnl|my_center|LOCUS_08790 9947 10678 gene locus_tag LOCUS_08800 9947 10678 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_08800 10678 11355 gene locus_tag LOCUS_08810 gene rnc 10678 11355 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 protein_id gnl|my_center|LOCUS_08810 11355 12263 gene locus_tag LOCUS_08820 gene era 11355 12263 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8I7 protein_id gnl|my_center|LOCUS_08820 12256 13017 gene locus_tag LOCUS_08830 gene recO 12256 13017 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT96 protein_id gnl|my_center|LOCUS_08830 13045 15267 gene locus_tag LOCUS_08840 gene parC 13045 15267 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_08840 16040 15303 gene locus_tag LOCUS_08850 gene ate 16040 15303 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z5 protein_id gnl|my_center|LOCUS_08850 17348 16128 gene locus_tag LOCUS_08860 17348 16128 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_08860 17605 17450 gene locus_tag LOCUS_08870 17605 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence036 <1 1394 gene locus_tag LOCUS_08880 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UDF5:putative multidrug resistance protein NorM 1458 4376 gene locus_tag LOCUS_08890 gene glnE 1458 4376 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMN1 protein_id gnl|my_center|LOCUS_08890 4632 5924 gene locus_tag LOCUS_08900 4632 5924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_08900 6170 6613 gene locus_tag LOCUS_08910 6170 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6734 6940 gene locus_tag LOCUS_08920 6734 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7384 6965 gene locus_tag LOCUS_08930 7384 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389917.1 protein_id gnl|my_center|LOCUS_08930 8842 7433 gene locus_tag LOCUS_08940 8842 7433 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_08940 10502 9042 gene locus_tag LOCUS_08950 10502 9042 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_08950 10741 12045 gene locus_tag LOCUS_08960 10741 12045 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974516.1 protein_id gnl|my_center|LOCUS_08960 13495 12179 gene locus_tag LOCUS_08970 13495 12179 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067368.1 protein_id gnl|my_center|LOCUS_08970 14474 13497 gene locus_tag LOCUS_08980 14474 13497 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 protein_id gnl|my_center|LOCUS_08980 15385 14648 gene locus_tag LOCUS_08990 15385 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 16737 15607 gene locus_tag LOCUS_09000 16737 15607 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_09000 <17404 16770 gene locus_tag LOCUS_09010 <17404 16770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389656.1:ABC transporter permease >Feature sequence037 1149 2483 gene locus_tag LOCUS_09020 gene glmU 1149 2483 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_09020 2531 3979 gene locus_tag LOCUS_09030 gene hldE 2531 3979 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_09030 5249 3993 gene locus_tag LOCUS_09040 gene bacA 5249 3993 CDS product bacteroid development protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08120 protein_id gnl|my_center|LOCUS_09040 6439 5348 gene locus_tag LOCUS_09050 gene rodA 6439 5348 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_09050 8388 6436 gene locus_tag LOCUS_09060 8388 6436 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_09060 8924 8385 gene locus_tag LOCUS_09070 8924 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9781 8924 gene locus_tag LOCUS_09080 9781 8924 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 protein_id gnl|my_center|LOCUS_09080 10889 9852 gene locus_tag LOCUS_09090 10889 9852 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_09090 12025 11006 gene locus_tag LOCUS_09100 gene ilvC 12025 11006 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G50 protein_id gnl|my_center|LOCUS_09100 12637 12113 gene locus_tag LOCUS_09110 gene ilvH 12637 12113 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089241.1 protein_id gnl|my_center|LOCUS_09110 14494 12674 gene locus_tag LOCUS_09120 14494 12674 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 protein_id gnl|my_center|LOCUS_09120 15510 14686 gene locus_tag LOCUS_09130 gene miaA 15510 14686 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX74 protein_id gnl|my_center|LOCUS_09130 15667 15497 gene locus_tag LOCUS_09140 15667 15497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 15724 16620 gene locus_tag LOCUS_09150 15724 16620 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence038 <1 1244 gene locus_tag LOCUS_09160 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969823.1:oxidoreductase 1247 3718 gene locus_tag LOCUS_09170 1247 3718 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887734.1 protein_id gnl|my_center|LOCUS_09170 3755 5302 gene locus_tag LOCUS_09180 gene mttB 3755 5302 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708704.1 protein_id gnl|my_center|LOCUS_09180 5431 7203 gene locus_tag LOCUS_09190 5431 7203 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_09190 9542 7200 gene locus_tag LOCUS_09200 9542 7200 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_09200 10384 9587 gene locus_tag LOCUS_09210 10384 9587 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_09210 11707 10409 gene locus_tag LOCUS_09220 gene cysD 11707 10409 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_09220 12892 11858 gene locus_tag LOCUS_09230 12892 11858 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_09230 13380 12901 gene locus_tag LOCUS_09240 gene trmL 13380 12901 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH4 protein_id gnl|my_center|LOCUS_09240 13609 13409 gene locus_tag LOCUS_09250 13609 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 15226 13619 gene locus_tag LOCUS_09260 15226 13619 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083178.1 protein_id gnl|my_center|LOCUS_09260 16205 15255 gene locus_tag LOCUS_09270 16205 15255 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence039 <1 764 gene locus_tag LOCUS_09280 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708345.1:uroporphyrin-III C-methyltransferase 764 2116 gene locus_tag LOCUS_09290 gene cobB 764 2116 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXD4 protein_id gnl|my_center|LOCUS_09290 2889 2119 gene locus_tag LOCUS_09300 2889 2119 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_09300 4742 2886 gene locus_tag LOCUS_09310 gene cbiG/cobJ 4742 2886 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203935.1 protein_id gnl|my_center|LOCUS_09310 5434 4733 gene locus_tag LOCUS_09320 5434 4733 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_09320 6675 5431 gene locus_tag LOCUS_09330 6675 5431 CDS product precorrin-6Y methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 protein_id gnl|my_center|LOCUS_09330 7367 6675 gene locus_tag LOCUS_09340 gene cobH 7367 6675 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 protein_id gnl|my_center|LOCUS_09340 8501 7377 gene locus_tag LOCUS_09350 8501 7377 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_09350 8775 8494 gene locus_tag LOCUS_09360 8775 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9114 10088 gene locus_tag LOCUS_09370 gene cobD 9114 10088 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UA98 protein_id gnl|my_center|LOCUS_09370 11596 10085 gene locus_tag LOCUS_09380 gene cobQ 11596 10085 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7H2 protein_id gnl|my_center|LOCUS_09380 12219 11596 gene locus_tag LOCUS_09390 gene cobO 12219 11596 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708347.1 protein_id gnl|my_center|LOCUS_09390 16004 12216 gene locus_tag LOCUS_09400 gene cobN 16004 12216 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969595.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence040 1485 2153 gene locus_tag LOCUS_09410 gene ccmA 1485 2153 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M1 protein_id gnl|my_center|LOCUS_09410 2146 2859 gene locus_tag LOCUS_09420 gene ccmB 2146 2859 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_09420 2905 3639 gene locus_tag LOCUS_09430 2905 3639 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_09430 3636 3815 gene locus_tag LOCUS_09440 3636 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5888 3828 gene locus_tag LOCUS_09450 5888 3828 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708377.1 protein_id gnl|my_center|LOCUS_09450 6821 5919 gene locus_tag LOCUS_09460 6821 5919 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 protein_id gnl|my_center|LOCUS_09460 7978 7058 gene locus_tag LOCUS_09470 gene metF 7978 7058 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G1 protein_id gnl|my_center|LOCUS_09470 8092 9036 gene locus_tag LOCUS_09480 gene metR 8092 9036 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537927.1 protein_id gnl|my_center|LOCUS_09480 9938 9039 gene locus_tag LOCUS_09490 gene metF 9938 9039 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971608.1 protein_id gnl|my_center|LOCUS_09490 10466 10149 gene locus_tag LOCUS_09500 10466 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531170.1 protein_id gnl|my_center|LOCUS_09500 11163 10504 gene locus_tag LOCUS_09510 11163 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_09510 11860 11156 gene locus_tag LOCUS_09520 gene mtbC 11860 11156 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 protein_id gnl|my_center|LOCUS_09520 12668 12081 gene locus_tag LOCUS_09530 12668 12081 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ3 protein_id gnl|my_center|LOCUS_09530 13701 12688 gene locus_tag LOCUS_09540 gene dusA 13701 12688 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NV0 protein_id gnl|my_center|LOCUS_09540 14090 13764 gene locus_tag LOCUS_09550 14090 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_09550 14314 14138 gene locus_tag LOCUS_09560 14314 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence041 41 592 gene locus_tag LOCUS_09570 gene bcpB 41 592 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087829.1 protein_id gnl|my_center|LOCUS_09570 665 940 gene locus_tag LOCUS_09580 665 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1454 966 gene locus_tag LOCUS_09590 gene yhaI 1454 966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 protein_id gnl|my_center|LOCUS_09590 1719 2171 gene locus_tag LOCUS_09600 1719 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2173 2592 gene locus_tag LOCUS_09610 2173 2592 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIC9 protein_id gnl|my_center|LOCUS_09610 4841 2622 gene locus_tag LOCUS_09620 4841 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6064 4934 gene locus_tag LOCUS_09630 6064 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6212 7144 gene locus_tag LOCUS_09640 6212 7144 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_09640 7700 7149 gene locus_tag LOCUS_09650 7700 7149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_09650 9172 7739 gene locus_tag LOCUS_09660 9172 7739 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_09660 10165 9188 gene locus_tag LOCUS_09670 10165 9188 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX96 protein_id gnl|my_center|LOCUS_09670 10319 10987 gene locus_tag LOCUS_09680 10319 10987 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_09680 11643 10984 gene locus_tag LOCUS_09690 11643 10984 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 protein_id gnl|my_center|LOCUS_09690 11716 12384 gene locus_tag LOCUS_09700 11716 12384 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_09700 12520 13431 gene locus_tag LOCUS_09710 12520 13431 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_09710 13531 14058 gene locus_tag LOCUS_09720 13531 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 <15395 14113 gene locus_tag LOCUS_09730 <15395 14113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530253.1:acetoacetate-CoA ligase >Feature sequence042 62 775 gene locus_tag LOCUS_09740 62 775 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM2 protein_id gnl|my_center|LOCUS_09740 796 881 gene locus_tag LOCUS_t00110 796 881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 902 1501 gene locus_tag LOCUS_09750 902 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1486 2025 gene locus_tag LOCUS_09760 1486 2025 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_09760 2029 2556 gene locus_tag LOCUS_09770 gene coq7 2029 2556 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_09770 3119 2553 gene locus_tag LOCUS_09780 3119 2553 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_09780 3929 3270 gene locus_tag LOCUS_09790 3929 3270 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05958 protein_id gnl|my_center|LOCUS_09790 4022 4900 gene locus_tag LOCUS_09800 4022 4900 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920066.1 protein_id gnl|my_center|LOCUS_09800 6360 5173 gene locus_tag LOCUS_09810 6360 5173 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_09810 6842 6435 gene locus_tag LOCUS_09820 gene fur 6842 6435 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719651.1 protein_id gnl|my_center|LOCUS_09820 7728 6919 gene locus_tag LOCUS_09830 gene pssA 7728 6919 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720902.1 protein_id gnl|my_center|LOCUS_09830 8465 7725 gene locus_tag LOCUS_09840 gene psd 8465 7725 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M997 protein_id gnl|my_center|LOCUS_09840 9775 8594 gene locus_tag LOCUS_09850 9775 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 10080 10457 gene locus_tag LOCUS_09860 10080 10457 CDS product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 protein_id gnl|my_center|LOCUS_09860 10704 11888 gene locus_tag LOCUS_09870 10704 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 12183 12467 gene locus_tag LOCUS_09880 12183 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13435 12515 gene locus_tag LOCUS_09890 13435 12515 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_09890 14103 13471 gene locus_tag LOCUS_09900 14103 13471 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259416.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence043 1982 1476 gene locus_tag LOCUS_09910 1982 1476 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A7 protein_id gnl|my_center|LOCUS_09910 2138 5104 gene locus_tag LOCUS_09920 gene uvrA 2138 5104 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTJ3 protein_id gnl|my_center|LOCUS_09920 5124 6485 gene locus_tag LOCUS_09930 gene trmFO 5124 6485 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBV5 protein_id gnl|my_center|LOCUS_09930 7171 6482 gene locus_tag LOCUS_09940 7171 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7547 7164 gene locus_tag LOCUS_09950 7547 7164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 protein_id gnl|my_center|LOCUS_09950 8485 7550 gene locus_tag LOCUS_09960 8485 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09960 10120 8537 gene locus_tag LOCUS_09970 gene secD 10120 8537 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 protein_id gnl|my_center|LOCUS_09970 10524 10195 gene locus_tag LOCUS_09980 10524 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 10663 11529 gene locus_tag LOCUS_09990 10663 11529 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_09990 12547 11561 gene locus_tag LOCUS_10000 12547 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 13178 12540 gene locus_tag LOCUS_10010 gene pcm 13178 12540 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0T1 protein_id gnl|my_center|LOCUS_10010 13982 13194 gene locus_tag LOCUS_10020 gene surE 13982 13194 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBU3 protein_id gnl|my_center|LOCUS_10020 <15260 13979 gene locus_tag LOCUS_10030 <15260 13979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTH5:serine--tRNA ligase >Feature sequence044 <1 1320 gene locus_tag LOCUS_10040 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXV5:protein translocase subunit SecA 1384 2562 gene locus_tag LOCUS_10050 1384 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2602 3186 gene locus_tag LOCUS_10060 2602 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388498.1 protein_id gnl|my_center|LOCUS_10060 3977 3243 gene locus_tag LOCUS_10070 gene ubiG 3977 3243 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ9 protein_id gnl|my_center|LOCUS_10070 4053 5276 gene locus_tag LOCUS_10080 4053 5276 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_10080 5474 6655 gene locus_tag LOCUS_10090 5474 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 6840 7991 gene locus_tag LOCUS_10100 gene gcpE 6840 7991 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J241 protein_id gnl|my_center|LOCUS_10100 7995 9266 gene locus_tag LOCUS_10110 gene hisS 7995 9266 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_10110 9288 10364 gene locus_tag LOCUS_10120 gene prfA 9288 10364 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_10120 10403 11281 gene locus_tag LOCUS_10130 gene prmC 10403 11281 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE0 protein_id gnl|my_center|LOCUS_10130 11480 12019 gene locus_tag LOCUS_10140 11480 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 12813 12052 gene locus_tag LOCUS_10150 12813 12052 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_10150 14201 12813 gene locus_tag LOCUS_10160 14201 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence045 1691 624 gene locus_tag LOCUS_10170 1691 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1878 2963 gene locus_tag LOCUS_10180 gene purM 1878 2963 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG98 protein_id gnl|my_center|LOCUS_10180 2972 3640 gene locus_tag LOCUS_10190 gene purN 2972 3640 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QW3 protein_id gnl|my_center|LOCUS_10190 3722 3853 gene locus_tag LOCUS_10200 3722 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4379 3957 gene locus_tag LOCUS_10210 gene ndk 4379 3957 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC6 protein_id gnl|my_center|LOCUS_10210 4936 4484 gene locus_tag LOCUS_10220 4936 4484 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 protein_id gnl|my_center|LOCUS_10220 6454 4982 gene locus_tag LOCUS_10230 gene pepA 6454 4982 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_10230 6631 7725 gene locus_tag LOCUS_10240 6631 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7729 8835 gene locus_tag LOCUS_10250 7729 8835 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314590.1 protein_id gnl|my_center|LOCUS_10250 8848 10122 gene locus_tag LOCUS_10260 gene surA 8848 10122 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A44 protein_id gnl|my_center|LOCUS_10260 10132 11130 gene locus_tag LOCUS_10270 gene pdxA 10132 11130 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA8 protein_id gnl|my_center|LOCUS_10270 11123 12016 gene locus_tag LOCUS_10280 gene rsmA 11123 12016 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7I6 protein_id gnl|my_center|LOCUS_10280 12689 12027 gene locus_tag LOCUS_10290 gene gmk 12689 12027 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXB1 protein_id gnl|my_center|LOCUS_10290 13707 12712 gene locus_tag LOCUS_10300 13707 12712 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707469.1 protein_id gnl|my_center|LOCUS_10300 14969 13707 gene locus_tag LOCUS_10310 14969 13707 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 protein_id gnl|my_center|LOCUS_10310 >Feature sequence046 506 126 gene locus_tag LOCUS_10320 506 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_10320 1028 684 gene locus_tag LOCUS_10330 1028 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 protein_id gnl|my_center|LOCUS_10330 1204 2193 gene locus_tag LOCUS_10340 1204 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2196 3035 gene locus_tag LOCUS_10350 2196 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125440.1 protein_id gnl|my_center|LOCUS_10350 3771 3094 gene locus_tag LOCUS_10360 3771 3094 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_10360 4725 3793 gene locus_tag LOCUS_10370 4725 3793 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267449.1 protein_id gnl|my_center|LOCUS_10370 5318 4842 gene locus_tag LOCUS_10380 5318 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5443 5255 gene locus_tag LOCUS_10390 5443 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5805 5729 gene locus_tag LOCUS_t00120 5805 5729 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5997 6332 gene locus_tag LOCUS_10400 5997 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6643 6329 gene locus_tag LOCUS_10410 6643 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 6971 6690 gene locus_tag LOCUS_10420 6971 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7168 7093 gene locus_tag LOCUS_t00130 7168 7093 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7577 7302 gene locus_tag LOCUS_10430 7577 7302 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_10430 10146 7726 gene locus_tag LOCUS_10440 gene lon 10146 7726 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 protein_id gnl|my_center|LOCUS_10440 11517 10267 gene locus_tag LOCUS_10450 gene clpX 11517 10267 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 protein_id gnl|my_center|LOCUS_10450 12357 11707 gene locus_tag LOCUS_10460 gene clpP 12357 11707 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 protein_id gnl|my_center|LOCUS_10460 14023 12545 gene locus_tag LOCUS_10470 gene tig 14023 12545 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_10470 14261 14177 gene locus_tag LOCUS_t00140 14261 14177 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14458 14382 gene locus_tag LOCUS_t00150 14458 14382 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <15206 14520 gene locus_tag LOCUS_10480 <15206 14520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P51007:transcriptional activator protein FnrL >Feature sequence047 106 1332 gene locus_tag LOCUS_10490 106 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388010.1 protein_id gnl|my_center|LOCUS_10490 1335 2372 gene locus_tag LOCUS_10500 1335 2372 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706924.1 protein_id gnl|my_center|LOCUS_10500 3298 2519 gene locus_tag LOCUS_10510 3298 2519 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_10510 4092 3301 gene locus_tag LOCUS_10520 4092 3301 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_10520 5639 4092 gene locus_tag LOCUS_10530 gene metG 5639 4092 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_10530 6804 5722 gene locus_tag LOCUS_10540 6804 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7449 6805 gene locus_tag LOCUS_10550 gene tmk 7449 6805 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9D5 protein_id gnl|my_center|LOCUS_10550 8647 7463 gene locus_tag LOCUS_10560 8647 7463 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_10560 9736 8723 gene locus_tag LOCUS_10570 9736 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919691.1 protein_id gnl|my_center|LOCUS_10570 10738 9755 gene locus_tag LOCUS_10580 gene mltB 10738 9755 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_10580 14054 10893 gene locus_tag LOCUS_10590 14054 10893 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence048 817 1098 gene locus_tag LOCUS_10600 817 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1235 2104 gene locus_tag LOCUS_10610 gene smtA 1235 2104 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125484.1 protein_id gnl|my_center|LOCUS_10610 2709 3398 gene locus_tag LOCUS_10620 2709 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5345 3420 gene locus_tag LOCUS_10630 5345 3420 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_10630 6068 5346 gene locus_tag LOCUS_10640 6068 5346 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_10640 6214 6477 gene locus_tag LOCUS_10650 6214 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_10650 6826 6494 gene locus_tag LOCUS_10660 6826 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6899 7609 gene locus_tag LOCUS_10670 gene plsC 6899 7609 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_10670 7609 8001 gene locus_tag LOCUS_10680 7609 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_10680 8058 8261 gene locus_tag LOCUS_10690 8058 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8316 8483 gene locus_tag LOCUS_10700 8316 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 8856 8491 gene locus_tag LOCUS_10710 8856 8491 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227522.1 protein_id gnl|my_center|LOCUS_10710 8977 9879 gene locus_tag LOCUS_10720 8977 9879 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706409.1 protein_id gnl|my_center|LOCUS_10720 11459 9933 gene locus_tag LOCUS_10730 11459 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918222.1 protein_id gnl|my_center|LOCUS_10730 11962 11498 gene locus_tag LOCUS_10740 11962 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12144 12890 gene locus_tag LOCUS_10750 12144 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 12999 13373 gene locus_tag LOCUS_10760 12999 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13391 13924 gene locus_tag LOCUS_10770 13391 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence049 <1 1005 gene locus_tag LOCUS_10780 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVF0:protein TolB 1641 1363 gene locus_tag LOCUS_10790 1641 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1604 1957 gene locus_tag LOCUS_10800 1604 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2077 3351 gene locus_tag LOCUS_10810 2077 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3411 4757 gene locus_tag LOCUS_10820 3411 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4772 6691 gene locus_tag LOCUS_10830 gene ftsH 4772 6691 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE6 protein_id gnl|my_center|LOCUS_10830 6695 7786 gene locus_tag LOCUS_10840 6695 7786 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_10840 7902 9266 gene locus_tag LOCUS_10850 gene glmM 7902 9266 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C2 protein_id gnl|my_center|LOCUS_10850 9413 10588 gene locus_tag LOCUS_10860 gene serC 9413 10588 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_10860 10673 12256 gene locus_tag LOCUS_10870 gene serA 10673 12256 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_10870 12436 13794 gene locus_tag LOCUS_10880 gene purA 12436 13794 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0Z3 protein_id gnl|my_center|LOCUS_10880 >Feature sequence050 <1 690 gene locus_tag LOCUS_10890 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CK15:pseudouridine synthase 2316 700 gene locus_tag LOCUS_10900 2316 700 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_10900 2471 3703 gene locus_tag LOCUS_10910 2471 3703 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040635.1 protein_id gnl|my_center|LOCUS_10910 3956 5734 gene locus_tag LOCUS_10920 gene ilvB2 3956 5734 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331273.1 protein_id gnl|my_center|LOCUS_10920 5853 6809 gene locus_tag LOCUS_10930 5853 6809 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 protein_id gnl|my_center|LOCUS_10930 8120 6831 gene locus_tag LOCUS_10940 8120 6831 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_10940 8644 8117 gene locus_tag LOCUS_10950 8644 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9685 8663 gene locus_tag LOCUS_10960 9685 8663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_10960 9944 11275 gene locus_tag LOCUS_10970 9944 11275 CDS product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_10970 11368 12747 gene locus_tag LOCUS_10980 11368 12747 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_10980 13277 12768 gene locus_tag LOCUS_10990 gene allA 13277 12768 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence051 1497 367 gene locus_tag LOCUS_11000 1497 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2214 1543 gene locus_tag LOCUS_11010 2214 1543 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972907.1 protein_id gnl|my_center|LOCUS_11010 2406 3563 gene locus_tag LOCUS_11020 2406 3563 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_11020 3577 4485 gene locus_tag LOCUS_11030 3577 4485 CDS product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972906.1 protein_id gnl|my_center|LOCUS_11030 4577 5230 gene locus_tag LOCUS_11040 4577 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5230 6729 gene locus_tag LOCUS_11050 5230 6729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975305.1 protein_id gnl|my_center|LOCUS_11050 6766 7824 gene locus_tag LOCUS_11060 6766 7824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 protein_id gnl|my_center|LOCUS_11060 8362 7883 gene locus_tag LOCUS_11070 8362 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8396 9694 gene locus_tag LOCUS_11080 8396 9694 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_11080 10867 9710 gene locus_tag LOCUS_11090 10867 9710 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8J8 protein_id gnl|my_center|LOCUS_11090 11560 10883 gene locus_tag LOCUS_11100 11560 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815682.1 protein_id gnl|my_center|LOCUS_11100 12697 11564 gene locus_tag LOCUS_11110 12697 11564 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_11110 13186 12770 gene locus_tag LOCUS_11120 13186 12770 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727821.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence052 818 2137 gene locus_tag LOCUS_11130 818 2137 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_11130 2224 2931 gene locus_tag LOCUS_11140 2224 2931 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_11140 2936 4126 gene locus_tag LOCUS_11150 2936 4126 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919303.1 protein_id gnl|my_center|LOCUS_11150 4126 4620 gene locus_tag LOCUS_11160 4126 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_11160 5050 4604 gene locus_tag LOCUS_11170 5050 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_11170 5793 5053 gene locus_tag LOCUS_11180 5793 5053 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969349.1 protein_id gnl|my_center|LOCUS_11180 5919 8996 gene locus_tag LOCUS_11190 5919 8996 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256767.1 protein_id gnl|my_center|LOCUS_11190 9186 10157 gene locus_tag LOCUS_11200 9186 10157 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968948.1 protein_id gnl|my_center|LOCUS_11200 10150 11133 gene locus_tag LOCUS_11210 gene cobC 10150 11133 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 protein_id gnl|my_center|LOCUS_11210 11509 12141 gene locus_tag LOCUS_11220 gene hupE 11509 12141 CDS product hydantoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124210.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence053 316 885 gene locus_tag LOCUS_11230 gene rpsE 316 885 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T6 protein_id gnl|my_center|LOCUS_11230 897 1082 gene locus_tag LOCUS_11240 gene rpmD 897 1082 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 protein_id gnl|my_center|LOCUS_11240 1130 1603 gene locus_tag LOCUS_11250 gene rplO 1130 1603 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U878 protein_id gnl|my_center|LOCUS_11250 1627 2961 gene locus_tag LOCUS_11260 gene secY 1627 2961 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_11260 2958 3524 gene locus_tag LOCUS_11270 gene adk 2958 3524 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F5 protein_id gnl|my_center|LOCUS_11270 3656 4024 gene locus_tag LOCUS_11280 gene rpsM 3656 4024 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_11280 4049 4444 gene locus_tag LOCUS_11290 gene rpsK 4049 4444 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F7 protein_id gnl|my_center|LOCUS_11290 4524 5540 gene locus_tag LOCUS_11300 gene rpoA 4524 5540 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_11300 5575 6009 gene locus_tag LOCUS_11310 gene rplQ 5575 6009 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_11310 6195 6809 gene locus_tag LOCUS_11320 6195 6809 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971209.1 protein_id gnl|my_center|LOCUS_11320 7042 8367 gene locus_tag LOCUS_11330 7042 8367 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_11330 8386 8799 gene locus_tag LOCUS_11340 gene crcB 8386 8799 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVS9 protein_id gnl|my_center|LOCUS_11340 8799 9803 gene locus_tag LOCUS_11350 8799 9803 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_11350 9836 10537 gene locus_tag LOCUS_11360 9836 10537 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385290.1 protein_id gnl|my_center|LOCUS_11360 10658 11062 gene locus_tag LOCUS_11370 10658 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12020 11295 gene locus_tag LOCUS_11380 gene lipB 12020 11295 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A6 protein_id gnl|my_center|LOCUS_11380 12150 12332 gene locus_tag LOCUS_11390 12150 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 12349 12435 gene locus_tag LOCUS_t00160 12349 12435 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 443 1516 gene locus_tag LOCUS_11400 443 1516 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 protein_id gnl|my_center|LOCUS_11400 2248 1553 gene locus_tag LOCUS_11410 2248 1553 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_11410 2943 2245 gene locus_tag LOCUS_11420 2943 2245 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_11420 4098 2965 gene locus_tag LOCUS_11430 4098 2965 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_11430 5125 4136 gene locus_tag LOCUS_11440 5125 4136 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969921.1 protein_id gnl|my_center|LOCUS_11440 6124 5156 gene locus_tag LOCUS_11450 6124 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 7142 6111 gene locus_tag LOCUS_11460 7142 6111 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_11460 7909 7142 gene locus_tag LOCUS_11470 7909 7142 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969919.1 protein_id gnl|my_center|LOCUS_11470 9216 7906 gene locus_tag LOCUS_11480 gene hisD 9216 7906 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UHG5 protein_id gnl|my_center|LOCUS_11480 9774 9220 gene locus_tag LOCUS_11490 9774 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10834 9788 gene locus_tag LOCUS_11500 10834 9788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969916.1 protein_id gnl|my_center|LOCUS_11500 11729 10845 gene locus_tag LOCUS_11510 11729 10845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969915.1 protein_id gnl|my_center|LOCUS_11510 <12460 11726 gene locus_tag LOCUS_11520 <12460 11726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969914.1:ABC transporter permease >Feature sequence055 1691 315 gene locus_tag LOCUS_11530 1691 315 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975319.1 protein_id gnl|my_center|LOCUS_11530 2398 1733 gene locus_tag LOCUS_11540 2398 1733 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_11540 4962 2500 gene locus_tag LOCUS_11550 4962 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 5209 5802 gene locus_tag LOCUS_11560 5209 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7713 5806 gene locus_tag LOCUS_11570 7713 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7860 7933 gene locus_tag LOCUS_t00170 7860 7933 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8403 8906 gene locus_tag LOCUS_11580 8403 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 8906 11149 gene locus_tag LOCUS_11590 8906 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 11149 12198 gene locus_tag LOCUS_11600 11149 12198 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 protein_id gnl|my_center|LOCUS_11600 12345 12419 gene locus_tag LOCUS_t00180 12345 12419 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 196 894 gene locus_tag LOCUS_11610 196 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 984 2393 gene locus_tag LOCUS_11620 984 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2595 3215 gene locus_tag LOCUS_11630 2595 3215 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720236.1 protein_id gnl|my_center|LOCUS_11630 5240 3300 gene locus_tag LOCUS_11640 gene acsA 5240 3300 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_11640 5917 5342 gene locus_tag LOCUS_11650 5917 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6145 6951 gene locus_tag LOCUS_11660 6145 6951 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_11660 7033 8154 gene locus_tag LOCUS_11670 gene dcd 7033 8154 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083925.1 protein_id gnl|my_center|LOCUS_11670 8385 9602 gene locus_tag LOCUS_11680 gene argD 8385 9602 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKT0 protein_id gnl|my_center|LOCUS_11680 9639 10547 gene locus_tag LOCUS_11690 gene argF 9639 10547 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S99 protein_id gnl|my_center|LOCUS_11690 10604 11539 gene locus_tag LOCUS_11700 10604 11539 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP75 protein_id gnl|my_center|LOCUS_11700 11647 12234 gene locus_tag LOCUS_11710 11647 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence057 1667 375 gene locus_tag LOCUS_11720 gene hflX 1667 375 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q83 protein_id gnl|my_center|LOCUS_11720 2043 1828 gene locus_tag LOCUS_11730 2043 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2086 2556 gene locus_tag LOCUS_11740 2086 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4186 2639 gene locus_tag LOCUS_11750 4186 2639 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_11750 4350 5153 gene locus_tag LOCUS_11760 4350 5153 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056400.1 protein_id gnl|my_center|LOCUS_11760 5146 5601 gene locus_tag LOCUS_11770 5146 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055866.1 protein_id gnl|my_center|LOCUS_11770 6777 5596 gene locus_tag LOCUS_11780 6777 5596 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920262.1 protein_id gnl|my_center|LOCUS_11780 7383 6871 gene locus_tag LOCUS_11790 7383 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7830 7516 gene locus_tag LOCUS_11800 7830 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 8290 7880 gene locus_tag LOCUS_11810 8290 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 8727 8335 gene locus_tag LOCUS_11820 8727 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 8925 9293 gene locus_tag LOCUS_11830 8925 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 9298 10890 gene locus_tag LOCUS_11840 9298 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 10992 11423 gene locus_tag LOCUS_11850 10992 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 11436 11732 gene locus_tag LOCUS_11860 11436 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence058 377 192 gene locus_tag LOCUS_11870 377 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 573 379 gene locus_tag LOCUS_11880 573 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1700 672 gene locus_tag LOCUS_11890 1700 672 CDS product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970000.1 protein_id gnl|my_center|LOCUS_11890 2936 1773 gene locus_tag LOCUS_11900 2936 1773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_11900 5112 2944 gene locus_tag LOCUS_11910 5112 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 5329 6834 gene locus_tag LOCUS_11920 5329 6834 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR1 protein_id gnl|my_center|LOCUS_11920 7228 6758 gene locus_tag LOCUS_11930 7228 6758 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532018.1 protein_id gnl|my_center|LOCUS_11930 8054 7341 gene locus_tag LOCUS_11940 8054 7341 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_11940 8795 8064 gene locus_tag LOCUS_11950 8795 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_11950 9824 8832 gene locus_tag LOCUS_11960 9824 8832 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721051.1 protein_id gnl|my_center|LOCUS_11960 10081 11058 gene locus_tag LOCUS_11970 10081 11058 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811091.1 protein_id gnl|my_center|LOCUS_11970 11116 11829 gene locus_tag LOCUS_11980 11116 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence059 <1 540 gene locus_tag LOCUS_11990 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU34:NADH-quinone oxidoreductase 545 1573 gene locus_tag LOCUS_12000 gene nuoH 545 1573 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 protein_id gnl|my_center|LOCUS_12000 1595 2083 gene locus_tag LOCUS_12010 gene nuoI 1595 2083 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3W3 protein_id gnl|my_center|LOCUS_12010 2106 2711 gene locus_tag LOCUS_12020 2106 2711 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 protein_id gnl|my_center|LOCUS_12020 2716 3027 gene locus_tag LOCUS_12030 gene nuoK1 2716 3027 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 protein_id gnl|my_center|LOCUS_12030 3034 4968 gene locus_tag LOCUS_12040 3034 4968 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_12040 4972 6477 gene locus_tag LOCUS_12050 4972 6477 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_12050 6510 7961 gene locus_tag LOCUS_12060 gene nuoN 6510 7961 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_12060 7973 8713 gene locus_tag LOCUS_12070 7973 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8713 9501 gene locus_tag LOCUS_12080 gene coaX 8713 9501 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6Z1 protein_id gnl|my_center|LOCUS_12080 9547 11226 gene locus_tag LOCUS_12090 9547 11226 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_12090 11223 11630 gene locus_tag LOCUS_12100 11223 11630 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969152.1 protein_id gnl|my_center|LOCUS_12100 11634 11870 gene locus_tag LOCUS_12110 11634 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence060 <1 560 gene locus_tag LOCUS_12120 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975275.1:sulfite reductase 553 993 gene locus_tag LOCUS_12130 553 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1127 1414 gene locus_tag LOCUS_12140 gene groES 1127 1414 CDS product co-chaperonin GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001314660.1 protein_id gnl|my_center|LOCUS_12140 1451 3100 gene locus_tag LOCUS_12150 gene groL1 1451 3100 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY28 protein_id gnl|my_center|LOCUS_12150 3650 3189 gene locus_tag LOCUS_12160 3650 3189 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970913.1 protein_id gnl|my_center|LOCUS_12160 4013 3687 gene locus_tag LOCUS_12170 4013 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7013 4200 gene locus_tag LOCUS_12180 7013 4200 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_12180 7206 8837 gene locus_tag LOCUS_12190 gene lysS 7206 8837 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VB4 protein_id gnl|my_center|LOCUS_12190 8834 9919 gene locus_tag LOCUS_12200 8834 9919 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAR8 protein_id gnl|my_center|LOCUS_12200 10250 9885 gene locus_tag LOCUS_12210 10250 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10581 10757 gene locus_tag LOCUS_12220 10581 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 <12174 10829 gene locus_tag LOCUS_12230 <12174 10829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529369.1:cobaltochelatase subunit CobT >Feature sequence061 <1 914 gene locus_tag LOCUS_12240 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083498.1:penicillin-binding protein activator 2268 955 gene locus_tag LOCUS_12250 2268 955 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_12250 2919 2290 gene locus_tag LOCUS_12260 2919 2290 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_12260 3767 3030 gene locus_tag LOCUS_12270 gene rph 3767 3030 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN60 protein_id gnl|my_center|LOCUS_12270 3871 4929 gene locus_tag LOCUS_12280 gene hrcA 3871 4929 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_12280 5484 4942 gene locus_tag LOCUS_12290 5484 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6522 5659 gene locus_tag LOCUS_12300 6522 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6901 7644 gene locus_tag LOCUS_12310 6901 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 7794 9707 gene locus_tag LOCUS_12320 gene dnaK 7794 9707 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE6 protein_id gnl|my_center|LOCUS_12320 9797 10912 gene locus_tag LOCUS_12330 gene dnaJ 9797 10912 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE7 protein_id gnl|my_center|LOCUS_12330 11005 11835 gene locus_tag LOCUS_12340 gene dapB 11005 11835 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_12340 11854 11987 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagcgtagattgataagatgatcgc >Feature sequence062 2173 1286 gene locus_tag LOCUS_12350 2173 1286 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_12350 3302 2175 gene locus_tag LOCUS_12360 3302 2175 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_12360 3481 4578 gene locus_tag LOCUS_12370 3481 4578 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T733 protein_id gnl|my_center|LOCUS_12370 5157 4594 gene locus_tag LOCUS_12380 5157 4594 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM58 protein_id gnl|my_center|LOCUS_12380 5960 5166 gene locus_tag LOCUS_12390 gene thyA 5960 5166 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB24 protein_id gnl|my_center|LOCUS_12390 6532 7020 gene locus_tag LOCUS_12400 6532 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 protein_id gnl|my_center|LOCUS_12400 7097 8704 gene locus_tag LOCUS_12410 7097 8704 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_12410 10003 8714 gene locus_tag LOCUS_12420 gene glcF 10003 8714 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RS1 protein_id gnl|my_center|LOCUS_12420 11220 10018 gene locus_tag LOCUS_12430 gene glcE 11220 10018 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090273.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence063 <1 975 gene locus_tag LOCUS_12440 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531176.1:trimethylamine methyltransferase 1619 996 gene locus_tag LOCUS_12450 1619 996 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269190.1 protein_id gnl|my_center|LOCUS_12450 4653 1612 gene locus_tag LOCUS_12460 4653 1612 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269189.1 protein_id gnl|my_center|LOCUS_12460 5024 4653 gene locus_tag LOCUS_12470 5024 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6340 5042 gene locus_tag LOCUS_12480 gene soxB 6340 5042 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 protein_id gnl|my_center|LOCUS_12480 6579 6391 gene locus_tag LOCUS_12490 6579 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6721 7890 gene locus_tag LOCUS_12500 6721 7890 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931140.1 protein_id gnl|my_center|LOCUS_12500 8143 8571 gene locus_tag LOCUS_12510 8143 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 10020 8770 gene locus_tag LOCUS_12520 10020 8770 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972228.1 protein_id gnl|my_center|LOCUS_12520 10437 10760 gene locus_tag LOCUS_12530 gene clpS 10437 10760 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 protein_id gnl|my_center|LOCUS_12530 >Feature sequence064 500 15 gene locus_tag LOCUS_12540 500 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1391 594 gene locus_tag LOCUS_12550 1391 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1562 2626 gene locus_tag LOCUS_12560 1562 2626 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 protein_id gnl|my_center|LOCUS_12560 3249 2638 gene locus_tag LOCUS_12570 3249 2638 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_12570 4649 3351 gene locus_tag LOCUS_12580 4649 3351 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090333.1 protein_id gnl|my_center|LOCUS_12580 4790 5404 gene locus_tag LOCUS_12590 4790 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6326 5391 gene locus_tag LOCUS_12600 6326 5391 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383292.1 protein_id gnl|my_center|LOCUS_12600 6823 6377 gene locus_tag LOCUS_12610 6823 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6972 7271 gene locus_tag LOCUS_12620 6972 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8276 7290 gene locus_tag LOCUS_12630 8276 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8388 9971 gene locus_tag LOCUS_12640 gene pgi 8388 9971 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2U4 protein_id gnl|my_center|LOCUS_12640 9968 10921 gene locus_tag LOCUS_12650 9968 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence065 5237 1059 gene locus_tag LOCUS_12660 gene rpoB 5237 1059 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV3 protein_id gnl|my_center|LOCUS_12660 5803 5423 gene locus_tag LOCUS_12670 gene rplL 5803 5423 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX1 protein_id gnl|my_center|LOCUS_12670 6359 5841 gene locus_tag LOCUS_12680 gene rplJ 6359 5841 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_12680 7324 6638 gene locus_tag LOCUS_12690 gene rplA 7324 6638 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV0 protein_id gnl|my_center|LOCUS_12690 7760 7329 gene locus_tag LOCUS_12700 gene rplK 7760 7329 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU9 protein_id gnl|my_center|LOCUS_12700 8361 7831 gene locus_tag LOCUS_12710 gene nusG 8361 7831 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU8 protein_id gnl|my_center|LOCUS_12710 8614 8417 gene locus_tag LOCUS_12720 gene secE 8614 8417 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU7 protein_id gnl|my_center|LOCUS_12720 8988 9866 gene locus_tag LOCUS_12730 8988 9866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_12730 10552 9902 gene locus_tag LOCUS_12740 10552 9902 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 protein_id gnl|my_center|LOCUS_12740 11428 10583 gene locus_tag LOCUS_12750 11428 10583 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532873.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence066 1217 2140 gene locus_tag LOCUS_12760 1217 2140 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267756.1 protein_id gnl|my_center|LOCUS_12760 3686 2145 gene locus_tag LOCUS_12770 3686 2145 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 protein_id gnl|my_center|LOCUS_12770 4521 3757 gene locus_tag LOCUS_12780 gene ygaJ 4521 3757 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_12780 4789 6270 gene locus_tag LOCUS_12790 4789 6270 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973016.1 protein_id gnl|my_center|LOCUS_12790 6417 7376 gene locus_tag LOCUS_12800 6417 7376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_12800 7376 8260 gene locus_tag LOCUS_12810 7376 8260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967159.1 protein_id gnl|my_center|LOCUS_12810 8262 10277 gene locus_tag LOCUS_12820 8262 10277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532883.1 protein_id gnl|my_center|LOCUS_12820 <11449 10362 gene locus_tag LOCUS_12830 <11449 10362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527148.1:beta-ketothiolase >Feature sequence067 17 1771 gene locus_tag LOCUS_12840 17 1771 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089329.1 protein_id gnl|my_center|LOCUS_12840 3859 1766 gene locus_tag LOCUS_12850 gene ligA 3859 1766 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV5 protein_id gnl|my_center|LOCUS_12850 5523 3862 gene locus_tag LOCUS_12860 5523 3862 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_12860 6345 5530 gene locus_tag LOCUS_12870 gene bamD 6345 5530 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_12870 7477 6512 gene locus_tag LOCUS_12880 gene envA 7477 6512 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L4 protein_id gnl|my_center|LOCUS_12880 9507 7618 gene locus_tag LOCUS_12890 gene ftsZ 9507 7618 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF60 protein_id gnl|my_center|LOCUS_12890 10964 9666 gene locus_tag LOCUS_12900 gene ftsA 10964 9666 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_12900 >Feature sequence068 917 60 gene locus_tag LOCUS_12910 917 60 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972799.1 protein_id gnl|my_center|LOCUS_12910 1129 2370 gene locus_tag LOCUS_12920 1129 2370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_12920 2544 3398 gene locus_tag LOCUS_12930 2544 3398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544732.1 protein_id gnl|my_center|LOCUS_12930 3401 4252 gene locus_tag LOCUS_12940 3401 4252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_12940 4272 5600 gene locus_tag LOCUS_12950 gene agaL2 4272 5600 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976337.1 protein_id gnl|my_center|LOCUS_12950 5600 6658 gene locus_tag LOCUS_12960 5600 6658 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WF7 protein_id gnl|my_center|LOCUS_12960 6651 7745 gene locus_tag LOCUS_12970 gene galK 6651 7745 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQH8 protein_id gnl|my_center|LOCUS_12970 9734 7740 gene locus_tag LOCUS_12980 gene lacZ2 9734 7740 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UN3 protein_id gnl|my_center|LOCUS_12980 10768 9734 gene locus_tag LOCUS_12990 gene thuK 10768 9734 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972956.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence069 1948 941 gene locus_tag LOCUS_13000 1948 941 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_13000 2559 1984 gene locus_tag LOCUS_13010 2559 1984 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709225.1 protein_id gnl|my_center|LOCUS_13010 2624 2893 gene locus_tag LOCUS_13020 2624 2893 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_13020 3459 2896 gene locus_tag LOCUS_13030 3459 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4753 3479 gene locus_tag LOCUS_13040 4753 3479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_13040 5864 4764 gene locus_tag LOCUS_13050 gene aroB 5864 4764 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_13050 6492 5872 gene locus_tag LOCUS_13060 gene aroK 6492 5872 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A435 protein_id gnl|my_center|LOCUS_13060 6752 6889 gene locus_tag LOCUS_13070 6752 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6870 8966 gene locus_tag LOCUS_13080 6870 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9026 9964 gene locus_tag LOCUS_13090 gene xerC 9026 9964 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW3 protein_id gnl|my_center|LOCUS_13090 9994 10950 gene locus_tag LOCUS_13100 gene accA 9994 10950 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_13100 >Feature sequence070 480 1439 gene locus_tag LOCUS_13110 480 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 1457 2254 gene locus_tag LOCUS_13120 gene cooxM 1457 2254 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_13120 2287 3132 gene locus_tag LOCUS_13130 2287 3132 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971078.1 protein_id gnl|my_center|LOCUS_13130 3144 4058 gene locus_tag LOCUS_13140 3144 4058 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_13140 4055 5572 gene locus_tag LOCUS_13150 4055 5572 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104361.1 protein_id gnl|my_center|LOCUS_13150 7035 5593 gene locus_tag LOCUS_13160 7035 5593 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_13160 7286 8521 gene locus_tag LOCUS_13170 7286 8521 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971333.1 protein_id gnl|my_center|LOCUS_13170 8554 9615 gene locus_tag LOCUS_13180 gene ltaA 8554 9615 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_13180 9698 10807 gene locus_tag LOCUS_13190 9698 10807 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence071 <1 2025 gene locus_tag LOCUS_13200 <1 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5S5:elongation factor G 2055 3245 gene locus_tag LOCUS_13210 gene tuf1 2055 3245 CDS product elongation factor Tu 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV8 protein_id gnl|my_center|LOCUS_13210 3306 3614 gene locus_tag LOCUS_13220 gene rpsJ 3306 3614 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_13220 3630 4442 gene locus_tag LOCUS_13230 gene rplC 3630 4442 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW0 protein_id gnl|my_center|LOCUS_13230 4447 5064 gene locus_tag LOCUS_13240 gene rplD 4447 5064 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE19 protein_id gnl|my_center|LOCUS_13240 5061 5387 gene locus_tag LOCUS_13250 gene rplW 5061 5387 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW2 protein_id gnl|my_center|LOCUS_13250 5391 6215 gene locus_tag LOCUS_13260 gene rplB 5391 6215 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW3 protein_id gnl|my_center|LOCUS_13260 6232 6507 gene locus_tag LOCUS_13270 gene rpsS 6232 6507 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66488 protein_id gnl|my_center|LOCUS_13270 6517 6894 gene locus_tag LOCUS_13280 gene rplV 6517 6894 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW5 protein_id gnl|my_center|LOCUS_13280 6895 7590 gene locus_tag LOCUS_13290 gene rpsC 6895 7590 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_13290 7609 8028 gene locus_tag LOCUS_13300 gene rplP 7609 8028 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_13300 8043 8258 gene locus_tag LOCUS_13310 gene rpmC 8043 8258 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW8 protein_id gnl|my_center|LOCUS_13310 8271 8516 gene locus_tag LOCUS_13320 gene rpsQ 8271 8516 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW9 protein_id gnl|my_center|LOCUS_13320 8529 8897 gene locus_tag LOCUS_13330 gene rplN 8529 8897 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 protein_id gnl|my_center|LOCUS_13330 8897 9214 gene locus_tag LOCUS_13340 gene rplX 8897 9214 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_13340 9240 9785 gene locus_tag LOCUS_13350 gene rplE 9240 9785 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX2 protein_id gnl|my_center|LOCUS_13350 9802 10107 gene locus_tag LOCUS_13360 gene rpsN 9802 10107 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF7 protein_id gnl|my_center|LOCUS_13360 10126 10524 gene locus_tag LOCUS_13370 gene rpsH 10126 10524 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_13370 >Feature sequence072 1008 1463 gene locus_tag LOCUS_13380 1008 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1572 2924 gene locus_tag LOCUS_13390 1572 2924 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_13390 3097 4476 gene locus_tag LOCUS_13400 3097 4476 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 protein_id gnl|my_center|LOCUS_13400 4515 5651 gene locus_tag LOCUS_13410 4515 5651 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 protein_id gnl|my_center|LOCUS_13410 5662 7347 gene locus_tag LOCUS_13420 gene nadE 5662 7347 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_13420 7401 8741 gene locus_tag LOCUS_13430 gene gltX1 7401 8741 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 protein_id gnl|my_center|LOCUS_13430 8738 10126 gene locus_tag LOCUS_13440 gene cysS 8738 10126 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_13440 >Feature sequence073 <1 1965 gene locus_tag LOCUS_13450 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709724.1:glycosyl transferase family 1 2011 3234 gene locus_tag LOCUS_13460 gene argG 2011 3234 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXL9 protein_id gnl|my_center|LOCUS_13460 3477 3250 gene locus_tag LOCUS_13470 3477 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4322 3693 gene locus_tag LOCUS_13480 4322 3693 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y7 protein_id gnl|my_center|LOCUS_13480 4449 5069 gene locus_tag LOCUS_13490 4449 5069 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_13490 5142 6593 gene locus_tag LOCUS_13500 gene gabD 5142 6593 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928500.1 protein_id gnl|my_center|LOCUS_13500 7533 6664 gene locus_tag LOCUS_13510 7533 6664 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 protein_id gnl|my_center|LOCUS_13510 7671 8213 gene locus_tag LOCUS_13520 gene hpt 7671 8213 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420875.1 protein_id gnl|my_center|LOCUS_13520 9601 8273 gene locus_tag LOCUS_13530 9601 8273 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_13530 <10599 9692 gene locus_tag LOCUS_13540 <10599 9692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704193.1:quinone oxidoreductase >Feature sequence074 <1 1465 gene locus_tag LOCUS_13550 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391543.1:phosphopantothenate synthase 1458 1907 gene locus_tag LOCUS_13560 gene dut 1458 1907 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_13560 1943 2722 gene locus_tag LOCUS_13570 gene thiF 1943 2722 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_13570 3808 2822 gene locus_tag LOCUS_13580 3808 2822 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_13580 3990 4481 gene locus_tag LOCUS_13590 3990 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 protein_id gnl|my_center|LOCUS_13590 6646 4514 gene locus_tag LOCUS_13600 gene katG 6646 4514 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_13600 7346 6900 gene locus_tag LOCUS_13610 7346 6900 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527884.1 protein_id gnl|my_center|LOCUS_13610 7629 8147 gene locus_tag LOCUS_13620 gene fabA 7629 8147 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 protein_id gnl|my_center|LOCUS_13620 8149 9381 gene locus_tag LOCUS_13630 gene fabB 8149 9381 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 protein_id gnl|my_center|LOCUS_13630 9383 10198 gene locus_tag LOCUS_13640 9383 10198 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT9 protein_id gnl|my_center|LOCUS_13640 >Feature sequence075 2636 405 gene locus_tag LOCUS_13650 2636 405 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU59 protein_id gnl|my_center|LOCUS_13650 2839 3627 gene locus_tag LOCUS_13660 gene vacJ 2839 3627 CDS product lipoprotein VacJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705305.1 protein_id gnl|my_center|LOCUS_13660 3627 4244 gene locus_tag LOCUS_13670 3627 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5918 4266 gene locus_tag LOCUS_13680 5918 4266 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_13680 6263 6553 gene locus_tag LOCUS_13690 6263 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6985 6593 gene locus_tag LOCUS_13700 6985 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6984 8009 gene locus_tag LOCUS_13710 6984 8009 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 protein_id gnl|my_center|LOCUS_13710 8153 9091 gene locus_tag LOCUS_13720 gene rpoH2 8153 9091 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6K8 protein_id gnl|my_center|LOCUS_13720 9416 9120 gene locus_tag LOCUS_13730 9416 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence076 423 4088 gene locus_tag LOCUS_13740 gene oplaH 423 4088 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_13740 4170 5534 gene locus_tag LOCUS_13750 4170 5534 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_13750 5534 7348 gene locus_tag LOCUS_13760 5534 7348 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_13760 7483 7558 gene locus_tag LOCUS_t00190 7483 7558 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8647 7631 gene locus_tag LOCUS_13770 8647 7631 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_13770 9366 8683 gene locus_tag LOCUS_13780 9366 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968146.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence077 2158 368 gene locus_tag LOCUS_13790 2158 368 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV40 protein_id gnl|my_center|LOCUS_13790 2542 2177 gene locus_tag LOCUS_13800 2542 2177 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_13800 2929 2558 gene locus_tag LOCUS_13810 2929 2558 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388957.1 protein_id gnl|my_center|LOCUS_13810 3079 3930 gene locus_tag LOCUS_13820 3079 3930 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV99 protein_id gnl|my_center|LOCUS_13820 4967 3933 gene locus_tag LOCUS_13830 gene asd 4967 3933 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV48 protein_id gnl|my_center|LOCUS_13830 6152 5040 gene locus_tag LOCUS_13840 gene leuB 6152 5040 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 protein_id gnl|my_center|LOCUS_13840 6815 6210 gene locus_tag LOCUS_13850 gene leuD 6815 6210 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LA1 protein_id gnl|my_center|LOCUS_13850 8238 6829 gene locus_tag LOCUS_13860 gene leuC 8238 6829 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 protein_id gnl|my_center|LOCUS_13860 8672 8292 gene locus_tag LOCUS_13870 8672 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9480 8746 gene locus_tag LOCUS_13880 gene trmD 9480 8746 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV57 protein_id gnl|my_center|LOCUS_13880 >Feature sequence078 1 1143 gene locus_tag LOCUS_13890 1 1143 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 protein_id gnl|my_center|LOCUS_13890 1345 1136 gene locus_tag LOCUS_13900 1345 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1693 1427 gene locus_tag LOCUS_13910 1693 1427 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_13910 1784 2968 gene locus_tag LOCUS_13920 1784 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 protein_id gnl|my_center|LOCUS_13920 3628 2975 gene locus_tag LOCUS_13930 3628 2975 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY27 protein_id gnl|my_center|LOCUS_13930 4694 3759 gene locus_tag LOCUS_13940 4694 3759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 protein_id gnl|my_center|LOCUS_13940 4949 5287 gene locus_tag LOCUS_13950 4949 5287 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_13950 5304 6629 gene locus_tag LOCUS_13960 gene amt-2 5304 6629 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_13960 6814 8439 gene locus_tag LOCUS_13970 6814 8439 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_13970 8436 9551 gene locus_tag LOCUS_13980 8436 9551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971868.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence079 1067 1549 gene locus_tag LOCUS_13990 1067 1549 CDS product glycine zipper family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331368.1 protein_id gnl|my_center|LOCUS_13990 1555 2127 gene locus_tag LOCUS_14000 1555 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2860 2204 gene locus_tag LOCUS_14010 2860 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4412 3003 gene locus_tag LOCUS_14020 4412 3003 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 protein_id gnl|my_center|LOCUS_14020 4852 4514 gene locus_tag LOCUS_14030 gene glnB 4852 4514 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_14030 5985 5113 gene locus_tag LOCUS_14040 5985 5113 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976263.1 protein_id gnl|my_center|LOCUS_14040 6104 6886 gene locus_tag LOCUS_14050 6104 6886 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972092.1 protein_id gnl|my_center|LOCUS_14050 7017 8063 gene locus_tag LOCUS_14060 7017 8063 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_14060 8201 8680 gene locus_tag LOCUS_14070 8201 8680 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence080 2119 821 gene locus_tag LOCUS_14080 gene hmgA 2119 821 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M930 protein_id gnl|my_center|LOCUS_14080 2492 4030 gene locus_tag LOCUS_14090 2492 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4024 5733 gene locus_tag LOCUS_14100 4024 5733 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_14100 5736 7196 gene locus_tag LOCUS_14110 5736 7196 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088217.1 protein_id gnl|my_center|LOCUS_14110 8398 7235 gene locus_tag LOCUS_14120 8398 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263666.1 protein_id gnl|my_center|LOCUS_14120 8583 9254 gene locus_tag LOCUS_14130 8583 9254 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence081 1032 82 gene locus_tag LOCUS_14140 gene tatC 1032 82 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_14140 1514 1032 gene locus_tag LOCUS_14150 1514 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1905 1531 gene locus_tag LOCUS_14160 1905 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3149 2046 gene locus_tag LOCUS_14170 gene fbpA1 3149 2046 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970876.1 protein_id gnl|my_center|LOCUS_14170 3855 3142 gene locus_tag LOCUS_14180 3855 3142 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH1 protein_id gnl|my_center|LOCUS_14180 4658 3852 gene locus_tag LOCUS_14190 4658 3852 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_14190 5489 4659 gene locus_tag LOCUS_14200 5489 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 7218 5500 gene locus_tag LOCUS_14210 gene argS 7218 5500 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J281 protein_id gnl|my_center|LOCUS_14210 8477 7266 gene locus_tag LOCUS_14220 8477 7266 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J2 protein_id gnl|my_center|LOCUS_14220 8629 9012 gene locus_tag LOCUS_14230 8629 9012 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence082 572 1306 gene locus_tag LOCUS_14240 572 1306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_14240 3461 1371 gene locus_tag LOCUS_14250 3461 1371 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_14250 3684 3947 gene locus_tag LOCUS_14260 3684 3947 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383983.1 protein_id gnl|my_center|LOCUS_14260 3955 7410 gene locus_tag LOCUS_14270 gene mfd 3955 7410 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 protein_id gnl|my_center|LOCUS_14270 8081 7428 gene locus_tag LOCUS_14280 8081 7428 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919709.1 protein_id gnl|my_center|LOCUS_14280 8205 8711 gene locus_tag LOCUS_14290 8205 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence083 1158 181 gene locus_tag LOCUS_14300 1158 181 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_14300 1495 1695 gene locus_tag LOCUS_14310 1495 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1746 4673 gene locus_tag LOCUS_14320 gene polA 1746 4673 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970660.1 protein_id gnl|my_center|LOCUS_14320 4834 5526 gene locus_tag LOCUS_14330 4834 5526 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_14330 5628 7256 gene locus_tag LOCUS_14340 5628 7256 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_14340 7266 8144 gene locus_tag LOCUS_14350 7266 8144 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_14350 >Feature sequence084 1552 644 gene locus_tag LOCUS_14360 1552 644 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 protein_id gnl|my_center|LOCUS_14360 1827 1561 gene locus_tag LOCUS_14370 1827 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2322 1855 gene locus_tag LOCUS_14380 2322 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3472 2477 gene locus_tag LOCUS_14390 3472 2477 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_14390 4006 3500 gene locus_tag LOCUS_14400 4006 3500 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_14400 4651 4313 gene locus_tag LOCUS_14410 4651 4313 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_14410 5189 4728 gene locus_tag LOCUS_14420 5189 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_14420 5612 5190 gene locus_tag LOCUS_14430 5612 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8541 5620 gene locus_tag LOCUS_14440 8541 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence085 460 1767 gene locus_tag LOCUS_14450 gene moeA 460 1767 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_14450 1862 2497 gene locus_tag LOCUS_14460 gene lexA 1862 2497 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCJ7 protein_id gnl|my_center|LOCUS_14460 3830 2439 gene locus_tag LOCUS_14470 3830 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4570 5940 gene locus_tag LOCUS_14480 gene gltX2 4570 5940 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_14480 6038 7345 gene locus_tag LOCUS_14490 6038 7345 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8L5 protein_id gnl|my_center|LOCUS_14490 8526 7357 gene locus_tag LOCUS_14500 8526 7357 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence086 96 713 gene locus_tag LOCUS_14510 96 713 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_14510 1354 743 gene locus_tag LOCUS_14520 gene PSrp1 1354 743 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_14520 2144 1518 gene locus_tag LOCUS_14530 2144 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2703 2146 gene locus_tag LOCUS_14540 2703 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2934 2731 gene locus_tag LOCUS_14550 2934 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3774 2983 gene locus_tag LOCUS_14560 3774 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4670 3771 gene locus_tag LOCUS_14570 4670 3771 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974051.1 protein_id gnl|my_center|LOCUS_14570 6601 4667 gene locus_tag LOCUS_14580 6601 4667 CDS product fatty-acid oxidation protein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085215.1 protein_id gnl|my_center|LOCUS_14580 7466 6705 gene locus_tag LOCUS_14590 gene cobK 7466 6705 CDS product cobalt-precorrin-6A/precorrin-6x reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311006.1 protein_id gnl|my_center|LOCUS_14590 8557 7466 gene locus_tag LOCUS_14600 gene cbiD 8557 7466 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8GDE1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence087 1706 405 gene locus_tag LOCUS_14610 gene hisD 1706 405 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_14610 2257 1745 gene locus_tag LOCUS_14620 2257 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3531 2272 gene locus_tag LOCUS_14630 gene murA 3531 2272 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZB1 protein_id gnl|my_center|LOCUS_14630 3736 3536 gene locus_tag LOCUS_14640 3736 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3921 4631 gene locus_tag LOCUS_14650 3921 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 4628 6067 gene locus_tag LOCUS_14660 4628 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 6191 6523 gene locus_tag LOCUS_14670 6191 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7008 6583 gene locus_tag LOCUS_14680 7008 6583 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_14680 7155 7230 gene locus_tag LOCUS_t00200 7155 7230 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8161 8445 gene locus_tag LOCUS_14690 8161 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence088 465 1409 gene locus_tag LOCUS_14700 465 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1427 2548 gene locus_tag LOCUS_14710 1427 2548 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088658.1 protein_id gnl|my_center|LOCUS_14710 3743 2598 gene locus_tag LOCUS_14720 3743 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3915 4973 gene locus_tag LOCUS_14730 3915 4973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 protein_id gnl|my_center|LOCUS_14730 5094 6176 gene locus_tag LOCUS_14740 5094 6176 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDP2 protein_id gnl|my_center|LOCUS_14740 6176 7063 gene locus_tag LOCUS_14750 6176 7063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 protein_id gnl|my_center|LOCUS_14750 7067 7900 gene locus_tag LOCUS_14760 7067 7900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 protein_id gnl|my_center|LOCUS_14760 7917 8354 gene locus_tag LOCUS_14770 7917 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8473 8547 gene locus_tag LOCUS_t00210 8473 8547 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 284 129 gene locus_tag LOCUS_14780 284 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 406 630 gene locus_tag LOCUS_14790 406 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 971 657 gene locus_tag LOCUS_14800 971 657 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930852.1 protein_id gnl|my_center|LOCUS_14800 1646 1020 gene locus_tag LOCUS_14810 gene hisI 1646 1020 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUU7 protein_id gnl|my_center|LOCUS_14810 2416 1649 gene locus_tag LOCUS_14820 gene hisF 2416 1649 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N9 protein_id gnl|my_center|LOCUS_14820 3150 2410 gene locus_tag LOCUS_14830 gene hisA 3150 2410 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUW5 protein_id gnl|my_center|LOCUS_14830 3758 3147 gene locus_tag LOCUS_14840 gene hisH 3758 3147 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9P1 protein_id gnl|my_center|LOCUS_14840 5434 3755 gene locus_tag LOCUS_14850 5434 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 6343 5444 gene locus_tag LOCUS_14860 gene hisG 6343 5444 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW86 protein_id gnl|my_center|LOCUS_14860 6664 6362 gene locus_tag LOCUS_14870 6664 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_14870 7290 6775 gene locus_tag LOCUS_14880 7290 6775 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709628.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence090 2834 1542 gene locus_tag LOCUS_14890 2834 1542 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_14890 3474 2827 gene locus_tag LOCUS_14900 3474 2827 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_14900 4649 3471 gene locus_tag LOCUS_14910 gene nuoD 4649 3471 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F8 protein_id gnl|my_center|LOCUS_14910 5318 4659 gene locus_tag LOCUS_14920 gene nuoC 5318 4659 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU38 protein_id gnl|my_center|LOCUS_14920 5878 5330 gene locus_tag LOCUS_14930 gene nuoB 5878 5330 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 protein_id gnl|my_center|LOCUS_14930 6234 5869 gene locus_tag LOCUS_14940 gene nuoA 6234 5869 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 protein_id gnl|my_center|LOCUS_14940 6514 7392 gene locus_tag LOCUS_14950 6514 7392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_14950 7423 7863 gene locus_tag LOCUS_14960 7423 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence091 718 206 gene locus_tag LOCUS_14970 718 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_14970 1379 825 gene locus_tag LOCUS_14980 1379 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1446 1919 gene locus_tag LOCUS_14990 1446 1919 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919242.1 protein_id gnl|my_center|LOCUS_14990 2417 1935 gene locus_tag LOCUS_15000 gene nusB 2417 1935 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H535 protein_id gnl|my_center|LOCUS_15000 2853 2422 gene locus_tag LOCUS_15010 gene ribH 2853 2422 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7P7 protein_id gnl|my_center|LOCUS_15010 4004 2853 gene locus_tag LOCUS_15020 4004 2853 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_15020 4615 4007 gene locus_tag LOCUS_15030 4615 4007 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_15030 5774 4635 gene locus_tag LOCUS_15040 5774 4635 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_15040 6219 5767 gene locus_tag LOCUS_15050 gene nrdR 6219 5767 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_15050 7569 6265 gene locus_tag LOCUS_15060 gene glyA2 7569 6265 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMP4 protein_id gnl|my_center|LOCUS_15060 8136 7687 gene locus_tag LOCUS_15070 8136 7687 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183002.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence092 556 98 gene locus_tag LOCUS_15080 556 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1198 566 gene locus_tag LOCUS_15090 1198 566 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931020.1 protein_id gnl|my_center|LOCUS_15090 1730 1209 gene locus_tag LOCUS_15100 1730 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2425 1862 gene locus_tag LOCUS_15110 2425 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2895 2428 gene locus_tag LOCUS_15120 gene rplM 2895 2428 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QR4 protein_id gnl|my_center|LOCUS_15120 3223 3059 gene locus_tag LOCUS_15130 3223 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3173 3844 gene locus_tag LOCUS_15140 3173 3844 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_15140 5253 3910 gene locus_tag LOCUS_15150 5253 3910 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_15150 5792 6208 gene locus_tag LOCUS_15160 5792 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 6374 7411 gene locus_tag LOCUS_15170 gene trpD 6374 7411 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_15170 >Feature sequence093 123 1403 gene locus_tag LOCUS_15180 gene proA 123 1403 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV8 protein_id gnl|my_center|LOCUS_15180 1384 2031 gene locus_tag LOCUS_15190 gene nadD 1384 2031 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV07 protein_id gnl|my_center|LOCUS_15190 2263 2514 gene locus_tag LOCUS_15200 2263 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2548 3006 gene locus_tag LOCUS_15210 gene rlmH 2548 3006 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV09 protein_id gnl|my_center|LOCUS_15210 3071 4609 gene locus_tag LOCUS_15220 gene gpmI 3071 4609 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_15220 4755 6125 gene locus_tag LOCUS_15230 4755 6125 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_15230 6122 6604 gene locus_tag LOCUS_15240 gene rppH 6122 6604 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_15240 7046 6693 gene locus_tag LOCUS_15250 gene atpC 7046 6693 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_15250 <7996 7088 gene locus_tag LOCUS_15260 <7996 7088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV18:ATP synthase subunit beta >Feature sequence094 14 90 gene locus_tag LOCUS_t00220 14 90 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 785 2830 gene locus_tag LOCUS_15270 785 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3629 2847 gene locus_tag LOCUS_15280 3629 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_15280 4474 3626 gene locus_tag LOCUS_15290 gene panC 4474 3626 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 protein_id gnl|my_center|LOCUS_15290 5308 4496 gene locus_tag LOCUS_15300 gene panB 5308 4496 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NN1 protein_id gnl|my_center|LOCUS_15300 7055 5460 gene locus_tag LOCUS_15310 7055 5460 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence095 1726 260 gene locus_tag LOCUS_15320 gene murF 1726 260 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 protein_id gnl|my_center|LOCUS_15320 3231 1723 gene locus_tag LOCUS_15330 gene murE 3231 1723 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_15330 4936 3218 gene locus_tag LOCUS_15340 4936 3218 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_15340 5403 4936 gene locus_tag LOCUS_15350 5403 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6398 5394 gene locus_tag LOCUS_15360 gene rsmH 6398 5394 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_15360 6880 6398 gene locus_tag LOCUS_15370 gene mraZ 6880 6398 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT5 protein_id gnl|my_center|LOCUS_15370 >Feature sequence096 1831 542 gene locus_tag LOCUS_15380 gene actS 1831 542 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968329.1 protein_id gnl|my_center|LOCUS_15380 4425 1960 gene locus_tag LOCUS_15390 gene gyrB 4425 1960 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI6 protein_id gnl|my_center|LOCUS_15390 5540 4407 gene locus_tag LOCUS_15400 gene recF 5540 4407 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI7 protein_id gnl|my_center|LOCUS_15400 6774 5671 gene locus_tag LOCUS_15410 6774 5671 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_15410 <7766 7026 gene locus_tag LOCUS_15420 <7766 7026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RYI9:chromosomal replication initiator protein DnaA >Feature sequence097 638 1558 gene locus_tag LOCUS_15430 gene metA 638 1558 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWE8 protein_id gnl|my_center|LOCUS_15430 2621 1572 gene locus_tag LOCUS_15440 gene purK 2621 1572 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_15440 3130 2618 gene locus_tag LOCUS_15450 gene purE 3130 2618 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJT3 protein_id gnl|my_center|LOCUS_15450 3389 3180 gene locus_tag LOCUS_15460 3389 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_15460 4014 3448 gene locus_tag LOCUS_15470 4014 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_15470 4203 4403 gene locus_tag LOCUS_15480 4203 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4403 5182 gene locus_tag LOCUS_15490 4403 5182 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388812.1 protein_id gnl|my_center|LOCUS_15490 6113 5202 gene locus_tag LOCUS_15500 6113 5202 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_15500 6711 6142 gene locus_tag LOCUS_15510 6711 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 <7736 6717 gene locus_tag LOCUS_15520 <7736 6717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969697.1:MFS transporter >Feature sequence098 34 519 gene locus_tag LOCUS_15530 34 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1101 613 gene locus_tag LOCUS_15540 1101 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1706 1101 gene locus_tag LOCUS_15550 gene atpF2 1706 1101 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ14 protein_id gnl|my_center|LOCUS_15550 1999 1772 gene locus_tag LOCUS_15560 gene atpE 1999 1772 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA5 protein_id gnl|my_center|LOCUS_15560 2846 2085 gene locus_tag LOCUS_15570 gene atpB 2846 2085 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 protein_id gnl|my_center|LOCUS_15570 3213 2839 gene locus_tag LOCUS_15580 3213 2839 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6M3 protein_id gnl|my_center|LOCUS_15580 6920 3501 gene locus_tag LOCUS_15590 gene smc 6920 3501 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Y9 protein_id gnl|my_center|LOCUS_15590 <7574 6952 gene locus_tag LOCUS_15600 <7574 6952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006309853.1:disulfide bond formation protein DsbD >Feature sequence099 1862 849 gene locus_tag LOCUS_15610 1862 849 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_15610 2569 1865 gene locus_tag LOCUS_15620 2569 1865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_15620 3387 2566 gene locus_tag LOCUS_15630 3387 2566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_15630 4597 3416 gene locus_tag LOCUS_15640 4597 3416 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_15640 4786 6138 gene locus_tag LOCUS_15650 4786 6138 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973457.1 protein_id gnl|my_center|LOCUS_15650 <7535 6151 gene locus_tag LOCUS_15660 <7535 6151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331276.1:trimethylamine methyltransferase >Feature sequence100 <1 647 gene locus_tag LOCUS_15670 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918195.1:protein-tyrosine-phosphatase 2432 663 gene locus_tag LOCUS_15680 2432 663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_15680 3508 2438 gene locus_tag LOCUS_15690 gene waaF 3508 2438 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_15690 3691 4371 gene locus_tag LOCUS_15700 3691 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_15700 4371 5651 gene locus_tag LOCUS_15710 gene kdtA 4371 5651 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208986.1 protein_id gnl|my_center|LOCUS_15710 5648 6652 gene locus_tag LOCUS_15720 gene lpxK 5648 6652 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6I0 protein_id gnl|my_center|LOCUS_15720 >Feature sequence101 428 1363 gene locus_tag LOCUS_15730 428 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1305 1874 gene locus_tag LOCUS_15740 1305 1874 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338578.1 protein_id gnl|my_center|LOCUS_15740 3705 1876 gene locus_tag LOCUS_15750 gene mutL 3705 1876 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DE6 protein_id gnl|my_center|LOCUS_15750 4258 3716 gene locus_tag LOCUS_15760 4258 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4758 4255 gene locus_tag LOCUS_15770 gene lspA 4758 4255 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 protein_id gnl|my_center|LOCUS_15770 <7310 4799 gene locus_tag LOCUS_15780 <7310 4799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ34:isoleucine--tRNA ligase >Feature sequence102 <1 1639 gene locus_tag LOCUS_15790 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084027.1:ABC transporter ATP-binding protein 1667 3049 gene locus_tag LOCUS_15800 1667 3049 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931468.1 protein_id gnl|my_center|LOCUS_15800 5228 3072 gene locus_tag LOCUS_15810 5228 3072 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086709.1 protein_id gnl|my_center|LOCUS_15810 6417 5221 gene locus_tag LOCUS_15820 6417 5221 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence103 1809 490 gene locus_tag LOCUS_15830 1809 490 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083307.1 protein_id gnl|my_center|LOCUS_15830 2659 1796 gene locus_tag LOCUS_15840 gene dapF 2659 1796 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_15840 3544 2765 gene locus_tag LOCUS_15850 3544 2765 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_15850 5498 3600 gene locus_tag LOCUS_15860 5498 3600 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706100.1 protein_id gnl|my_center|LOCUS_15860 6296 5661 gene locus_tag LOCUS_15870 6296 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 <7281 6286 gene locus_tag LOCUS_15880 <7281 6286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92L89:DNA translocase FtsK >Feature sequence104 1030 50 gene locus_tag LOCUS_15890 1030 50 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_15890 1266 1691 gene locus_tag LOCUS_15900 1266 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1807 2514 gene locus_tag LOCUS_15910 1807 2514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_15910 2507 3184 gene locus_tag LOCUS_15920 2507 3184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_15920 3213 4049 gene locus_tag LOCUS_15930 3213 4049 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_15930 4766 4071 gene locus_tag LOCUS_15940 4766 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4932 5702 gene locus_tag LOCUS_15950 4932 5702 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_15950 6829 5711 gene locus_tag LOCUS_15960 6829 5711 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530831.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence105 873 2501 gene locus_tag LOCUS_15970 873 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2760 2518 gene locus_tag LOCUS_15980 2760 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2938 3333 gene locus_tag LOCUS_15990 gene fliS 2938 3333 CDS product flagellar biosynthesis protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337948.1 protein_id gnl|my_center|LOCUS_15990 3330 3653 gene locus_tag LOCUS_16000 3330 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 4756 3650 gene locus_tag LOCUS_16010 gene fleQ 4756 3650 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720220.1 protein_id gnl|my_center|LOCUS_16010 4977 6179 gene locus_tag LOCUS_16020 gene torF 4977 6179 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337955.1 protein_id gnl|my_center|LOCUS_16020 6192 6503 gene locus_tag LOCUS_16030 6192 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence106 252 842 gene locus_tag LOCUS_16040 252 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 855 1508 gene locus_tag LOCUS_16050 855 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529733.1 protein_id gnl|my_center|LOCUS_16050 2152 1526 gene locus_tag LOCUS_16060 2152 1526 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532893.1 protein_id gnl|my_center|LOCUS_16060 3502 2195 gene locus_tag LOCUS_16070 3502 2195 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_16070 4896 3556 gene locus_tag LOCUS_16080 gene glxD 4896 3556 CDS product glutamate synthase large subunit-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87392 protein_id gnl|my_center|LOCUS_16080 5591 4908 gene locus_tag LOCUS_16090 gene fwdC 5591 4908 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_16090 6489 5593 gene locus_tag LOCUS_16100 gene purF 6489 5593 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973660.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence107 2 604 gene locus_tag LOCUS_16110 2 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 671 1441 gene locus_tag LOCUS_16120 671 1441 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 protein_id gnl|my_center|LOCUS_16120 1618 3822 gene locus_tag LOCUS_16130 1618 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5300 4395 gene locus_tag LOCUS_16140 5300 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6358 5621 gene locus_tag LOCUS_16150 6358 5621 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence108 1566 2582 gene locus_tag LOCUS_16160 gene bztA 1566 2582 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_16160 2798 3856 gene locus_tag LOCUS_16170 2798 3856 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_16170 3859 4998 gene locus_tag LOCUS_16180 3859 4998 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 protein_id gnl|my_center|LOCUS_16180 5014 5781 gene locus_tag LOCUS_16190 5014 5781 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 protein_id gnl|my_center|LOCUS_16190 6688 5828 gene locus_tag LOCUS_16200 gene SseA 6688 5828 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence109 <1 738 gene locus_tag LOCUS_16210 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020819.1:cryptochrome/photolyase family protein 758 1399 gene locus_tag LOCUS_16220 758 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234232.1 protein_id gnl|my_center|LOCUS_16220 1396 1974 gene locus_tag LOCUS_16230 1396 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705035.1 protein_id gnl|my_center|LOCUS_16230 1971 2528 gene locus_tag LOCUS_16240 1971 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3258 2515 gene locus_tag LOCUS_16250 3258 2515 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 protein_id gnl|my_center|LOCUS_16250 3370 3849 gene locus_tag LOCUS_16260 3370 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4785 3865 gene locus_tag LOCUS_16270 gene rbsK 4785 3865 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGC7 protein_id gnl|my_center|LOCUS_16270 5544 4900 gene locus_tag LOCUS_16280 5544 4900 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 protein_id gnl|my_center|LOCUS_16280 6284 5610 gene locus_tag LOCUS_16290 gene ung2 6284 5610 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_16290 >Feature sequence110 1456 860 gene locus_tag LOCUS_16300 gene pdxH 1456 860 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y3 protein_id gnl|my_center|LOCUS_16300 1688 2275 gene locus_tag LOCUS_16310 1688 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2586 3353 gene locus_tag LOCUS_16320 gene fabI1 2586 3353 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58380 protein_id gnl|my_center|LOCUS_16320 3355 4449 gene locus_tag LOCUS_16330 gene aroC 3355 4449 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR25 protein_id gnl|my_center|LOCUS_16330 5243 4446 gene locus_tag LOCUS_16340 5243 4446 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_16340 6768 5308 gene locus_tag LOCUS_16350 gene dxs1 6768 5308 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD6 protein_id gnl|my_center|LOCUS_16350 >Feature sequence111 2629 1403 gene locus_tag LOCUS_16360 2629 1403 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336784.1 protein_id gnl|my_center|LOCUS_16360 2909 3439 gene locus_tag LOCUS_16370 2909 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3429 4700 gene locus_tag LOCUS_16380 3429 4700 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709638.1 protein_id gnl|my_center|LOCUS_16380 5074 4709 gene locus_tag LOCUS_16390 5074 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708243.1 protein_id gnl|my_center|LOCUS_16390 5418 5173 gene locus_tag LOCUS_16400 5418 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 6073 5420 gene locus_tag LOCUS_16410 6073 5420 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528774.1 protein_id gnl|my_center|LOCUS_16410 <6732 6202 gene locus_tag LOCUS_16420 <6732 6202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391458.1:co-chaperone YbbN >Feature sequence112 203 1135 gene locus_tag LOCUS_16430 203 1135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336870.1 protein_id gnl|my_center|LOCUS_16430 2017 1373 gene locus_tag LOCUS_16440 gene cbbY 2017 1373 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089577.1 protein_id gnl|my_center|LOCUS_16440 2260 2874 gene locus_tag LOCUS_16450 2260 2874 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707287.1 protein_id gnl|my_center|LOCUS_16450 2962 3120 gene locus_tag LOCUS_16460 2962 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4042 3173 gene locus_tag LOCUS_16470 4042 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 4501 4142 gene locus_tag LOCUS_16480 4501 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5719 4793 gene locus_tag LOCUS_16490 5719 4793 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_16490 6443 5835 gene locus_tag LOCUS_16500 6443 5835 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 protein_id gnl|my_center|LOCUS_16500 6542 6712 gene locus_tag LOCUS_16510 6542 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence113 2344 845 gene locus_tag LOCUS_16520 2344 845 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_16520 2830 2396 gene locus_tag LOCUS_16530 gene uspA 2830 2396 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277008.1 protein_id gnl|my_center|LOCUS_16530 4073 3159 gene locus_tag LOCUS_16540 4073 3159 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_16540 5346 4081 gene locus_tag LOCUS_16550 5346 4081 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_16550 6501 5410 gene locus_tag LOCUS_16560 6501 5410 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence114 2033 1074 gene locus_tag LOCUS_16570 2033 1074 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 protein_id gnl|my_center|LOCUS_16570 2266 3087 gene locus_tag LOCUS_16580 2266 3087 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_16580 3087 4256 gene locus_tag LOCUS_16590 3087 4256 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_16590 4274 5446 gene locus_tag LOCUS_16600 gene pepQ 4274 5446 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906076.1 protein_id gnl|my_center|LOCUS_16600 5473 6255 gene locus_tag LOCUS_16610 5473 6255 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064245.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence115 568 1602 gene locus_tag LOCUS_16620 568 1602 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528701.1 protein_id gnl|my_center|LOCUS_16620 2185 1622 gene locus_tag LOCUS_16630 2185 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5150 2178 gene locus_tag LOCUS_16640 5150 2178 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_16640 5434 5147 gene locus_tag LOCUS_16650 gene soxD2 5434 5147 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707982.1 protein_id gnl|my_center|LOCUS_16650 <6403 5447 gene locus_tag LOCUS_16660 <6403 5447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707983.1:sarcosine oxidase subunit beta >Feature sequence116 2350 1754 gene locus_tag LOCUS_16670 2350 1754 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531137.1 protein_id gnl|my_center|LOCUS_16670 2907 2488 gene locus_tag LOCUS_16680 2907 2488 CDS product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537578.1 protein_id gnl|my_center|LOCUS_16680 5727 3040 gene locus_tag LOCUS_16690 5727 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6251 5889 gene locus_tag LOCUS_16700 6251 5889 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence117 594 241 gene locus_tag LOCUS_16710 594 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1423 596 gene locus_tag LOCUS_16720 1423 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2281 1658 gene locus_tag LOCUS_16730 2281 1658 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_16730 2818 2336 gene locus_tag LOCUS_16740 2818 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3399 2839 gene locus_tag LOCUS_16750 3399 2839 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_16750 3534 3731 gene locus_tag LOCUS_16760 3534 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5670 3748 gene locus_tag LOCUS_16770 5670 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence118 2167 3051 gene locus_tag LOCUS_16780 gene folD 2167 3051 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB2 protein_id gnl|my_center|LOCUS_16780 3051 4355 gene locus_tag LOCUS_16790 3051 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040264.1 protein_id gnl|my_center|LOCUS_16790 4339 5103 gene locus_tag LOCUS_16800 gene glpQ 4339 5103 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence119 1863 829 gene locus_tag LOCUS_16810 gene gpuA 1863 829 CDS product guanidinopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6K2 protein_id gnl|my_center|LOCUS_16810 2811 1867 gene locus_tag LOCUS_16820 2811 1867 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971710.1 protein_id gnl|my_center|LOCUS_16820 3302 2853 gene locus_tag LOCUS_16830 gene ytoQ 3302 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_16830 3516 3881 gene locus_tag LOCUS_16840 3516 3881 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_16840 4817 3897 gene locus_tag LOCUS_16850 4817 3897 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence120 <1 650 gene locus_tag LOCUS_16860 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391182.1:double-strand break repair protein AddB 643 4131 gene locus_tag LOCUS_16870 643 4131 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_16870 4172 4492 gene locus_tag LOCUS_16880 4172 4492 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_16880 5930 4563 gene locus_tag LOCUS_16890 5930 4563 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence121 1939 569 gene locus_tag LOCUS_16900 1939 569 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_16900 2116 3396 gene locus_tag LOCUS_16910 2116 3396 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 protein_id gnl|my_center|LOCUS_16910 4431 3439 gene locus_tag LOCUS_16920 gene speB 4431 3439 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_16920 5268 4456 gene locus_tag LOCUS_16930 5268 4456 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_16930 <6114 5265 gene locus_tag LOCUS_16940 <6114 5265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071491.1:putrescine ABC transporter permease >Feature sequence122 1886 300 gene locus_tag LOCUS_16950 1886 300 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418263.1 protein_id gnl|my_center|LOCUS_16950 3520 1919 gene locus_tag LOCUS_16960 3520 1919 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522103.1 protein_id gnl|my_center|LOCUS_16960 3792 5438 gene locus_tag LOCUS_16970 3792 5438 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence123 2171 738 gene locus_tag LOCUS_16980 gene phrB 2171 738 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_16980 3012 2218 gene locus_tag LOCUS_16990 3012 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3147 4058 gene locus_tag LOCUS_17000 3147 4058 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531939.1 protein_id gnl|my_center|LOCUS_17000 5120 4071 gene locus_tag LOCUS_17010 gene pyrC 5120 4071 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SC7 protein_id gnl|my_center|LOCUS_17010 <6021 5194 gene locus_tag LOCUS_17020 <6021 5194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389832.1:glutamine synthetase >Feature sequence124 724 29 gene locus_tag LOCUS_17030 724 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1737 724 gene locus_tag LOCUS_17040 gene cobT 1737 724 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH66 protein_id gnl|my_center|LOCUS_17040 2316 1780 gene locus_tag LOCUS_17050 gene cobP 2316 1780 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_17050 2655 4253 gene locus_tag LOCUS_17060 2655 4253 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence125 1760 249 gene locus_tag LOCUS_17070 1760 249 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 protein_id gnl|my_center|LOCUS_17070 2566 1760 gene locus_tag LOCUS_17080 gene ubiE 2566 1760 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY65 protein_id gnl|my_center|LOCUS_17080 2716 3549 gene locus_tag LOCUS_17090 gene mutM 2716 3549 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_17090 3608 3976 gene locus_tag LOCUS_17100 3608 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4164 4430 gene locus_tag LOCUS_17110 gene rpsT 4164 4430 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMP9 protein_id gnl|my_center|LOCUS_17110 >Feature sequence126 2753 1698 gene locus_tag LOCUS_17120 2753 1698 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_17120 2949 2767 gene locus_tag LOCUS_17130 2949 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3647 3120 gene locus_tag LOCUS_17140 gene pfpI 3647 3120 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 protein_id gnl|my_center|LOCUS_17140 4258 5703 gene locus_tag LOCUS_17150 4258 5703 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU7 protein_id gnl|my_center|LOCUS_17150 >Feature sequence127 <1 2222 gene locus_tag LOCUS_17160 <1 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948496.1:aminopeptidase N 3640 2231 gene locus_tag LOCUS_17170 3640 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3772 4497 gene locus_tag LOCUS_17180 3772 4497 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_17180 <5579 4494 gene locus_tag LOCUS_17190 <5579 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQT8:DNA topoisomerase 4 subunit B >Feature sequence128 2093 804 gene locus_tag LOCUS_17200 2093 804 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528002.1 protein_id gnl|my_center|LOCUS_17200 2922 2098 gene locus_tag LOCUS_17210 2922 2098 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706991.1 protein_id gnl|my_center|LOCUS_17210 4660 3059 gene locus_tag LOCUS_17220 4660 3059 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 protein_id gnl|my_center|LOCUS_17220 5103 4810 gene locus_tag LOCUS_17230 5103 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence129 <1 871 gene locus_tag LOCUS_17240 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KNP3:pseudouridine-5'-phosphate glycosidase 994 1410 gene locus_tag LOCUS_17250 994 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2466 1438 gene locus_tag LOCUS_17260 2466 1438 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170557.1 protein_id gnl|my_center|LOCUS_17260 2643 3701 gene locus_tag LOCUS_17270 2643 3701 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902083.1 protein_id gnl|my_center|LOCUS_17270 3912 5147 gene locus_tag LOCUS_17280 3912 5147 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969913.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence130 <1 863 gene locus_tag LOCUS_17290 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288608.1:hyaluronate lyase 1684 860 gene locus_tag LOCUS_17300 1684 860 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUP6 protein_id gnl|my_center|LOCUS_17300 1889 2356 gene locus_tag LOCUS_17310 1889 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2383 2703 gene locus_tag LOCUS_17320 2383 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529006.1 protein_id gnl|my_center|LOCUS_17320 3873 2713 gene locus_tag LOCUS_17330 3873 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969980.1 protein_id gnl|my_center|LOCUS_17330 4018 4710 gene locus_tag LOCUS_17340 4018 4710 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence131 347 790 gene locus_tag LOCUS_17350 347 790 CDS product blasticidin S-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703859.1 protein_id gnl|my_center|LOCUS_17350 2581 851 gene locus_tag LOCUS_17360 gene ilvD 2581 851 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_17360 5135 2619 gene locus_tag LOCUS_17370 gene valS 5135 2619 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 protein_id gnl|my_center|LOCUS_17370 >Feature sequence132 66 959 gene locus_tag LOCUS_17380 66 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1122 1196 gene locus_tag LOCUS_t00230 1122 1196 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1272 1853 gene locus_tag LOCUS_17390 1272 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2593 1862 gene locus_tag LOCUS_17400 2593 1862 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142830.1 protein_id gnl|my_center|LOCUS_17400 2687 3835 gene locus_tag LOCUS_17410 2687 3835 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_17410 4716 4036 gene locus_tag LOCUS_17420 4716 4036 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence133 2731 1886 gene locus_tag LOCUS_17430 2731 1886 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710167.1 protein_id gnl|my_center|LOCUS_17430 3544 2756 gene locus_tag LOCUS_17440 3544 2756 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_17440 <5101 3546 gene locus_tag LOCUS_17450 <5101 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192697.1:sugar ABC transporter >Feature sequence134 1041 415 gene locus_tag LOCUS_17460 1041 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_17460 1282 1611 gene locus_tag LOCUS_17470 1282 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067288.1 protein_id gnl|my_center|LOCUS_17470 1776 2054 gene locus_tag LOCUS_17480 1776 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2208 2426 gene locus_tag LOCUS_17490 2208 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602550.1 protein_id gnl|my_center|LOCUS_17490 3082 2462 gene locus_tag LOCUS_17500 3082 2462 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706095.1 protein_id gnl|my_center|LOCUS_17500 3383 3150 gene locus_tag LOCUS_17510 3383 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3878 3477 gene locus_tag LOCUS_17520 3878 3477 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 protein_id gnl|my_center|LOCUS_17520 4194 3883 gene locus_tag LOCUS_17530 4194 3883 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204343.1 protein_id gnl|my_center|LOCUS_17530 5052 4723 gene locus_tag LOCUS_17540 5052 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence135 689 1390 gene locus_tag LOCUS_17550 689 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2606 1491 gene locus_tag LOCUS_17560 2606 1491 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_17560 3011 2664 gene locus_tag LOCUS_17570 3011 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4818 3076 gene locus_tag LOCUS_17580 4818 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence136 962 57 gene locus_tag LOCUS_17590 962 57 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_17590 1214 2338 gene locus_tag LOCUS_17600 1214 2338 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_17600 3352 2363 gene locus_tag LOCUS_17610 3352 2363 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528364.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence137 1740 1075 gene locus_tag LOCUS_17620 1740 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2025 1771 gene locus_tag LOCUS_17630 gene rpsR 2025 1771 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9B0 protein_id gnl|my_center|LOCUS_17630 2478 2026 gene locus_tag LOCUS_17640 2478 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2726 3676 gene locus_tag LOCUS_17650 gene fabD 2726 3676 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJH8 protein_id gnl|my_center|LOCUS_17650 3759 4496 gene locus_tag LOCUS_17660 gene fabG 3759 4496 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence138 <1 876 gene locus_tag LOCUS_17670 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337262.1:cysteine desulfurase 1032 2207 gene locus_tag LOCUS_17680 gene patB 1032 2207 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537460.1 protein_id gnl|my_center|LOCUS_17680 2246 3148 gene locus_tag LOCUS_17690 2246 3148 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193291.1 protein_id gnl|my_center|LOCUS_17690 3828 3145 gene locus_tag LOCUS_17700 3828 3145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930483.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence139 1574 699 gene locus_tag LOCUS_17710 gene atpG 1574 699 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S2 protein_id gnl|my_center|LOCUS_17710 3160 1625 gene locus_tag LOCUS_17720 gene atpA 3160 1625 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 protein_id gnl|my_center|LOCUS_17720 3783 3160 gene locus_tag LOCUS_17730 gene atpH 3783 3160 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_17730 <4806 3907 gene locus_tag LOCUS_17740 <4806 3907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV22:primosomal protein N' >Feature sequence140 1101 151 gene locus_tag LOCUS_17750 gene yeiC 1101 151 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208153.1 protein_id gnl|my_center|LOCUS_17750 1425 2726 gene locus_tag LOCUS_17760 gene amt-1 1425 2726 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_17760 2884 3096 gene locus_tag LOCUS_17770 2884 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3799 3143 gene locus_tag LOCUS_17780 3799 3143 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087925.1 protein_id gnl|my_center|LOCUS_17780 4705 3809 gene locus_tag LOCUS_17790 4705 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence141 1129 176 gene locus_tag LOCUS_17800 1129 176 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532707.1 protein_id gnl|my_center|LOCUS_17800 1868 1236 gene locus_tag LOCUS_17810 1868 1236 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970633.1 protein_id gnl|my_center|LOCUS_17810 2041 3072 gene locus_tag LOCUS_17820 2041 3072 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 protein_id gnl|my_center|LOCUS_17820 3197 4501 gene locus_tag LOCUS_17830 gene smoE 3197 4501 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525578.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence142 34 1017 gene locus_tag LOCUS_17840 gene murG 34 1017 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF54 protein_id gnl|my_center|LOCUS_17840 1014 2435 gene locus_tag LOCUS_17850 gene murC 1014 2435 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 protein_id gnl|my_center|LOCUS_17850 2432 3361 gene locus_tag LOCUS_17860 gene murB 2432 3361 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU9 protein_id gnl|my_center|LOCUS_17860 3358 4266 gene locus_tag LOCUS_17870 gene ddl 3358 4266 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU7 protein_id gnl|my_center|LOCUS_17870 >Feature sequence143 1239 208 gene locus_tag LOCUS_17880 1239 208 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975109.1 protein_id gnl|my_center|LOCUS_17880 1553 2707 gene locus_tag LOCUS_17890 1553 2707 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_17890 2775 3584 gene locus_tag LOCUS_17900 gene fadB 2775 3584 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_17900 4411 3614 gene locus_tag LOCUS_17910 4411 3614 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194709.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence144 <1 1182 gene locus_tag LOCUS_17920 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388453.1:citramalate synthase 1212 1979 gene locus_tag LOCUS_17930 gene trmJ 1212 1979 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_17930 2096 2722 gene locus_tag LOCUS_17940 gene rpsD 2096 2722 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ0 protein_id gnl|my_center|LOCUS_17940 2835 3197 gene locus_tag LOCUS_17950 2835 3197 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104566.1 protein_id gnl|my_center|LOCUS_17950 3553 3215 gene locus_tag LOCUS_17960 3553 3215 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI6 protein_id gnl|my_center|LOCUS_17960 3848 3609 gene locus_tag LOCUS_17970 3848 3609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_17970 <4549 3900 gene locus_tag LOCUS_17980 <4549 3900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWI3:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence145 1049 63 gene locus_tag LOCUS_17990 1049 63 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815879.1 protein_id gnl|my_center|LOCUS_17990 2687 1104 gene locus_tag LOCUS_18000 2687 1104 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 protein_id gnl|my_center|LOCUS_18000 2897 3439 gene locus_tag LOCUS_18010 2897 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3844 3446 gene locus_tag LOCUS_18020 3844 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence146 2278 1253 gene locus_tag LOCUS_18030 2278 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3295 2282 gene locus_tag LOCUS_18040 3295 2282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380009.1 protein_id gnl|my_center|LOCUS_18040 <4394 3413 gene locus_tag LOCUS_18050 <4394 3413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973330.1:ABC transporter substrate-binding protein >Feature sequence147 337 708 gene locus_tag LOCUS_18060 337 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2556 754 gene locus_tag LOCUS_18070 gene lepA 2556 754 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNY6 protein_id gnl|my_center|LOCUS_18070 >Feature sequence148 1320 895 gene locus_tag LOCUS_18080 1320 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1742 1317 gene locus_tag LOCUS_18090 1742 1317 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_18090 2308 1745 gene locus_tag LOCUS_18100 2308 1745 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_18100 2670 2305 gene locus_tag LOCUS_18110 2670 2305 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024439.1 protein_id gnl|my_center|LOCUS_18110 2950 2663 gene locus_tag LOCUS_18120 2950 2663 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_18120 3444 2947 gene locus_tag LOCUS_18130 3444 2947 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_18130 3635 3781 gene locus_tag LOCUS_18140 3635 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence149 2504 1014 gene locus_tag LOCUS_18150 2504 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3021 2776 gene locus_tag LOCUS_18160 3021 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <4204 3040 gene locus_tag LOCUS_18170 <4204 3040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974909.1:cytochrome P450 >Feature sequence150 949 1881 gene locus_tag LOCUS_18180 949 1881 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927097.1 protein_id gnl|my_center|LOCUS_18180 2722 1925 gene locus_tag LOCUS_18190 2722 1925 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530131.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence151 1713 718 gene locus_tag LOCUS_18200 1713 718 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815914.1 protein_id gnl|my_center|LOCUS_18200 2810 1710 gene locus_tag LOCUS_18210 2810 1710 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521858.1 protein_id gnl|my_center|LOCUS_18210 <4086 3393 gene locus_tag LOCUS_18220 <4086 3393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940551.1:aldehyde dehydrogenase >Feature sequence152 1416 70 gene locus_tag LOCUS_18230 1416 70 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_18230 2946 1477 gene locus_tag LOCUS_18240 gene guaB 2946 1477 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU6 protein_id gnl|my_center|LOCUS_18240 3862 3041 gene locus_tag LOCUS_18250 gene rlmE 3862 3041 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THI2 protein_id gnl|my_center|LOCUS_18250 >Feature sequence153 3570 607 gene locus_tag LOCUS_18260 gene sucA 3570 607 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_426301.2 protein_id gnl|my_center|LOCUS_18260 >Feature sequence154 >Feature sequence155 1445 525 gene locus_tag LOCUS_18270 gene glyQ 1445 525 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_18270 1769 1533 gene locus_tag LOCUS_18280 1769 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2654 1812 gene locus_tag LOCUS_18290 2654 1812 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532833.1 protein_id gnl|my_center|LOCUS_18290 3541 2780 gene locus_tag LOCUS_18300 3541 2780 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_18300 3746 3531 gene locus_tag LOCUS_18310 3746 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence156 883 1968 gene locus_tag LOCUS_18320 883 1968 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 protein_id gnl|my_center|LOCUS_18320 2103 2720 gene locus_tag LOCUS_18330 2103 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 protein_id gnl|my_center|LOCUS_18330 2717 3682 gene locus_tag LOCUS_18340 2717 3682 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532895.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence157 1130 756 gene locus_tag LOCUS_18350 1130 756 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_18350 3151 1244 gene locus_tag LOCUS_18360 3151 1244 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337826.1 protein_id gnl|my_center|LOCUS_18360 <3870 3208 gene locus_tag LOCUS_18370 <3870 3208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261697.1:LysR family transcriptional regulator >Feature sequence158 490 1683 gene locus_tag LOCUS_18380 gene tyrB 490 1683 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383317.1 protein_id gnl|my_center|LOCUS_18380 1741 3420 gene locus_tag LOCUS_18390 1741 3420 CDS product thiamine pyrophosphate TPP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530395.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence159 <1 3276 gene locus_tag LOCUS_18400 <1 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQV4:DNA-directed RNA polymerase subunit beta' >Feature sequence160 3244 563 gene locus_tag LOCUS_18410 gene clpB 3244 563 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM5 protein_id gnl|my_center|LOCUS_18410 >Feature sequence161 1472 477 gene locus_tag LOCUS_18420 1472 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1922 1494 gene locus_tag LOCUS_18430 1922 1494 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_18430 2647 1922 gene locus_tag LOCUS_18440 2647 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3238 2768 gene locus_tag LOCUS_18450 3238 2768 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066851.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence162 957 151 gene locus_tag LOCUS_18460 gene thiD 957 151 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56904 protein_id gnl|my_center|LOCUS_18460 1257 2078 gene locus_tag LOCUS_18470 1257 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2818 2075 gene locus_tag LOCUS_18480 2818 2075 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339088.1 protein_id gnl|my_center|LOCUS_18480 <3565 2815 gene locus_tag LOCUS_18490 <3565 2815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CAY0:DNA polymerase IV >Feature sequence163 1456 1172 gene locus_tag LOCUS_18500 1456 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2910 1453 gene locus_tag LOCUS_18510 2910 1453 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_18510 <3521 2907 gene locus_tag LOCUS_18520 <3521 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389325.1:cation:proton antiporter >Feature sequence164 226 651 gene locus_tag LOCUS_18530 226 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1087 674 gene locus_tag LOCUS_18540 1087 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_18540 2711 1149 gene locus_tag LOCUS_18550 gene aldA 2711 1149 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_18550 3061 3477 gene locus_tag LOCUS_18560 3061 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence165 1478 234 gene locus_tag LOCUS_18570 1478 234 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523157.1 protein_id gnl|my_center|LOCUS_18570 2581 1562 gene locus_tag LOCUS_18580 2581 1562 CDS product hydrolase glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence166 476 2053 gene locus_tag LOCUS_18590 476 2053 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 protein_id gnl|my_center|LOCUS_18590 2189 3166 gene locus_tag LOCUS_18600 2189 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence167 577 215 gene locus_tag LOCUS_18610 577 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1718 579 gene locus_tag LOCUS_18620 1718 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2094 3059 gene locus_tag LOCUS_18630 gene ctaA 2094 3059 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H9 protein_id gnl|my_center|LOCUS_18630 >Feature sequence168 1285 161 gene locus_tag LOCUS_18640 1285 161 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530956.1 protein_id gnl|my_center|LOCUS_18640 2621 1278 gene locus_tag LOCUS_18650 gene murD 2621 1278 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 protein_id gnl|my_center|LOCUS_18650 <3399 2631 gene locus_tag LOCUS_18660 <3399 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVU1:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence169 <1 506 gene locus_tag LOCUS_18670 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNQ7:adenosylhomocysteinase 527 1024 gene locus_tag LOCUS_18680 527 1024 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence170 1222 233 gene locus_tag LOCUS_18690 1222 233 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064349.1 protein_id gnl|my_center|LOCUS_18690 1492 1911 gene locus_tag LOCUS_18700 1492 1911 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707572.1 protein_id gnl|my_center|LOCUS_18700 2222 2007 gene locus_tag LOCUS_18710 2222 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 <3251 2234 gene locus_tag LOCUS_18720 <3251 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896012.1:ammonium transporter >Feature sequence171 1079 588 gene locus_tag LOCUS_18730 1079 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1253 2395 gene locus_tag LOCUS_18740 gene mutY 1253 2395 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538060.1 protein_id gnl|my_center|LOCUS_18740 <3207 2392 gene locus_tag LOCUS_18750 <3207 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYU8:bifunctional purine biosynthesis protein PurH >Feature sequence172 1288 371 gene locus_tag LOCUS_18760 1288 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1487 1412 gene locus_tag LOCUS_t00240 1487 1412 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2774 1680 gene locus_tag LOCUS_18770 2774 1680 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCI5 protein_id gnl|my_center|LOCUS_18770 >Feature sequence173 201 126 gene locus_tag LOCUS_t00250 201 126 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1134 274 gene locus_tag LOCUS_18780 1134 274 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140071.1 protein_id gnl|my_center|LOCUS_18780 1258 1614 gene locus_tag LOCUS_18790 1258 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2555 1632 gene locus_tag LOCUS_18800 2555 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence174 1226 78 gene locus_tag LOCUS_18810 1226 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 protein_id gnl|my_center|LOCUS_18810 2704 1223 gene locus_tag LOCUS_18820 2704 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence175 273 1532 gene locus_tag LOCUS_18830 gene mnmA 273 1532 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ES7 protein_id gnl|my_center|LOCUS_18830 2074 1556 gene locus_tag LOCUS_18840 2074 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2798 2166 gene locus_tag LOCUS_18850 2798 2166 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6V3 protein_id gnl|my_center|LOCUS_18850 2960 3036 gene locus_tag LOCUS_t00260 2960 3036 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 1326 70 gene locus_tag LOCUS_18860 gene purD 1326 70 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 protein_id gnl|my_center|LOCUS_18860 1385 2869 gene locus_tag LOCUS_18870 gene xseA 1385 2869 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A649 protein_id gnl|my_center|LOCUS_18870 >Feature sequence177 836 579 gene locus_tag LOCUS_18880 836 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 991 1683 gene locus_tag LOCUS_18890 991 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2181 1696 gene locus_tag LOCUS_18900 2181 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence178 737 1840 gene locus_tag LOCUS_18910 737 1840 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_18910 1946 2383 gene locus_tag LOCUS_18920 1946 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence179 1213 101 gene locus_tag LOCUS_18930 1213 101 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 protein_id gnl|my_center|LOCUS_18930 1543 2760 gene locus_tag LOCUS_18940 1543 2760 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence180 1268 453 gene locus_tag LOCUS_18950 1268 453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085657.1 protein_id gnl|my_center|LOCUS_18950 2212 1265 gene locus_tag LOCUS_18960 2212 1265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_18960 <2904 2212 gene locus_tag LOCUS_18970 <2904 2212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384486.1:peptide ABC transporter permease >Feature sequence181 1383 247 gene locus_tag LOCUS_18980 1383 247 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_18980 <2894 1757 gene locus_tag LOCUS_18990 <2894 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385060.1:oxidoreductase >Feature sequence182 535 1620 gene locus_tag LOCUS_19000 gene potF 535 1620 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WH82 protein_id gnl|my_center|LOCUS_19000 1723 2811 gene locus_tag LOCUS_19010 1723 2811 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM67 protein_id gnl|my_center|LOCUS_19010 >Feature sequence183 110 535 gene locus_tag LOCUS_19020 gene mutT 110 535 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_19020 1429 536 gene locus_tag LOCUS_19030 1429 536 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_19030 1833 2324 gene locus_tag LOCUS_19040 1833 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2373 2636 gene locus_tag LOCUS_19050 gene grxC 2373 2636 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence184 1328 675 gene locus_tag LOCUS_19060 gene tal 1328 675 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H6D3 protein_id gnl|my_center|LOCUS_19060 >Feature sequence185 1 426 gene locus_tag LOCUS_19070 1 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1737 430 gene locus_tag LOCUS_19080 1737 430 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence186 1020 4 gene locus_tag LOCUS_19090 gene yedY 1020 4 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_19090 2275 1073 gene locus_tag LOCUS_19100 gene aatA 2275 1073 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y488 protein_id gnl|my_center|LOCUS_19100 >Feature sequence187 1936 1100 gene locus_tag LOCUS_19110 gene ppiD 1936 1100 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CSN8 protein_id gnl|my_center|LOCUS_19110 >Feature sequence188 153 1301 gene locus_tag LOCUS_19120 153 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971570.1 protein_id gnl|my_center|LOCUS_19120 <2770 1313 gene locus_tag LOCUS_19130 <2770 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389862.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence189 2295 850 gene locus_tag LOCUS_19140 gene pykA 2295 850 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A3 protein_id gnl|my_center|LOCUS_19140 2540 2701 gene locus_tag LOCUS_19150 2540 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence190 <1 846 gene locus_tag LOCUS_19160 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y7E9:tyrosine recombinase XerC 2410 1001 gene locus_tag LOCUS_19170 2410 1001 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_19170 >Feature sequence191 1120 173 gene locus_tag LOCUS_19180 gene mdh 1120 173 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIV5 protein_id gnl|my_center|LOCUS_19180 2472 1279 gene locus_tag LOCUS_19190 2472 1279 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence192 <1 752 gene locus_tag LOCUS_19200 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038807.1:ABC transporter substrate-binding protein 846 1832 gene locus_tag LOCUS_19210 846 1832 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 protein_id gnl|my_center|LOCUS_19210 1900 2667 gene locus_tag LOCUS_19220 1900 2667 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084028.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence193 <1 948 gene locus_tag LOCUS_19230 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339410.1:xanthine dehydrogenase accessory protein XdhC 1028 2245 gene locus_tag LOCUS_19240 1028 2245 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887369.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence194 82 372 gene locus_tag LOCUS_19250 82 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 538 463 gene locus_tag LOCUS_t00270 538 463 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1323 811 gene locus_tag LOCUS_19260 gene coaD 1323 811 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK2 protein_id gnl|my_center|LOCUS_19260 <2628 1324 gene locus_tag LOCUS_19270 <2628 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TB11:DNA gyrase subunit A >Feature sequence195 <1 570 gene locus_tag LOCUS_19280 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969774.1:aldehyde dehydrogenase 570 1715 gene locus_tag LOCUS_19290 570 1715 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_19290 2545 2033 gene locus_tag LOCUS_19300 2545 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence196 1257 904 gene locus_tag LOCUS_19310 1257 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 <2600 1392 gene locus_tag LOCUS_19320 <2600 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545400.1:sodium:solute symporter >Feature sequence197 345 19 gene locus_tag LOCUS_19330 345 19 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_19330 515 1408 gene locus_tag LOCUS_19340 515 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1632 1423 gene locus_tag LOCUS_19350 1632 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 <2595 1659 gene locus_tag LOCUS_19360 <2595 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338501.1:peptidase M19 >Feature sequence198 267 872 gene locus_tag LOCUS_19370 267 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2248 965 gene locus_tag LOCUS_19380 2248 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence199 132 923 gene locus_tag LOCUS_19390 132 923 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_19390 2311 977 gene locus_tag LOCUS_19400 gene xylA 2311 977 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UD89 protein_id gnl|my_center|LOCUS_19400 >Feature sequence200 3 170 gene locus_tag LOCUS_19410 3 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 182 616 gene locus_tag LOCUS_19420 182 616 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037697.1 protein_id gnl|my_center|LOCUS_19420 616 951 gene locus_tag LOCUS_19430 616 951 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083958.1 protein_id gnl|my_center|LOCUS_19430 2481 955 gene locus_tag LOCUS_19440 gene mhpA 2481 955 CDS product 3-(3-hydroxyphenyl)propionate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence201 358 1725 gene locus_tag LOCUS_19450 gene glnA 358 1725 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence202 28 1068 gene locus_tag LOCUS_19460 gene hemH 28 1068 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M52 protein_id gnl|my_center|LOCUS_19460 1201 2031 gene locus_tag LOCUS_19470 1201 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence203 1397 414 gene locus_tag LOCUS_19480 1397 414 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_19480 >Feature sequence204 153 1661 gene locus_tag LOCUS_19490 gene ffh 153 1661 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG5 protein_id gnl|my_center|LOCUS_19490 1723 2178 gene locus_tag LOCUS_19500 1723 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence205 341 1963 gene locus_tag LOCUS_19510 341 1963 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence206 <1 1401 gene locus_tag LOCUS_19520 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971758.1:dimethylglycine dehydrogenase >Feature sequence207 <2346 121 gene locus_tag LOCUS_19530 <2346 121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89WI2:phenylalanine--tRNA ligase beta subunit >Feature sequence208 <1 1455 gene locus_tag LOCUS_19540 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQB2:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 1481 1621 gene locus_tag LOCUS_19550 1481 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1721 2224 gene locus_tag LOCUS_19560 gene greA 1721 2224 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence209 51 2069 gene locus_tag LOCUS_19570 51 2069 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088785.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence210 157 930 gene locus_tag LOCUS_19580 157 930 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 protein_id gnl|my_center|LOCUS_19580 1016 1666 gene locus_tag LOCUS_19590 1016 1666 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532130.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence211 709 1713 gene locus_tag LOCUS_19600 709 1713 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence212 <1 738 gene locus_tag LOCUS_19610 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704330.1:C4-dicarboxylate ABC transporter 759 2096 gene locus_tag LOCUS_19620 759 2096 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence213 1894 983 gene locus_tag LOCUS_19630 1894 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence214 1567 86 gene locus_tag LOCUS_19640 1567 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence215 <1 1007 gene locus_tag LOCUS_19650 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0W2:glutamate dehydrogenase 1990 1043 gene locus_tag LOCUS_19660 1990 1043 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence216 467 78 gene locus_tag LOCUS_19670 467 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 595 1143 gene locus_tag LOCUS_19680 595 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 <2012 1178 gene locus_tag LOCUS_19690 <2012 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530045.1:3-hydroxyisobutyrate dehydrogenase >Feature sequence217 <2000 1110 gene locus_tag LOCUS_19700 <2000 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388526.1:iron ABC transporter permease >Feature sequence218 13 720 gene locus_tag LOCUS_19710 13 720 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DQ1 protein_id gnl|my_center|LOCUS_19710 717 1445 gene locus_tag LOCUS_19720 717 1445 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705473.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence219 1547 1077 gene locus_tag LOCUS_19730 1547 1077 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence220 1 546 gene locus_tag LOCUS_19740 1 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 543 1166 gene locus_tag LOCUS_19750 543 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 <1868 1212 gene locus_tag LOCUS_19760 <1868 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973831.1:glutaryl-CoA dehydrogenase >Feature sequence221 219 1292 gene locus_tag LOCUS_19770 219 1292 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_19770 1767 1315 gene locus_tag LOCUS_19780 1767 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence222 1549 2 gene locus_tag LOCUS_19790 gene guaA 1549 2 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SQ3 protein_id gnl|my_center|LOCUS_19790 >Feature sequence223 770 603 gene locus_tag LOCUS_19800 770 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 <1712 781 gene locus_tag LOCUS_19810 <1712 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972408.1:glycine oxidase ThiO >Feature sequence224 1519 770 gene locus_tag LOCUS_19820 gene tauB 1519 770 CDS product Taurine import ATP-binding protein TauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UX0 protein_id gnl|my_center|LOCUS_19820 >Feature sequence225 1265 1131 gene locus_tag LOCUS_19830 1265 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence226 <1 1449 gene locus_tag LOCUS_19840 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y8A3:pyruvate kinase >Feature sequence227 1586 423 gene locus_tag LOCUS_19850 gene sucC 1586 423 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYZ1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence228 <1 734 gene locus_tag LOCUS_19860 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086325.1:shikimate 5-dehydrogenase 853 1257 gene locus_tag LOCUS_19870 853 1257 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence229 >Feature sequence230 1495 1571 gene locus_tag LOCUS_t00280 1495 1571 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 1148 489 gene locus_tag LOCUS_19880 1148 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531783.1 protein_id gnl|my_center|LOCUS_19880