>Feature sequence01 590 357 gene locus_tag LOCUS_00010 590 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1845 817 gene locus_tag LOCUS_00020 1845 817 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970697.1 protein_id gnl|my_center|LOCUS_00020 2043 2435 gene locus_tag LOCUS_00030 2043 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2584 3789 gene locus_tag LOCUS_00040 gene gcdH 2584 3789 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973831.1 protein_id gnl|my_center|LOCUS_00040 3876 5204 gene locus_tag LOCUS_00050 3876 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5320 5784 gene locus_tag LOCUS_00060 5320 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6797 6186 gene locus_tag LOCUS_00070 6797 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7439 7726 gene locus_tag LOCUS_00080 7439 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7885 8718 gene locus_tag LOCUS_00090 7885 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_00090 8845 10095 gene locus_tag LOCUS_00100 gene soxB 8845 10095 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87388 protein_id gnl|my_center|LOCUS_00100 10109 10450 gene locus_tag LOCUS_00110 gene soxD2 10109 10450 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707982.1 protein_id gnl|my_center|LOCUS_00110 10447 13947 gene locus_tag LOCUS_00120 gene soxA 10447 13947 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973655.1 protein_id gnl|my_center|LOCUS_00120 14287 14892 gene locus_tag LOCUS_00130 14287 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14964 15221 gene locus_tag LOCUS_00140 14964 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15889 16326 gene locus_tag LOCUS_00150 15889 16326 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 protein_id gnl|my_center|LOCUS_00150 16376 17305 gene locus_tag LOCUS_00160 16376 17305 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970329.1 protein_id gnl|my_center|LOCUS_00160 17567 18178 gene locus_tag LOCUS_00170 17567 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707065.1 protein_id gnl|my_center|LOCUS_00170 18433 20241 gene locus_tag LOCUS_00180 18433 20241 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_00180 21539 20502 gene locus_tag LOCUS_00190 21539 20502 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_00190 21685 23079 gene locus_tag LOCUS_00200 21685 23079 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525361.1 protein_id gnl|my_center|LOCUS_00200 23136 24080 gene locus_tag LOCUS_00210 23136 24080 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707318.1 protein_id gnl|my_center|LOCUS_00210 24454 24266 gene locus_tag LOCUS_00220 24454 24266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25373 25011 gene locus_tag LOCUS_00230 25373 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26110 25391 gene locus_tag LOCUS_00240 26110 25391 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_00240 26355 26654 gene locus_tag LOCUS_00250 26355 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26656 26886 gene locus_tag LOCUS_00260 26656 26886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26920 27780 gene locus_tag LOCUS_00270 26920 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27780 28244 gene locus_tag LOCUS_00280 27780 28244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28241 28459 gene locus_tag LOCUS_00290 28241 28459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28459 29022 gene locus_tag LOCUS_00300 28459 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29019 31226 gene locus_tag LOCUS_00310 gene tnpA 29019 31226 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070968.1 protein_id gnl|my_center|LOCUS_00310 31295 32047 gene locus_tag LOCUS_00320 31295 32047 CDS product DNA segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939958.1 protein_id gnl|my_center|LOCUS_00320 32047 32664 gene locus_tag LOCUS_00330 32047 32664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32661 33056 gene locus_tag LOCUS_00340 32661 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33049 33333 gene locus_tag LOCUS_00350 33049 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 33330 33704 gene locus_tag LOCUS_00360 33330 33704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33706 34377 gene locus_tag LOCUS_00370 33706 34377 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_00370 34377 34604 gene locus_tag LOCUS_00380 34377 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34604 34831 gene locus_tag LOCUS_00390 34604 34831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34856 35047 gene locus_tag LOCUS_00400 34856 35047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 35044 35523 gene locus_tag LOCUS_00410 35044 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 35520 36152 gene locus_tag LOCUS_00420 35520 36152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 36152 36877 gene locus_tag LOCUS_00430 36152 36877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976044.1 protein_id gnl|my_center|LOCUS_00430 36877 37179 gene locus_tag LOCUS_00440 36877 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 37179 37619 gene locus_tag LOCUS_00450 37179 37619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 37622 37972 gene locus_tag LOCUS_00460 37622 37972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 38079 39035 gene locus_tag LOCUS_00470 38079 39035 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U932 protein_id gnl|my_center|LOCUS_00470 39032 39214 gene locus_tag LOCUS_00480 39032 39214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 39211 39753 gene locus_tag LOCUS_00490 39211 39753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 39750 39965 gene locus_tag LOCUS_00500 39750 39965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 39967 40314 gene locus_tag LOCUS_00510 39967 40314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 40311 40610 gene locus_tag LOCUS_00520 40311 40610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 40614 41207 gene locus_tag LOCUS_00530 40614 41207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 41204 42886 gene locus_tag LOCUS_00540 41204 42886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 protein_id gnl|my_center|LOCUS_00540 42886 44472 gene locus_tag LOCUS_00550 gene gpH 42886 44472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_00550 44485 44739 gene locus_tag LOCUS_00560 44485 44739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 44813 45589 gene locus_tag LOCUS_00570 gene gpF 44813 45589 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072628.1 protein_id gnl|my_center|LOCUS_00570 45827 46993 gene locus_tag LOCUS_00580 45827 46993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 protein_id gnl|my_center|LOCUS_00580 47047 47493 gene locus_tag LOCUS_00590 47047 47493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 47558 48451 gene locus_tag LOCUS_00600 47558 48451 CDS product head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070999.1 protein_id gnl|my_center|LOCUS_00600 48550 49197 gene locus_tag LOCUS_00610 48550 49197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 49194 49625 gene locus_tag LOCUS_00620 49194 49625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104956.1 protein_id gnl|my_center|LOCUS_00620 49628 50209 gene locus_tag LOCUS_00630 49628 50209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 50206 50640 gene locus_tag LOCUS_00640 50206 50640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 50637 50840 gene locus_tag LOCUS_00650 50637 50840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 50843 51769 gene locus_tag LOCUS_00660 50843 51769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 51876 52241 gene locus_tag LOCUS_00670 51876 52241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 52304 52627 gene locus_tag LOCUS_00680 52304 52627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 52627 55029 gene locus_tag LOCUS_00690 52627 55029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 55029 55679 gene locus_tag LOCUS_00700 55029 55679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976011.1 protein_id gnl|my_center|LOCUS_00700 55679 56287 gene locus_tag LOCUS_00710 55679 56287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976010.1 protein_id gnl|my_center|LOCUS_00710 56284 56676 gene locus_tag LOCUS_00720 56284 56676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976008.1 protein_id gnl|my_center|LOCUS_00720 56680 61218 gene locus_tag LOCUS_00730 56680 61218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 61302 62264 gene locus_tag LOCUS_00740 61302 62264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 62275 62775 gene locus_tag LOCUS_00750 62275 62775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 63266 64054 gene locus_tag LOCUS_00760 63266 64054 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 protein_id gnl|my_center|LOCUS_00760 64377 65765 gene locus_tag LOCUS_00770 64377 65765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 66143 66610 gene locus_tag LOCUS_00780 66143 66610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 67095 66874 gene locus_tag LOCUS_00790 67095 66874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 68810 67734 gene locus_tag LOCUS_00800 gene paaE 68810 67734 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085679.1 protein_id gnl|my_center|LOCUS_00800 69378 68824 gene locus_tag LOCUS_00810 gene paaD 69378 68824 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_00810 70160 69384 gene locus_tag LOCUS_00820 gene paaC 70160 69384 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 protein_id gnl|my_center|LOCUS_00820 70453 70160 gene locus_tag LOCUS_00830 gene paaB 70453 70160 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_00830 71475 70450 gene locus_tag LOCUS_00840 gene paaA 71475 70450 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085675.1 protein_id gnl|my_center|LOCUS_00840 72527 71541 gene locus_tag LOCUS_00850 gene paaX 72527 71541 CDS product phenylacetic acid degradation operon negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_00850 72911 72582 gene locus_tag LOCUS_00860 72911 72582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 72911 73774 gene locus_tag LOCUS_00870 72911 73774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_00870 74437 73829 gene locus_tag LOCUS_00880 74437 73829 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_00880 74717 75070 gene locus_tag LOCUS_00890 74717 75070 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534198.1 protein_id gnl|my_center|LOCUS_00890 75364 76620 gene locus_tag LOCUS_00900 gene dadA 75364 76620 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_00900 77658 76771 gene locus_tag LOCUS_00910 77658 76771 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_00910 77917 78411 gene locus_tag LOCUS_00920 77917 78411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084063.1 protein_id gnl|my_center|LOCUS_00920 78438 79034 gene locus_tag LOCUS_00930 78438 79034 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084064.1 protein_id gnl|my_center|LOCUS_00930 79973 79092 gene locus_tag LOCUS_00940 79973 79092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_00940 82183 80150 gene locus_tag LOCUS_00950 gene paaZ 82183 80150 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_00950 84307 82244 gene locus_tag LOCUS_00960 84307 82244 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 protein_id gnl|my_center|LOCUS_00960 84419 85210 gene locus_tag LOCUS_00970 gene paaG 84419 85210 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_00970 85207 85650 gene locus_tag LOCUS_00980 gene paaD 85207 85650 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709124.1 protein_id gnl|my_center|LOCUS_00980 85726 87036 gene locus_tag LOCUS_00990 gene paaF 85726 87036 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH82 protein_id gnl|my_center|LOCUS_00990 87041 87664 gene locus_tag LOCUS_01000 87041 87664 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709126.1 protein_id gnl|my_center|LOCUS_01000 88926 87748 gene locus_tag LOCUS_01010 88926 87748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974563.1 protein_id gnl|my_center|LOCUS_01010 89036 90445 gene locus_tag LOCUS_01020 89036 90445 CDS product coa transferase caib/baif family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198768.1 protein_id gnl|my_center|LOCUS_01020 90670 91626 gene locus_tag LOCUS_01030 90670 91626 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_01030 91728 93833 gene locus_tag LOCUS_01040 91728 93833 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528642.1 protein_id gnl|my_center|LOCUS_01040 93833 94201 gene locus_tag LOCUS_01050 93833 94201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 protein_id gnl|my_center|LOCUS_01050 94332 95738 gene locus_tag LOCUS_01060 94332 95738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968806.1 protein_id gnl|my_center|LOCUS_01060 97511 95886 gene locus_tag LOCUS_01070 gene groL5 97511 95886 CDS product 60 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35471 protein_id gnl|my_center|LOCUS_01070 97890 97555 gene locus_tag LOCUS_01080 gene groS5 97890 97555 CDS product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 protein_id gnl|my_center|LOCUS_01080 98141 98410 gene locus_tag LOCUS_01090 98141 98410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975852.1 protein_id gnl|my_center|LOCUS_01090 99157 98456 gene locus_tag LOCUS_01100 99157 98456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 99281 100591 gene locus_tag LOCUS_01110 99281 100591 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_01110 100588 101490 gene locus_tag LOCUS_01120 100588 101490 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_01120 101487 102425 gene locus_tag LOCUS_01130 gene galE 101487 102425 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_01130 102422 103189 gene locus_tag LOCUS_01140 102422 103189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 103637 103452 gene locus_tag LOCUS_01150 103637 103452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 103555 104154 gene locus_tag LOCUS_01160 103555 104154 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528658.1 protein_id gnl|my_center|LOCUS_01160 104151 105107 gene locus_tag LOCUS_01170 104151 105107 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528657.1 protein_id gnl|my_center|LOCUS_01170 105104 106021 gene locus_tag LOCUS_01180 105104 106021 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 protein_id gnl|my_center|LOCUS_01180 106018 107154 gene locus_tag LOCUS_01190 106018 107154 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 protein_id gnl|my_center|LOCUS_01190 107707 108006 gene locus_tag LOCUS_01200 107707 108006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 108121 108420 gene locus_tag LOCUS_01210 108121 108420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 108539 108838 gene locus_tag LOCUS_01220 108539 108838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 108987 109583 gene locus_tag LOCUS_01230 108987 109583 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710083.1 protein_id gnl|my_center|LOCUS_01230 111336 109717 gene locus_tag LOCUS_01240 111336 109717 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970803.1 protein_id gnl|my_center|LOCUS_01240 112765 111356 gene locus_tag LOCUS_01250 112765 111356 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368556.1 protein_id gnl|my_center|LOCUS_01250 113442 112762 gene locus_tag LOCUS_01260 113442 112762 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 protein_id gnl|my_center|LOCUS_01260 113759 113439 gene locus_tag LOCUS_01270 113759 113439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 113891 114163 gene locus_tag LOCUS_01280 113891 114163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337789.1 protein_id gnl|my_center|LOCUS_01280 114169 114762 gene locus_tag LOCUS_01290 114169 114762 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_01290 115053 116456 gene locus_tag LOCUS_01300 115053 116456 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338823.1 protein_id gnl|my_center|LOCUS_01300 116632 118173 gene locus_tag LOCUS_01310 116632 118173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 118429 119271 gene locus_tag LOCUS_01320 118429 119271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 119412 119891 gene locus_tag LOCUS_01330 119412 119891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 120298 120720 gene locus_tag LOCUS_01340 120298 120720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 121852 120998 gene locus_tag LOCUS_01350 121852 120998 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_01350 123351 121867 gene locus_tag LOCUS_01360 123351 121867 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_01360 127055 123570 gene locus_tag LOCUS_01370 127055 123570 CDS product sugar translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969143.1 protein_id gnl|my_center|LOCUS_01370 128143 127055 gene locus_tag LOCUS_01380 128143 127055 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969142.1 protein_id gnl|my_center|LOCUS_01380 128060 128302 gene locus_tag LOCUS_01390 128060 128302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 129088 128522 gene locus_tag LOCUS_01400 129088 128522 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968472.1 protein_id gnl|my_center|LOCUS_01400 129434 130726 gene locus_tag LOCUS_01410 129434 130726 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720466.1 protein_id gnl|my_center|LOCUS_01410 130789 132738 gene locus_tag LOCUS_01420 130789 132738 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338134.1 protein_id gnl|my_center|LOCUS_01420 132742 133911 gene locus_tag LOCUS_01430 132742 133911 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338133.1 protein_id gnl|my_center|LOCUS_01430 133908 134648 gene locus_tag LOCUS_01440 133908 134648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338132.1 protein_id gnl|my_center|LOCUS_01440 134652 135347 gene locus_tag LOCUS_01450 134652 135347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338131.1 protein_id gnl|my_center|LOCUS_01450 136758 135640 gene locus_tag LOCUS_01460 136758 135640 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_01460 136864 137790 gene locus_tag LOCUS_01470 136864 137790 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887667.1 protein_id gnl|my_center|LOCUS_01470 137895 138419 gene locus_tag LOCUS_01480 137895 138419 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706536.1 protein_id gnl|my_center|LOCUS_01480 139595 138504 gene locus_tag LOCUS_01490 139595 138504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_01490 140038 139688 gene locus_tag LOCUS_01500 140038 139688 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_01500 140385 140035 gene locus_tag LOCUS_01510 140385 140035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 140612 141346 gene locus_tag LOCUS_01520 gene ccdA 140612 141346 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086292.1 protein_id gnl|my_center|LOCUS_01520 141357 141944 gene locus_tag LOCUS_01530 141357 141944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 142071 142535 gene locus_tag LOCUS_01540 gene soxX 142071 142535 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086295.1 protein_id gnl|my_center|LOCUS_01540 142561 143016 gene locus_tag LOCUS_01550 gene soxY 142561 143016 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_01550 143038 143361 gene locus_tag LOCUS_01560 gene soxZ 143038 143361 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_01560 143429 144277 gene locus_tag LOCUS_01570 gene soxA 143429 144277 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PG6 protein_id gnl|my_center|LOCUS_01570 144501 146201 gene locus_tag LOCUS_01580 gene soxB 144501 146201 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_01580 146297 147580 gene locus_tag LOCUS_01590 gene soxC 146297 147580 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_01590 147564 148679 gene locus_tag LOCUS_01600 147564 148679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 148717 149460 gene locus_tag LOCUS_01610 148717 149460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 149490 150764 gene locus_tag LOCUS_01620 gene fccB-2 149490 150764 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_01620 150844 151197 gene locus_tag LOCUS_01630 150844 151197 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_01630 151267 152049 gene locus_tag LOCUS_01640 gene modA 151267 152049 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836199.1 protein_id gnl|my_center|LOCUS_01640 152054 152776 gene locus_tag LOCUS_01650 152054 152776 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531024.1 protein_id gnl|my_center|LOCUS_01650 152773 153861 gene locus_tag LOCUS_01660 gene modC 152773 153861 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKL8 protein_id gnl|my_center|LOCUS_01660 154526 153873 gene locus_tag LOCUS_01670 154526 153873 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_01670 155767 154523 gene locus_tag LOCUS_01680 gene btaA 155767 154523 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338545.1 protein_id gnl|my_center|LOCUS_01680 156632 155817 gene locus_tag LOCUS_01690 156632 155817 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531888.1 protein_id gnl|my_center|LOCUS_01690 157490 156735 gene locus_tag LOCUS_01700 157490 156735 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529525.1 protein_id gnl|my_center|LOCUS_01700 157593 158075 gene locus_tag LOCUS_01710 157593 158075 CDS product protein phnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529524.1 protein_id gnl|my_center|LOCUS_01710 158075 158695 gene locus_tag LOCUS_01720 158075 158695 CDS product carbon-phosphorus lyase subunit PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 protein_id gnl|my_center|LOCUS_01720 158698 159825 gene locus_tag LOCUS_01730 158698 159825 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969860.1 protein_id gnl|my_center|LOCUS_01730 159822 160745 gene locus_tag LOCUS_01740 gene phnJ 159822 160745 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52987 protein_id gnl|my_center|LOCUS_01740 160745 161569 gene locus_tag LOCUS_01750 160745 161569 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_01750 161573 162280 gene locus_tag LOCUS_01760 161573 162280 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_01760 162277 162891 gene locus_tag LOCUS_01770 162277 162891 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 protein_id gnl|my_center|LOCUS_01770 163674 162949 gene locus_tag LOCUS_01780 163674 162949 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_01780 163817 164032 gene locus_tag LOCUS_01790 163817 164032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 164306 165157 gene locus_tag LOCUS_01800 gene phcN 164306 165157 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 protein_id gnl|my_center|LOCUS_01800 165251 166156 gene locus_tag LOCUS_01810 165251 166156 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887429.1 protein_id gnl|my_center|LOCUS_01810 166227 167099 gene locus_tag LOCUS_01820 gene phnE 166227 167099 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970702.1 protein_id gnl|my_center|LOCUS_01820 167101 168450 gene locus_tag LOCUS_01830 gene phnE 167101 168450 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970701.1 protein_id gnl|my_center|LOCUS_01830 168447 169154 gene locus_tag LOCUS_01840 168447 169154 CDS product phosphonate metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528376.1 protein_id gnl|my_center|LOCUS_01840 169155 170294 gene locus_tag LOCUS_01850 169155 170294 CDS product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061593.1 protein_id gnl|my_center|LOCUS_01850 170294 170887 gene locus_tag LOCUS_01860 gene phnN 170294 170887 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCF6 protein_id gnl|my_center|LOCUS_01860 171196 170939 gene locus_tag LOCUS_01870 171196 170939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 171608 172321 gene locus_tag LOCUS_01880 171608 172321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 172636 172406 gene locus_tag LOCUS_01890 172636 172406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 172717 173541 gene locus_tag LOCUS_01900 gene cpdA 172717 173541 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ1 protein_id gnl|my_center|LOCUS_01900 173980 173576 gene locus_tag LOCUS_01910 173980 173576 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_01910 174118 175389 gene locus_tag LOCUS_01920 gene ordL 174118 175389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 protein_id gnl|my_center|LOCUS_01920 175587 177239 gene locus_tag LOCUS_01930 175587 177239 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973292.1 protein_id gnl|my_center|LOCUS_01930 177963 178724 gene locus_tag LOCUS_01940 177963 178724 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708340.1 protein_id gnl|my_center|LOCUS_01940 178864 180066 gene locus_tag LOCUS_01950 gene arcA 178864 180066 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZSZ9 protein_id gnl|my_center|LOCUS_01950 180305 182323 gene locus_tag LOCUS_01960 180305 182323 CDS product peptidase S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 protein_id gnl|my_center|LOCUS_01960 183295 182348 gene locus_tag LOCUS_01970 183295 182348 CDS product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528299.1 protein_id gnl|my_center|LOCUS_01970 183381 184100 gene locus_tag LOCUS_01980 183381 184100 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971078.1 protein_id gnl|my_center|LOCUS_01980 185740 184121 gene locus_tag LOCUS_01990 185740 184121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_01990 186651 185737 gene locus_tag LOCUS_02000 186651 185737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974600.1 protein_id gnl|my_center|LOCUS_02000 187628 186648 gene locus_tag LOCUS_02010 187628 186648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_02010 188033 189640 gene locus_tag LOCUS_02020 188033 189640 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 protein_id gnl|my_center|LOCUS_02020 190264 189800 gene locus_tag LOCUS_02030 190264 189800 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 protein_id gnl|my_center|LOCUS_02030 192073 190490 gene locus_tag LOCUS_02040 192073 190490 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_02040 194224 192077 gene locus_tag LOCUS_02050 194224 192077 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_02050 194734 194243 gene locus_tag LOCUS_02060 194734 194243 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527967.1 protein_id gnl|my_center|LOCUS_02060 196308 194731 gene locus_tag LOCUS_02070 196308 194731 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_02070 197127 196336 gene locus_tag LOCUS_02080 197127 196336 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 protein_id gnl|my_center|LOCUS_02080 197263 198837 gene locus_tag LOCUS_02090 197263 198837 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 protein_id gnl|my_center|LOCUS_02090 198861 200393 gene locus_tag LOCUS_02100 198861 200393 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527971.1 protein_id gnl|my_center|LOCUS_02100 200458 201468 gene locus_tag LOCUS_02110 200458 201468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527972.1 protein_id gnl|my_center|LOCUS_02110 201461 202312 gene locus_tag LOCUS_02120 201461 202312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527973.1 protein_id gnl|my_center|LOCUS_02120 202309 203187 gene locus_tag LOCUS_02130 202309 203187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527974.1 protein_id gnl|my_center|LOCUS_02130 203195 204001 gene locus_tag LOCUS_02140 203195 204001 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527975.1 protein_id gnl|my_center|LOCUS_02140 204067 205227 gene locus_tag LOCUS_02150 204067 205227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 205363 207657 gene locus_tag LOCUS_02160 205363 207657 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_02160 207660 208421 gene locus_tag LOCUS_02170 207660 208421 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_02170 208418 208918 gene locus_tag LOCUS_02180 208418 208918 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 protein_id gnl|my_center|LOCUS_02180 208923 209726 gene locus_tag LOCUS_02190 208923 209726 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_02190 209726 210892 gene locus_tag LOCUS_02200 209726 210892 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527981.1 protein_id gnl|my_center|LOCUS_02200 210894 212522 gene locus_tag LOCUS_02210 210894 212522 CDS product 2-aminobenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531743.1 protein_id gnl|my_center|LOCUS_02210 212580 212990 gene locus_tag LOCUS_02220 212580 212990 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_02220 212995 214188 gene locus_tag LOCUS_02230 gene kynU 212995 214188 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C0 protein_id gnl|my_center|LOCUS_02230 214185 215027 gene locus_tag LOCUS_02240 gene kynA 214185 215027 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MN4 protein_id gnl|my_center|LOCUS_02240 215175 216266 gene locus_tag LOCUS_02250 215175 216266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 216338 217540 gene locus_tag LOCUS_02260 216338 217540 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_02260 217678 218451 gene locus_tag LOCUS_02270 217678 218451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_02270 218448 219167 gene locus_tag LOCUS_02280 218448 219167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_02280 219164 220054 gene locus_tag LOCUS_02290 219164 220054 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_02290 220054 220998 gene locus_tag LOCUS_02300 220054 220998 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532984.1 protein_id gnl|my_center|LOCUS_02300 221448 221020 gene locus_tag LOCUS_02310 221448 221020 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_02310 222066 221656 gene locus_tag LOCUS_02320 gene atsE 222066 221656 CDS product attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035339.1 protein_id gnl|my_center|LOCUS_02320 222742 222173 gene locus_tag LOCUS_02330 gene pfpI 222742 222173 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313905.1 protein_id gnl|my_center|LOCUS_02330 223185 222916 gene locus_tag LOCUS_02340 223185 222916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 223579 223382 gene locus_tag LOCUS_02350 223579 223382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064480.1 protein_id gnl|my_center|LOCUS_02350 225207 223582 gene locus_tag LOCUS_02360 225207 223582 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_02360 226189 225239 gene locus_tag LOCUS_02370 226189 225239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_02370 227768 226398 gene locus_tag LOCUS_02380 gene hmgA 227768 226398 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIF6 protein_id gnl|my_center|LOCUS_02380 228362 227928 gene locus_tag LOCUS_02390 gene lrp 228362 227928 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974190.1 protein_id gnl|my_center|LOCUS_02390 228842 230083 gene locus_tag LOCUS_02400 gene bkdA1 228842 230083 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709485.1 protein_id gnl|my_center|LOCUS_02400 230086 231099 gene locus_tag LOCUS_02410 230086 231099 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528742.1 protein_id gnl|my_center|LOCUS_02410 231101 232408 gene locus_tag LOCUS_02420 231101 232408 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW2 protein_id gnl|my_center|LOCUS_02420 232410 233807 gene locus_tag LOCUS_02430 gene lpdA2 232410 233807 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M924 protein_id gnl|my_center|LOCUS_02430 233915 234220 gene locus_tag LOCUS_02440 233915 234220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 234269 234553 gene locus_tag LOCUS_02450 234269 234553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 235840 235601 gene locus_tag LOCUS_02460 235840 235601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02460 237507 236035 gene locus_tag LOCUS_02470 237507 236035 CDS product ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970060.1 protein_id gnl|my_center|LOCUS_02470 238700 237507 gene locus_tag LOCUS_02480 238700 237507 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970063.1 protein_id gnl|my_center|LOCUS_02480 239422 238697 gene locus_tag LOCUS_02490 239422 238697 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970597.1 protein_id gnl|my_center|LOCUS_02490 240075 239422 gene locus_tag LOCUS_02500 240075 239422 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974085.1 protein_id gnl|my_center|LOCUS_02500 241094 240075 gene locus_tag LOCUS_02510 241094 240075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039166.1 protein_id gnl|my_center|LOCUS_02510 242059 241091 gene locus_tag LOCUS_02520 242059 241091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_02520 242983 242066 gene locus_tag LOCUS_02530 242983 242066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 protein_id gnl|my_center|LOCUS_02530 243979 242996 gene locus_tag LOCUS_02540 243979 242996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815879.1 protein_id gnl|my_center|LOCUS_02540 245621 244056 gene locus_tag LOCUS_02550 245621 244056 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970606.1 protein_id gnl|my_center|LOCUS_02550 245804 246487 gene locus_tag LOCUS_02560 245804 246487 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974084.1 protein_id gnl|my_center|LOCUS_02560 246484 247923 gene locus_tag LOCUS_02570 246484 247923 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970608.1 protein_id gnl|my_center|LOCUS_02570 249556 248246 gene locus_tag LOCUS_02580 gene ordL1 249556 248246 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 protein_id gnl|my_center|LOCUS_02580 250217 250849 gene locus_tag LOCUS_02590 250217 250849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 251159 250743 gene locus_tag LOCUS_02600 251159 250743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 251288 252280 gene locus_tag LOCUS_02610 gene dusA 251288 252280 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIZ5 protein_id gnl|my_center|LOCUS_02610 252323 253087 gene locus_tag LOCUS_02620 252323 253087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 253498 253121 gene locus_tag LOCUS_02630 253498 253121 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975762.1 protein_id gnl|my_center|LOCUS_02630 253826 253620 gene locus_tag LOCUS_02640 253826 253620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 253993 254877 gene locus_tag LOCUS_02650 253993 254877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 255144 255962 gene locus_tag LOCUS_02660 255144 255962 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDI9 protein_id gnl|my_center|LOCUS_02660 258312 256009 gene locus_tag LOCUS_02670 258312 256009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972376.1 protein_id gnl|my_center|LOCUS_02670 259150 258461 gene locus_tag LOCUS_02680 259150 258461 CDS product aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531717.1 protein_id gnl|my_center|LOCUS_02680 260215 259433 gene locus_tag LOCUS_02690 gene cobS 260215 259433 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9W5 protein_id gnl|my_center|LOCUS_02690 260332 261348 gene locus_tag LOCUS_02700 gene cobT 260332 261348 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P98 protein_id gnl|my_center|LOCUS_02700 262895 261378 gene locus_tag LOCUS_02710 262895 261378 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969537.1 protein_id gnl|my_center|LOCUS_02710 263149 263679 gene locus_tag LOCUS_02720 263149 263679 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531713.1 protein_id gnl|my_center|LOCUS_02720 263709 264320 gene locus_tag LOCUS_02730 263709 264320 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_02730 264317 264979 gene locus_tag LOCUS_02740 264317 264979 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971937.1 protein_id gnl|my_center|LOCUS_02740 265042 265578 gene locus_tag LOCUS_02750 265042 265578 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_02750 265690 266145 gene locus_tag LOCUS_02760 265690 266145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 266913 266200 gene locus_tag LOCUS_02770 266913 266200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_02770 267784 266915 gene locus_tag LOCUS_02780 267784 266915 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_02780 267892 270357 gene locus_tag LOCUS_02790 267892 270357 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_02790 271532 270552 gene locus_tag LOCUS_02800 gene mecR 271532 270552 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_02800 272144 271545 gene locus_tag LOCUS_02810 gene ydhM 272144 271545 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_02810 273380 272568 gene locus_tag LOCUS_02820 273380 272568 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708256.1 protein_id gnl|my_center|LOCUS_02820 274237 273476 gene locus_tag LOCUS_02830 274237 273476 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708253.1 protein_id gnl|my_center|LOCUS_02830 275103 274303 gene locus_tag LOCUS_02840 275103 274303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708252.1 protein_id gnl|my_center|LOCUS_02840 276004 275207 gene locus_tag LOCUS_02850 276004 275207 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708251.1 protein_id gnl|my_center|LOCUS_02850 276784 276167 gene locus_tag LOCUS_02860 gene mobA 276784 276167 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_02860 278010 276781 gene locus_tag LOCUS_02870 278010 276781 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971806.1 protein_id gnl|my_center|LOCUS_02870 278254 278475 gene locus_tag LOCUS_02880 278254 278475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 279400 278492 gene locus_tag LOCUS_02890 279400 278492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_02890 280606 279509 gene locus_tag LOCUS_02900 280606 279509 CDS product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532194.1 protein_id gnl|my_center|LOCUS_02900 281667 280633 gene locus_tag LOCUS_02910 gene moaA 281667 280633 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_02910 281887 282195 gene locus_tag LOCUS_02920 281887 282195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_02920 283859 283464 gene locus_tag LOCUS_02930 283859 283464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 283989 284975 gene locus_tag LOCUS_02940 283989 284975 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975727.1 protein_id gnl|my_center|LOCUS_02940 285825 285217 gene locus_tag LOCUS_02950 285825 285217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 287087 286017 gene locus_tag LOCUS_02960 287087 286017 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708239.1 protein_id gnl|my_center|LOCUS_02960 288843 287236 gene locus_tag LOCUS_02970 288843 287236 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I43 protein_id gnl|my_center|LOCUS_02970 289071 290132 gene locus_tag LOCUS_02980 289071 290132 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971664.1 protein_id gnl|my_center|LOCUS_02980 290327 292204 gene locus_tag LOCUS_02990 290327 292204 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969521.1 protein_id gnl|my_center|LOCUS_02990 293067 292333 gene locus_tag LOCUS_03000 gene ftrB 293067 292333 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 protein_id gnl|my_center|LOCUS_03000 293349 296072 gene locus_tag LOCUS_03010 293349 296072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 296092 299838 gene locus_tag LOCUS_03020 gene narG 296092 299838 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 protein_id gnl|my_center|LOCUS_03020 299835 301358 gene locus_tag LOCUS_03030 gene narH 299835 301358 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_03030 301355 302047 gene locus_tag LOCUS_03040 gene narJ 301355 302047 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_03040 302066 302767 gene locus_tag LOCUS_03050 gene narI 302066 302767 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_03050 302764 303561 gene locus_tag LOCUS_03060 302764 303561 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 protein_id gnl|my_center|LOCUS_03060 303666 304178 gene locus_tag LOCUS_03070 303666 304178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 305153 304206 gene locus_tag LOCUS_03080 gene pfkB 305153 304206 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Z5 protein_id gnl|my_center|LOCUS_03080 307605 305218 gene locus_tag LOCUS_03090 gene ppsA 307605 305218 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 protein_id gnl|my_center|LOCUS_03090 308702 307779 gene locus_tag LOCUS_03100 308702 307779 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 protein_id gnl|my_center|LOCUS_03100 309517 308699 gene locus_tag LOCUS_03110 309517 308699 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_03110 310332 309517 gene locus_tag LOCUS_03120 310332 309517 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_03120 311132 310329 gene locus_tag LOCUS_03130 gene phnC 311132 310329 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_03130 312213 311236 gene locus_tag LOCUS_03140 312213 311236 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_03140 313266 312478 gene locus_tag LOCUS_03150 313266 312478 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_03150 314389 313268 gene locus_tag LOCUS_03160 314389 313268 CDS product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_03160 315415 314468 gene locus_tag LOCUS_03170 315415 314468 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 protein_id gnl|my_center|LOCUS_03170 315610 316608 gene locus_tag LOCUS_03180 315610 316608 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429728.1 protein_id gnl|my_center|LOCUS_03180 317403 316648 gene locus_tag LOCUS_03190 317403 316648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 317702 317502 gene locus_tag LOCUS_03200 317702 317502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 317604 318515 gene locus_tag LOCUS_03210 gene czcD 317604 318515 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_03210 319030 318626 gene locus_tag LOCUS_03220 319030 318626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 319941 319030 gene locus_tag LOCUS_03230 319941 319030 CDS product Zn-dependent hydrolase glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003593.1 protein_id gnl|my_center|LOCUS_03230 320174 319938 gene locus_tag LOCUS_03240 320174 319938 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 protein_id gnl|my_center|LOCUS_03240 320933 320229 gene locus_tag LOCUS_03250 320933 320229 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_03250 321998 320946 gene locus_tag LOCUS_03260 321998 320946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_03260 322282 321995 gene locus_tag LOCUS_03270 322282 321995 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331458.1 protein_id gnl|my_center|LOCUS_03270 323420 322512 gene locus_tag LOCUS_03280 323420 322512 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973899.1 protein_id gnl|my_center|LOCUS_03280 323893 323417 gene locus_tag LOCUS_03290 323893 323417 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709433.1 protein_id gnl|my_center|LOCUS_03290 325120 323963 gene locus_tag LOCUS_03300 325120 323963 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383268.1 protein_id gnl|my_center|LOCUS_03300 326289 325399 gene locus_tag LOCUS_03310 326289 325399 CDS product sugar phosphate isomerase/epimerase IoIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706509.1 protein_id gnl|my_center|LOCUS_03310 327413 326301 gene locus_tag LOCUS_03320 327413 326301 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_03320 327551 329416 gene locus_tag LOCUS_03330 gene iolD 327551 329416 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968521.1 protein_id gnl|my_center|LOCUS_03330 329418 330257 gene locus_tag LOCUS_03340 329418 330257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 330254 331234 gene locus_tag LOCUS_03350 gene iolC 330254 331234 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK4 protein_id gnl|my_center|LOCUS_03350 331264 332106 gene locus_tag LOCUS_03360 331264 332106 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_03360 332103 332945 gene locus_tag LOCUS_03370 332103 332945 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_03370 332949 333938 gene locus_tag LOCUS_03380 gene idhA 332949 333938 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 protein_id gnl|my_center|LOCUS_03380 334600 334040 gene locus_tag LOCUS_03390 334600 334040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 335137 334925 gene locus_tag LOCUS_03400 335137 334925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 335796 335134 gene locus_tag LOCUS_03410 335796 335134 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7H5 protein_id gnl|my_center|LOCUS_03410 336595 335840 gene locus_tag LOCUS_03420 336595 335840 CDS product autoinducer-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530376.1 protein_id gnl|my_center|LOCUS_03420 337802 336846 gene locus_tag LOCUS_03430 337802 336846 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_03430 337960 338736 gene locus_tag LOCUS_03440 337960 338736 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_03440 338824 339615 gene locus_tag LOCUS_03450 338824 339615 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031754.1 protein_id gnl|my_center|LOCUS_03450 339633 340280 gene locus_tag LOCUS_03460 339633 340280 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532095.1 protein_id gnl|my_center|LOCUS_03460 340311 340967 gene locus_tag LOCUS_03470 340311 340967 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532096.1 protein_id gnl|my_center|LOCUS_03470 340987 341754 gene locus_tag LOCUS_03480 340987 341754 CDS product polar amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 protein_id gnl|my_center|LOCUS_03480 341756 343114 gene locus_tag LOCUS_03490 341756 343114 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_03490 343114 343806 gene locus_tag LOCUS_03500 343114 343806 CDS product acetyl-CoA--acetoacetyl-CoA transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 protein_id gnl|my_center|LOCUS_03500 343814 344446 gene locus_tag LOCUS_03510 gene scoB 343814 344446 CDS product putative succinyl-CoA:3-ketoacid coenzyme A transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPW3 protein_id gnl|my_center|LOCUS_03510 344458 345753 gene locus_tag LOCUS_03520 344458 345753 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532989.1 protein_id gnl|my_center|LOCUS_03520 345768 346943 gene locus_tag LOCUS_03530 345768 346943 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_03530 347319 346981 gene locus_tag LOCUS_03540 347319 346981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087423.1 protein_id gnl|my_center|LOCUS_03540 348263 347316 gene locus_tag LOCUS_03550 gene dnaJ 348263 347316 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087422.1 protein_id gnl|my_center|LOCUS_03550 351679 348557 gene locus_tag LOCUS_03560 gene acrB 351679 348557 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339205.1 protein_id gnl|my_center|LOCUS_03560 352826 351696 gene locus_tag LOCUS_03570 gene acrA 352826 351696 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 protein_id gnl|my_center|LOCUS_03570 352977 353627 gene locus_tag LOCUS_03580 352977 353627 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723970.1 protein_id gnl|my_center|LOCUS_03580 354347 353841 gene locus_tag LOCUS_03590 354347 353841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 354615 354541 gene locus_tag LOCUS_t00010 354615 354541 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 355456 354767 gene locus_tag LOCUS_03600 gene gph1 355456 354767 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969520.1 protein_id gnl|my_center|LOCUS_03600 355790 356488 gene locus_tag LOCUS_03610 gene rpiA 355790 356488 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9T4 protein_id gnl|my_center|LOCUS_03610 356507 357043 gene locus_tag LOCUS_03620 356507 357043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708234.1 protein_id gnl|my_center|LOCUS_03620 357204 358592 gene locus_tag LOCUS_03630 gene gor 357204 358592 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969519.1 protein_id gnl|my_center|LOCUS_03630 358615 359394 gene locus_tag LOCUS_03640 358615 359394 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972645.1 protein_id gnl|my_center|LOCUS_03640 359729 360136 gene locus_tag LOCUS_03650 359729 360136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384293.1 protein_id gnl|my_center|LOCUS_03650 360762 360328 gene locus_tag LOCUS_03660 360762 360328 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_03660 360820 361218 gene locus_tag LOCUS_03670 gene merT 360820 361218 CDS product mercuric transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_569361.1 protein_id gnl|my_center|LOCUS_03670 361234 361533 gene locus_tag LOCUS_03680 gene merP 361234 361533 CDS product periplasmic mercury ion-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQ79 protein_id gnl|my_center|LOCUS_03680 361530 361751 gene locus_tag LOCUS_03690 361530 361751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 361788 363137 gene locus_tag LOCUS_03700 361788 363137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_03700 363199 364650 gene locus_tag LOCUS_03710 gene merA-1 363199 364650 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZ63 protein_id gnl|my_center|LOCUS_03710 365276 364836 gene locus_tag LOCUS_03720 gene trx 365276 364836 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_03720 365910 365284 gene locus_tag LOCUS_03730 365910 365284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706157.1 protein_id gnl|my_center|LOCUS_03730 367406 366036 gene locus_tag LOCUS_03740 367406 366036 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_03740 367646 368347 gene locus_tag LOCUS_03750 367646 368347 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882022.1 protein_id gnl|my_center|LOCUS_03750 368445 369818 gene locus_tag LOCUS_03760 368445 369818 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9T1 protein_id gnl|my_center|LOCUS_03760 370204 370629 gene locus_tag LOCUS_03770 370204 370629 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_03770 371488 372321 gene locus_tag LOCUS_03780 371488 372321 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_03780 372409 372633 gene locus_tag LOCUS_03790 372409 372633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 372730 374415 gene locus_tag LOCUS_03800 gene nadE 372730 374415 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975715.1 protein_id gnl|my_center|LOCUS_03800 374415 375662 gene locus_tag LOCUS_03810 374415 375662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_03810 376945 375770 gene locus_tag LOCUS_03820 376945 375770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971774.1 protein_id gnl|my_center|LOCUS_03820 379429 377114 gene locus_tag LOCUS_03830 gene dme 379429 377114 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30807 protein_id gnl|my_center|LOCUS_03830 380689 379706 gene locus_tag LOCUS_03840 380689 379706 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 protein_id gnl|my_center|LOCUS_03840 380789 381979 gene locus_tag LOCUS_03850 380789 381979 CDS product toluene ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969504.1 protein_id gnl|my_center|LOCUS_03850 382012 382881 gene locus_tag LOCUS_03860 382012 382881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969503.1 protein_id gnl|my_center|LOCUS_03860 382881 384251 gene locus_tag LOCUS_03870 382881 384251 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315371.1 protein_id gnl|my_center|LOCUS_03870 384365 384925 gene locus_tag LOCUS_03880 384365 384925 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315372.1 protein_id gnl|my_center|LOCUS_03880 385282 384998 gene locus_tag LOCUS_03890 385282 384998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 385924 385463 gene locus_tag LOCUS_03900 385924 385463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 391101 385927 gene locus_tag LOCUS_03910 391101 385927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 391477 391845 gene locus_tag LOCUS_03920 391477 391845 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975687.1 protein_id gnl|my_center|LOCUS_03920 392049 392369 gene locus_tag LOCUS_03930 392049 392369 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708200.1 protein_id gnl|my_center|LOCUS_03930 392398 393423 gene locus_tag LOCUS_03940 392398 393423 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC20 protein_id gnl|my_center|LOCUS_03940 394816 394202 gene locus_tag LOCUS_03950 394816 394202 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975685.1 protein_id gnl|my_center|LOCUS_03950 394987 395802 gene locus_tag LOCUS_03960 394987 395802 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC17 protein_id gnl|my_center|LOCUS_03960 395795 396163 gene locus_tag LOCUS_03970 395795 396163 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9P5 protein_id gnl|my_center|LOCUS_03970 396156 396677 gene locus_tag LOCUS_03980 gene folK 396156 396677 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969486.1 protein_id gnl|my_center|LOCUS_03980 397227 396688 gene locus_tag LOCUS_03990 397227 396688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975681.1 protein_id gnl|my_center|LOCUS_03990 398434 397325 gene locus_tag LOCUS_04000 398434 397325 CDS product UPF0283 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9P2 protein_id gnl|my_center|LOCUS_04000 399903 398431 gene locus_tag LOCUS_04010 399903 398431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971561.1 protein_id gnl|my_center|LOCUS_04010 400524 399988 gene locus_tag LOCUS_04020 400524 399988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 400819 401238 gene locus_tag LOCUS_04030 gene dksA 400819 401238 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9N9 protein_id gnl|my_center|LOCUS_04030 402338 401334 gene locus_tag LOCUS_04040 402338 401334 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708185.1 protein_id gnl|my_center|LOCUS_04040 402635 405241 gene locus_tag LOCUS_04050 402635 405241 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969481.1 protein_id gnl|my_center|LOCUS_04050 405369 406130 gene locus_tag LOCUS_04060 405369 406130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 406133 406630 gene locus_tag LOCUS_04070 406133 406630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 406701 407348 gene locus_tag LOCUS_04080 406701 407348 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_04080 407713 407477 gene locus_tag LOCUS_04090 407713 407477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 408680 407757 gene locus_tag LOCUS_04100 gene psuG 408680 407757 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PG0 protein_id gnl|my_center|LOCUS_04100 409314 408697 gene locus_tag LOCUS_04110 409314 408697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 409486 409875 gene locus_tag LOCUS_04120 409486 409875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 409887 410981 gene locus_tag LOCUS_04130 gene recA 409887 410981 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG98 protein_id gnl|my_center|LOCUS_04130 411214 413865 gene locus_tag LOCUS_04140 gene alaS 411214 413865 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27866 protein_id gnl|my_center|LOCUS_04140 414681 414061 gene locus_tag LOCUS_04150 gene gst5 414681 414061 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_04150 415307 414696 gene locus_tag LOCUS_04160 415307 414696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 415747 415304 gene locus_tag LOCUS_04170 415747 415304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 416962 415751 gene locus_tag LOCUS_04180 416962 415751 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9N3 protein_id gnl|my_center|LOCUS_04180 417248 418048 gene locus_tag LOCUS_04190 gene trmJ 417248 418048 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFE4 protein_id gnl|my_center|LOCUS_04190 418045 418836 gene locus_tag LOCUS_04200 gene murI 418045 418836 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFE3 protein_id gnl|my_center|LOCUS_04200 419004 420527 gene locus_tag LOCUS_04210 419004 420527 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971920.1 protein_id gnl|my_center|LOCUS_04210 421778 420540 gene locus_tag LOCUS_04220 gene pepT 421778 420540 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KND3 protein_id gnl|my_center|LOCUS_04220 422116 422733 gene locus_tag LOCUS_04230 gene rpsD 422116 422733 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PG9 protein_id gnl|my_center|LOCUS_04230 422907 422725 gene locus_tag LOCUS_04240 422907 422725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 422830 423759 gene locus_tag LOCUS_04250 gene glsA 422830 423759 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_04250 423738 424685 gene locus_tag LOCUS_04260 gene ttcA 423738 424685 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFD9 protein_id gnl|my_center|LOCUS_04260 424682 425518 gene locus_tag LOCUS_04270 424682 425518 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 protein_id gnl|my_center|LOCUS_04270 426803 425556 gene locus_tag LOCUS_04280 426803 425556 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971915.1 protein_id gnl|my_center|LOCUS_04280 428004 427291 gene locus_tag LOCUS_04290 428004 427291 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530968.1 protein_id gnl|my_center|LOCUS_04290 429041 428160 gene locus_tag LOCUS_04300 429041 428160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 429672 429190 gene locus_tag LOCUS_04310 gene ytoQ 429672 429190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_04310 430123 429791 gene locus_tag LOCUS_04320 430123 429791 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD75 protein_id gnl|my_center|LOCUS_04320 430224 431057 gene locus_tag LOCUS_04330 430224 431057 CDS product lipoprotein signal peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 protein_id gnl|my_center|LOCUS_04330 431779 431192 gene locus_tag LOCUS_04340 431779 431192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 432157 431924 gene locus_tag LOCUS_04350 432157 431924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_04350 434410 432179 gene locus_tag LOCUS_04360 gene purL 434410 432179 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PH7 protein_id gnl|my_center|LOCUS_04360 434936 434559 gene locus_tag LOCUS_04370 434936 434559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531401.1 protein_id gnl|my_center|LOCUS_04370 435755 435081 gene locus_tag LOCUS_04380 gene purQ 435755 435081 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L4 protein_id gnl|my_center|LOCUS_04380 436001 435759 gene locus_tag LOCUS_04390 gene purS 436001 435759 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD66 protein_id gnl|my_center|LOCUS_04390 436784 436020 gene locus_tag LOCUS_04400 gene purC 436784 436020 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 protein_id gnl|my_center|LOCUS_04400 437009 437329 gene locus_tag LOCUS_04410 437009 437329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_04410 437476 438204 gene locus_tag LOCUS_04420 437476 438204 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532125.1 protein_id gnl|my_center|LOCUS_04420 438822 438268 gene locus_tag LOCUS_04430 438822 438268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531424.1 protein_id gnl|my_center|LOCUS_04430 439188 438955 gene locus_tag LOCUS_04440 439188 438955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 440651 439302 gene locus_tag LOCUS_04450 440651 439302 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K7 protein_id gnl|my_center|LOCUS_04450 441314 440718 gene locus_tag LOCUS_04460 441314 440718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969446.1 protein_id gnl|my_center|LOCUS_04460 442042 441311 gene locus_tag LOCUS_04470 442042 441311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708059.1 protein_id gnl|my_center|LOCUS_04470 443118 442111 gene locus_tag LOCUS_04480 443118 442111 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969443.1 protein_id gnl|my_center|LOCUS_04480 444197 443133 gene locus_tag LOCUS_04490 444197 443133 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708062.1 protein_id gnl|my_center|LOCUS_04490 444120 444287 gene locus_tag LOCUS_04500 444120 444287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 444420 444914 gene locus_tag LOCUS_04510 444420 444914 CDS product 4-hydroxyphenylacetate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532115.1 protein_id gnl|my_center|LOCUS_04510 444960 445883 gene locus_tag LOCUS_04520 444960 445883 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969441.1 protein_id gnl|my_center|LOCUS_04520 445883 447109 gene locus_tag LOCUS_04530 445883 447109 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_04530 447183 447530 gene locus_tag LOCUS_04540 447183 447530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532112.1 protein_id gnl|my_center|LOCUS_04540 447530 448246 gene locus_tag LOCUS_04550 447530 448246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 protein_id gnl|my_center|LOCUS_04550 448243 449892 gene locus_tag LOCUS_04560 448243 449892 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708068.1 protein_id gnl|my_center|LOCUS_04560 449882 450199 gene locus_tag LOCUS_04570 449882 450199 CDS product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969438.1 protein_id gnl|my_center|LOCUS_04570 451813 450302 gene locus_tag LOCUS_04580 451813 450302 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975633.1 protein_id gnl|my_center|LOCUS_04580 453355 452054 gene locus_tag LOCUS_04590 453355 452054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708072.1 protein_id gnl|my_center|LOCUS_04590 454296 453466 gene locus_tag LOCUS_04600 454296 453466 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971897.1 protein_id gnl|my_center|LOCUS_04600 454782 454315 gene locus_tag LOCUS_04610 gene bcp 454782 454315 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 protein_id gnl|my_center|LOCUS_04610 454908 458291 gene locus_tag LOCUS_04620 454908 458291 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969432.1 protein_id gnl|my_center|LOCUS_04620 459623 458370 gene locus_tag LOCUS_04630 gene tyrS 459623 458370 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCM5 protein_id gnl|my_center|LOCUS_04630 459909 459724 gene locus_tag LOCUS_04640 459909 459724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 459866 461020 gene locus_tag LOCUS_04650 gene anmK 459866 461020 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCM6 protein_id gnl|my_center|LOCUS_04650 461444 462892 gene locus_tag LOCUS_04660 461444 462892 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_04660 462879 466481 gene locus_tag LOCUS_04670 gene nifJ-1 462879 466481 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KID4 protein_id gnl|my_center|LOCUS_04670 466519 467514 gene locus_tag LOCUS_04680 466519 467514 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_04680 467637 469508 gene locus_tag LOCUS_04690 467637 469508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 469505 470224 gene locus_tag LOCUS_04700 469505 470224 CDS product hydrogenase HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_04700 470217 470786 gene locus_tag LOCUS_04710 470217 470786 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_04710 470807 472249 gene locus_tag LOCUS_04720 470807 472249 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_04720 472249 472698 gene locus_tag LOCUS_04730 gene hoxP 472249 472698 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_04730 473433 472738 gene locus_tag LOCUS_04740 473433 472738 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525382.1 protein_id gnl|my_center|LOCUS_04740 473553 474743 gene locus_tag LOCUS_04750 473553 474743 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_04750 475034 477286 gene locus_tag LOCUS_04760 gene nosR 475034 477286 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_04760 477300 479213 gene locus_tag LOCUS_04770 gene nosZ 477300 479213 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ6 protein_id gnl|my_center|LOCUS_04770 479233 480501 gene locus_tag LOCUS_04780 gene nosD 479233 480501 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083148.1 protein_id gnl|my_center|LOCUS_04780 480498 481415 gene locus_tag LOCUS_04790 gene nosF 480498 481415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 protein_id gnl|my_center|LOCUS_04790 481415 482248 gene locus_tag LOCUS_04800 481415 482248 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_04800 482245 482796 gene locus_tag LOCUS_04810 gene nosL 482245 482796 CDS product NosL copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_04810 482793 483740 gene locus_tag LOCUS_04820 gene nosX 482793 483740 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ4 protein_id gnl|my_center|LOCUS_04820 484146 484071 gene locus_tag LOCUS_t00020 484146 484071 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 484393 484469 gene locus_tag LOCUS_t00030 484393 484469 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 484946 485311 gene locus_tag LOCUS_04830 gene nuoA 484946 485311 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJB3 protein_id gnl|my_center|LOCUS_04830 485302 485877 gene locus_tag LOCUS_04840 gene nuoB2 485302 485877 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA56 protein_id gnl|my_center|LOCUS_04840 485889 486491 gene locus_tag LOCUS_04850 gene nuoC2 485889 486491 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA57 protein_id gnl|my_center|LOCUS_04850 486503 487693 gene locus_tag LOCUS_04860 gene nuoD1 486503 487693 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W6 protein_id gnl|my_center|LOCUS_04860 487801 488997 gene locus_tag LOCUS_04870 487801 488997 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531093.1 protein_id gnl|my_center|LOCUS_04870 489007 490314 gene locus_tag LOCUS_04880 gene nuoF1 489007 490314 CDS product NADH-quinone oxidoreductase subunit F 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56912 protein_id gnl|my_center|LOCUS_04880 490395 491264 gene locus_tag LOCUS_04890 490395 491264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 491371 493452 gene locus_tag LOCUS_04900 491371 493452 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7X1 protein_id gnl|my_center|LOCUS_04900 493467 494513 gene locus_tag LOCUS_04910 gene nuoH 493467 494513 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7X2 protein_id gnl|my_center|LOCUS_04910 494575 495063 gene locus_tag LOCUS_04920 gene nuoI 494575 495063 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA65 protein_id gnl|my_center|LOCUS_04920 495206 495820 gene locus_tag LOCUS_04930 gene nuoJ 495206 495820 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 protein_id gnl|my_center|LOCUS_04930 495847 496155 gene locus_tag LOCUS_04940 gene nuoK1 495847 496155 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 protein_id gnl|my_center|LOCUS_04940 496163 498148 gene locus_tag LOCUS_04950 gene nuoL 496163 498148 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707630.1 protein_id gnl|my_center|LOCUS_04950 498148 499659 gene locus_tag LOCUS_04960 gene nuoM 498148 499659 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531857.1 protein_id gnl|my_center|LOCUS_04960 499680 501122 gene locus_tag LOCUS_04970 gene nuoN1 499680 501122 CDS product NADH-quinone oxidoreductase subunit N 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QN9 protein_id gnl|my_center|LOCUS_04970 501141 501881 gene locus_tag LOCUS_04980 gene birA 501141 501881 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707633.1 protein_id gnl|my_center|LOCUS_04980 502014 503681 gene locus_tag LOCUS_04990 502014 503681 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971517.1 protein_id gnl|my_center|LOCUS_04990 503692 504096 gene locus_tag LOCUS_05000 503692 504096 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 protein_id gnl|my_center|LOCUS_05000 504107 504379 gene locus_tag LOCUS_05010 504107 504379 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975099.1 protein_id gnl|my_center|LOCUS_05010 504518 504751 gene locus_tag LOCUS_05020 504518 504751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 505182 506525 gene locus_tag LOCUS_05030 gene proS 505182 506525 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA1 protein_id gnl|my_center|LOCUS_05030 506556 507857 gene locus_tag LOCUS_05040 506556 507857 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971521.1 protein_id gnl|my_center|LOCUS_05040 507850 508554 gene locus_tag LOCUS_05050 gene lolD 507850 508554 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7Z5 protein_id gnl|my_center|LOCUS_05050 509572 508790 gene locus_tag LOCUS_05060 509572 508790 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_05060 510225 509569 gene locus_tag LOCUS_05070 510225 509569 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_05070 511050 510373 gene locus_tag LOCUS_05080 511050 510373 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495402.1 protein_id gnl|my_center|LOCUS_05080 511296 512468 gene locus_tag LOCUS_05090 511296 512468 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708080.1 protein_id gnl|my_center|LOCUS_05090 512626 514095 gene locus_tag LOCUS_05100 512626 514095 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 protein_id gnl|my_center|LOCUS_05100 514140 514361 gene locus_tag LOCUS_05110 514140 514361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 514389 514556 gene locus_tag LOCUS_05120 514389 514556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 514625 515380 gene locus_tag LOCUS_05130 514625 515380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975622.1 protein_id gnl|my_center|LOCUS_05130 515424 516695 gene locus_tag LOCUS_05140 515424 516695 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975621.1 protein_id gnl|my_center|LOCUS_05140 516688 517926 gene locus_tag LOCUS_05150 gene csd 516688 517926 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PL2 protein_id gnl|my_center|LOCUS_05150 517940 518329 gene locus_tag LOCUS_05160 517940 518329 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971890.1 protein_id gnl|my_center|LOCUS_05160 518440 518829 gene locus_tag LOCUS_05170 518440 518829 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708086.1 protein_id gnl|my_center|LOCUS_05170 521560 519005 gene locus_tag LOCUS_05180 521560 519005 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531196.1 protein_id gnl|my_center|LOCUS_05180 521749 522255 gene locus_tag LOCUS_05190 521749 522255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532107.1 protein_id gnl|my_center|LOCUS_05190 522396 524333 gene locus_tag LOCUS_05200 522396 524333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_05200 524335 528525 gene locus_tag LOCUS_05210 524335 528525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 528667 529116 gene locus_tag LOCUS_05220 gene msrB1 528667 529116 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W178 protein_id gnl|my_center|LOCUS_05220 529117 529623 gene locus_tag LOCUS_05230 gene msrA2 529117 529623 CDS product peptide methionine sulfoxide reductase MsrA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJI2 protein_id gnl|my_center|LOCUS_05230 529732 530229 gene locus_tag LOCUS_05240 529732 530229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 530282 531760 gene locus_tag LOCUS_05250 530282 531760 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_05250 531948 532373 gene locus_tag LOCUS_05260 531948 532373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 533745 532699 gene locus_tag LOCUS_05270 533745 532699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 538416 534604 gene locus_tag LOCUS_05280 gene nrd 538416 534604 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529536.1 protein_id gnl|my_center|LOCUS_05280 539633 539133 gene locus_tag LOCUS_05290 539633 539133 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920132.1 protein_id gnl|my_center|LOCUS_05290 541611 539914 gene locus_tag LOCUS_05300 541611 539914 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920687.1 protein_id gnl|my_center|LOCUS_05300 541874 541608 gene locus_tag LOCUS_05310 541874 541608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 542718 542221 gene locus_tag LOCUS_05320 gene gpt 542718 542221 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9A2 protein_id gnl|my_center|LOCUS_05320 543735 542893 gene locus_tag LOCUS_05330 543735 542893 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314363.1 protein_id gnl|my_center|LOCUS_05330 544603 543836 gene locus_tag LOCUS_05340 544603 543836 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708023.1 protein_id gnl|my_center|LOCUS_05340 544804 545403 gene locus_tag LOCUS_05350 544804 545403 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9A0 protein_id gnl|my_center|LOCUS_05350 545566 545652 gene locus_tag LOCUS_t00040 545566 545652 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 547190 545694 gene locus_tag LOCUS_05360 547190 545694 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_05360 548733 547279 gene locus_tag LOCUS_05370 gene trkH 548733 547279 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PU8 protein_id gnl|my_center|LOCUS_05370 548809 550083 gene locus_tag LOCUS_05380 gene ilvA 548809 550083 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZR6 protein_id gnl|my_center|LOCUS_05380 551155 550169 gene locus_tag LOCUS_05390 551155 550169 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531457.1 protein_id gnl|my_center|LOCUS_05390 551614 551297 gene locus_tag LOCUS_05400 551614 551297 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975648.1 protein_id gnl|my_center|LOCUS_05400 553757 551766 gene locus_tag LOCUS_05410 gene cpdB 553757 551766 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969356.1 protein_id gnl|my_center|LOCUS_05410 553982 554278 gene locus_tag LOCUS_05420 553982 554278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312784.1 protein_id gnl|my_center|LOCUS_05420 554759 554391 gene locus_tag LOCUS_05430 554759 554391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 555141 554953 gene locus_tag LOCUS_05440 555141 554953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368443.1 protein_id gnl|my_center|LOCUS_05440 555450 555815 gene locus_tag LOCUS_05450 555450 555815 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310664.1 protein_id gnl|my_center|LOCUS_05450 556499 556035 gene locus_tag LOCUS_05460 556499 556035 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708035.1 protein_id gnl|my_center|LOCUS_05460 556667 557785 gene locus_tag LOCUS_05470 556667 557785 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCI5 protein_id gnl|my_center|LOCUS_05470 558320 557850 gene locus_tag LOCUS_05480 558320 557850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531464.1 protein_id gnl|my_center|LOCUS_05480 558968 558387 gene locus_tag LOCUS_05490 558968 558387 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708038.1 protein_id gnl|my_center|LOCUS_05490 559848 558970 gene locus_tag LOCUS_05500 gene sseA 559848 558970 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708039.1 protein_id gnl|my_center|LOCUS_05500 560592 560065 gene locus_tag LOCUS_05510 560592 560065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 561442 560717 gene locus_tag LOCUS_05520 gene alaS2 561442 560717 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708040.1 protein_id gnl|my_center|LOCUS_05520 562502 561465 gene locus_tag LOCUS_05530 gene cysK2 562502 561465 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708041.1 protein_id gnl|my_center|LOCUS_05530 562777 563421 gene locus_tag LOCUS_05540 562777 563421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384381.1 protein_id gnl|my_center|LOCUS_05540 563508 564311 gene locus_tag LOCUS_05550 563508 564311 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 protein_id gnl|my_center|LOCUS_05550 565709 564459 gene locus_tag LOCUS_05560 565709 564459 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_05560 566598 565747 gene locus_tag LOCUS_05570 566598 565747 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_05570 567941 566601 gene locus_tag LOCUS_05580 567941 566601 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_05580 569398 567938 gene locus_tag LOCUS_05590 gene phrA 569398 567938 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_05590 569716 570681 gene locus_tag LOCUS_05600 569716 570681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 571050 570976 gene locus_tag LOCUS_t00050 571050 570976 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 571603 571530 gene locus_tag LOCUS_t00060 571603 571530 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 571819 572487 gene locus_tag LOCUS_05610 571819 572487 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969269.1 protein_id gnl|my_center|LOCUS_05610 572670 574022 gene locus_tag LOCUS_05620 gene tolC 572670 574022 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707908.1 protein_id gnl|my_center|LOCUS_05620 574230 574970 gene locus_tag LOCUS_05630 574230 574970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707910.1 protein_id gnl|my_center|LOCUS_05630 575066 575434 gene locus_tag LOCUS_05640 575066 575434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 575583 578399 gene locus_tag LOCUS_05650 gene valS 575583 578399 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8M2 protein_id gnl|my_center|LOCUS_05650 578718 579890 gene locus_tag LOCUS_05660 578718 579890 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707915.1 protein_id gnl|my_center|LOCUS_05660 580128 581948 gene locus_tag LOCUS_05670 gene ilvD 580128 581948 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_05670 581935 582732 gene locus_tag LOCUS_05680 gene exoR 581935 582732 CDS product exopolysaccharide production negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707916.1 protein_id gnl|my_center|LOCUS_05680 583977 583195 gene locus_tag LOCUS_05690 583977 583195 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971819.1 protein_id gnl|my_center|LOCUS_05690 584352 584017 gene locus_tag LOCUS_05700 584352 584017 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971818.1 protein_id gnl|my_center|LOCUS_05700 584492 585697 gene locus_tag LOCUS_05710 584492 585697 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q32 protein_id gnl|my_center|LOCUS_05710 585763 587523 gene locus_tag LOCUS_05720 gene argS 585763 587523 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8M9 protein_id gnl|my_center|LOCUS_05720 587584 590796 gene locus_tag LOCUS_05730 587584 590796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 590920 591936 gene locus_tag LOCUS_05740 590920 591936 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969277.1 protein_id gnl|my_center|LOCUS_05740 591955 592818 gene locus_tag LOCUS_05750 591955 592818 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969278.1 protein_id gnl|my_center|LOCUS_05750 592815 593573 gene locus_tag LOCUS_05760 592815 593573 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBT7 protein_id gnl|my_center|LOCUS_05760 593680 594729 gene locus_tag LOCUS_05770 593680 594729 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707926.1 protein_id gnl|my_center|LOCUS_05770 594769 594978 gene locus_tag LOCUS_05780 gene tatA 594769 594978 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEP9 protein_id gnl|my_center|LOCUS_05780 595020 595760 gene locus_tag LOCUS_05790 595020 595760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 595757 596596 gene locus_tag LOCUS_05800 gene tatC 595757 596596 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q23 protein_id gnl|my_center|LOCUS_05800 596977 596564 gene locus_tag LOCUS_05810 596977 596564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 596861 598114 gene locus_tag LOCUS_05820 gene serS 596861 598114 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T4 protein_id gnl|my_center|LOCUS_05820 598140 598898 gene locus_tag LOCUS_05830 gene surE 598140 598898 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08248 protein_id gnl|my_center|LOCUS_05830 598902 599555 gene locus_tag LOCUS_05840 gene pcm 598902 599555 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314400.1 protein_id gnl|my_center|LOCUS_05840 599661 601403 gene locus_tag LOCUS_05850 599661 601403 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971809.1 protein_id gnl|my_center|LOCUS_05850 602354 601485 gene locus_tag LOCUS_05860 602354 601485 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_05860 602662 602991 gene locus_tag LOCUS_05870 602662 602991 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534584.1 protein_id gnl|my_center|LOCUS_05870 603084 605654 gene locus_tag LOCUS_05880 603084 605654 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_05880 605658 606044 gene locus_tag LOCUS_05890 605658 606044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969289.1 protein_id gnl|my_center|LOCUS_05890 606104 606925 gene locus_tag LOCUS_05900 606104 606925 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707939.1 protein_id gnl|my_center|LOCUS_05900 607069 607527 gene locus_tag LOCUS_05910 607069 607527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707940.1 protein_id gnl|my_center|LOCUS_05910 607520 608485 gene locus_tag LOCUS_05920 607520 608485 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_05920 609939 608584 gene locus_tag LOCUS_05930 609939 608584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 611495 610059 gene locus_tag LOCUS_05940 gene trmFO 611495 610059 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q15 protein_id gnl|my_center|LOCUS_05940 611754 611608 gene locus_tag LOCUS_05950 611754 611608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 612218 612075 gene locus_tag LOCUS_05960 612218 612075 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531315.1 protein_id gnl|my_center|LOCUS_05960 612760 612620 gene locus_tag LOCUS_05970 612760 612620 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529522.1 protein_id gnl|my_center|LOCUS_05970 613032 614144 gene locus_tag LOCUS_05980 613032 614144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 protein_id gnl|my_center|LOCUS_05980 614141 614749 gene locus_tag LOCUS_05990 614141 614749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 protein_id gnl|my_center|LOCUS_05990 614899 614983 gene locus_tag LOCUS_t00070 614899 614983 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 615159 616586 gene locus_tag LOCUS_06000 gene tig 615159 616586 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q12 protein_id gnl|my_center|LOCUS_06000 617514 616720 gene locus_tag LOCUS_06010 617514 616720 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 protein_id gnl|my_center|LOCUS_06010 618392 617565 gene locus_tag LOCUS_06020 gene map1 618392 617565 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBW5 protein_id gnl|my_center|LOCUS_06020 619163 618441 gene locus_tag LOCUS_06030 gene sfsA 619163 618441 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87322 protein_id gnl|my_center|LOCUS_06030 621087 619252 gene locus_tag LOCUS_06040 621087 619252 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975611.1 protein_id gnl|my_center|LOCUS_06040 621233 621793 gene locus_tag LOCUS_06050 621233 621793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 621876 623099 gene locus_tag LOCUS_06060 gene aatC 621876 623099 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBW8 protein_id gnl|my_center|LOCUS_06060 623199 624521 gene locus_tag LOCUS_06070 gene thrA 623199 624521 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PL9 protein_id gnl|my_center|LOCUS_06070 624711 625697 gene locus_tag LOCUS_06080 624711 625697 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD76 protein_id gnl|my_center|LOCUS_06080 625850 627649 gene locus_tag LOCUS_06090 gene recJ 625850 627649 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707956.1 protein_id gnl|my_center|LOCUS_06090 627919 627845 gene locus_tag LOCUS_t00080 627919 627845 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 629206 628076 gene locus_tag LOCUS_06100 629206 628076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975606.1 protein_id gnl|my_center|LOCUS_06100 629956 629516 gene locus_tag LOCUS_06110 629956 629516 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_06110 630245 630820 gene locus_tag LOCUS_06120 gene cspA3 630245 630820 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707962.1 protein_id gnl|my_center|LOCUS_06120 630826 631308 gene locus_tag LOCUS_06130 630826 631308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531330.1 protein_id gnl|my_center|LOCUS_06130 631389 631465 gene locus_tag LOCUS_t00090 631389 631465 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 631539 631862 gene locus_tag LOCUS_06140 631539 631862 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532440.1 protein_id gnl|my_center|LOCUS_06140 631907 631983 gene locus_tag LOCUS_t00100 631907 631983 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 632440 633129 gene locus_tag LOCUS_06150 632440 633129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 633140 633571 gene locus_tag LOCUS_06160 633140 633571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 633610 635841 gene locus_tag LOCUS_06170 633610 635841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 637112 635925 gene locus_tag LOCUS_06180 637112 635925 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975280.1 protein_id gnl|my_center|LOCUS_06180 637450 638472 gene locus_tag LOCUS_06190 637450 638472 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975279.1 protein_id gnl|my_center|LOCUS_06190 638614 639819 gene locus_tag LOCUS_06200 gene aapQ 638614 639819 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969246.1 protein_id gnl|my_center|LOCUS_06200 639823 640956 gene locus_tag LOCUS_06210 639823 640956 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316325.1 protein_id gnl|my_center|LOCUS_06210 640972 641769 gene locus_tag LOCUS_06220 gene aapP 640972 641769 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707870.1 protein_id gnl|my_center|LOCUS_06220 641783 642538 gene locus_tag LOCUS_06230 641783 642538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532419.1 protein_id gnl|my_center|LOCUS_06230 643695 642517 gene locus_tag LOCUS_06240 643695 642517 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975281.1 protein_id gnl|my_center|LOCUS_06240 643977 643732 gene locus_tag LOCUS_06250 643977 643732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532417.1 protein_id gnl|my_center|LOCUS_06250 644154 644948 gene locus_tag LOCUS_06260 644154 644948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975283.1 protein_id gnl|my_center|LOCUS_06260 644945 645835 gene locus_tag LOCUS_06270 644945 645835 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702781.1 protein_id gnl|my_center|LOCUS_06270 646640 645840 gene locus_tag LOCUS_06280 646640 645840 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_06280 646720 647544 gene locus_tag LOCUS_06290 gene cysE 646720 647544 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707878.1 protein_id gnl|my_center|LOCUS_06290 647663 647869 gene locus_tag LOCUS_06300 647663 647869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 648647 647862 gene locus_tag LOCUS_06310 648647 647862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975218.1 protein_id gnl|my_center|LOCUS_06310 648703 649038 gene locus_tag LOCUS_06320 648703 649038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 649365 649892 gene locus_tag LOCUS_06330 649365 649892 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_06330 650719 650108 gene locus_tag LOCUS_06340 650719 650108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975219.1 protein_id gnl|my_center|LOCUS_06340 651928 651317 gene locus_tag LOCUS_06350 651928 651317 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707808.1 protein_id gnl|my_center|LOCUS_06350 652644 652018 gene locus_tag LOCUS_06360 652644 652018 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531342.1 protein_id gnl|my_center|LOCUS_06360 652996 653718 gene locus_tag LOCUS_06370 652996 653718 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707811.1 protein_id gnl|my_center|LOCUS_06370 653892 654320 gene locus_tag LOCUS_06380 653892 654320 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_06380 655344 654349 gene locus_tag LOCUS_06390 655344 654349 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975224.1 protein_id gnl|my_center|LOCUS_06390 656010 655558 gene locus_tag LOCUS_06400 gene hisI 656010 655558 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB44 protein_id gnl|my_center|LOCUS_06400 656647 656039 gene locus_tag LOCUS_06410 gene folE 656647 656039 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QB4 protein_id gnl|my_center|LOCUS_06410 656931 657380 gene locus_tag LOCUS_06420 656931 657380 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707816.1 protein_id gnl|my_center|LOCUS_06420 657377 657721 gene locus_tag LOCUS_06430 657377 657721 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD67 protein_id gnl|my_center|LOCUS_06430 657883 659886 gene locus_tag LOCUS_06440 gene thrS 657883 659886 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEL1 protein_id gnl|my_center|LOCUS_06440 661197 660268 gene locus_tag LOCUS_06450 661197 660268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975232.1 protein_id gnl|my_center|LOCUS_06450 661288 661881 gene locus_tag LOCUS_06460 661288 661881 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 protein_id gnl|my_center|LOCUS_06460 661887 662498 gene locus_tag LOCUS_06470 661887 662498 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707823.1 protein_id gnl|my_center|LOCUS_06470 663434 662529 gene locus_tag LOCUS_06480 663434 662529 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_06480 663886 663431 gene locus_tag LOCUS_06490 663886 663431 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_06490 664107 665189 gene locus_tag LOCUS_06500 664107 665189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971838.1 protein_id gnl|my_center|LOCUS_06500 665189 665446 gene locus_tag LOCUS_06510 665189 665446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 667827 665749 gene locus_tag LOCUS_06520 gene parE 667827 665749 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QA5 protein_id gnl|my_center|LOCUS_06520 667925 668797 gene locus_tag LOCUS_06530 667925 668797 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971747.1 protein_id gnl|my_center|LOCUS_06530 668921 669367 gene locus_tag LOCUS_06540 668921 669367 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_06540 669364 670377 gene locus_tag LOCUS_06550 669364 670377 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 protein_id gnl|my_center|LOCUS_06550 670400 671890 gene locus_tag LOCUS_06560 670400 671890 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531150.1 protein_id gnl|my_center|LOCUS_06560 672177 673199 gene locus_tag LOCUS_06570 672177 673199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 673216 674259 gene locus_tag LOCUS_06580 673216 674259 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339192.1 protein_id gnl|my_center|LOCUS_06580 675117 674326 gene locus_tag LOCUS_06590 675117 674326 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266291.1 protein_id gnl|my_center|LOCUS_06590 <675709 675159 gene locus_tag LOCUS_06600 <675709 675159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975446.1:transcriptional regulator >Feature sequence02 340 113 gene locus_tag LOCUS_06610 340 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 907 350 gene locus_tag LOCUS_06620 907 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1612 1536 gene locus_tag LOCUS_t00110 1612 1536 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1844 2821 gene locus_tag LOCUS_06630 1844 2821 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 protein_id gnl|my_center|LOCUS_06630 4187 2997 gene locus_tag LOCUS_06640 gene mnmA 4187 2997 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCQ0 protein_id gnl|my_center|LOCUS_06640 4438 4713 gene locus_tag LOCUS_06650 4438 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430042.1 protein_id gnl|my_center|LOCUS_06650 5324 4866 gene locus_tag LOCUS_06660 5324 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5477 5755 gene locus_tag LOCUS_06670 5477 5755 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527553.1 protein_id gnl|my_center|LOCUS_06670 6246 5890 gene locus_tag LOCUS_06680 6246 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066823.1 protein_id gnl|my_center|LOCUS_06680 6685 7386 gene locus_tag LOCUS_06690 6685 7386 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709262.1 protein_id gnl|my_center|LOCUS_06690 7853 7491 gene locus_tag LOCUS_06700 7853 7491 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709263.1 protein_id gnl|my_center|LOCUS_06700 8643 7993 gene locus_tag LOCUS_06710 8643 7993 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709264.1 protein_id gnl|my_center|LOCUS_06710 8879 9466 gene locus_tag LOCUS_06720 8879 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970153.1 protein_id gnl|my_center|LOCUS_06720 9642 10949 gene locus_tag LOCUS_06730 9642 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 11820 10978 gene locus_tag LOCUS_06740 11820 10978 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527563.1 protein_id gnl|my_center|LOCUS_06740 12218 11823 gene locus_tag LOCUS_06750 12218 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066831.1 protein_id gnl|my_center|LOCUS_06750 12248 13315 gene locus_tag LOCUS_06760 gene rluD 12248 13315 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MI11 protein_id gnl|my_center|LOCUS_06760 13480 14382 gene locus_tag LOCUS_06770 gene rpoH 13480 14382 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7F7 protein_id gnl|my_center|LOCUS_06770 15623 15204 gene locus_tag LOCUS_06780 15623 15204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338003.1 protein_id gnl|my_center|LOCUS_06780 16137 16892 gene locus_tag LOCUS_06790 16137 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 16880 17635 gene locus_tag LOCUS_06800 16880 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 17632 19122 gene locus_tag LOCUS_06810 17632 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19119 19370 gene locus_tag LOCUS_06820 19119 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 19391 20446 gene locus_tag LOCUS_06830 19391 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 20624 21685 gene locus_tag LOCUS_06840 20624 21685 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_06840 23365 21761 gene locus_tag LOCUS_06850 23365 21761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532519.1 protein_id gnl|my_center|LOCUS_06850 25174 23633 gene locus_tag LOCUS_06860 25174 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 26527 25229 gene locus_tag LOCUS_06870 gene purA 26527 25229 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MI14 protein_id gnl|my_center|LOCUS_06870 26754 27632 gene locus_tag LOCUS_06880 26754 27632 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 protein_id gnl|my_center|LOCUS_06880 27679 27819 gene locus_tag LOCUS_06890 27679 27819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 28342 27806 gene locus_tag LOCUS_06900 28342 27806 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222348.1 protein_id gnl|my_center|LOCUS_06900 30174 28579 gene locus_tag LOCUS_06910 gene serA 30174 28579 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFK0 protein_id gnl|my_center|LOCUS_06910 31437 30262 gene locus_tag LOCUS_06920 gene serC 31437 30262 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_06920 32430 31597 gene locus_tag LOCUS_06930 32430 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709276.1 protein_id gnl|my_center|LOCUS_06930 33525 32668 gene locus_tag LOCUS_06940 33525 32668 CDS product HEAT resistant agglutinin 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970160.1 protein_id gnl|my_center|LOCUS_06940 35314 34019 gene locus_tag LOCUS_06950 gene glmM 35314 34019 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L9 protein_id gnl|my_center|LOCUS_06950 37482 35545 gene locus_tag LOCUS_06960 gene ftsH 37482 35545 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M98 protein_id gnl|my_center|LOCUS_06960 38881 37595 gene locus_tag LOCUS_06970 38881 37595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 39879 38974 gene locus_tag LOCUS_06980 39879 38974 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709281.1 protein_id gnl|my_center|LOCUS_06980 40655 40149 gene locus_tag LOCUS_06990 40655 40149 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066845.1 protein_id gnl|my_center|LOCUS_06990 42135 40822 gene locus_tag LOCUS_07000 gene tolB 42135 40822 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L4 protein_id gnl|my_center|LOCUS_07000 43227 42154 gene locus_tag LOCUS_07010 43227 42154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066847.1 protein_id gnl|my_center|LOCUS_07010 43690 43238 gene locus_tag LOCUS_07020 gene tolR 43690 43238 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 protein_id gnl|my_center|LOCUS_07020 44416 43700 gene locus_tag LOCUS_07030 44416 43700 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066849.1 protein_id gnl|my_center|LOCUS_07030 45412 44660 gene locus_tag LOCUS_07040 gene map 45412 44660 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CI17 protein_id gnl|my_center|LOCUS_07040 45890 45417 gene locus_tag LOCUS_07050 45890 45417 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709289.1 protein_id gnl|my_center|LOCUS_07050 46013 47233 gene locus_tag LOCUS_07060 gene sqdB 46013 47233 CDS product UDP-sulfoquinovose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709290.1 protein_id gnl|my_center|LOCUS_07060 47230 48135 gene locus_tag LOCUS_07070 gene sqdD 47230 48135 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970166.1 protein_id gnl|my_center|LOCUS_07070 48548 48150 gene locus_tag LOCUS_07080 48548 48150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 48435 49022 gene locus_tag LOCUS_07090 48435 49022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 49435 49076 gene locus_tag LOCUS_07100 49435 49076 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969558.1 protein_id gnl|my_center|LOCUS_07100 50667 49630 gene locus_tag LOCUS_07110 gene ruvB 50667 49630 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCT7 protein_id gnl|my_center|LOCUS_07110 51068 50664 gene locus_tag LOCUS_07120 51068 50664 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036811.1 protein_id gnl|my_center|LOCUS_07120 51346 51065 gene locus_tag LOCUS_07130 51346 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 52022 51405 gene locus_tag LOCUS_07140 gene ruvA 52022 51405 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K5 protein_id gnl|my_center|LOCUS_07140 52539 52033 gene locus_tag LOCUS_07150 gene ruvC 52539 52033 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ9 protein_id gnl|my_center|LOCUS_07150 52700 53686 gene locus_tag LOCUS_07160 52700 53686 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970170.1 protein_id gnl|my_center|LOCUS_07160 54496 53750 gene locus_tag LOCUS_07170 54496 53750 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_07170 54577 55077 gene locus_tag LOCUS_07180 54577 55077 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067666.1 protein_id gnl|my_center|LOCUS_07180 55151 55987 gene locus_tag LOCUS_07190 55151 55987 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709299.1 protein_id gnl|my_center|LOCUS_07190 55990 56568 gene locus_tag LOCUS_07200 55990 56568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 57408 56584 gene locus_tag LOCUS_07210 57408 56584 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709302.1 protein_id gnl|my_center|LOCUS_07210 57988 57416 gene locus_tag LOCUS_07220 57988 57416 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MII4 protein_id gnl|my_center|LOCUS_07220 58212 58421 gene locus_tag LOCUS_07230 58212 58421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 58897 59961 gene locus_tag LOCUS_07240 58897 59961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 60088 61338 gene locus_tag LOCUS_07250 60088 61338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 61475 63265 gene locus_tag LOCUS_07260 61475 63265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 63670 63308 gene locus_tag LOCUS_07270 63670 63308 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92JX9 protein_id gnl|my_center|LOCUS_07270 64009 63737 gene locus_tag LOCUS_07280 64009 63737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003506205.1 protein_id gnl|my_center|LOCUS_07280 64245 66236 gene locus_tag LOCUS_07290 gene tkt2 64245 66236 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M82 protein_id gnl|my_center|LOCUS_07290 66283 67293 gene locus_tag LOCUS_07300 66283 67293 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ0 protein_id gnl|my_center|LOCUS_07300 67576 69375 gene locus_tag LOCUS_07310 67576 69375 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973288.1 protein_id gnl|my_center|LOCUS_07310 69486 70682 gene locus_tag LOCUS_07320 gene pgk 69486 70682 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ2 protein_id gnl|my_center|LOCUS_07320 70874 71752 gene locus_tag LOCUS_07330 70874 71752 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_07330 71870 72613 gene locus_tag LOCUS_07340 71870 72613 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529244.1 protein_id gnl|my_center|LOCUS_07340 72857 74098 gene locus_tag LOCUS_07350 72857 74098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 protein_id gnl|my_center|LOCUS_07350 75097 74117 gene locus_tag LOCUS_07360 75097 74117 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_07360 75209 75400 gene locus_tag LOCUS_07370 75209 75400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084320.1 protein_id gnl|my_center|LOCUS_07370 75831 76349 gene locus_tag LOCUS_07380 75831 76349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066879.1 protein_id gnl|my_center|LOCUS_07380 76961 76527 gene locus_tag LOCUS_07390 76961 76527 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706922.1 protein_id gnl|my_center|LOCUS_07390 77356 77135 gene locus_tag LOCUS_07400 gene rpmE 77356 77135 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCW1 protein_id gnl|my_center|LOCUS_07400 77560 79395 gene locus_tag LOCUS_07410 77560 79395 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709320.1 protein_id gnl|my_center|LOCUS_07410 79526 80437 gene locus_tag LOCUS_07420 79526 80437 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531193.1 protein_id gnl|my_center|LOCUS_07420 80466 81266 gene locus_tag LOCUS_07430 80466 81266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 82312 81281 gene locus_tag LOCUS_07440 82312 81281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709323.1 protein_id gnl|my_center|LOCUS_07440 83338 82316 gene locus_tag LOCUS_07450 83338 82316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709324.1 protein_id gnl|my_center|LOCUS_07450 84247 83447 gene locus_tag LOCUS_07460 gene suhB 84247 83447 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973295.1 protein_id gnl|my_center|LOCUS_07460 84864 84301 gene locus_tag LOCUS_07470 gene efp 84864 84301 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_07470 86031 84985 gene locus_tag LOCUS_07480 86031 84985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970186.1 protein_id gnl|my_center|LOCUS_07480 86402 86031 gene locus_tag LOCUS_07490 86402 86031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 86334 86711 gene locus_tag LOCUS_07500 86334 86711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 86777 87553 gene locus_tag LOCUS_07510 86777 87553 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIK9 protein_id gnl|my_center|LOCUS_07510 87620 89272 gene locus_tag LOCUS_07520 87620 89272 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_07520 89378 89635 gene locus_tag LOCUS_07530 89378 89635 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536024.1 protein_id gnl|my_center|LOCUS_07530 89916 89740 gene locus_tag LOCUS_07540 89916 89740 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314700.1 protein_id gnl|my_center|LOCUS_07540 90129 90332 gene locus_tag LOCUS_07550 90129 90332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066888.1 protein_id gnl|my_center|LOCUS_07550 90346 90846 gene locus_tag LOCUS_07560 gene purE 90346 90846 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7B0 protein_id gnl|my_center|LOCUS_07560 90843 91931 gene locus_tag LOCUS_07570 gene purK 90843 91931 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7A9 protein_id gnl|my_center|LOCUS_07570 92090 92215 gene locus_tag LOCUS_07580 gene rpmJ 92090 92215 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68993 protein_id gnl|my_center|LOCUS_07580 92286 92897 gene locus_tag LOCUS_07590 92286 92897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970192.1 protein_id gnl|my_center|LOCUS_07590 93014 94045 gene locus_tag LOCUS_07600 93014 94045 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709336.1 protein_id gnl|my_center|LOCUS_07600 95521 94082 gene locus_tag LOCUS_07610 gene pykA 95521 94082 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M63 protein_id gnl|my_center|LOCUS_07610 95991 95521 gene locus_tag LOCUS_07620 95991 95521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709338.1 protein_id gnl|my_center|LOCUS_07620 96208 96990 gene locus_tag LOCUS_07630 96208 96990 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066894.1 protein_id gnl|my_center|LOCUS_07630 97130 97396 gene locus_tag LOCUS_07640 97130 97396 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIM2 protein_id gnl|my_center|LOCUS_07640 99365 97626 gene locus_tag LOCUS_07650 99365 97626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709342.1 protein_id gnl|my_center|LOCUS_07650 101193 99655 gene locus_tag LOCUS_07660 gene tacA 101193 99655 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531053.1 protein_id gnl|my_center|LOCUS_07660 101377 103224 gene locus_tag LOCUS_07670 101377 103224 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709344.1 protein_id gnl|my_center|LOCUS_07670 103318 104769 gene locus_tag LOCUS_07680 103318 104769 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709349.1 protein_id gnl|my_center|LOCUS_07680 104905 105270 gene locus_tag LOCUS_07690 gene omp10 104905 105270 CDS product outer membrane lipoprotein Omp16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M53 protein_id gnl|my_center|LOCUS_07690 105294 106547 gene locus_tag LOCUS_07700 105294 106547 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_07700 106688 108631 gene locus_tag LOCUS_07710 106688 108631 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709351.1 protein_id gnl|my_center|LOCUS_07710 108839 109903 gene locus_tag LOCUS_07720 gene hemH 108839 109903 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M52 protein_id gnl|my_center|LOCUS_07720 110157 111176 gene locus_tag LOCUS_07730 110157 111176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 protein_id gnl|my_center|LOCUS_07730 111173 111628 gene locus_tag LOCUS_07740 111173 111628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_07740 112681 111650 gene locus_tag LOCUS_07750 112681 111650 CDS product KpsF/GutQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529724.1 protein_id gnl|my_center|LOCUS_07750 112873 114369 gene locus_tag LOCUS_07760 112873 114369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066922.1 protein_id gnl|my_center|LOCUS_07760 115324 114440 gene locus_tag LOCUS_07770 gene exoN2 115324 114440 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M48 protein_id gnl|my_center|LOCUS_07770 115520 116737 gene locus_tag LOCUS_07780 115520 116737 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709367.1 protein_id gnl|my_center|LOCUS_07780 116796 117953 gene locus_tag LOCUS_07790 116796 117953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709368.1 protein_id gnl|my_center|LOCUS_07790 119508 118054 gene locus_tag LOCUS_07800 gene gltD 119508 118054 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709369.1 protein_id gnl|my_center|LOCUS_07800 119691 119524 gene locus_tag LOCUS_07810 119691 119524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 124367 119688 gene locus_tag LOCUS_07820 124367 119688 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_07820 124998 126047 gene locus_tag LOCUS_07830 124998 126047 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M44 protein_id gnl|my_center|LOCUS_07830 126235 126540 gene locus_tag LOCUS_07840 126235 126540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975389.1 protein_id gnl|my_center|LOCUS_07840 126571 127491 gene locus_tag LOCUS_07850 126571 127491 CDS product UPF0276 protein RB0508 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92W37 protein_id gnl|my_center|LOCUS_07850 127496 128281 gene locus_tag LOCUS_07860 127496 128281 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 protein_id gnl|my_center|LOCUS_07860 128278 128850 gene locus_tag LOCUS_07870 128278 128850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 129380 128913 gene locus_tag LOCUS_07880 gene hspL 129380 128913 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973403.1 protein_id gnl|my_center|LOCUS_07880 129600 129367 gene locus_tag LOCUS_07890 129600 129367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 129776 130762 gene locus_tag LOCUS_07900 129776 130762 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066932.1 protein_id gnl|my_center|LOCUS_07900 131525 130746 gene locus_tag LOCUS_07910 131525 130746 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709374.1 protein_id gnl|my_center|LOCUS_07910 132734 131826 gene locus_tag LOCUS_07920 132734 131826 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970220.1 protein_id gnl|my_center|LOCUS_07920 132910 133275 gene locus_tag LOCUS_07930 132910 133275 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 protein_id gnl|my_center|LOCUS_07930 133476 133550 gene locus_tag LOCUS_t00120 133476 133550 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 134016 136487 gene locus_tag LOCUS_07940 gene glgP 134016 136487 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M15 protein_id gnl|my_center|LOCUS_07940 136469 138706 gene locus_tag LOCUS_07950 gene glgB 136469 138706 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8L4 protein_id gnl|my_center|LOCUS_07950 138725 139996 gene locus_tag LOCUS_07960 gene glgC 138725 139996 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNQ1 protein_id gnl|my_center|LOCUS_07960 139993 141444 gene locus_tag LOCUS_07970 gene glgA 139993 141444 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIS8 protein_id gnl|my_center|LOCUS_07970 141441 143069 gene locus_tag LOCUS_07980 gene pgm 141441 143069 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970236.1 protein_id gnl|my_center|LOCUS_07980 143069 145042 gene locus_tag LOCUS_07990 143069 145042 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIT0 protein_id gnl|my_center|LOCUS_07990 145209 145697 gene locus_tag LOCUS_08000 145209 145697 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066960.1 protein_id gnl|my_center|LOCUS_08000 146386 145832 gene locus_tag LOCUS_08010 146386 145832 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529660.1 protein_id gnl|my_center|LOCUS_08010 149375 146379 gene locus_tag LOCUS_08020 gene soxA2 149375 146379 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970242.1 protein_id gnl|my_center|LOCUS_08020 149695 149372 gene locus_tag LOCUS_08030 149695 149372 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529658.1 protein_id gnl|my_center|LOCUS_08030 150066 149710 gene locus_tag LOCUS_08040 150066 149710 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_08040 151331 150078 gene locus_tag LOCUS_08050 151331 150078 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_08050 151426 151665 gene locus_tag LOCUS_08060 151426 151665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 151667 151900 gene locus_tag LOCUS_08070 gene rpsU1 151667 151900 CDS product 30S ribosomal protein S21 A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8M6 protein_id gnl|my_center|LOCUS_08070 152023 152883 gene locus_tag LOCUS_08080 152023 152883 CDS product GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313767.1 protein_id gnl|my_center|LOCUS_08080 153327 153827 gene locus_tag LOCUS_08090 153327 153827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529650.1 protein_id gnl|my_center|LOCUS_08090 155304 153907 gene locus_tag LOCUS_08100 gene pntB 155304 153907 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LZ9 protein_id gnl|my_center|LOCUS_08100 155734 155315 gene locus_tag LOCUS_08110 155734 155315 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887714.1 protein_id gnl|my_center|LOCUS_08110 156885 155734 gene locus_tag LOCUS_08120 156885 155734 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887715.1 protein_id gnl|my_center|LOCUS_08120 157189 156965 gene locus_tag LOCUS_08130 157189 156965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066975.1 protein_id gnl|my_center|LOCUS_08130 158056 157322 gene locus_tag LOCUS_08140 158056 157322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528206.1 protein_id gnl|my_center|LOCUS_08140 160586 158259 gene locus_tag LOCUS_08150 160586 158259 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709414.1 protein_id gnl|my_center|LOCUS_08150 164226 160744 gene locus_tag LOCUS_08160 164226 160744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528208.1 protein_id gnl|my_center|LOCUS_08160 165097 164441 gene locus_tag LOCUS_08170 165097 164441 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_08170 165029 165196 gene locus_tag LOCUS_08180 165029 165196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 165441 166025 gene locus_tag LOCUS_08190 165441 166025 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563933.1 protein_id gnl|my_center|LOCUS_08190 166018 167805 gene locus_tag LOCUS_08200 166018 167805 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969561.1 protein_id gnl|my_center|LOCUS_08200 169072 167963 gene locus_tag LOCUS_08210 169072 167963 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315175.1 protein_id gnl|my_center|LOCUS_08210 169367 170131 gene locus_tag LOCUS_08220 169367 170131 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972978.1 protein_id gnl|my_center|LOCUS_08220 171188 170214 gene locus_tag LOCUS_08230 171188 170214 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970252.1 protein_id gnl|my_center|LOCUS_08230 172213 171185 gene locus_tag LOCUS_08240 172213 171185 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066979.1 protein_id gnl|my_center|LOCUS_08240 172864 172292 gene locus_tag LOCUS_08250 172864 172292 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 protein_id gnl|my_center|LOCUS_08250 172946 173689 gene locus_tag LOCUS_08260 172946 173689 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 protein_id gnl|my_center|LOCUS_08260 173816 174898 gene locus_tag LOCUS_08270 173816 174898 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066982.1 protein_id gnl|my_center|LOCUS_08270 174912 175901 gene locus_tag LOCUS_08280 174912 175901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970256.1 protein_id gnl|my_center|LOCUS_08280 176360 175914 gene locus_tag LOCUS_08290 176360 175914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709422.1 protein_id gnl|my_center|LOCUS_08290 177633 176566 gene locus_tag LOCUS_08300 177633 176566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 177856 177674 gene locus_tag LOCUS_08310 177856 177674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 177889 178131 gene locus_tag LOCUS_08320 177889 178131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 178821 178222 gene locus_tag LOCUS_08330 178821 178222 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066986.1 protein_id gnl|my_center|LOCUS_08330 180056 178923 gene locus_tag LOCUS_08340 180056 178923 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970259.1 protein_id gnl|my_center|LOCUS_08340 180611 181504 gene locus_tag LOCUS_08350 180611 181504 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709426.1 protein_id gnl|my_center|LOCUS_08350 181597 182253 gene locus_tag LOCUS_08360 181597 182253 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528900.1 protein_id gnl|my_center|LOCUS_08360 182250 183299 gene locus_tag LOCUS_08370 182250 183299 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LY4 protein_id gnl|my_center|LOCUS_08370 183540 183307 gene locus_tag LOCUS_08380 183540 183307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 184096 183641 gene locus_tag LOCUS_08390 184096 183641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 184770 184096 gene locus_tag LOCUS_08400 184770 184096 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709430.1 protein_id gnl|my_center|LOCUS_08400 184856 186034 gene locus_tag LOCUS_08410 184856 186034 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_08410 186807 186184 gene locus_tag LOCUS_08420 186807 186184 CDS product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706096.1 protein_id gnl|my_center|LOCUS_08420 187028 188059 gene locus_tag LOCUS_08430 187028 188059 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530537.1 protein_id gnl|my_center|LOCUS_08430 188681 188124 gene locus_tag LOCUS_08440 188681 188124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 190551 188935 gene locus_tag LOCUS_08450 190551 188935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 191265 190558 gene locus_tag LOCUS_08460 191265 190558 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_08460 192428 191424 gene locus_tag LOCUS_08470 gene dctP 192428 191424 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR9 protein_id gnl|my_center|LOCUS_08470 194083 192716 gene locus_tag LOCUS_08480 194083 192716 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246574.1 protein_id gnl|my_center|LOCUS_08480 195947 194178 gene locus_tag LOCUS_08490 195947 194178 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_08490 196709 196011 gene locus_tag LOCUS_08500 196709 196011 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709431.1 protein_id gnl|my_center|LOCUS_08500 197475 196837 gene locus_tag LOCUS_08510 197475 196837 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709432.1 protein_id gnl|my_center|LOCUS_08510 197632 198561 gene locus_tag LOCUS_08520 197632 198561 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U7F8 protein_id gnl|my_center|LOCUS_08520 198558 199808 gene locus_tag LOCUS_08530 198558 199808 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529090.1 protein_id gnl|my_center|LOCUS_08530 199832 200836 gene locus_tag LOCUS_08540 199832 200836 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_08540 201616 200900 gene locus_tag LOCUS_08550 201616 200900 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338738.1 protein_id gnl|my_center|LOCUS_08550 203099 201699 gene locus_tag LOCUS_08560 203099 201699 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LX2 protein_id gnl|my_center|LOCUS_08560 203960 203163 gene locus_tag LOCUS_08570 203960 203163 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969833.1 protein_id gnl|my_center|LOCUS_08570 205409 204096 gene locus_tag LOCUS_08580 gene xylA 205409 204096 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8Y0 protein_id gnl|my_center|LOCUS_08580 206860 205406 gene locus_tag LOCUS_08590 gene xylB 206860 205406 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 protein_id gnl|my_center|LOCUS_08590 207931 206909 gene locus_tag LOCUS_08600 207931 206909 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709447.1 protein_id gnl|my_center|LOCUS_08600 208205 209677 gene locus_tag LOCUS_08610 gene gltX 208205 209677 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15189 protein_id gnl|my_center|LOCUS_08610 209682 211178 gene locus_tag LOCUS_08620 gene lysS 209682 211178 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8Z1 protein_id gnl|my_center|LOCUS_08620 211975 211337 gene locus_tag LOCUS_08630 211975 211337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 213363 212074 gene locus_tag LOCUS_08640 213363 212074 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528035.1 protein_id gnl|my_center|LOCUS_08640 214304 213360 gene locus_tag LOCUS_08650 214304 213360 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706298.1 protein_id gnl|my_center|LOCUS_08650 215355 214306 gene locus_tag LOCUS_08660 215355 214306 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706299.1 protein_id gnl|my_center|LOCUS_08660 216895 215345 gene locus_tag LOCUS_08670 216895 215345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706300.1 protein_id gnl|my_center|LOCUS_08670 217932 216895 gene locus_tag LOCUS_08680 217932 216895 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706301.1 protein_id gnl|my_center|LOCUS_08680 218286 219449 gene locus_tag LOCUS_08690 gene ackA 218286 219449 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58382 protein_id gnl|my_center|LOCUS_08690 219763 219533 gene locus_tag LOCUS_08700 219763 219533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 219644 220720 gene locus_tag LOCUS_08710 219644 220720 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_08710 223856 220779 gene locus_tag LOCUS_08720 223856 220779 CDS product ACR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527921.1 protein_id gnl|my_center|LOCUS_08720 224908 223853 gene locus_tag LOCUS_08730 224908 223853 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_08730 225966 224905 gene locus_tag LOCUS_08740 225966 224905 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383346.1 protein_id gnl|my_center|LOCUS_08740 226188 226865 gene locus_tag LOCUS_08750 226188 226865 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 protein_id gnl|my_center|LOCUS_08750 226862 227818 gene locus_tag LOCUS_08760 226862 227818 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528410.1 protein_id gnl|my_center|LOCUS_08760 227983 229293 gene locus_tag LOCUS_08770 227983 229293 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528413.1 protein_id gnl|my_center|LOCUS_08770 229390 230259 gene locus_tag LOCUS_08780 229390 230259 CDS product sorbitol/mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972813.1 protein_id gnl|my_center|LOCUS_08780 230269 231093 gene locus_tag LOCUS_08790 230269 231093 CDS product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528415.1 protein_id gnl|my_center|LOCUS_08790 231112 232110 gene locus_tag LOCUS_08800 231112 232110 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528416.1 protein_id gnl|my_center|LOCUS_08800 232137 232883 gene locus_tag LOCUS_08810 232137 232883 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269242.1 protein_id gnl|my_center|LOCUS_08810 232883 234388 gene locus_tag LOCUS_08820 232883 234388 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528418.1 protein_id gnl|my_center|LOCUS_08820 235159 234395 gene locus_tag LOCUS_08830 235159 234395 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_08830 235400 236386 gene locus_tag LOCUS_08840 235400 236386 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_08840 236554 237576 gene locus_tag LOCUS_08850 236554 237576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_08850 237579 239603 gene locus_tag LOCUS_08860 237579 239603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_08860 239607 240503 gene locus_tag LOCUS_08870 239607 240503 CDS product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_08870 240500 242941 gene locus_tag LOCUS_08880 240500 242941 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_08880 243586 242954 gene locus_tag LOCUS_08890 243586 242954 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528032.1 protein_id gnl|my_center|LOCUS_08890 243688 244599 gene locus_tag LOCUS_08900 243688 244599 CDS product choline/ethanolamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 protein_id gnl|my_center|LOCUS_08900 244679 245386 gene locus_tag LOCUS_08910 244679 245386 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068413.1 protein_id gnl|my_center|LOCUS_08910 246006 245440 gene locus_tag LOCUS_08920 246006 245440 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT56 protein_id gnl|my_center|LOCUS_08920 247430 246126 gene locus_tag LOCUS_08930 247430 246126 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886797.1 protein_id gnl|my_center|LOCUS_08930 249054 247432 gene locus_tag LOCUS_08940 249054 247432 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_08940 249939 249082 gene locus_tag LOCUS_08950 249939 249082 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_08950 250808 249939 gene locus_tag LOCUS_08960 250808 249939 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 protein_id gnl|my_center|LOCUS_08960 251931 250819 gene locus_tag LOCUS_08970 gene potA 251931 250819 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXF4 protein_id gnl|my_center|LOCUS_08970 253118 252042 gene locus_tag LOCUS_08980 253118 252042 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3S6 protein_id gnl|my_center|LOCUS_08980 254829 253357 gene locus_tag LOCUS_08990 254829 253357 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813159.1 protein_id gnl|my_center|LOCUS_08990 254946 256061 gene locus_tag LOCUS_09000 254946 256061 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_09000 256151 257143 gene locus_tag LOCUS_09010 256151 257143 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 protein_id gnl|my_center|LOCUS_09010 257235 259019 gene locus_tag LOCUS_09020 257235 259019 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_09020 258998 259825 gene locus_tag LOCUS_09030 258998 259825 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBU7 protein_id gnl|my_center|LOCUS_09030 259845 261062 gene locus_tag LOCUS_09040 259845 261062 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_09040 263350 261137 gene locus_tag LOCUS_09050 gene katG 263350 261137 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRK1 protein_id gnl|my_center|LOCUS_09050 263611 264507 gene locus_tag LOCUS_09060 263611 264507 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530140.1 protein_id gnl|my_center|LOCUS_09060 266135 264522 gene locus_tag LOCUS_09070 266135 264522 CDS product thiamine pyrophosphate-requiring enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339087.1 protein_id gnl|my_center|LOCUS_09070 267744 266230 gene locus_tag LOCUS_09080 267744 266230 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_09080 268169 267741 gene locus_tag LOCUS_09090 268169 267741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 269407 268430 gene locus_tag LOCUS_09100 269407 268430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927165.1 protein_id gnl|my_center|LOCUS_09100 269571 270488 gene locus_tag LOCUS_09110 269571 270488 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 protein_id gnl|my_center|LOCUS_09110 270478 271224 gene locus_tag LOCUS_09120 270478 271224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339088.1 protein_id gnl|my_center|LOCUS_09120 271221 272360 gene locus_tag LOCUS_09130 271221 272360 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_09130 272690 272370 gene locus_tag LOCUS_09140 272690 272370 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723669.1 protein_id gnl|my_center|LOCUS_09140 273725 272712 gene locus_tag LOCUS_09150 273725 272712 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339078.1 protein_id gnl|my_center|LOCUS_09150 274911 273808 gene locus_tag LOCUS_09160 274911 273808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 275595 274915 gene locus_tag LOCUS_09170 gene ttdB 275595 274915 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_09170 276521 275559 gene locus_tag LOCUS_09180 gene ttdA 276521 275559 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 protein_id gnl|my_center|LOCUS_09180 278281 276521 gene locus_tag LOCUS_09190 gene sdhA 278281 276521 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_09190 278625 278284 gene locus_tag LOCUS_09200 278625 278284 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339082.1 protein_id gnl|my_center|LOCUS_09200 278954 278622 gene locus_tag LOCUS_09210 278954 278622 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 protein_id gnl|my_center|LOCUS_09210 279662 278955 gene locus_tag LOCUS_09220 gene frdB 279662 278955 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_09220 279862 280476 gene locus_tag LOCUS_09230 gene gst 279862 280476 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085290.1 protein_id gnl|my_center|LOCUS_09230 281904 280759 gene locus_tag LOCUS_09240 281904 280759 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706945.1 protein_id gnl|my_center|LOCUS_09240 284088 282409 gene locus_tag LOCUS_09250 284088 282409 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930276.1 protein_id gnl|my_center|LOCUS_09250 285013 284270 gene locus_tag LOCUS_09260 gene surE 285013 284270 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8H5 protein_id gnl|my_center|LOCUS_09260 286176 285025 gene locus_tag LOCUS_09270 286176 285025 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 protein_id gnl|my_center|LOCUS_09270 287249 286176 gene locus_tag LOCUS_09280 287249 286176 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529321.1 protein_id gnl|my_center|LOCUS_09280 288937 287237 gene locus_tag LOCUS_09290 288937 287237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529320.1 protein_id gnl|my_center|LOCUS_09290 290020 289034 gene locus_tag LOCUS_09300 290020 289034 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529319.1 protein_id gnl|my_center|LOCUS_09300 290251 291210 gene locus_tag LOCUS_09310 290251 291210 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529318.1 protein_id gnl|my_center|LOCUS_09310 291617 291222 gene locus_tag LOCUS_09320 291617 291222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529317.1 protein_id gnl|my_center|LOCUS_09320 292796 291807 gene locus_tag LOCUS_09330 292796 291807 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888010.1 protein_id gnl|my_center|LOCUS_09330 294128 292833 gene locus_tag LOCUS_09340 294128 292833 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067244.1 protein_id gnl|my_center|LOCUS_09340 295138 294128 gene locus_tag LOCUS_09350 295138 294128 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_09350 296139 295135 gene locus_tag LOCUS_09360 296139 295135 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529314.1 protein_id gnl|my_center|LOCUS_09360 297463 296132 gene locus_tag LOCUS_09370 297463 296132 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529313.1 protein_id gnl|my_center|LOCUS_09370 297698 299251 gene locus_tag LOCUS_09380 297698 299251 CDS product periplasmic mannitol/sorbitol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888011.1 protein_id gnl|my_center|LOCUS_09380 299287 300231 gene locus_tag LOCUS_09390 299287 300231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 300235 301080 gene locus_tag LOCUS_09400 300235 301080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888013.1 protein_id gnl|my_center|LOCUS_09400 301085 302134 gene locus_tag LOCUS_09410 301085 302134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888014.1 protein_id gnl|my_center|LOCUS_09410 302163 303119 gene locus_tag LOCUS_09420 302163 303119 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888015.1 protein_id gnl|my_center|LOCUS_09420 303391 303810 gene locus_tag LOCUS_09430 303391 303810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 303812 304408 gene locus_tag LOCUS_09440 303812 304408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529326.1 protein_id gnl|my_center|LOCUS_09440 304429 304989 gene locus_tag LOCUS_09450 304429 304989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 306198 305251 gene locus_tag LOCUS_09460 gene dppF 306198 305251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_09460 307196 306195 gene locus_tag LOCUS_09470 307196 306195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_09470 308101 307196 gene locus_tag LOCUS_09480 gene dppC 308101 307196 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706930.1 protein_id gnl|my_center|LOCUS_09480 309115 308111 gene locus_tag LOCUS_09490 gene dppB 309115 308111 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706929.1 protein_id gnl|my_center|LOCUS_09490 310765 309170 gene locus_tag LOCUS_09500 310765 309170 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723837.1 protein_id gnl|my_center|LOCUS_09500 311720 311959 gene locus_tag LOCUS_09510 311720 311959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 312610 312311 gene locus_tag LOCUS_09520 312610 312311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 313002 312703 gene locus_tag LOCUS_09530 313002 312703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 313504 313220 gene locus_tag LOCUS_09540 313504 313220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886834.1 protein_id gnl|my_center|LOCUS_09540 314037 313558 gene locus_tag LOCUS_09550 314037 313558 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886835.1 protein_id gnl|my_center|LOCUS_09550 314640 314314 gene locus_tag LOCUS_09560 314640 314314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886947.1 protein_id gnl|my_center|LOCUS_09560 315297 315629 gene locus_tag LOCUS_09570 315297 315629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09570 315697 315861 gene locus_tag LOCUS_09580 315697 315861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 317043 316009 gene locus_tag LOCUS_09590 317043 316009 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090852.1 protein_id gnl|my_center|LOCUS_09590 317528 317040 gene locus_tag LOCUS_09600 317528 317040 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256868.1 protein_id gnl|my_center|LOCUS_09600 318195 317536 gene locus_tag LOCUS_09610 318195 317536 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972948.1 protein_id gnl|my_center|LOCUS_09610 318674 318192 gene locus_tag LOCUS_09620 318674 318192 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976006.1 protein_id gnl|my_center|LOCUS_09620 319536 318979 gene locus_tag LOCUS_09630 319536 318979 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311709.1 protein_id gnl|my_center|LOCUS_09630 319919 319593 gene locus_tag LOCUS_09640 319919 319593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 321361 319970 gene locus_tag LOCUS_09650 321361 319970 CDS product metallo-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_09650 323092 321656 gene locus_tag LOCUS_09660 323092 321656 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_09660 323811 323089 gene locus_tag LOCUS_09670 323811 323089 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_09670 323980 324666 gene locus_tag LOCUS_09680 323980 324666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 324867 325253 gene locus_tag LOCUS_09690 324867 325253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_09690 325774 326637 gene locus_tag LOCUS_09700 325774 326637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972949.1 protein_id gnl|my_center|LOCUS_09700 327178 326870 gene locus_tag LOCUS_09710 327178 326870 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036968.1 protein_id gnl|my_center|LOCUS_09710 327426 328445 gene locus_tag LOCUS_09720 327426 328445 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527931.1 protein_id gnl|my_center|LOCUS_09720 328514 330022 gene locus_tag LOCUS_09730 gene rbsA1 328514 330022 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706321.1 protein_id gnl|my_center|LOCUS_09730 330019 330999 gene locus_tag LOCUS_09740 330019 330999 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974944.1 protein_id gnl|my_center|LOCUS_09740 330996 331964 gene locus_tag LOCUS_09750 330996 331964 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706323.1 protein_id gnl|my_center|LOCUS_09750 331967 332986 gene locus_tag LOCUS_09760 331967 332986 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969745.1 protein_id gnl|my_center|LOCUS_09760 333007 334260 gene locus_tag LOCUS_09770 333007 334260 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706325.1 protein_id gnl|my_center|LOCUS_09770 334324 335334 gene locus_tag LOCUS_09780 gene glmS1 334324 335334 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706190.1 protein_id gnl|my_center|LOCUS_09780 335331 336293 gene locus_tag LOCUS_09790 gene glk 335331 336293 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038066.1 protein_id gnl|my_center|LOCUS_09790 336723 336974 gene locus_tag LOCUS_09800 336723 336974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09800 337129 338523 gene locus_tag LOCUS_09810 337129 338523 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_09810 338520 338930 gene locus_tag LOCUS_09820 338520 338930 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_09820 338927 339211 gene locus_tag LOCUS_09830 338927 339211 CDS product F0F1 ATP synthase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932709.1 protein_id gnl|my_center|LOCUS_09830 339208 339507 gene locus_tag LOCUS_09840 339208 339507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 339504 340199 gene locus_tag LOCUS_09850 339504 340199 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_09850 340196 340483 gene locus_tag LOCUS_09860 gene atpE 340196 340483 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_09860 340487 341257 gene locus_tag LOCUS_09870 340487 341257 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_09870 341247 342785 gene locus_tag LOCUS_09880 gene atpA1 341247 342785 CDS product ATP synthase subunit alpha 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH05 protein_id gnl|my_center|LOCUS_09880 342769 343662 gene locus_tag LOCUS_09890 gene atpG 342769 343662 CDS product ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_09890 344106 344405 gene locus_tag LOCUS_09900 344106 344405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence03 1318 605 gene locus_tag LOCUS_09910 1318 605 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_09910 1718 1518 gene locus_tag LOCUS_09920 1718 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1608 2039 gene locus_tag LOCUS_09930 1608 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 2153 2078 gene locus_tag LOCUS_t00130 2153 2078 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2614 2414 gene locus_tag LOCUS_09940 gene yacG 2614 2414 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX7 protein_id gnl|my_center|LOCUS_09940 3239 2619 gene locus_tag LOCUS_09950 3239 2619 CDS product Maf-like protein R00615 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S22 protein_id gnl|my_center|LOCUS_09950 3478 3260 gene locus_tag LOCUS_09960 gene infA 3478 3260 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Z0 protein_id gnl|my_center|LOCUS_09960 4051 3581 gene locus_tag LOCUS_09970 4051 3581 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968705.1 protein_id gnl|my_center|LOCUS_09970 4538 4059 gene locus_tag LOCUS_09980 4538 4059 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX3 protein_id gnl|my_center|LOCUS_09980 5863 4535 gene locus_tag LOCUS_09990 gene hisD1 5863 4535 CDS product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S26 protein_id gnl|my_center|LOCUS_09990 6335 5898 gene locus_tag LOCUS_10000 6335 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968702.1 protein_id gnl|my_center|LOCUS_10000 7757 6468 gene locus_tag LOCUS_10010 gene murA 7757 6468 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFX0 protein_id gnl|my_center|LOCUS_10010 8084 7875 gene locus_tag LOCUS_10020 8084 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530202.1 protein_id gnl|my_center|LOCUS_10020 8427 8501 gene locus_tag LOCUS_t00140 8427 8501 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8826 10367 gene locus_tag LOCUS_10030 8826 10367 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808335.1 protein_id gnl|my_center|LOCUS_10030 10766 11548 gene locus_tag LOCUS_10040 10766 11548 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975064.1 protein_id gnl|my_center|LOCUS_10040 12915 11788 gene locus_tag LOCUS_10050 12915 11788 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_10050 13157 13987 gene locus_tag LOCUS_10060 13157 13987 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_10060 15029 14034 gene locus_tag LOCUS_10070 15029 14034 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_10070 16355 15138 gene locus_tag LOCUS_10080 16355 15138 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S71 protein_id gnl|my_center|LOCUS_10080 16905 16489 gene locus_tag LOCUS_10090 gene mscL 16905 16489 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHY0 protein_id gnl|my_center|LOCUS_10090 17138 20638 gene locus_tag LOCUS_10100 17138 20638 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974376.1 protein_id gnl|my_center|LOCUS_10100 21338 20682 gene locus_tag LOCUS_10110 21338 20682 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530107.1 protein_id gnl|my_center|LOCUS_10110 21978 21535 gene locus_tag LOCUS_10120 21978 21535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974374.1 protein_id gnl|my_center|LOCUS_10120 22103 22450 gene locus_tag LOCUS_10130 22103 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974373.1 protein_id gnl|my_center|LOCUS_10130 22447 23529 gene locus_tag LOCUS_10140 gene pyrD 22447 23529 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFT0 protein_id gnl|my_center|LOCUS_10140 24886 23531 gene locus_tag LOCUS_10150 gene dinF 24886 23531 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706765.1 protein_id gnl|my_center|LOCUS_10150 25016 25912 gene locus_tag LOCUS_10160 25016 25912 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 protein_id gnl|my_center|LOCUS_10160 26214 25915 gene locus_tag LOCUS_10170 26214 25915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 27859 26246 gene locus_tag LOCUS_10180 27859 26246 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_10180 28879 27863 gene locus_tag LOCUS_10190 28879 27863 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 protein_id gnl|my_center|LOCUS_10190 28978 30009 gene locus_tag LOCUS_10200 28978 30009 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968647.1 protein_id gnl|my_center|LOCUS_10200 30087 32618 gene locus_tag LOCUS_10210 30087 32618 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530127.1 protein_id gnl|my_center|LOCUS_10210 32630 33349 gene locus_tag LOCUS_10220 32630 33349 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974363.1 protein_id gnl|my_center|LOCUS_10220 34201 33395 gene locus_tag LOCUS_10230 34201 33395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 protein_id gnl|my_center|LOCUS_10230 35127 34201 gene locus_tag LOCUS_10240 35127 34201 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S85 protein_id gnl|my_center|LOCUS_10240 39174 35464 gene locus_tag LOCUS_10250 39174 35464 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706755.1 protein_id gnl|my_center|LOCUS_10250 39755 40165 gene locus_tag LOCUS_10260 39755 40165 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533661.1 protein_id gnl|my_center|LOCUS_10260 40488 42284 gene locus_tag LOCUS_10270 gene acd 40488 42284 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_10270 42353 43525 gene locus_tag LOCUS_10280 42353 43525 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_10280 43530 44183 gene locus_tag LOCUS_10290 43530 44183 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_10290 44215 45423 gene locus_tag LOCUS_10300 gene fadA 44215 45423 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706753.1 protein_id gnl|my_center|LOCUS_10300 45439 47652 gene locus_tag LOCUS_10310 gene fadB 45439 47652 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706752.1 protein_id gnl|my_center|LOCUS_10310 48515 47706 gene locus_tag LOCUS_10320 48515 47706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114629.1 protein_id gnl|my_center|LOCUS_10320 48695 49312 gene locus_tag LOCUS_10330 48695 49312 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_10330 49463 50134 gene locus_tag LOCUS_10340 gene c1 49463 50134 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970929.1 protein_id gnl|my_center|LOCUS_10340 50250 50663 gene locus_tag LOCUS_10350 50250 50663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706746.1 protein_id gnl|my_center|LOCUS_10350 50769 51614 gene locus_tag LOCUS_10360 50769 51614 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 protein_id gnl|my_center|LOCUS_10360 52399 51608 gene locus_tag LOCUS_10370 52399 51608 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533652.1 protein_id gnl|my_center|LOCUS_10370 52626 54482 gene locus_tag LOCUS_10380 52626 54482 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970924.1 protein_id gnl|my_center|LOCUS_10380 54510 54983 gene locus_tag LOCUS_10390 54510 54983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 55070 55336 gene locus_tag LOCUS_10400 55070 55336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 55333 55866 gene locus_tag LOCUS_10410 55333 55866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 56834 55863 gene locus_tag LOCUS_10420 56834 55863 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_10420 56930 57172 gene locus_tag LOCUS_10430 56930 57172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 57301 57996 gene locus_tag LOCUS_10440 57301 57996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 58279 58206 gene locus_tag LOCUS_t00150 58279 58206 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58407 59213 gene locus_tag LOCUS_10450 58407 59213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 60332 59244 gene locus_tag LOCUS_10460 gene dcd 60332 59244 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970891.1 protein_id gnl|my_center|LOCUS_10460 60536 61720 gene locus_tag LOCUS_10470 gene metZ 60536 61720 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S95 protein_id gnl|my_center|LOCUS_10470 62438 61830 gene locus_tag LOCUS_10480 62438 61830 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530164.1 protein_id gnl|my_center|LOCUS_10480 62618 63010 gene locus_tag LOCUS_10490 gene apaG 62618 63010 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S97 protein_id gnl|my_center|LOCUS_10490 63007 64464 gene locus_tag LOCUS_10500 63007 64464 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_10500 67901 64494 gene locus_tag LOCUS_10510 67901 64494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 69286 67898 gene locus_tag LOCUS_10520 69286 67898 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_10520 70464 69466 gene locus_tag LOCUS_10530 gene hslO 70464 69466 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB8 protein_id gnl|my_center|LOCUS_10530 71496 70573 gene locus_tag LOCUS_10540 gene argF 71496 70573 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI70 protein_id gnl|my_center|LOCUS_10540 72698 71511 gene locus_tag LOCUS_10550 gene argD 72698 71511 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI71 protein_id gnl|my_center|LOCUS_10550 73176 73703 gene locus_tag LOCUS_10560 73176 73703 CDS product GcrA cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530176.1 protein_id gnl|my_center|LOCUS_10560 74480 73791 gene locus_tag LOCUS_10570 gene phoB 74480 73791 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493692.1 protein_id gnl|my_center|LOCUS_10570 75226 74504 gene locus_tag LOCUS_10580 75226 74504 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q3 protein_id gnl|my_center|LOCUS_10580 76082 75273 gene locus_tag LOCUS_10590 gene pstB 76082 75273 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8C2 protein_id gnl|my_center|LOCUS_10590 77413 76103 gene locus_tag LOCUS_10600 77413 76103 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_10600 78783 77413 gene locus_tag LOCUS_10610 78783 77413 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_10610 79888 78854 gene locus_tag LOCUS_10620 79888 78854 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_10620 81329 80034 gene locus_tag LOCUS_10630 81329 80034 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974331.1 protein_id gnl|my_center|LOCUS_10630 81457 82341 gene locus_tag LOCUS_10640 81457 82341 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706729.1 protein_id gnl|my_center|LOCUS_10640 82618 84303 gene locus_tag LOCUS_10650 82618 84303 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527994.1 protein_id gnl|my_center|LOCUS_10650 84433 86091 gene locus_tag LOCUS_10660 gene pgi 84433 86091 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MI91 protein_id gnl|my_center|LOCUS_10660 87015 86092 gene locus_tag LOCUS_10670 87015 86092 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706704.1 protein_id gnl|my_center|LOCUS_10670 87757 87059 gene locus_tag LOCUS_10680 gene pyrE 87757 87059 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI98 protein_id gnl|my_center|LOCUS_10680 88894 87857 gene locus_tag LOCUS_10690 gene pyrC 88894 87857 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SC7 protein_id gnl|my_center|LOCUS_10690 89012 89800 gene locus_tag LOCUS_10700 89012 89800 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_10700 90718 89840 gene locus_tag LOCUS_10710 90718 89840 CDS product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339326.1 protein_id gnl|my_center|LOCUS_10710 90833 91945 gene locus_tag LOCUS_10720 90833 91945 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707819.1 protein_id gnl|my_center|LOCUS_10720 93276 92044 gene locus_tag LOCUS_10730 93276 92044 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976068.1 protein_id gnl|my_center|LOCUS_10730 93842 93273 gene locus_tag LOCUS_10740 gene rfbC-2 93842 93273 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707821.1 protein_id gnl|my_center|LOCUS_10740 94951 93839 gene locus_tag LOCUS_10750 gene rfbG 94951 93839 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707822.1 protein_id gnl|my_center|LOCUS_10750 95706 94936 gene locus_tag LOCUS_10760 gene rfbF 95706 94936 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_10760 96023 97591 gene locus_tag LOCUS_10770 96023 97591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968956.1 protein_id gnl|my_center|LOCUS_10770 98432 97665 gene locus_tag LOCUS_10780 98432 97665 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968952.1 protein_id gnl|my_center|LOCUS_10780 100079 98670 gene locus_tag LOCUS_10790 gene otsA 100079 98670 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZA3 protein_id gnl|my_center|LOCUS_10790 100885 100082 gene locus_tag LOCUS_10800 gene otsB 100885 100082 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SB3 protein_id gnl|my_center|LOCUS_10800 101786 101133 gene locus_tag LOCUS_10810 101786 101133 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974784.1 protein_id gnl|my_center|LOCUS_10810 102070 102936 gene locus_tag LOCUS_10820 102070 102936 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532668.1 protein_id gnl|my_center|LOCUS_10820 102964 103347 gene locus_tag LOCUS_10830 102964 103347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709643.1 protein_id gnl|my_center|LOCUS_10830 104362 103379 gene locus_tag LOCUS_10840 104362 103379 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310918.1 protein_id gnl|my_center|LOCUS_10840 104642 105526 gene locus_tag LOCUS_10850 104642 105526 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337922.1 protein_id gnl|my_center|LOCUS_10850 105759 106934 gene locus_tag LOCUS_10860 105759 106934 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083709.1 protein_id gnl|my_center|LOCUS_10860 107004 107768 gene locus_tag LOCUS_10870 107004 107768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 protein_id gnl|my_center|LOCUS_10870 107761 108483 gene locus_tag LOCUS_10880 107761 108483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083707.1 protein_id gnl|my_center|LOCUS_10880 108486 109517 gene locus_tag LOCUS_10890 108486 109517 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 protein_id gnl|my_center|LOCUS_10890 109519 110571 gene locus_tag LOCUS_10900 109519 110571 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083705.1 protein_id gnl|my_center|LOCUS_10900 110568 111347 gene locus_tag LOCUS_10910 gene ydjP 110568 111347 CDS product AB hydrolase superfamily protein YdjP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34592 protein_id gnl|my_center|LOCUS_10910 111738 111382 gene locus_tag LOCUS_10920 111738 111382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259469.1 protein_id gnl|my_center|LOCUS_10920 112094 111738 gene locus_tag LOCUS_10930 112094 111738 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259467.1 protein_id gnl|my_center|LOCUS_10930 113575 112091 gene locus_tag LOCUS_10940 113575 112091 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083800.1 protein_id gnl|my_center|LOCUS_10940 114350 113568 gene locus_tag LOCUS_10950 114350 113568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 114901 114347 gene locus_tag LOCUS_10960 gene acrR3 114901 114347 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880133.1 protein_id gnl|my_center|LOCUS_10960 116076 115087 gene locus_tag LOCUS_10970 116076 115087 CDS product N-alpha-acetyl diaminobutyric acid deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888381.1 protein_id gnl|my_center|LOCUS_10970 117270 116083 gene locus_tag LOCUS_10980 117270 116083 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 protein_id gnl|my_center|LOCUS_10980 118291 117299 gene locus_tag LOCUS_10990 gene ocd2 118291 117299 CDS product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888383.1 protein_id gnl|my_center|LOCUS_10990 119297 118293 gene locus_tag LOCUS_11000 119297 118293 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530331.1 protein_id gnl|my_center|LOCUS_11000 120091 119294 gene locus_tag LOCUS_11010 120091 119294 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975299.1 protein_id gnl|my_center|LOCUS_11010 120585 120148 gene locus_tag LOCUS_11020 gene yxiE 120585 120148 CDS product universal stress protein YxiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42297 protein_id gnl|my_center|LOCUS_11020 121881 120598 gene locus_tag LOCUS_11030 121881 120598 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_11030 122472 121894 gene locus_tag LOCUS_11040 122472 121894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 123577 122558 gene locus_tag LOCUS_11050 123577 122558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 protein_id gnl|my_center|LOCUS_11050 125409 124021 gene locus_tag LOCUS_11060 125409 124021 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530325.1 protein_id gnl|my_center|LOCUS_11060 125475 125975 gene locus_tag LOCUS_11070 125475 125975 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 protein_id gnl|my_center|LOCUS_11070 125998 127575 gene locus_tag LOCUS_11080 125998 127575 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 protein_id gnl|my_center|LOCUS_11080 127601 128971 gene locus_tag LOCUS_11090 127601 128971 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 protein_id gnl|my_center|LOCUS_11090 129281 129206 gene locus_tag LOCUS_t00160 129281 129206 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 130467 129508 gene locus_tag LOCUS_11100 130467 129508 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706727.1 protein_id gnl|my_center|LOCUS_11100 130736 131992 gene locus_tag LOCUS_11110 130736 131992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968630.1 protein_id gnl|my_center|LOCUS_11110 132712 132083 gene locus_tag LOCUS_11120 132712 132083 CDS product antioxidant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 protein_id gnl|my_center|LOCUS_11120 134496 132709 gene locus_tag LOCUS_11130 134496 132709 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_11130 135575 134691 gene locus_tag LOCUS_11140 135575 134691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_11140 136119 135679 gene locus_tag LOCUS_11150 136119 135679 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_11150 136548 136123 gene locus_tag LOCUS_11160 136548 136123 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_11160 137755 136733 gene locus_tag LOCUS_11170 137755 136733 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338472.1 protein_id gnl|my_center|LOCUS_11170 138991 137846 gene locus_tag LOCUS_11180 138991 137846 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337231.1 protein_id gnl|my_center|LOCUS_11180 139494 139048 gene locus_tag LOCUS_11190 gene aroQ2 139494 139048 CDS product 3-dehydroquinate dehydratase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GF9 protein_id gnl|my_center|LOCUS_11190 141060 139618 gene locus_tag LOCUS_11200 141060 139618 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969867.1 protein_id gnl|my_center|LOCUS_11200 141195 141773 gene locus_tag LOCUS_11210 141195 141773 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_11210 141773 143305 gene locus_tag LOCUS_11220 gene pccB 141773 143305 CDS product propionyl-CoA carboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E3 protein_id gnl|my_center|LOCUS_11220 143318 143497 gene locus_tag LOCUS_11230 143318 143497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 143534 143812 gene locus_tag LOCUS_11240 143534 143812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 143915 144310 gene locus_tag LOCUS_11250 143915 144310 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973783.1 protein_id gnl|my_center|LOCUS_11250 144642 145568 gene locus_tag LOCUS_11260 144642 145568 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_11260 145568 145945 gene locus_tag LOCUS_11270 145568 145945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973163.1 protein_id gnl|my_center|LOCUS_11270 146150 148156 gene locus_tag LOCUS_11280 146150 148156 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 protein_id gnl|my_center|LOCUS_11280 148153 150291 gene locus_tag LOCUS_11290 gene mutA 148153 150291 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973160.1 protein_id gnl|my_center|LOCUS_11290 150769 151539 gene locus_tag LOCUS_11300 150769 151539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 152623 151559 gene locus_tag LOCUS_11310 152623 151559 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338501.1 protein_id gnl|my_center|LOCUS_11310 153457 152687 gene locus_tag LOCUS_11320 gene DppF 153457 152687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338502.1 protein_id gnl|my_center|LOCUS_11320 154293 153466 gene locus_tag LOCUS_11330 gene DppD 154293 153466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338503.1 protein_id gnl|my_center|LOCUS_11330 155222 154290 gene locus_tag LOCUS_11340 gene DppC 155222 154290 CDS product cytochrome c550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338504.1 protein_id gnl|my_center|LOCUS_11340 156283 155219 gene locus_tag LOCUS_11350 gene DppB 156283 155219 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338505.1 protein_id gnl|my_center|LOCUS_11350 157879 156284 gene locus_tag LOCUS_11360 gene DdpA 157879 156284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139954.1 protein_id gnl|my_center|LOCUS_11360 159159 158155 gene locus_tag LOCUS_11370 159159 158155 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE45 protein_id gnl|my_center|LOCUS_11370 160341 159346 gene locus_tag LOCUS_11380 gene adh 160341 159346 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_11380 161081 160338 gene locus_tag LOCUS_11390 gene gno 161081 160338 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_11390 162414 161098 gene locus_tag LOCUS_11400 gene hisD1 162414 161098 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KKX2 protein_id gnl|my_center|LOCUS_11400 163755 162427 gene locus_tag LOCUS_11410 163755 162427 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384579.1 protein_id gnl|my_center|LOCUS_11410 164281 163766 gene locus_tag LOCUS_11420 164281 163766 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 protein_id gnl|my_center|LOCUS_11420 165541 164390 gene locus_tag LOCUS_11430 165541 164390 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462087.1 protein_id gnl|my_center|LOCUS_11430 165768 165538 gene locus_tag LOCUS_11440 165768 165538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 165878 166912 gene locus_tag LOCUS_11450 165878 166912 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089097.1 protein_id gnl|my_center|LOCUS_11450 170316 166921 gene locus_tag LOCUS_11460 gene dnaE2 170316 166921 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Z5 protein_id gnl|my_center|LOCUS_11460 171830 170313 gene locus_tag LOCUS_11470 171830 170313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970471.1 protein_id gnl|my_center|LOCUS_11470 172692 171814 gene locus_tag LOCUS_11480 172692 171814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709670.1 protein_id gnl|my_center|LOCUS_11480 172881 173174 gene locus_tag LOCUS_11490 172881 173174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531854.1 protein_id gnl|my_center|LOCUS_11490 173263 173658 gene locus_tag LOCUS_11500 gene lguL 173263 173658 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_11500 173733 174257 gene locus_tag LOCUS_11510 173733 174257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_11510 174273 175844 gene locus_tag LOCUS_11520 174273 175844 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_11520 177461 175935 gene locus_tag LOCUS_11530 gene garD 177461 175935 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_11530 177542 178276 gene locus_tag LOCUS_11540 177542 178276 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888143.1 protein_id gnl|my_center|LOCUS_11540 178512 179381 gene locus_tag LOCUS_11550 178512 179381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 179378 180439 gene locus_tag LOCUS_11560 gene gmd 179378 180439 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EX0 protein_id gnl|my_center|LOCUS_11560 180470 181411 gene locus_tag LOCUS_11570 gene fcl 180470 181411 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24886 protein_id gnl|my_center|LOCUS_11570 181408 182589 gene locus_tag LOCUS_11580 181408 182589 CDS product CDP-4-keto-6-deoxy-D-glucose-3-dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_11580 183290 182628 gene locus_tag LOCUS_11590 183290 182628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 184161 183295 gene locus_tag LOCUS_11600 184161 183295 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_11600 184782 184252 gene locus_tag LOCUS_11610 184782 184252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 185786 184920 gene locus_tag LOCUS_11620 185786 184920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 186625 185789 gene locus_tag LOCUS_11630 186625 185789 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528059.1 protein_id gnl|my_center|LOCUS_11630 187761 186757 gene locus_tag LOCUS_11640 187761 186757 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_11640 188528 187758 gene locus_tag LOCUS_11650 188528 187758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 191308 188900 gene locus_tag LOCUS_11660 191308 188900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 192386 191802 gene locus_tag LOCUS_11670 192386 191802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 192741 194921 gene locus_tag LOCUS_11680 192741 194921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 196637 195195 gene locus_tag LOCUS_11690 196637 195195 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709055.1 protein_id gnl|my_center|LOCUS_11690 197802 196681 gene locus_tag LOCUS_11700 197802 196681 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198292.1 protein_id gnl|my_center|LOCUS_11700 198980 197799 gene locus_tag LOCUS_11710 198980 197799 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064840.1 protein_id gnl|my_center|LOCUS_11710 199807 198995 gene locus_tag LOCUS_11720 199807 198995 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_11720 200341 199811 gene locus_tag LOCUS_11730 200341 199811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 201839 200349 gene locus_tag LOCUS_11740 gene fadD 201839 200349 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_11740 202817 201840 gene locus_tag LOCUS_11750 202817 201840 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086397.1 protein_id gnl|my_center|LOCUS_11750 203683 202814 gene locus_tag LOCUS_11760 203683 202814 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 protein_id gnl|my_center|LOCUS_11760 204965 203757 gene locus_tag LOCUS_11770 204965 203757 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764936.1 protein_id gnl|my_center|LOCUS_11770 205700 204999 gene locus_tag LOCUS_11780 205700 204999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_11780 206511 205684 gene locus_tag LOCUS_11790 206511 205684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703357.1 protein_id gnl|my_center|LOCUS_11790 207484 206840 gene locus_tag LOCUS_11800 207484 206840 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389687.1 protein_id gnl|my_center|LOCUS_11800 209690 207798 gene locus_tag LOCUS_11810 209690 207798 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706100.1 protein_id gnl|my_center|LOCUS_11810 210529 209711 gene locus_tag LOCUS_11820 210529 209711 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089654.1 protein_id gnl|my_center|LOCUS_11820 211289 210549 gene locus_tag LOCUS_11830 211289 210549 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_11830 212166 211306 gene locus_tag LOCUS_11840 212166 211306 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_11840 212961 212257 gene locus_tag LOCUS_11850 212961 212257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 214275 212995 gene locus_tag LOCUS_11860 214275 212995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 214742 214272 gene locus_tag LOCUS_11870 214742 214272 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379064.1 protein_id gnl|my_center|LOCUS_11870 215731 214745 gene locus_tag LOCUS_11880 215731 214745 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_11880 216030 216719 gene locus_tag LOCUS_11890 216030 216719 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090694.1 protein_id gnl|my_center|LOCUS_11890 217568 216816 gene locus_tag LOCUS_11900 217568 216816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085948.1 protein_id gnl|my_center|LOCUS_11900 217639 217818 gene locus_tag LOCUS_11910 217639 217818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 218079 218003 gene locus_tag LOCUS_t00170 218079 218003 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 219773 218286 gene locus_tag LOCUS_11920 219773 218286 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974298.1 protein_id gnl|my_center|LOCUS_11920 221229 219799 gene locus_tag LOCUS_11930 221229 219799 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974297.1 protein_id gnl|my_center|LOCUS_11930 222093 221284 gene locus_tag LOCUS_11940 222093 221284 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 protein_id gnl|my_center|LOCUS_11940 223074 222265 gene locus_tag LOCUS_11950 223074 222265 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_11950 223580 224029 gene locus_tag LOCUS_11960 gene rnpA 223580 224029 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIB2 protein_id gnl|my_center|LOCUS_11960 224029 225840 gene locus_tag LOCUS_11970 gene yidC 224029 225840 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5K9 protein_id gnl|my_center|LOCUS_11970 225863 226540 gene locus_tag LOCUS_11980 gene engB 225863 226540 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF47 protein_id gnl|my_center|LOCUS_11980 227068 226562 gene locus_tag LOCUS_11990 227068 226562 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706667.1 protein_id gnl|my_center|LOCUS_11990 227812 227246 gene locus_tag LOCUS_12000 227812 227246 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706666.1 protein_id gnl|my_center|LOCUS_12000 228639 227938 gene locus_tag LOCUS_12010 228639 227938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706665.1 protein_id gnl|my_center|LOCUS_12010 229175 228636 gene locus_tag LOCUS_12020 229175 228636 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706664.1 protein_id gnl|my_center|LOCUS_12020 229384 230280 gene locus_tag LOCUS_12030 gene argB 229384 230280 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDL4 protein_id gnl|my_center|LOCUS_12030 230409 230795 gene locus_tag LOCUS_12040 230409 230795 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222802.1 protein_id gnl|my_center|LOCUS_12040 230792 231220 gene locus_tag LOCUS_12050 230792 231220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719676.1 protein_id gnl|my_center|LOCUS_12050 232490 231228 gene locus_tag LOCUS_12060 232490 231228 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708962.1 protein_id gnl|my_center|LOCUS_12060 232375 232599 gene locus_tag LOCUS_12070 232375 232599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 233546 232644 gene locus_tag LOCUS_12080 233546 232644 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706660.1 protein_id gnl|my_center|LOCUS_12080 234497 233742 gene locus_tag LOCUS_12090 234497 233742 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528483.1 protein_id gnl|my_center|LOCUS_12090 234707 235414 gene locus_tag LOCUS_12100 234707 235414 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528482.1 protein_id gnl|my_center|LOCUS_12100 235544 236122 gene locus_tag LOCUS_12110 235544 236122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 237049 236195 gene locus_tag LOCUS_12120 237049 236195 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_12120 237197 238051 gene locus_tag LOCUS_12130 gene dapD 237197 238051 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF35 protein_id gnl|my_center|LOCUS_12130 238058 238438 gene locus_tag LOCUS_12140 238058 238438 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528478.1 protein_id gnl|my_center|LOCUS_12140 238502 239710 gene locus_tag LOCUS_12150 gene dapE 238502 239710 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKC4 protein_id gnl|my_center|LOCUS_12150 239713 240315 gene locus_tag LOCUS_12160 239713 240315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 240862 240392 gene locus_tag LOCUS_12170 240862 240392 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708610.1 protein_id gnl|my_center|LOCUS_12170 243357 240862 gene locus_tag LOCUS_12180 243357 240862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 244319 243561 gene locus_tag LOCUS_12190 gene truA 244319 243561 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF26 protein_id gnl|my_center|LOCUS_12190 245257 244319 gene locus_tag LOCUS_12200 gene fmt 245257 244319 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5I5 protein_id gnl|my_center|LOCUS_12200 245914 245324 gene locus_tag LOCUS_12210 gene def 245914 245324 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID1 protein_id gnl|my_center|LOCUS_12210 245960 247252 gene locus_tag LOCUS_12220 245960 247252 CDS product DNA recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528468.1 protein_id gnl|my_center|LOCUS_12220 247404 248021 gene locus_tag LOCUS_12230 247404 248021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 248058 248957 gene locus_tag LOCUS_12240 gene rbsK 248058 248957 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKC7 protein_id gnl|my_center|LOCUS_12240 249930 248992 gene locus_tag LOCUS_12250 249930 248992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706641.1 protein_id gnl|my_center|LOCUS_12250 250089 250520 gene locus_tag LOCUS_12260 gene hspH 250089 250520 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706640.1 protein_id gnl|my_center|LOCUS_12260 250576 250833 gene locus_tag LOCUS_12270 250576 250833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974262.1 protein_id gnl|my_center|LOCUS_12270 251490 251026 gene locus_tag LOCUS_12280 gene ptsN 251490 251026 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527726.1 protein_id gnl|my_center|LOCUS_12280 252189 251614 gene locus_tag LOCUS_12290 252189 251614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706605.1 protein_id gnl|my_center|LOCUS_12290 253990 252437 gene locus_tag LOCUS_12300 gene rpoN 253990 252437 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22881 protein_id gnl|my_center|LOCUS_12300 255142 254336 gene locus_tag LOCUS_12310 255142 254336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529586.1 protein_id gnl|my_center|LOCUS_12310 255693 255139 gene locus_tag LOCUS_12320 255693 255139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974232.1 protein_id gnl|my_center|LOCUS_12320 256375 255695 gene locus_tag LOCUS_12330 256375 255695 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974233.1 protein_id gnl|my_center|LOCUS_12330 256610 257578 gene locus_tag LOCUS_12340 gene sppA 256610 257578 CDS product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970827.1 protein_id gnl|my_center|LOCUS_12340 257591 257881 gene locus_tag LOCUS_12350 gene ihfB 257591 257881 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIF9 protein_id gnl|my_center|LOCUS_12350 258039 258389 gene locus_tag LOCUS_12360 258039 258389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527712.1 protein_id gnl|my_center|LOCUS_12360 258892 258596 gene locus_tag LOCUS_12370 258892 258596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 260025 259321 gene locus_tag LOCUS_12380 260025 259321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 260099 260509 gene locus_tag LOCUS_12390 260099 260509 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_12390 261154 260699 gene locus_tag LOCUS_12400 261154 260699 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974238.1 protein_id gnl|my_center|LOCUS_12400 261490 262530 gene locus_tag LOCUS_12410 261490 262530 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706614.1 protein_id gnl|my_center|LOCUS_12410 262527 263408 gene locus_tag LOCUS_12420 262527 263408 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974240.1 protein_id gnl|my_center|LOCUS_12420 263438 263899 gene locus_tag LOCUS_12430 gene lspA 263438 263899 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKD5 protein_id gnl|my_center|LOCUS_12430 264096 265100 gene locus_tag LOCUS_12440 264096 265100 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 protein_id gnl|my_center|LOCUS_12440 265474 265199 gene locus_tag LOCUS_12450 265474 265199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 265359 267485 gene locus_tag LOCUS_12460 265359 267485 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529573.1 protein_id gnl|my_center|LOCUS_12460 267602 268471 gene locus_tag LOCUS_12470 267602 268471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706618.1 protein_id gnl|my_center|LOCUS_12470 270827 268542 gene locus_tag LOCUS_12480 270827 268542 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706619.1 protein_id gnl|my_center|LOCUS_12480 270986 273736 gene locus_tag LOCUS_12490 gene mutS 270986 273736 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIF2 protein_id gnl|my_center|LOCUS_12490 273800 274333 gene locus_tag LOCUS_12500 273800 274333 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106351.1 protein_id gnl|my_center|LOCUS_12500 274527 274730 gene locus_tag LOCUS_12510 274527 274730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 274802 276241 gene locus_tag LOCUS_12520 274802 276241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 276466 277458 gene locus_tag LOCUS_12530 276466 277458 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067580.1 protein_id gnl|my_center|LOCUS_12530 278106 277471 gene locus_tag LOCUS_12540 278106 277471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534379.1 protein_id gnl|my_center|LOCUS_12540 278786 278145 gene locus_tag LOCUS_12550 gene grpE 278786 278145 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCN8 protein_id gnl|my_center|LOCUS_12550 279972 278887 gene locus_tag LOCUS_12560 gene hrcA 279972 278887 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SK1 protein_id gnl|my_center|LOCUS_12560 280181 280906 gene locus_tag LOCUS_12570 gene rph 280181 280906 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIG8 protein_id gnl|my_center|LOCUS_12570 280913 281575 gene locus_tag LOCUS_12580 280913 281575 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SK4 protein_id gnl|my_center|LOCUS_12580 281572 282777 gene locus_tag LOCUS_12590 gene hemN 281572 282777 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_12590 282890 283423 gene locus_tag LOCUS_12600 282890 283423 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_12600 285426 283486 gene locus_tag LOCUS_12610 285426 283486 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267909.1 protein_id gnl|my_center|LOCUS_12610 286015 286956 gene locus_tag LOCUS_12620 gene rsmI 286015 286956 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SN5 protein_id gnl|my_center|LOCUS_12620 286953 287321 gene locus_tag LOCUS_12630 286953 287321 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP9 protein_id gnl|my_center|LOCUS_12630 288532 287345 gene locus_tag LOCUS_12640 288532 287345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 288625 289716 gene locus_tag LOCUS_12650 288625 289716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 289883 290830 gene locus_tag LOCUS_12660 gene gshB 289883 290830 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCV6 protein_id gnl|my_center|LOCUS_12660 291105 292637 gene locus_tag LOCUS_12670 291105 292637 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710147.1 protein_id gnl|my_center|LOCUS_12670 293200 293667 gene locus_tag LOCUS_12680 293200 293667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 294708 293737 gene locus_tag LOCUS_12690 gene cysK 294708 293737 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_12690 295875 294859 gene locus_tag LOCUS_12700 295875 294859 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528049.1 protein_id gnl|my_center|LOCUS_12700 296324 295872 gene locus_tag LOCUS_12710 gene dut 296324 295872 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SM6 protein_id gnl|my_center|LOCUS_12710 296418 298061 gene locus_tag LOCUS_12720 gene prfC 296418 298061 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFE0 protein_id gnl|my_center|LOCUS_12720 298161 298799 gene locus_tag LOCUS_12730 298161 298799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 299710 300051 gene locus_tag LOCUS_12740 299710 300051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 301117 300380 gene locus_tag LOCUS_12750 301117 300380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 301605 302645 gene locus_tag LOCUS_12760 gene adh 301605 302645 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972097.1 protein_id gnl|my_center|LOCUS_12760 302756 302986 gene locus_tag LOCUS_12770 302756 302986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 304394 303006 gene locus_tag LOCUS_12780 304394 303006 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 protein_id gnl|my_center|LOCUS_12780 304535 304834 gene locus_tag LOCUS_12790 304535 304834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_12790 304831 305865 gene locus_tag LOCUS_12800 304831 305865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 305976 306527 gene locus_tag LOCUS_12810 305976 306527 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 protein_id gnl|my_center|LOCUS_12810 306535 307062 gene locus_tag LOCUS_12820 306535 307062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102722.1 protein_id gnl|my_center|LOCUS_12820 307197 307403 gene locus_tag LOCUS_12830 307197 307403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 307779 307495 gene locus_tag LOCUS_12840 307779 307495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 307666 307911 gene locus_tag LOCUS_12850 307666 307911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 307916 309787 gene locus_tag LOCUS_12860 307916 309787 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_12860 309791 309997 gene locus_tag LOCUS_12870 309791 309997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 310574 310029 gene locus_tag LOCUS_12880 310574 310029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 311661 310750 gene locus_tag LOCUS_12890 311661 310750 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_12890 311909 312112 gene locus_tag LOCUS_12900 311909 312112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 312599 312135 gene locus_tag LOCUS_12910 312599 312135 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528044.1 protein_id gnl|my_center|LOCUS_12910 312730 312945 gene locus_tag LOCUS_12920 312730 312945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 312952 313761 gene locus_tag LOCUS_12930 312952 313761 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710169.1 protein_id gnl|my_center|LOCUS_12930 315466 314873 gene locus_tag LOCUS_12940 315466 314873 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882644.1 protein_id gnl|my_center|LOCUS_12940 315924 317552 gene locus_tag LOCUS_12950 315924 317552 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence04 360 1091 gene locus_tag LOCUS_12960 360 1091 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338008.1 protein_id gnl|my_center|LOCUS_12960 1103 1900 gene locus_tag LOCUS_12970 1103 1900 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267531.1 protein_id gnl|my_center|LOCUS_12970 2516 2004 gene locus_tag LOCUS_12980 2516 2004 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529081.1 protein_id gnl|my_center|LOCUS_12980 3086 2670 gene locus_tag LOCUS_12990 3086 2670 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067665.1 protein_id gnl|my_center|LOCUS_12990 3354 3785 gene locus_tag LOCUS_13000 3354 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3722 5911 gene locus_tag LOCUS_13010 gene trpE(G) 3722 5911 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15395 protein_id gnl|my_center|LOCUS_13010 5908 6267 gene locus_tag LOCUS_13020 5908 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6273 7172 gene locus_tag LOCUS_13030 6273 7172 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529938.1 protein_id gnl|my_center|LOCUS_13030 8191 7217 gene locus_tag LOCUS_13040 8191 7217 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337349.1 protein_id gnl|my_center|LOCUS_13040 9034 8351 gene locus_tag LOCUS_13050 9034 8351 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975415.1 protein_id gnl|my_center|LOCUS_13050 9428 10366 gene locus_tag LOCUS_13060 9428 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_13060 10677 12092 gene locus_tag LOCUS_13070 10677 12092 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_13070 12276 12854 gene locus_tag LOCUS_13080 gene clpP3 12276 12854 CDS product ATP-dependent Clp protease proteolytic subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD57 protein_id gnl|my_center|LOCUS_13080 13994 12918 gene locus_tag LOCUS_13090 gene rsgA2 13994 12918 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_13090 14180 14674 gene locus_tag LOCUS_13100 14180 14674 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972320.1 protein_id gnl|my_center|LOCUS_13100 14722 15522 gene locus_tag LOCUS_13110 14722 15522 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_13110 16893 15652 gene locus_tag LOCUS_13120 16893 15652 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969784.1 protein_id gnl|my_center|LOCUS_13120 18050 16932 gene locus_tag LOCUS_13130 gene nspC 18050 16932 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG65 protein_id gnl|my_center|LOCUS_13130 19502 19209 gene locus_tag LOCUS_13140 19502 19209 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968460.1 protein_id gnl|my_center|LOCUS_13140 20280 20008 gene locus_tag LOCUS_13150 20280 20008 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529470.1 protein_id gnl|my_center|LOCUS_13150 20793 22580 gene locus_tag LOCUS_13160 20793 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 22972 24681 gene locus_tag LOCUS_13170 gene leuA 22972 24681 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFP8 protein_id gnl|my_center|LOCUS_13170 24754 25530 gene locus_tag LOCUS_13180 24754 25530 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529922.1 protein_id gnl|my_center|LOCUS_13180 25663 26445 gene locus_tag LOCUS_13190 25663 26445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 27310 26438 gene locus_tag LOCUS_13200 27310 26438 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972184.1 protein_id gnl|my_center|LOCUS_13200 27344 27907 gene locus_tag LOCUS_13210 27344 27907 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969890.1 protein_id gnl|my_center|LOCUS_13210 28110 29036 gene locus_tag LOCUS_13220 28110 29036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535323.1 protein_id gnl|my_center|LOCUS_13220 29033 29794 gene locus_tag LOCUS_13230 29033 29794 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGP9 protein_id gnl|my_center|LOCUS_13230 30886 29897 gene locus_tag LOCUS_13240 30886 29897 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708857.1 protein_id gnl|my_center|LOCUS_13240 31117 31626 gene locus_tag LOCUS_13250 31117 31626 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969886.1 protein_id gnl|my_center|LOCUS_13250 31911 33038 gene locus_tag LOCUS_13260 gene gpsA 31911 33038 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_13260 33035 33817 gene locus_tag LOCUS_13270 33035 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13270 33821 35314 gene locus_tag LOCUS_13280 33821 35314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13280 37476 35416 gene locus_tag LOCUS_13290 37476 35416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708855.1 protein_id gnl|my_center|LOCUS_13290 40282 37478 gene locus_tag LOCUS_13300 40282 37478 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976404.1 protein_id gnl|my_center|LOCUS_13300 41196 40279 gene locus_tag LOCUS_13310 41196 40279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972177.1 protein_id gnl|my_center|LOCUS_13310 42214 41201 gene locus_tag LOCUS_13320 42214 41201 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708852.1 protein_id gnl|my_center|LOCUS_13320 42434 43054 gene locus_tag LOCUS_13330 42434 43054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972175.1 protein_id gnl|my_center|LOCUS_13330 43051 43710 gene locus_tag LOCUS_13340 43051 43710 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969880.1 protein_id gnl|my_center|LOCUS_13340 43707 44957 gene locus_tag LOCUS_13350 43707 44957 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708849.1 protein_id gnl|my_center|LOCUS_13350 45169 44984 gene locus_tag LOCUS_13360 45169 44984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529972.1 protein_id gnl|my_center|LOCUS_13360 45556 46017 gene locus_tag LOCUS_13370 45556 46017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708933.1 protein_id gnl|my_center|LOCUS_13370 46980 46069 gene locus_tag LOCUS_13380 gene hemF 46980 46069 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD80 protein_id gnl|my_center|LOCUS_13380 47172 47441 gene locus_tag LOCUS_13390 47172 47441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975698.1 protein_id gnl|my_center|LOCUS_13390 47954 47481 gene locus_tag LOCUS_13400 47954 47481 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_13400 48043 48426 gene locus_tag LOCUS_13410 48043 48426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 48906 48439 gene locus_tag LOCUS_13420 gene trmL 48906 48439 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CI49 protein_id gnl|my_center|LOCUS_13420 49247 51097 gene locus_tag LOCUS_13430 49247 51097 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975693.1 protein_id gnl|my_center|LOCUS_13430 51145 53016 gene locus_tag LOCUS_13440 51145 53016 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975692.1 protein_id gnl|my_center|LOCUS_13440 53219 53797 gene locus_tag LOCUS_13450 gene fbcF 53219 53797 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE6 protein_id gnl|my_center|LOCUS_13450 53812 55113 gene locus_tag LOCUS_13460 gene fbcB 53812 55113 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDB8 protein_id gnl|my_center|LOCUS_13460 55142 55993 gene locus_tag LOCUS_13470 gene fbcC 55142 55993 CDS product ribosomal protein P2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969491.1 protein_id gnl|my_center|LOCUS_13470 56086 56628 gene locus_tag LOCUS_13480 gene apt 56086 56628 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N62 protein_id gnl|my_center|LOCUS_13480 57438 56950 gene locus_tag LOCUS_13490 57438 56950 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529990.1 protein_id gnl|my_center|LOCUS_13490 57908 57435 gene locus_tag LOCUS_13500 57908 57435 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972161.1 protein_id gnl|my_center|LOCUS_13500 58145 58351 gene locus_tag LOCUS_13510 58145 58351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_13510 59596 58493 gene locus_tag LOCUS_13520 gene ychF 59596 58493 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFM9 protein_id gnl|my_center|LOCUS_13520 59936 60364 gene locus_tag LOCUS_13530 59936 60364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 61409 60669 gene locus_tag LOCUS_13540 gene pth 61409 60669 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD97 protein_id gnl|my_center|LOCUS_13540 62087 61443 gene locus_tag LOCUS_13550 gene rplY 62087 61443 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_13550 62692 64014 gene locus_tag LOCUS_13560 62692 64014 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706992.1 protein_id gnl|my_center|LOCUS_13560 64954 64022 gene locus_tag LOCUS_13570 gene prsA 64954 64022 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFJ9 protein_id gnl|my_center|LOCUS_13570 65834 65184 gene locus_tag LOCUS_13580 65834 65184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 67087 65933 gene locus_tag LOCUS_13590 67087 65933 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532879.1 protein_id gnl|my_center|LOCUS_13590 67889 67071 gene locus_tag LOCUS_13600 67889 67071 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CI60 protein_id gnl|my_center|LOCUS_13600 69120 67993 gene locus_tag LOCUS_13610 69120 67993 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972143.1 protein_id gnl|my_center|LOCUS_13610 69950 69117 gene locus_tag LOCUS_13620 gene lgt 69950 69117 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N77 protein_id gnl|my_center|LOCUS_13620 70183 70512 gene locus_tag LOCUS_13630 70183 70512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708808.1 protein_id gnl|my_center|LOCUS_13630 70849 71349 gene locus_tag LOCUS_13640 70849 71349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532890.1 protein_id gnl|my_center|LOCUS_13640 71351 72163 gene locus_tag LOCUS_13650 gene proC 71351 72163 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N78 protein_id gnl|my_center|LOCUS_13650 72203 72544 gene locus_tag LOCUS_13660 gene csaA 72203 72544 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 protein_id gnl|my_center|LOCUS_13660 73964 72591 gene locus_tag LOCUS_13670 73964 72591 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708804.1 protein_id gnl|my_center|LOCUS_13670 74276 75355 gene locus_tag LOCUS_13680 74276 75355 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_13680 75434 76018 gene locus_tag LOCUS_13690 75434 76018 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339251.1 protein_id gnl|my_center|LOCUS_13690 76015 77433 gene locus_tag LOCUS_13700 76015 77433 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_13700 77480 78778 gene locus_tag LOCUS_13710 77480 78778 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_13710 78784 78942 gene locus_tag LOCUS_13720 78784 78942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724127.1 protein_id gnl|my_center|LOCUS_13720 79715 79008 gene locus_tag LOCUS_13730 79715 79008 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708803.1 protein_id gnl|my_center|LOCUS_13730 80239 79721 gene locus_tag LOCUS_13740 80239 79721 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976372.1 protein_id gnl|my_center|LOCUS_13740 80447 81337 gene locus_tag LOCUS_13750 80447 81337 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_13750 81548 82030 gene locus_tag LOCUS_13760 81548 82030 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532311.1 protein_id gnl|my_center|LOCUS_13760 82275 83162 gene locus_tag LOCUS_13770 82275 83162 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529072.1 protein_id gnl|my_center|LOCUS_13770 83290 83937 gene locus_tag LOCUS_13780 83290 83937 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708800.1 protein_id gnl|my_center|LOCUS_13780 84712 84209 gene locus_tag LOCUS_13790 84712 84209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 85125 84913 gene locus_tag LOCUS_13800 gene cspA 85125 84913 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494703.1 protein_id gnl|my_center|LOCUS_13800 85734 85492 gene locus_tag LOCUS_13810 85734 85492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 86234 85992 gene locus_tag LOCUS_13820 86234 85992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 87418 86534 gene locus_tag LOCUS_13830 87418 86534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976366.1 protein_id gnl|my_center|LOCUS_13830 88004 87507 gene locus_tag LOCUS_13840 88004 87507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 89261 88077 gene locus_tag LOCUS_13850 89261 88077 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708796.1 protein_id gnl|my_center|LOCUS_13850 89388 89894 gene locus_tag LOCUS_13860 89388 89894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 90138 89878 gene locus_tag LOCUS_13870 90138 89878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 91227 90277 gene locus_tag LOCUS_13880 91227 90277 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316373.1 protein_id gnl|my_center|LOCUS_13880 91416 92618 gene locus_tag LOCUS_13890 gene aatA3 91416 92618 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFH8 protein_id gnl|my_center|LOCUS_13890 93079 92675 gene locus_tag LOCUS_13900 93079 92675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_13900 94130 93210 gene locus_tag LOCUS_13910 94130 93210 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971324.1 protein_id gnl|my_center|LOCUS_13910 95125 94214 gene locus_tag LOCUS_13920 95125 94214 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310604.1 protein_id gnl|my_center|LOCUS_13920 95219 96271 gene locus_tag LOCUS_13930 95219 96271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 protein_id gnl|my_center|LOCUS_13930 97729 96833 gene locus_tag LOCUS_13940 97729 96833 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708103.1 protein_id gnl|my_center|LOCUS_13940 98758 97784 gene locus_tag LOCUS_13950 98758 97784 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8W8 protein_id gnl|my_center|LOCUS_13950 99045 99515 gene locus_tag LOCUS_13960 gene lrp 99045 99515 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56901 protein_id gnl|my_center|LOCUS_13960 100649 99555 gene locus_tag LOCUS_13970 gene lpcC 100649 99555 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972124.1 protein_id gnl|my_center|LOCUS_13970 101154 100678 gene locus_tag LOCUS_13980 gene greA 101154 100678 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8X4 protein_id gnl|my_center|LOCUS_13980 101638 102429 gene locus_tag LOCUS_13990 101638 102429 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261788.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13990 102752 102435 gene locus_tag LOCUS_14000 102752 102435 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530051.1 protein_id gnl|my_center|LOCUS_14000 102897 103445 gene locus_tag LOCUS_14010 102897 103445 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948142.1 protein_id gnl|my_center|LOCUS_14010 104842 103607 gene locus_tag LOCUS_14020 104842 103607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083004.1 protein_id gnl|my_center|LOCUS_14020 105415 104894 gene locus_tag LOCUS_14030 105415 104894 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070933.1 protein_id gnl|my_center|LOCUS_14030 105616 105422 gene locus_tag LOCUS_14040 105616 105422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 105870 105613 gene locus_tag LOCUS_14050 105870 105613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 109372 105890 gene locus_tag LOCUS_14060 gene carB 109372 105890 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PZ4 protein_id gnl|my_center|LOCUS_14060 109835 109569 gene locus_tag LOCUS_14070 109835 109569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 110035 111150 gene locus_tag LOCUS_14080 110035 111150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 111473 111156 gene locus_tag LOCUS_14090 111473 111156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 113138 111579 gene locus_tag LOCUS_14100 113138 111579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971185.1 protein_id gnl|my_center|LOCUS_14100 113282 113794 gene locus_tag LOCUS_14110 113282 113794 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971184.1 protein_id gnl|my_center|LOCUS_14110 114728 113853 gene locus_tag LOCUS_14120 114728 113853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 114864 115820 gene locus_tag LOCUS_14130 114864 115820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 115877 116791 gene locus_tag LOCUS_14140 115877 116791 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969317.1 protein_id gnl|my_center|LOCUS_14140 118195 116834 gene locus_tag LOCUS_14150 118195 116834 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_14150 118509 119897 gene locus_tag LOCUS_14160 gene norM 118509 119897 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PZ0 protein_id gnl|my_center|LOCUS_14160 120439 121281 gene locus_tag LOCUS_14170 120439 121281 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339394.1 protein_id gnl|my_center|LOCUS_14170 122638 121394 gene locus_tag LOCUS_14180 gene carA 122638 121394 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFH6 protein_id gnl|my_center|LOCUS_14180 122898 123347 gene locus_tag LOCUS_14190 122898 123347 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976357.1 protein_id gnl|my_center|LOCUS_14190 123529 123918 gene locus_tag LOCUS_14200 123529 123918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 123922 124662 gene locus_tag LOCUS_14210 123922 124662 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971087.1 protein_id gnl|my_center|LOCUS_14210 124845 126839 gene locus_tag LOCUS_14220 gene dnaG 124845 126839 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM9 protein_id gnl|my_center|LOCUS_14220 127258 129306 gene locus_tag LOCUS_14230 gene rpoD 127258 129306 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM5 protein_id gnl|my_center|LOCUS_14230 129675 129908 gene locus_tag LOCUS_14240 129675 129908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_14240 130537 129914 gene locus_tag LOCUS_14250 gene gst 130537 129914 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_14250 130723 131889 gene locus_tag LOCUS_14260 130723 131889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 135916 132086 gene locus_tag LOCUS_14270 135916 132086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 137301 137714 gene locus_tag LOCUS_14280 137301 137714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_14280 137760 138344 gene locus_tag LOCUS_14290 137760 138344 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_14290 138520 138927 gene locus_tag LOCUS_14300 138520 138927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 139765 139007 gene locus_tag LOCUS_14310 139765 139007 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976345.1 protein_id gnl|my_center|LOCUS_14310 140100 140174 gene locus_tag LOCUS_t00180 140100 140174 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 140400 141431 gene locus_tag LOCUS_14320 gene idiA 140400 141431 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_14320 142134 144824 gene locus_tag LOCUS_14330 142134 144824 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_14330 146627 144945 gene locus_tag LOCUS_14340 146627 144945 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_14340 146792 147010 gene locus_tag LOCUS_14350 146792 147010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 147096 147464 gene locus_tag LOCUS_14360 147096 147464 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976253.1 protein_id gnl|my_center|LOCUS_14360 147926 148831 gene locus_tag LOCUS_14370 147926 148831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537655.1 protein_id gnl|my_center|LOCUS_14370 150677 149013 gene locus_tag LOCUS_14380 gene ilvG 150677 149013 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969768.1 protein_id gnl|my_center|LOCUS_14380 151898 150681 gene locus_tag LOCUS_14390 151898 150681 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530920.1 protein_id gnl|my_center|LOCUS_14390 153073 152135 gene locus_tag LOCUS_14400 153073 152135 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969766.1 protein_id gnl|my_center|LOCUS_14400 153293 153523 gene locus_tag LOCUS_14410 153293 153523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528523.1 protein_id gnl|my_center|LOCUS_14410 153735 155402 gene locus_tag LOCUS_14420 153735 155402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 155507 157156 gene locus_tag LOCUS_14430 155507 157156 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969764.1 protein_id gnl|my_center|LOCUS_14430 157237 158724 gene locus_tag LOCUS_14440 157237 158724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 158733 159092 gene locus_tag LOCUS_14450 158733 159092 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 protein_id gnl|my_center|LOCUS_14450 159606 160286 gene locus_tag LOCUS_14460 159606 160286 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_14460 160719 160297 gene locus_tag LOCUS_14470 160719 160297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 160794 161015 gene locus_tag LOCUS_14480 160794 161015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 161101 161727 gene locus_tag LOCUS_14490 161101 161727 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 protein_id gnl|my_center|LOCUS_14490 161882 162895 gene locus_tag LOCUS_14500 161882 162895 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310475.1 protein_id gnl|my_center|LOCUS_14500 162897 163811 gene locus_tag LOCUS_14510 162897 163811 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF31 protein_id gnl|my_center|LOCUS_14510 165588 164323 gene locus_tag LOCUS_14520 165588 164323 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087863.1 protein_id gnl|my_center|LOCUS_14520 166555 165632 gene locus_tag LOCUS_14530 166555 165632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529170.1 protein_id gnl|my_center|LOCUS_14530 166706 167926 gene locus_tag LOCUS_14540 166706 167926 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530936.1 protein_id gnl|my_center|LOCUS_14540 168137 168616 gene locus_tag LOCUS_14550 168137 168616 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_14550 168731 168976 gene locus_tag LOCUS_14560 168731 168976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 170282 169002 gene locus_tag LOCUS_14570 gene siaM 170282 169002 CDS product sialic acid TRAP transporter large permease protein SiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR66 protein_id gnl|my_center|LOCUS_14570 170892 170326 gene locus_tag LOCUS_14580 170892 170326 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525902.1 protein_id gnl|my_center|LOCUS_14580 171943 170963 gene locus_tag LOCUS_14590 171943 170963 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972883.1 protein_id gnl|my_center|LOCUS_14590 172269 173933 gene locus_tag LOCUS_14600 172269 173933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 175103 173916 gene locus_tag LOCUS_14610 175103 173916 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976243.1 protein_id gnl|my_center|LOCUS_14610 175890 175477 gene locus_tag LOCUS_14620 175890 175477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 177320 176592 gene locus_tag LOCUS_14630 177320 176592 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976242.1 protein_id gnl|my_center|LOCUS_14630 177210 177467 gene locus_tag LOCUS_14640 177210 177467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 177752 179362 gene locus_tag LOCUS_14650 177752 179362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 183048 179422 gene locus_tag LOCUS_14660 183048 179422 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 protein_id gnl|my_center|LOCUS_14660 183229 183702 gene locus_tag LOCUS_14670 183229 183702 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706225.1 protein_id gnl|my_center|LOCUS_14670 183766 184752 gene locus_tag LOCUS_14680 183766 184752 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267240.1 protein_id gnl|my_center|LOCUS_14680 185608 184766 gene locus_tag LOCUS_14690 185608 184766 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970748.1 protein_id gnl|my_center|LOCUS_14690 185817 186521 gene locus_tag LOCUS_14700 gene djlA 185817 186521 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972066.1 protein_id gnl|my_center|LOCUS_14700 186518 187279 gene locus_tag LOCUS_14710 186518 187279 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969755.1 protein_id gnl|my_center|LOCUS_14710 187545 188057 gene locus_tag LOCUS_14720 187545 188057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 189377 188118 gene locus_tag LOCUS_14730 189377 188118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706429.1 protein_id gnl|my_center|LOCUS_14730 190974 189586 gene locus_tag LOCUS_14740 190974 189586 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_14740 191896 192132 gene locus_tag LOCUS_14750 191896 192132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 192129 192602 gene locus_tag LOCUS_14760 192129 192602 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974717.1 protein_id gnl|my_center|LOCUS_14760 193237 192686 gene locus_tag LOCUS_14770 193237 192686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 193384 194046 gene locus_tag LOCUS_14780 193384 194046 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMH9 protein_id gnl|my_center|LOCUS_14780 196344 194101 gene locus_tag LOCUS_14790 196344 194101 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 protein_id gnl|my_center|LOCUS_14790 196804 196346 gene locus_tag LOCUS_14800 196804 196346 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 protein_id gnl|my_center|LOCUS_14800 196988 197509 gene locus_tag LOCUS_14810 196988 197509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 197647 198006 gene locus_tag LOCUS_14820 197647 198006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 198144 199100 gene locus_tag LOCUS_14830 198144 199100 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_14830 199204 200958 gene locus_tag LOCUS_14840 199204 200958 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878140.1 protein_id gnl|my_center|LOCUS_14840 203570 200991 gene locus_tag LOCUS_14850 203570 200991 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_14850 204118 203567 gene locus_tag LOCUS_14860 204118 203567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 204734 205162 gene locus_tag LOCUS_14870 gene mraZ 204734 205162 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEN8 protein_id gnl|my_center|LOCUS_14870 205189 206214 gene locus_tag LOCUS_14880 gene rsmH 205189 206214 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NL4 protein_id gnl|my_center|LOCUS_14880 206218 206574 gene locus_tag LOCUS_14890 206218 206574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976219.1 protein_id gnl|my_center|LOCUS_14890 206571 208307 gene locus_tag LOCUS_14900 gene pbpB1 206571 208307 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310452.1 protein_id gnl|my_center|LOCUS_14900 208387 209856 gene locus_tag LOCUS_14910 gene murE 208387 209856 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NL6 protein_id gnl|my_center|LOCUS_14910 209853 211286 gene locus_tag LOCUS_14920 gene murF 209853 211286 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIA7 protein_id gnl|my_center|LOCUS_14920 211309 212412 gene locus_tag LOCUS_14930 gene mraY 211309 212412 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEN2 protein_id gnl|my_center|LOCUS_14930 212416 213837 gene locus_tag LOCUS_14940 gene murD 212416 213837 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52953 protein_id gnl|my_center|LOCUS_14940 213830 214984 gene locus_tag LOCUS_14950 gene ftsW 213830 214984 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529129.1 protein_id gnl|my_center|LOCUS_14950 214989 216116 gene locus_tag LOCUS_14960 gene murG 214989 216116 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM8 protein_id gnl|my_center|LOCUS_14960 216113 217543 gene locus_tag LOCUS_14970 gene murC 216113 217543 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEM8 protein_id gnl|my_center|LOCUS_14970 217540 218517 gene locus_tag LOCUS_14980 gene murB 217540 218517 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF56 protein_id gnl|my_center|LOCUS_14980 218703 219524 gene locus_tag LOCUS_14990 218703 219524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 220688 219561 gene locus_tag LOCUS_15000 220688 219561 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_15000 221104 222042 gene locus_tag LOCUS_15010 gene ddl 221104 222042 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF57 protein_id gnl|my_center|LOCUS_15010 222039 222959 gene locus_tag LOCUS_15020 gene ftsQ 222039 222959 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIB0 protein_id gnl|my_center|LOCUS_15020 222956 224284 gene locus_tag LOCUS_15030 gene ftsA 222956 224284 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEM4 protein_id gnl|my_center|LOCUS_15030 224343 226049 gene locus_tag LOCUS_15040 gene ftsZ2 224343 226049 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIB1 protein_id gnl|my_center|LOCUS_15040 226408 227295 gene locus_tag LOCUS_15050 gene lpxC 226408 227295 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXW9 protein_id gnl|my_center|LOCUS_15050 227479 228345 gene locus_tag LOCUS_15060 gene bamD 227479 228345 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM6 protein_id gnl|my_center|LOCUS_15060 228357 230030 gene locus_tag LOCUS_15070 gene recN 228357 230030 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIB2 protein_id gnl|my_center|LOCUS_15070 230703 230041 gene locus_tag LOCUS_15080 230703 230041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 230855 232960 gene locus_tag LOCUS_15090 gene ligA 230855 232960 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIB3 protein_id gnl|my_center|LOCUS_15090 233274 233462 gene locus_tag LOCUS_15100 233274 233462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 233466 234155 gene locus_tag LOCUS_15110 233466 234155 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720652.1 protein_id gnl|my_center|LOCUS_15110 234249 234998 gene locus_tag LOCUS_15120 234249 234998 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_15120 236559 235063 gene locus_tag LOCUS_15130 236559 235063 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G3 protein_id gnl|my_center|LOCUS_15130 237112 237828 gene locus_tag LOCUS_15140 237112 237828 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_15140 238238 239332 gene locus_tag LOCUS_15150 238238 239332 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_15150 240777 239386 gene locus_tag LOCUS_15160 240777 239386 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_15160 241355 240777 gene locus_tag LOCUS_15170 241355 240777 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_15170 242079 241720 gene locus_tag LOCUS_15180 242079 241720 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 protein_id gnl|my_center|LOCUS_15180 243494 242106 gene locus_tag LOCUS_15190 243494 242106 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_15190 245007 243517 gene locus_tag LOCUS_15200 245007 243517 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709512.1 protein_id gnl|my_center|LOCUS_15200 246543 245038 gene locus_tag LOCUS_15210 246543 245038 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_15210 247438 246536 gene locus_tag LOCUS_15220 247438 246536 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_15220 247935 247588 gene locus_tag LOCUS_15230 247935 247588 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528939.1 protein_id gnl|my_center|LOCUS_15230 248311 247949 gene locus_tag LOCUS_15240 248311 247949 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 protein_id gnl|my_center|LOCUS_15240 249594 248308 gene locus_tag LOCUS_15250 249594 248308 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_15250 250721 249654 gene locus_tag LOCUS_15260 250721 249654 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJZ1 protein_id gnl|my_center|LOCUS_15260 251509 250718 gene locus_tag LOCUS_15270 251509 250718 CDS product putrescine/spermidine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_15270 252365 251502 gene locus_tag LOCUS_15280 252365 251502 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_15280 253518 252469 gene locus_tag LOCUS_15290 253518 252469 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_15290 253781 254647 gene locus_tag LOCUS_15300 253781 254647 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 protein_id gnl|my_center|LOCUS_15300 254644 255939 gene locus_tag LOCUS_15310 254644 255939 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528948.1 protein_id gnl|my_center|LOCUS_15310 256567 257475 gene locus_tag LOCUS_15320 256567 257475 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_15320 257773 258492 gene locus_tag LOCUS_15330 257773 258492 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530969.1 protein_id gnl|my_center|LOCUS_15330 258489 258806 gene locus_tag LOCUS_15340 258489 258806 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972034.1 protein_id gnl|my_center|LOCUS_15340 259362 258904 gene locus_tag LOCUS_15350 259362 258904 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974537.1 protein_id gnl|my_center|LOCUS_15350 260568 259363 gene locus_tag LOCUS_15360 260568 259363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66504 protein_id gnl|my_center|LOCUS_15360 262569 260740 gene locus_tag LOCUS_15370 262569 260740 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969733.1 protein_id gnl|my_center|LOCUS_15370 262947 263120 gene locus_tag LOCUS_15380 262947 263120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 264110 263223 gene locus_tag LOCUS_15390 gene prmA 264110 263223 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEL0 protein_id gnl|my_center|LOCUS_15390 266014 264107 gene locus_tag LOCUS_15400 266014 264107 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_15400 266743 266150 gene locus_tag LOCUS_15410 gene senC 266743 266150 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708613.1 protein_id gnl|my_center|LOCUS_15410 266994 266821 gene locus_tag LOCUS_15420 266994 266821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 267229 267729 gene locus_tag LOCUS_15430 gene creA 267229 267729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969727.1 protein_id gnl|my_center|LOCUS_15430 267789 270512 gene locus_tag LOCUS_15440 267789 270512 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_15440 270638 271327 gene locus_tag LOCUS_15450 270638 271327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087949.1 protein_id gnl|my_center|LOCUS_15450 271331 271576 gene locus_tag LOCUS_15460 271331 271576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 271737 271573 gene locus_tag LOCUS_15470 271737 271573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 271882 272568 gene locus_tag LOCUS_15480 271882 272568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 274400 272604 gene locus_tag LOCUS_15490 gene ggtA 274400 272604 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_15490 274588 274950 gene locus_tag LOCUS_15500 274588 274950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 274947 275273 gene locus_tag LOCUS_15510 274947 275273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15510 275365 276150 gene locus_tag LOCUS_15520 275365 276150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 276348 277526 gene locus_tag LOCUS_15530 276348 277526 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_15530 277764 278744 gene locus_tag LOCUS_15540 277764 278744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 279550 278870 gene locus_tag LOCUS_15550 279550 278870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 282847 279803 gene locus_tag LOCUS_15560 282847 279803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 283045 286203 gene locus_tag LOCUS_15570 gene uvrB 283045 286203 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CY37 protein_id gnl|my_center|LOCUS_15570 286559 286702 gene locus_tag LOCUS_15580 286559 286702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence05 740 579 gene locus_tag LOCUS_15590 740 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1489 932 gene locus_tag LOCUS_15600 1489 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1775 2524 gene locus_tag LOCUS_15610 1775 2524 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE46 protein_id gnl|my_center|LOCUS_15610 3222 2509 gene locus_tag LOCUS_15620 gene trmD 3222 2509 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE45 protein_id gnl|my_center|LOCUS_15620 3806 3219 gene locus_tag LOCUS_15630 gene rimM 3806 3219 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBZ8 protein_id gnl|my_center|LOCUS_15630 4761 3976 gene locus_tag LOCUS_15640 4761 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5399 4989 gene locus_tag LOCUS_15650 5399 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5781 5479 gene locus_tag LOCUS_15660 gene tyrA 5781 5479 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310875.1 protein_id gnl|my_center|LOCUS_15660 7381 5792 gene locus_tag LOCUS_15670 gene ffh 7381 5792 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THW2 protein_id gnl|my_center|LOCUS_15670 9112 7784 gene locus_tag LOCUS_15680 9112 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 10159 9470 gene locus_tag LOCUS_15690 10159 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 10619 11254 gene locus_tag LOCUS_15700 10619 11254 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209942.1 protein_id gnl|my_center|LOCUS_15700 13047 11281 gene locus_tag LOCUS_15710 13047 11281 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_15710 13769 13341 gene locus_tag LOCUS_15720 13769 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 13975 14778 gene locus_tag LOCUS_15730 gene oxa 13975 14778 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C757 protein_id gnl|my_center|LOCUS_15730 14833 15912 gene locus_tag LOCUS_15740 14833 15912 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972496.1 protein_id gnl|my_center|LOCUS_15740 15984 16871 gene locus_tag LOCUS_15750 gene dapF 15984 16871 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L46 protein_id gnl|my_center|LOCUS_15750 16868 18178 gene locus_tag LOCUS_15760 16868 18178 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972494.1 protein_id gnl|my_center|LOCUS_15760 18202 19713 gene locus_tag LOCUS_15770 gene ftsY 18202 19713 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE37 protein_id gnl|my_center|LOCUS_15770 19710 20423 gene locus_tag LOCUS_15780 19710 20423 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIU7 protein_id gnl|my_center|LOCUS_15780 20568 21710 gene locus_tag LOCUS_15790 20568 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 22753 21878 gene locus_tag LOCUS_15800 22753 21878 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972680.1 protein_id gnl|my_center|LOCUS_15800 23226 22750 gene locus_tag LOCUS_15810 23226 22750 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384079.1 protein_id gnl|my_center|LOCUS_15810 23564 23223 gene locus_tag LOCUS_15820 23564 23223 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972681.1 protein_id gnl|my_center|LOCUS_15820 23710 24738 gene locus_tag LOCUS_15830 23710 24738 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_15830 25334 24807 gene locus_tag LOCUS_15840 25334 24807 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_15840 26013 25402 gene locus_tag LOCUS_15850 26013 25402 CDS product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709715.1 protein_id gnl|my_center|LOCUS_15850 26180 26010 gene locus_tag LOCUS_15860 gene ccmD 26180 26010 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L52 protein_id gnl|my_center|LOCUS_15860 26950 26180 gene locus_tag LOCUS_15870 gene ccmC 26950 26180 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709716.1 protein_id gnl|my_center|LOCUS_15870 27657 26995 gene locus_tag LOCUS_15880 gene ccmB 27657 26995 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAH6 protein_id gnl|my_center|LOCUS_15880 28304 27654 gene locus_tag LOCUS_15890 gene ccmA 28304 27654 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L55 protein_id gnl|my_center|LOCUS_15890 28588 31284 gene locus_tag LOCUS_15900 gene acnA 28588 31284 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAH8 protein_id gnl|my_center|LOCUS_15900 31443 32201 gene locus_tag LOCUS_15910 31443 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970510.1 protein_id gnl|my_center|LOCUS_15910 32633 33022 gene locus_tag LOCUS_15920 32633 33022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970509.1 protein_id gnl|my_center|LOCUS_15920 33604 33053 gene locus_tag LOCUS_15930 33604 33053 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970506.1 protein_id gnl|my_center|LOCUS_15930 34573 33719 gene locus_tag LOCUS_15940 34573 33719 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310857.1 protein_id gnl|my_center|LOCUS_15940 37238 34677 gene locus_tag LOCUS_15950 37238 34677 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970504.1 protein_id gnl|my_center|LOCUS_15950 37957 37238 gene locus_tag LOCUS_15960 37957 37238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970503.1 protein_id gnl|my_center|LOCUS_15960 38057 38698 gene locus_tag LOCUS_15970 38057 38698 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 protein_id gnl|my_center|LOCUS_15970 38734 39384 gene locus_tag LOCUS_15980 gene ligT 38734 39384 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWH9 protein_id gnl|my_center|LOCUS_15980 39833 39312 gene locus_tag LOCUS_15990 39833 39312 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_15990 39864 40169 gene locus_tag LOCUS_16000 39864 40169 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX7 protein_id gnl|my_center|LOCUS_16000 40244 40675 gene locus_tag LOCUS_16010 40244 40675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 41268 40693 gene locus_tag LOCUS_16020 41268 40693 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_16020 41562 42065 gene locus_tag LOCUS_16030 41562 42065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709731.1 protein_id gnl|my_center|LOCUS_16030 42192 42767 gene locus_tag LOCUS_16040 42192 42767 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083430.1 protein_id gnl|my_center|LOCUS_16040 43444 42800 gene locus_tag LOCUS_16050 43444 42800 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528368.1 protein_id gnl|my_center|LOCUS_16050 43896 45131 gene locus_tag LOCUS_16060 gene rlmN 43896 45131 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAJ1 protein_id gnl|my_center|LOCUS_16060 45141 45623 gene locus_tag LOCUS_16070 45141 45623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 46284 45643 gene locus_tag LOCUS_16080 46284 45643 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528810.1 protein_id gnl|my_center|LOCUS_16080 46829 46353 gene locus_tag LOCUS_16090 46829 46353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 47051 46830 gene locus_tag LOCUS_16100 47051 46830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 48084 47230 gene locus_tag LOCUS_16110 48084 47230 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525644.1 protein_id gnl|my_center|LOCUS_16110 48291 49520 gene locus_tag LOCUS_16120 48291 49520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 49664 51715 gene locus_tag LOCUS_16130 49664 51715 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709793.1 protein_id gnl|my_center|LOCUS_16130 52134 53960 gene locus_tag LOCUS_16140 52134 53960 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067186.1 protein_id gnl|my_center|LOCUS_16140 53962 54609 gene locus_tag LOCUS_16150 53962 54609 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_16150 54761 55267 gene locus_tag LOCUS_16160 54761 55267 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972474.1 protein_id gnl|my_center|LOCUS_16160 55466 55999 gene locus_tag LOCUS_16170 gene ppa 55466 55999 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LH1 protein_id gnl|my_center|LOCUS_16170 56282 56004 gene locus_tag LOCUS_16180 56282 56004 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKX3 protein_id gnl|my_center|LOCUS_16180 56608 56318 gene locus_tag LOCUS_16190 56608 56318 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 protein_id gnl|my_center|LOCUS_16190 56886 58187 gene locus_tag LOCUS_16200 56886 58187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_16200 58694 58218 gene locus_tag LOCUS_16210 58694 58218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528912.1 protein_id gnl|my_center|LOCUS_16210 60577 58718 gene locus_tag LOCUS_16220 60577 58718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 62048 60588 gene locus_tag LOCUS_16230 62048 60588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972468.1 protein_id gnl|my_center|LOCUS_16230 62819 62139 gene locus_tag LOCUS_16240 62819 62139 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083395.1 protein_id gnl|my_center|LOCUS_16240 63837 62914 gene locus_tag LOCUS_16250 gene hemC 63837 62914 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC46 protein_id gnl|my_center|LOCUS_16250 63929 65026 gene locus_tag LOCUS_16260 gene tsaD 63929 65026 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF2 protein_id gnl|my_center|LOCUS_16260 65147 65440 gene locus_tag LOCUS_16270 65147 65440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972463.1 protein_id gnl|my_center|LOCUS_16270 65443 65880 gene locus_tag LOCUS_16280 65443 65880 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972462.1 protein_id gnl|my_center|LOCUS_16280 65903 66550 gene locus_tag LOCUS_16290 65903 66550 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970388.1 protein_id gnl|my_center|LOCUS_16290 66629 67039 gene locus_tag LOCUS_16300 66629 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 protein_id gnl|my_center|LOCUS_16300 67556 67065 gene locus_tag LOCUS_16310 67556 67065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709629.1 protein_id gnl|my_center|LOCUS_16310 67792 68475 gene locus_tag LOCUS_16320 67792 68475 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528898.1 protein_id gnl|my_center|LOCUS_16320 68509 68967 gene locus_tag LOCUS_16330 68509 68967 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709631.1 protein_id gnl|my_center|LOCUS_16330 69864 69052 gene locus_tag LOCUS_16340 69864 69052 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067261.1 protein_id gnl|my_center|LOCUS_16340 70776 70096 gene locus_tag LOCUS_16350 70776 70096 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDZ9 protein_id gnl|my_center|LOCUS_16350 73499 70860 gene locus_tag LOCUS_16360 gene ftsK2 73499 70860 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709634.1 protein_id gnl|my_center|LOCUS_16360 75025 73670 gene locus_tag LOCUS_16370 75025 73670 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDZ7 protein_id gnl|my_center|LOCUS_16370 75383 75045 gene locus_tag LOCUS_16380 gene glnK 75383 75045 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004444057.1 protein_id gnl|my_center|LOCUS_16380 75443 75703 gene locus_tag LOCUS_16390 75443 75703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 77083 75737 gene locus_tag LOCUS_16400 gene amt-2 77083 75737 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_16400 77441 77103 gene locus_tag LOCUS_16410 77441 77103 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709636.1 protein_id gnl|my_center|LOCUS_16410 78549 77671 gene locus_tag LOCUS_16420 gene tesB 78549 77671 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 protein_id gnl|my_center|LOCUS_16420 78701 79933 gene locus_tag LOCUS_16430 78701 79933 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970481.1 protein_id gnl|my_center|LOCUS_16430 80543 79971 gene locus_tag LOCUS_16440 80543 79971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 80869 80657 gene locus_tag LOCUS_16450 80869 80657 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Z9 protein_id gnl|my_center|LOCUS_16450 81559 80882 gene locus_tag LOCUS_16460 81559 80882 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709673.1 protein_id gnl|my_center|LOCUS_16460 82642 81641 gene locus_tag LOCUS_16470 82642 81641 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709674.1 protein_id gnl|my_center|LOCUS_16470 83189 82692 gene locus_tag LOCUS_16480 83189 82692 CDS product prolyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973263.1 protein_id gnl|my_center|LOCUS_16480 83514 83588 gene locus_tag LOCUS_t00190 83514 83588 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 83869 84291 gene locus_tag LOCUS_16490 83869 84291 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310993.1 protein_id gnl|my_center|LOCUS_16490 85485 84322 gene locus_tag LOCUS_16500 gene celE 85485 84322 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_16500 85688 85482 gene locus_tag LOCUS_16510 85688 85482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505258.1 protein_id gnl|my_center|LOCUS_16510 86614 85685 gene locus_tag LOCUS_16520 86614 85685 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067234.1 protein_id gnl|my_center|LOCUS_16520 86758 86991 gene locus_tag LOCUS_16530 86758 86991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 87104 87754 gene locus_tag LOCUS_16540 gene leuD 87104 87754 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9W6 protein_id gnl|my_center|LOCUS_16540 87832 88086 gene locus_tag LOCUS_16550 gene nodF 87832 88086 CDS product nodulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06232 protein_id gnl|my_center|LOCUS_16550 88089 89300 gene locus_tag LOCUS_16560 88089 89300 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528392.1 protein_id gnl|my_center|LOCUS_16560 90332 89349 gene locus_tag LOCUS_16570 90332 89349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 90432 91535 gene locus_tag LOCUS_16580 gene leuB 90432 91535 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THV1 protein_id gnl|my_center|LOCUS_16580 92042 91608 gene locus_tag LOCUS_16590 92042 91608 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550324.1 protein_id gnl|my_center|LOCUS_16590 92172 93029 gene locus_tag LOCUS_16600 92172 93029 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706210.1 protein_id gnl|my_center|LOCUS_16600 93228 94259 gene locus_tag LOCUS_16610 gene asd 93228 94259 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AEN7 protein_id gnl|my_center|LOCUS_16610 94400 95218 gene locus_tag LOCUS_16620 94400 95218 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709800.1 protein_id gnl|my_center|LOCUS_16620 95737 95315 gene locus_tag LOCUS_16630 95737 95315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 96467 95817 gene locus_tag LOCUS_16640 96467 95817 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAR1 protein_id gnl|my_center|LOCUS_16640 97399 96653 gene locus_tag LOCUS_16650 97399 96653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 protein_id gnl|my_center|LOCUS_16650 98289 97396 gene locus_tag LOCUS_16660 98289 97396 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKY5 protein_id gnl|my_center|LOCUS_16660 98528 98286 gene locus_tag LOCUS_16670 98528 98286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528991.1 protein_id gnl|my_center|LOCUS_16670 98916 103706 gene locus_tag LOCUS_16680 98916 103706 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709803.1 protein_id gnl|my_center|LOCUS_16680 103745 105151 gene locus_tag LOCUS_16690 103745 105151 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529010.1 protein_id gnl|my_center|LOCUS_16690 106893 105280 gene locus_tag LOCUS_16700 gene purH 106893 105280 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL06 protein_id gnl|my_center|LOCUS_16700 108596 107046 gene locus_tag LOCUS_16710 108596 107046 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067395.1 protein_id gnl|my_center|LOCUS_16710 110323 108938 gene locus_tag LOCUS_16720 110323 108938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709807.1 protein_id gnl|my_center|LOCUS_16720 111249 110320 gene locus_tag LOCUS_16730 gene htpX 111249 110320 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAR8 protein_id gnl|my_center|LOCUS_16730 111384 111659 gene locus_tag LOCUS_16740 111384 111659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 111709 112176 gene locus_tag LOCUS_16750 111709 112176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 113117 112332 gene locus_tag LOCUS_16760 113117 112332 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_16760 115183 113273 gene locus_tag LOCUS_16770 115183 113273 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970577.1 protein_id gnl|my_center|LOCUS_16770 115985 115326 gene locus_tag LOCUS_16780 115985 115326 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 protein_id gnl|my_center|LOCUS_16780 116206 118818 gene locus_tag LOCUS_16790 gene leuS 116206 118818 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KW8 protein_id gnl|my_center|LOCUS_16790 118805 119308 gene locus_tag LOCUS_16800 118805 119308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970580.1 protein_id gnl|my_center|LOCUS_16800 119404 120432 gene locus_tag LOCUS_16810 119404 120432 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310932.1 protein_id gnl|my_center|LOCUS_16810 121452 120556 gene locus_tag LOCUS_16820 gene parB 121452 120556 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970582.1 protein_id gnl|my_center|LOCUS_16820 122281 121487 gene locus_tag LOCUS_16830 122281 121487 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709820.1 protein_id gnl|my_center|LOCUS_16830 122948 122298 gene locus_tag LOCUS_16840 gene rsmG 122948 122298 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KW3 protein_id gnl|my_center|LOCUS_16840 124816 122945 gene locus_tag LOCUS_16850 gene mnmG 124816 122945 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEE8 protein_id gnl|my_center|LOCUS_16850 126036 124981 gene locus_tag LOCUS_16860 gene mnmE 126036 124981 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHB2 protein_id gnl|my_center|LOCUS_16860 126061 126279 gene locus_tag LOCUS_16870 126061 126279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 127615 126350 gene locus_tag LOCUS_16880 gene rho 127615 126350 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KW0 protein_id gnl|my_center|LOCUS_16880 128355 127810 gene locus_tag LOCUS_16890 128355 127810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972600.1 protein_id gnl|my_center|LOCUS_16890 129392 128352 gene locus_tag LOCUS_16900 gene hemE 129392 128352 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB70 protein_id gnl|my_center|LOCUS_16900 129768 130589 gene locus_tag LOCUS_16910 129768 130589 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TF2 protein_id gnl|my_center|LOCUS_16910 130628 131221 gene locus_tag LOCUS_16920 130628 131221 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU7 protein_id gnl|my_center|LOCUS_16920 131214 132071 gene locus_tag LOCUS_16930 gene aroE 131214 132071 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB73 protein_id gnl|my_center|LOCUS_16930 132068 132664 gene locus_tag LOCUS_16940 gene coaE 132068 132664 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEF6 protein_id gnl|my_center|LOCUS_16940 132669 133364 gene locus_tag LOCUS_16950 132669 133364 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067418.1 protein_id gnl|my_center|LOCUS_16950 134133 133621 gene locus_tag LOCUS_16960 gene secB 134133 133621 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB76 protein_id gnl|my_center|LOCUS_16960 134772 134236 gene locus_tag LOCUS_16970 134772 134236 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 protein_id gnl|my_center|LOCUS_16970 134903 135607 gene locus_tag LOCUS_16980 134903 135607 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709834.1 protein_id gnl|my_center|LOCUS_16980 135607 136728 gene locus_tag LOCUS_16990 135607 136728 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067422.1 protein_id gnl|my_center|LOCUS_16990 136718 137269 gene locus_tag LOCUS_17000 136718 137269 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970599.1 protein_id gnl|my_center|LOCUS_17000 137266 137685 gene locus_tag LOCUS_17010 137266 137685 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311080.1 protein_id gnl|my_center|LOCUS_17010 138708 137719 gene locus_tag LOCUS_17020 138708 137719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528356.1 protein_id gnl|my_center|LOCUS_17020 140103 138796 gene locus_tag LOCUS_17030 gene hslU 140103 138796 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ87 protein_id gnl|my_center|LOCUS_17030 141277 140111 gene locus_tag LOCUS_17040 141277 140111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 141962 141402 gene locus_tag LOCUS_17050 gene hslV 141962 141402 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBC6 protein_id gnl|my_center|LOCUS_17050 142163 142771 gene locus_tag LOCUS_17060 gene hisB 142163 142771 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TB0 protein_id gnl|my_center|LOCUS_17060 142809 143291 gene locus_tag LOCUS_17070 142809 143291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972624.1 protein_id gnl|my_center|LOCUS_17070 143297 143947 gene locus_tag LOCUS_17080 gene hisH 143297 143947 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBC3 protein_id gnl|my_center|LOCUS_17080 143949 144719 gene locus_tag LOCUS_17090 gene hisA 143949 144719 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG7 protein_id gnl|my_center|LOCUS_17090 144716 145492 gene locus_tag LOCUS_17100 gene hisF 144716 145492 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58799 protein_id gnl|my_center|LOCUS_17100 145528 145851 gene locus_tag LOCUS_17110 gene hisE 145528 145851 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TB4 protein_id gnl|my_center|LOCUS_17110 145854 146840 gene locus_tag LOCUS_17120 gene coaA 145854 146840 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ92 protein_id gnl|my_center|LOCUS_17120 147476 146868 gene locus_tag LOCUS_17130 gene alkB 147476 146868 CDS product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968316.1 protein_id gnl|my_center|LOCUS_17130 148019 147504 gene locus_tag LOCUS_17140 148019 147504 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528340.1 protein_id gnl|my_center|LOCUS_17140 148534 148100 gene locus_tag LOCUS_17150 148534 148100 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067459.1 protein_id gnl|my_center|LOCUS_17150 149208 148531 gene locus_tag LOCUS_17160 149208 148531 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_17160 150950 149310 gene locus_tag LOCUS_17170 gene pckA 150950 149310 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ94 protein_id gnl|my_center|LOCUS_17170 151280 151993 gene locus_tag LOCUS_17180 gene chvI 151280 151993 CDS product transcriptional regulatory protein ChvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50350 protein_id gnl|my_center|LOCUS_17180 152038 153822 gene locus_tag LOCUS_17190 152038 153822 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067456.1 protein_id gnl|my_center|LOCUS_17190 153819 154289 gene locus_tag LOCUS_17200 153819 154289 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532002.1 protein_id gnl|my_center|LOCUS_17200 154445 154846 gene locus_tag LOCUS_17210 154445 154846 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_17210 154861 155130 gene locus_tag LOCUS_17220 gene ptsH 154861 155130 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 protein_id gnl|my_center|LOCUS_17220 155249 156646 gene locus_tag LOCUS_17230 gene ahcY 155249 156646 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C7 protein_id gnl|my_center|LOCUS_17230 156949 159375 gene locus_tag LOCUS_17240 156949 159375 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968312.1 protein_id gnl|my_center|LOCUS_17240 159381 160889 gene locus_tag LOCUS_17250 159381 160889 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968311.1 protein_id gnl|my_center|LOCUS_17250 160907 161662 gene locus_tag LOCUS_17260 160907 161662 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968310.1 protein_id gnl|my_center|LOCUS_17260 161659 164877 gene locus_tag LOCUS_17270 161659 164877 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970610.1 protein_id gnl|my_center|LOCUS_17270 164870 168427 gene locus_tag LOCUS_17280 164870 168427 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709860.1 protein_id gnl|my_center|LOCUS_17280 168539 168859 gene locus_tag LOCUS_17290 gene trxA 168539 168859 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D2B9 protein_id gnl|my_center|LOCUS_17290 170338 169013 gene locus_tag LOCUS_17300 gene folC 170338 169013 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968306.1 protein_id gnl|my_center|LOCUS_17300 171314 170388 gene locus_tag LOCUS_17310 gene accD 171314 170388 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEI3 protein_id gnl|my_center|LOCUS_17310 172190 171351 gene locus_tag LOCUS_17320 gene trpA 172190 171351 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBE0 protein_id gnl|my_center|LOCUS_17320 172898 172191 gene locus_tag LOCUS_17330 172898 172191 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_17330 174121 172901 gene locus_tag LOCUS_17340 gene trpB 174121 172901 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEI1 protein_id gnl|my_center|LOCUS_17340 174806 174123 gene locus_tag LOCUS_17350 gene trpF 174806 174123 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB98 protein_id gnl|my_center|LOCUS_17350 175658 174912 gene locus_tag LOCUS_17360 175658 174912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067440.1 protein_id gnl|my_center|LOCUS_17360 176207 175773 gene locus_tag LOCUS_17370 176207 175773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528315.1 protein_id gnl|my_center|LOCUS_17370 177653 176370 gene locus_tag LOCUS_17380 177653 176370 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_17380 178013 179212 gene locus_tag LOCUS_17390 178013 179212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 179389 181173 gene locus_tag LOCUS_17400 gene ilvB2 179389 181173 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331273.1 protein_id gnl|my_center|LOCUS_17400 182696 181224 gene locus_tag LOCUS_17410 182696 181224 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 protein_id gnl|my_center|LOCUS_17410 184212 182830 gene locus_tag LOCUS_17420 gene yhxA 184212 182830 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 protein_id gnl|my_center|LOCUS_17420 184552 185550 gene locus_tag LOCUS_17430 gene tauA 184552 185550 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975809.1 protein_id gnl|my_center|LOCUS_17430 185636 186442 gene locus_tag LOCUS_17440 gene tauB 185636 186442 CDS product Taurine import ATP-binding protein TauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UX0 protein_id gnl|my_center|LOCUS_17440 186439 187707 gene locus_tag LOCUS_17450 186439 187707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 190223 187791 gene locus_tag LOCUS_17460 gene gyrB 190223 187791 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE4 protein_id gnl|my_center|LOCUS_17460 190431 191825 gene locus_tag LOCUS_17470 190431 191825 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709886.1 protein_id gnl|my_center|LOCUS_17470 191961 193964 gene locus_tag LOCUS_17480 191961 193964 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709887.1 protein_id gnl|my_center|LOCUS_17480 194188 196344 gene locus_tag LOCUS_17490 gene glcB 194188 196344 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ85 protein_id gnl|my_center|LOCUS_17490 197084 196437 gene locus_tag LOCUS_17500 197084 196437 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709889.1 protein_id gnl|my_center|LOCUS_17500 197292 197762 gene locus_tag LOCUS_17510 197292 197762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709890.1 protein_id gnl|my_center|LOCUS_17510 198408 197839 gene locus_tag LOCUS_17520 198408 197839 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709891.1 protein_id gnl|my_center|LOCUS_17520 199724 198471 gene locus_tag LOCUS_17530 gene actS 199724 198471 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968329.1 protein_id gnl|my_center|LOCUS_17530 202405 199940 gene locus_tag LOCUS_17540 gene hrpB 202405 199940 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970628.1 protein_id gnl|my_center|LOCUS_17540 205778 202836 gene locus_tag LOCUS_17550 gene polA 205778 202836 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709984.1 protein_id gnl|my_center|LOCUS_17550 206131 205847 gene locus_tag LOCUS_17560 206131 205847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 206684 208075 gene locus_tag LOCUS_17570 206684 208075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067585.1 protein_id gnl|my_center|LOCUS_17570 208501 210495 gene locus_tag LOCUS_17580 208501 210495 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968409.1 protein_id gnl|my_center|LOCUS_17580 210748 212661 gene locus_tag LOCUS_17590 gene dnaK 210748 212661 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC06 protein_id gnl|my_center|LOCUS_17590 212886 214001 gene locus_tag LOCUS_17600 212886 214001 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_17600 214194 215333 gene locus_tag LOCUS_17610 gene dnaJ 214194 215333 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_17610 215445 216035 gene locus_tag LOCUS_17620 215445 216035 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067737.1 protein_id gnl|my_center|LOCUS_17620 216214 216795 gene locus_tag LOCUS_17630 216214 216795 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_17630 216865 217596 gene locus_tag LOCUS_17640 gene pyrF 216865 217596 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCU3 protein_id gnl|my_center|LOCUS_17640 217608 217901 gene locus_tag LOCUS_17650 217608 217901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529780.1 protein_id gnl|my_center|LOCUS_17650 218043 219023 gene locus_tag LOCUS_17660 218043 219023 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067733.1 protein_id gnl|my_center|LOCUS_17660 219086 219805 gene locus_tag LOCUS_17670 219086 219805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 221007 220204 gene locus_tag LOCUS_17680 gene uppP1 221007 220204 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58740 protein_id gnl|my_center|LOCUS_17680 221197 221889 gene locus_tag LOCUS_17690 221197 221889 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067730.1 protein_id gnl|my_center|LOCUS_17690 221894 223078 gene locus_tag LOCUS_17700 gene queG 221894 223078 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_17700 223124 223996 gene locus_tag LOCUS_17710 223124 223996 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968506.1 protein_id gnl|my_center|LOCUS_17710 224136 224483 gene locus_tag LOCUS_17720 224136 224483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529787.1 protein_id gnl|my_center|LOCUS_17720 224547 225890 gene locus_tag LOCUS_17730 224547 225890 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_17730 225891 227381 gene locus_tag LOCUS_17740 225891 227381 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_17740 227452 228402 gene locus_tag LOCUS_17750 227452 228402 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_17750 228399 229262 gene locus_tag LOCUS_17760 228399 229262 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_17760 229259 230869 gene locus_tag LOCUS_17770 229259 230869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531215.1 protein_id gnl|my_center|LOCUS_17770 230890 232356 gene locus_tag LOCUS_17780 230890 232356 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_17780 232377 233123 gene locus_tag LOCUS_17790 232377 233123 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533144.1 protein_id gnl|my_center|LOCUS_17790 233301 234593 gene locus_tag LOCUS_17800 gene sun 233301 234593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970797.1 protein_id gnl|my_center|LOCUS_17800 234665 235129 gene locus_tag LOCUS_17810 gene tspO 234665 235129 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970792.1 protein_id gnl|my_center|LOCUS_17810 235205 235654 gene locus_tag LOCUS_17820 235205 235654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968499.1 protein_id gnl|my_center|LOCUS_17820 235651 236283 gene locus_tag LOCUS_17830 235651 236283 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710118.1 protein_id gnl|my_center|LOCUS_17830 236293 237864 gene locus_tag LOCUS_17840 gene guaA 236293 237864 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIL2 protein_id gnl|my_center|LOCUS_17840 238360 237950 gene locus_tag LOCUS_17850 238360 237950 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708295.1 protein_id gnl|my_center|LOCUS_17850 239229 238357 gene locus_tag LOCUS_17860 239229 238357 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708296.1 protein_id gnl|my_center|LOCUS_17860 239989 239201 gene locus_tag LOCUS_17870 gene znuC 239989 239201 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UF79 protein_id gnl|my_center|LOCUS_17870 240193 241206 gene locus_tag LOCUS_17880 gene znuA 240193 241206 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969557.1 protein_id gnl|my_center|LOCUS_17880 241450 241797 gene locus_tag LOCUS_17890 241450 241797 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_17890 241909 242283 gene locus_tag LOCUS_17900 241909 242283 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SR0 protein_id gnl|my_center|LOCUS_17900 243949 242363 gene locus_tag LOCUS_17910 gene xseA 243949 242363 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIM4 protein_id gnl|my_center|LOCUS_17910 244127 245734 gene locus_tag LOCUS_17920 244127 245734 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 protein_id gnl|my_center|LOCUS_17920 245806 246864 gene locus_tag LOCUS_17930 245806 246864 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529941.1 protein_id gnl|my_center|LOCUS_17930 247012 248046 gene locus_tag LOCUS_17940 247012 248046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_17940 248970 248059 gene locus_tag LOCUS_17950 248970 248059 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_17950 249721 248975 gene locus_tag LOCUS_17960 249721 248975 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_17960 252558 249718 gene locus_tag LOCUS_17970 252558 249718 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_17970 253111 252785 gene locus_tag LOCUS_17980 gene hlyU 253111 252785 CDS product transcriptional activator HlyU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52695 protein_id gnl|my_center|LOCUS_17980 254198 253173 gene locus_tag LOCUS_17990 254198 253173 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338815.1 protein_id gnl|my_center|LOCUS_17990 254421 255653 gene locus_tag LOCUS_18000 254421 255653 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975867.1 protein_id gnl|my_center|LOCUS_18000 255747 256643 gene locus_tag LOCUS_18010 255747 256643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708313.1 protein_id gnl|my_center|LOCUS_18010 256636 257577 gene locus_tag LOCUS_18020 256636 257577 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529541.1 protein_id gnl|my_center|LOCUS_18020 257582 258664 gene locus_tag LOCUS_18030 257582 258664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529542.1 protein_id gnl|my_center|LOCUS_18030 258688 259440 gene locus_tag LOCUS_18040 258688 259440 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529543.1 protein_id gnl|my_center|LOCUS_18040 259446 260591 gene locus_tag LOCUS_18050 259446 260591 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529544.1 protein_id gnl|my_center|LOCUS_18050 260594 261637 gene locus_tag LOCUS_18060 260594 261637 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 protein_id gnl|my_center|LOCUS_18060 261634 263244 gene locus_tag LOCUS_18070 gene xynA 261634 263244 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708300.1 protein_id gnl|my_center|LOCUS_18070 263244 264074 gene locus_tag LOCUS_18080 gene tolB2 263244 264074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708227.1 protein_id gnl|my_center|LOCUS_18080 264344 264114 gene locus_tag LOCUS_18090 gene slyX 264344 264114 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC38 protein_id gnl|my_center|LOCUS_18090 264685 264341 gene locus_tag LOCUS_18100 264685 264341 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561457.1 protein_id gnl|my_center|LOCUS_18100 264993 266528 gene locus_tag LOCUS_18110 264993 266528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968369.1 protein_id gnl|my_center|LOCUS_18110 266525 267658 gene locus_tag LOCUS_18120 266525 267658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709922.1 protein_id gnl|my_center|LOCUS_18120 267663 268634 gene locus_tag LOCUS_18130 267663 268634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709923.1 protein_id gnl|my_center|LOCUS_18130 268636 269028 gene locus_tag LOCUS_18140 268636 269028 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067542.1 protein_id gnl|my_center|LOCUS_18140 269025 269834 gene locus_tag LOCUS_18150 gene deoD 269025 269834 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKN6 protein_id gnl|my_center|LOCUS_18150 269827 270615 gene locus_tag LOCUS_18160 gene deoC 269827 270615 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ09 protein_id gnl|my_center|LOCUS_18160 270618 271928 gene locus_tag LOCUS_18170 gene deoA 270618 271928 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T50 protein_id gnl|my_center|LOCUS_18170 272497 271931 gene locus_tag LOCUS_18180 272497 271931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 273300 272671 gene locus_tag LOCUS_18190 gene upp 273300 272671 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UET4 protein_id gnl|my_center|LOCUS_18190 274454 273483 gene locus_tag LOCUS_18200 274454 273483 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ05 protein_id gnl|my_center|LOCUS_18200 275671 274451 gene locus_tag LOCUS_18210 gene deoB 275671 274451 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ04 protein_id gnl|my_center|LOCUS_18210 275885 275727 gene locus_tag LOCUS_18220 275885 275727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 275878 276747 gene locus_tag LOCUS_18230 275878 276747 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533690.1 protein_id gnl|my_center|LOCUS_18230 277424 276852 gene locus_tag LOCUS_18240 gene tadE1 277424 276852 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709931.1 protein_id gnl|my_center|LOCUS_18240 277993 277475 gene locus_tag LOCUS_18250 277993 277475 CDS product pilus assembly protein TadG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067549.1 protein_id gnl|my_center|LOCUS_18250 278652 278239 gene locus_tag LOCUS_18260 gene pilQ1 278652 278239 CDS product type IV pilus protein PilQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709933.1 protein_id gnl|my_center|LOCUS_18260 279023 279208 gene locus_tag LOCUS_18270 279023 279208 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533686.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence06 85 585 gene locus_tag LOCUS_18280 85 585 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707542.1 protein_id gnl|my_center|LOCUS_18280 3071 918 gene locus_tag LOCUS_18290 gene hppA 3071 918 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THD0 protein_id gnl|my_center|LOCUS_18290 4557 3319 gene locus_tag LOCUS_18300 4557 3319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_18300 5075 4563 gene locus_tag LOCUS_18310 gene nusB 5075 4563 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THD7 protein_id gnl|my_center|LOCUS_18310 5527 5072 gene locus_tag LOCUS_18320 gene ribH2 5527 5072 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_18320 5807 5565 gene locus_tag LOCUS_18330 5807 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5788 6501 gene locus_tag LOCUS_18340 5788 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086936.1 protein_id gnl|my_center|LOCUS_18340 6712 8043 gene locus_tag LOCUS_18350 6712 8043 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530224.1 protein_id gnl|my_center|LOCUS_18350 8686 8033 gene locus_tag LOCUS_18360 8686 8033 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707534.1 protein_id gnl|my_center|LOCUS_18360 9794 8691 gene locus_tag LOCUS_18370 9794 8691 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THE2 protein_id gnl|my_center|LOCUS_18370 10281 9799 gene locus_tag LOCUS_18380 gene nrdR 10281 9799 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58259 protein_id gnl|my_center|LOCUS_18380 11600 10287 gene locus_tag LOCUS_18390 gene glyA 11600 10287 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THE5 protein_id gnl|my_center|LOCUS_18390 13043 11850 gene locus_tag LOCUS_18400 13043 11850 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707530.1 protein_id gnl|my_center|LOCUS_18400 14032 13508 gene locus_tag LOCUS_18410 14032 13508 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529316.1 protein_id gnl|my_center|LOCUS_18410 14608 14159 gene locus_tag LOCUS_18420 14608 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975010.1 protein_id gnl|my_center|LOCUS_18420 14814 15869 gene locus_tag LOCUS_18430 14814 15869 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7N8 protein_id gnl|my_center|LOCUS_18430 16230 16700 gene locus_tag LOCUS_18440 16230 16700 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971440.1 protein_id gnl|my_center|LOCUS_18440 17189 16719 gene locus_tag LOCUS_18450 17189 16719 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090317.1 protein_id gnl|my_center|LOCUS_18450 17315 20740 gene locus_tag LOCUS_18460 17315 20740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090318.1 protein_id gnl|my_center|LOCUS_18460 20893 22713 gene locus_tag LOCUS_18470 20893 22713 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_18470 22733 23482 gene locus_tag LOCUS_18480 gene ate 22733 23482 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7N6 protein_id gnl|my_center|LOCUS_18480 23575 24486 gene locus_tag LOCUS_18490 23575 24486 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 protein_id gnl|my_center|LOCUS_18490 24689 25294 gene locus_tag LOCUS_18500 24689 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972644.1 protein_id gnl|my_center|LOCUS_18500 25809 25321 gene locus_tag LOCUS_18510 25809 25321 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530760.1 protein_id gnl|my_center|LOCUS_18510 28116 25870 gene locus_tag LOCUS_18520 gene parC 28116 25870 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7N3 protein_id gnl|my_center|LOCUS_18520 28335 29546 gene locus_tag LOCUS_18530 28335 29546 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975003.1 protein_id gnl|my_center|LOCUS_18530 29705 29481 gene locus_tag LOCUS_18540 29705 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 29708 29866 gene locus_tag LOCUS_18550 29708 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 31755 29968 gene locus_tag LOCUS_18560 gene aspS 31755 29968 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QV4 protein_id gnl|my_center|LOCUS_18560 31973 33268 gene locus_tag LOCUS_18570 31973 33268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969101.1 protein_id gnl|my_center|LOCUS_18570 33278 34429 gene locus_tag LOCUS_18580 gene rnd 33278 34429 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9G5 protein_id gnl|my_center|LOCUS_18580 36248 34722 gene locus_tag LOCUS_18590 gene ppx 36248 34722 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971426.1 protein_id gnl|my_center|LOCUS_18590 38625 36412 gene locus_tag LOCUS_18600 gene ppk 38625 36412 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9G0 protein_id gnl|my_center|LOCUS_18600 39387 38683 gene locus_tag LOCUS_18610 39387 38683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974992.1 protein_id gnl|my_center|LOCUS_18610 40514 39387 gene locus_tag LOCUS_18620 40514 39387 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312858.1 protein_id gnl|my_center|LOCUS_18620 41198 40566 gene locus_tag LOCUS_18630 41198 40566 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_18630 41315 42385 gene locus_tag LOCUS_18640 gene purM 41315 42385 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9F7 protein_id gnl|my_center|LOCUS_18640 42382 43005 gene locus_tag LOCUS_18650 gene purN 42382 43005 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG9 protein_id gnl|my_center|LOCUS_18650 43161 44432 gene locus_tag LOCUS_18660 43161 44432 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_18660 44930 44502 gene locus_tag LOCUS_18670 44930 44502 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_18670 45057 45530 gene locus_tag LOCUS_18680 45057 45530 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709023.1 protein_id gnl|my_center|LOCUS_18680 47743 45620 gene locus_tag LOCUS_18690 47743 45620 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 protein_id gnl|my_center|LOCUS_18690 47824 48684 gene locus_tag LOCUS_18700 gene rlmJ 47824 48684 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QW7 protein_id gnl|my_center|LOCUS_18700 48983 49393 gene locus_tag LOCUS_18710 48983 49393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532490.1 protein_id gnl|my_center|LOCUS_18710 49403 50113 gene locus_tag LOCUS_18720 49403 50113 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969088.1 protein_id gnl|my_center|LOCUS_18720 50154 50750 gene locus_tag LOCUS_18730 50154 50750 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974983.1 protein_id gnl|my_center|LOCUS_18730 50747 51133 gene locus_tag LOCUS_18740 50747 51133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 51724 51146 gene locus_tag LOCUS_18750 51724 51146 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 protein_id gnl|my_center|LOCUS_18750 51936 52490 gene locus_tag LOCUS_18760 51936 52490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 52561 52980 gene locus_tag LOCUS_18770 52561 52980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 53060 53713 gene locus_tag LOCUS_18780 53060 53713 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_18780 54490 53852 gene locus_tag LOCUS_18790 54490 53852 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707496.1 protein_id gnl|my_center|LOCUS_18790 54811 55737 gene locus_tag LOCUS_18800 54811 55737 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_18800 55759 56547 gene locus_tag LOCUS_18810 55759 56547 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 protein_id gnl|my_center|LOCUS_18810 56675 58768 gene locus_tag LOCUS_18820 gene uvrC 56675 58768 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGA9 protein_id gnl|my_center|LOCUS_18820 61526 58977 gene locus_tag LOCUS_18830 61526 58977 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 protein_id gnl|my_center|LOCUS_18830 62053 62637 gene locus_tag LOCUS_18840 gene pgsA 62053 62637 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 protein_id gnl|my_center|LOCUS_18840 62634 62891 gene locus_tag LOCUS_18850 gene moaD 62634 62891 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9E2 protein_id gnl|my_center|LOCUS_18850 62893 63390 gene locus_tag LOCUS_18860 62893 63390 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707491.1 protein_id gnl|my_center|LOCUS_18860 63387 64079 gene locus_tag LOCUS_18870 gene ung 63387 64079 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDC0 protein_id gnl|my_center|LOCUS_18870 64612 64190 gene locus_tag LOCUS_18880 gene ndk 64612 64190 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGB6 protein_id gnl|my_center|LOCUS_18880 65677 64985 gene locus_tag LOCUS_18890 65677 64985 CDS product beta-aryl ether-cleaving enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974972.1 protein_id gnl|my_center|LOCUS_18890 65803 67683 gene locus_tag LOCUS_18900 65803 67683 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707482.1 protein_id gnl|my_center|LOCUS_18900 67802 69055 gene locus_tag LOCUS_18910 67802 69055 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339255.1 protein_id gnl|my_center|LOCUS_18910 69052 69813 gene locus_tag LOCUS_18920 69052 69813 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_18920 69803 71017 gene locus_tag LOCUS_18930 69803 71017 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_18930 71107 72195 gene locus_tag LOCUS_18940 71107 72195 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538001.1 protein_id gnl|my_center|LOCUS_18940 72920 74698 gene locus_tag LOCUS_18950 gene mcpA 72920 74698 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974789.1 protein_id gnl|my_center|LOCUS_18950 75253 74804 gene locus_tag LOCUS_18960 75253 74804 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707479.1 protein_id gnl|my_center|LOCUS_18960 76752 75265 gene locus_tag LOCUS_18970 gene pepA 76752 75265 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9C8 protein_id gnl|my_center|LOCUS_18970 77106 78296 gene locus_tag LOCUS_18980 77106 78296 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532506.1 protein_id gnl|my_center|LOCUS_18980 78293 79381 gene locus_tag LOCUS_18990 78293 79381 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707476.1 protein_id gnl|my_center|LOCUS_18990 79531 81744 gene locus_tag LOCUS_19000 gene lptD 79531 81744 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9C5 protein_id gnl|my_center|LOCUS_19000 81872 82810 gene locus_tag LOCUS_19010 81872 82810 CDS product molecular chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314587.1 protein_id gnl|my_center|LOCUS_19010 82825 83871 gene locus_tag LOCUS_19020 gene pdxA 82825 83871 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD4 protein_id gnl|my_center|LOCUS_19020 83871 84701 gene locus_tag LOCUS_19030 gene rsmA 83871 84701 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD5 protein_id gnl|my_center|LOCUS_19030 85200 84742 gene locus_tag LOCUS_19040 85200 84742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19040 85414 86619 gene locus_tag LOCUS_19050 85414 86619 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_19050 87161 86682 gene locus_tag LOCUS_19060 87161 86682 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725054.1 protein_id gnl|my_center|LOCUS_19060 87269 88237 gene locus_tag LOCUS_19070 87269 88237 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_19070 88234 90612 gene locus_tag LOCUS_19080 88234 90612 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVE3 protein_id gnl|my_center|LOCUS_19080 90872 91339 gene locus_tag LOCUS_19090 90872 91339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 91996 91340 gene locus_tag LOCUS_19100 gene gmk 91996 91340 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN5 protein_id gnl|my_center|LOCUS_19100 92886 91999 gene locus_tag LOCUS_19110 92886 91999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707470.1 protein_id gnl|my_center|LOCUS_19110 94136 92940 gene locus_tag LOCUS_19120 94136 92940 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969070.1 protein_id gnl|my_center|LOCUS_19120 95511 94249 gene locus_tag LOCUS_19130 gene fabF 95511 94249 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZZ8 protein_id gnl|my_center|LOCUS_19130 95905 95612 gene locus_tag LOCUS_19140 gene acpP 95905 95612 CDS product acyl carrier protein AcpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19372 protein_id gnl|my_center|LOCUS_19140 96874 96137 gene locus_tag LOCUS_19150 96874 96137 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532516.1 protein_id gnl|my_center|LOCUS_19150 97893 96940 gene locus_tag LOCUS_19160 97893 96940 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7H0 protein_id gnl|my_center|LOCUS_19160 98141 98437 gene locus_tag LOCUS_19170 98141 98437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 98528 99454 gene locus_tag LOCUS_19180 98528 99454 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_19180 99593 100636 gene locus_tag LOCUS_19190 99593 100636 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971391.1 protein_id gnl|my_center|LOCUS_19190 101303 100704 gene locus_tag LOCUS_19200 101303 100704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 102225 102046 gene locus_tag LOCUS_19210 102225 102046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 102889 102437 gene locus_tag LOCUS_19220 102889 102437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 103026 104117 gene locus_tag LOCUS_19230 103026 104117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 104809 104114 gene locus_tag LOCUS_19240 104809 104114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 105443 105312 gene locus_tag LOCUS_19250 105443 105312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 105402 105734 gene locus_tag LOCUS_19260 105402 105734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 105746 105994 gene locus_tag LOCUS_19270 gene rpsR 105746 105994 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI9 protein_id gnl|my_center|LOCUS_19270 106130 107089 gene locus_tag LOCUS_19280 106130 107089 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707460.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19280 107115 107735 gene locus_tag LOCUS_19290 gene rplI 107115 107735 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGF0 protein_id gnl|my_center|LOCUS_19290 107958 108866 gene locus_tag LOCUS_19300 107958 108866 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532622.1 protein_id gnl|my_center|LOCUS_19300 109059 110348 gene locus_tag LOCUS_19310 109059 110348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974846.1 protein_id gnl|my_center|LOCUS_19310 111517 110453 gene locus_tag LOCUS_19320 111517 110453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707367.1 protein_id gnl|my_center|LOCUS_19320 113988 111637 gene locus_tag LOCUS_19330 113988 111637 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532625.1 protein_id gnl|my_center|LOCUS_19330 114182 116842 gene locus_tag LOCUS_19340 gene pepN 114182 116842 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971307.1 protein_id gnl|my_center|LOCUS_19340 117153 119501 gene locus_tag LOCUS_19350 117153 119501 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707365.1 protein_id gnl|my_center|LOCUS_19350 120058 119675 gene locus_tag LOCUS_19360 120058 119675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 121500 120442 gene locus_tag LOCUS_19370 121500 120442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971145.1 protein_id gnl|my_center|LOCUS_19370 122391 121984 gene locus_tag LOCUS_19380 122391 121984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 122582 123118 gene locus_tag LOCUS_19390 122582 123118 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_19390 126171 123145 gene locus_tag LOCUS_19400 gene glnE 126171 123145 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8N3 protein_id gnl|my_center|LOCUS_19400 127571 126168 gene locus_tag LOCUS_19410 127571 126168 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 protein_id gnl|my_center|LOCUS_19410 128255 127578 gene locus_tag LOCUS_19420 128255 127578 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527354.1 protein_id gnl|my_center|LOCUS_19420 130067 128502 gene locus_tag LOCUS_19430 130067 128502 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707361.1 protein_id gnl|my_center|LOCUS_19430 131444 130215 gene locus_tag LOCUS_19440 131444 130215 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887546.1 protein_id gnl|my_center|LOCUS_19440 131970 131482 gene locus_tag LOCUS_19450 gene cycL 131970 131482 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707360.1 protein_id gnl|my_center|LOCUS_19450 133961 131967 gene locus_tag LOCUS_19460 gene cycK 133961 131967 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707359.1 protein_id gnl|my_center|LOCUS_19460 134480 134010 gene locus_tag LOCUS_19470 gene ccmE 134480 134010 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMN7 protein_id gnl|my_center|LOCUS_19470 136066 134477 gene locus_tag LOCUS_19480 136066 134477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 136755 136231 gene locus_tag LOCUS_19490 136755 136231 CDS product outer-hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974834.1 protein_id gnl|my_center|LOCUS_19490 138193 136811 gene locus_tag LOCUS_19500 138193 136811 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971296.1 protein_id gnl|my_center|LOCUS_19500 138876 138190 gene locus_tag LOCUS_19510 138876 138190 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_19510 139312 139025 gene locus_tag LOCUS_19520 139312 139025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974831.1 protein_id gnl|my_center|LOCUS_19520 139628 139422 gene locus_tag LOCUS_19530 139628 139422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 143503 139658 gene locus_tag LOCUS_19540 143503 139658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 protein_id gnl|my_center|LOCUS_19540 143993 143520 gene locus_tag LOCUS_19550 143993 143520 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 protein_id gnl|my_center|LOCUS_19550 144880 143990 gene locus_tag LOCUS_19560 144880 143990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_19560 145518 144877 gene locus_tag LOCUS_19570 145518 144877 CDS product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971292.1 protein_id gnl|my_center|LOCUS_19570 146118 145534 gene locus_tag LOCUS_19580 146118 145534 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972646.1 protein_id gnl|my_center|LOCUS_19580 146365 146108 gene locus_tag LOCUS_19590 146365 146108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 146775 146362 gene locus_tag LOCUS_19600 146775 146362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 147190 146783 gene locus_tag LOCUS_19610 147190 146783 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 protein_id gnl|my_center|LOCUS_19610 147638 147240 gene locus_tag LOCUS_19620 147638 147240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971288.1 protein_id gnl|my_center|LOCUS_19620 147970 147635 gene locus_tag LOCUS_19630 147970 147635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 148536 147970 gene locus_tag LOCUS_19640 148536 147970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 150590 148626 gene locus_tag LOCUS_19650 150590 148626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 150962 150642 gene locus_tag LOCUS_19660 150962 150642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971284.1 protein_id gnl|my_center|LOCUS_19660 152226 151048 gene locus_tag LOCUS_19670 gene gp34 152226 151048 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 protein_id gnl|my_center|LOCUS_19670 152637 152326 gene locus_tag LOCUS_19680 152637 152326 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971282.1 protein_id gnl|my_center|LOCUS_19680 154171 152717 gene locus_tag LOCUS_19690 154171 152717 CDS product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971281.1 protein_id gnl|my_center|LOCUS_19690 154713 154168 gene locus_tag LOCUS_19700 154713 154168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 155133 155387 gene locus_tag LOCUS_19710 155133 155387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 155380 155667 gene locus_tag LOCUS_19720 155380 155667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 156002 155805 gene locus_tag LOCUS_19730 156002 155805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 156278 156003 gene locus_tag LOCUS_19740 156278 156003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 156603 156442 gene locus_tag LOCUS_19750 156603 156442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 156877 158076 gene locus_tag LOCUS_19760 156877 158076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932130.1 protein_id gnl|my_center|LOCUS_19760 158495 158043 gene locus_tag LOCUS_19770 158495 158043 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_19770 158675 160867 gene locus_tag LOCUS_19780 gene pbp 158675 160867 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968985.1 protein_id gnl|my_center|LOCUS_19780 161087 161674 gene locus_tag LOCUS_19790 161087 161674 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527372.1 protein_id gnl|my_center|LOCUS_19790 161667 162221 gene locus_tag LOCUS_19800 161667 162221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707346.1 protein_id gnl|my_center|LOCUS_19800 162491 163765 gene locus_tag LOCUS_19810 gene sqr 162491 163765 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_19810 164120 163887 gene locus_tag LOCUS_19820 164120 163887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 164271 165509 gene locus_tag LOCUS_19830 164271 165509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 165890 167203 gene locus_tag LOCUS_19840 165890 167203 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525028.1 protein_id gnl|my_center|LOCUS_19840 167410 168753 gene locus_tag LOCUS_19850 gene dos 167410 168753 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206293.1 protein_id gnl|my_center|LOCUS_19850 169026 168841 gene locus_tag LOCUS_19860 169026 168841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 169105 170106 gene locus_tag LOCUS_19870 169105 170106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_19870 170226 172289 gene locus_tag LOCUS_19880 170226 172289 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 protein_id gnl|my_center|LOCUS_19880 172684 172400 gene locus_tag LOCUS_19890 172684 172400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 173145 172804 gene locus_tag LOCUS_19900 173145 172804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971254.1 protein_id gnl|my_center|LOCUS_19900 174098 173142 gene locus_tag LOCUS_19910 174098 173142 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972618.1 protein_id gnl|my_center|LOCUS_19910 175944 174064 gene locus_tag LOCUS_19920 175944 174064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 176380 176703 gene locus_tag LOCUS_19930 176380 176703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 177043 177558 gene locus_tag LOCUS_19940 177043 177558 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971252.1 protein_id gnl|my_center|LOCUS_19940 178318 177521 gene locus_tag LOCUS_19950 178318 177521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 178616 178341 gene locus_tag LOCUS_19960 178616 178341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 179766 179344 gene locus_tag LOCUS_19970 gene ros 179766 179344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509257.1 protein_id gnl|my_center|LOCUS_19970 180366 180028 gene locus_tag LOCUS_19980 180366 180028 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974815.1 protein_id gnl|my_center|LOCUS_19980 180794 180363 gene locus_tag LOCUS_19990 180794 180363 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707333.1 protein_id gnl|my_center|LOCUS_19990 181264 180791 gene locus_tag LOCUS_20000 gene mnhE 181264 180791 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971247.1 protein_id gnl|my_center|LOCUS_20000 182862 181261 gene locus_tag LOCUS_20010 182862 181261 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974812.1 protein_id gnl|my_center|LOCUS_20010 183253 182876 gene locus_tag LOCUS_20020 gene mnhC 183253 182876 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 protein_id gnl|my_center|LOCUS_20020 183672 183253 gene locus_tag LOCUS_20030 183672 183253 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974810.1 protein_id gnl|my_center|LOCUS_20030 186037 183674 gene locus_tag LOCUS_20040 gene phaA2 186037 183674 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968975.1 protein_id gnl|my_center|LOCUS_20040 186464 186949 gene locus_tag LOCUS_20050 186464 186949 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532088.1 protein_id gnl|my_center|LOCUS_20050 187175 188452 gene locus_tag LOCUS_20060 187175 188452 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969673.1 protein_id gnl|my_center|LOCUS_20060 189340 188459 gene locus_tag LOCUS_20070 189340 188459 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552203.1 protein_id gnl|my_center|LOCUS_20070 189450 190154 gene locus_tag LOCUS_20080 189450 190154 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535109.1 protein_id gnl|my_center|LOCUS_20080 190167 190415 gene locus_tag LOCUS_20090 190167 190415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 191632 190442 gene locus_tag LOCUS_20100 gene mdoC 191632 190442 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973110.1 protein_id gnl|my_center|LOCUS_20100 192196 191891 gene locus_tag LOCUS_20110 192196 191891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 193449 192430 gene locus_tag LOCUS_20120 gene ilvC 193449 192430 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UAW6 protein_id gnl|my_center|LOCUS_20120 194219 193527 gene locus_tag LOCUS_20130 194219 193527 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531064.1 protein_id gnl|my_center|LOCUS_20130 194488 194868 gene locus_tag LOCUS_20140 194488 194868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 195656 195084 gene locus_tag LOCUS_20150 195656 195084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 195867 196865 gene locus_tag LOCUS_20160 195867 196865 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_20160 197684 196941 gene locus_tag LOCUS_20170 gene pdxJ 197684 196941 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH49 protein_id gnl|my_center|LOCUS_20170 198119 197844 gene locus_tag LOCUS_20180 198119 197844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 198530 199840 gene locus_tag LOCUS_20190 198530 199840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 201565 200054 gene locus_tag LOCUS_20200 gene mcpV 201565 200054 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971342.1 protein_id gnl|my_center|LOCUS_20200 202327 201938 gene locus_tag LOCUS_20210 202327 201938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 203447 202371 gene locus_tag LOCUS_20220 203447 202371 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_20220 204577 203912 gene locus_tag LOCUS_20230 204577 203912 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083679.1 protein_id gnl|my_center|LOCUS_20230 205360 204686 gene locus_tag LOCUS_20240 205360 204686 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_20240 205830 205462 gene locus_tag LOCUS_20250 205830 205462 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315823.1 protein_id gnl|my_center|LOCUS_20250 205932 207053 gene locus_tag LOCUS_20260 205932 207053 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_20260 207424 209046 gene locus_tag LOCUS_20270 207424 209046 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729028.1 protein_id gnl|my_center|LOCUS_20270 210394 209288 gene locus_tag LOCUS_20280 210394 209288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388632.1 protein_id gnl|my_center|LOCUS_20280 210513 211625 gene locus_tag LOCUS_20290 210513 211625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence07 1011 130 gene locus_tag LOCUS_20300 1011 130 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_20300 1114 1398 gene locus_tag LOCUS_20310 1114 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_20310 1406 2056 gene locus_tag LOCUS_20320 gene msrQ 1406 2056 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QE8 protein_id gnl|my_center|LOCUS_20320 2080 2940 gene locus_tag LOCUS_20330 2080 2940 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123291.1 protein_id gnl|my_center|LOCUS_20330 3666 4160 gene locus_tag LOCUS_20340 3666 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4524 4252 gene locus_tag LOCUS_20350 4524 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4642 5277 gene locus_tag LOCUS_20360 4642 5277 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769977.1 protein_id gnl|my_center|LOCUS_20360 7024 5297 gene locus_tag LOCUS_20370 7024 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7168 7491 gene locus_tag LOCUS_20380 7168 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 7654 8325 gene locus_tag LOCUS_20390 7654 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 8827 8621 gene locus_tag LOCUS_20400 8827 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 9144 8869 gene locus_tag LOCUS_20410 9144 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 9323 9063 gene locus_tag LOCUS_20420 9323 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 10531 9374 gene locus_tag LOCUS_20430 10531 9374 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707185.1 protein_id gnl|my_center|LOCUS_20430 10903 11154 gene locus_tag LOCUS_20440 10903 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 12304 11447 gene locus_tag LOCUS_20450 12304 11447 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_20450 13092 12301 gene locus_tag LOCUS_20460 gene nadX 13092 12301 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LV9 protein_id gnl|my_center|LOCUS_20460 13795 13094 gene locus_tag LOCUS_20470 13795 13094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_20470 14544 13789 gene locus_tag LOCUS_20480 14544 13789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 protein_id gnl|my_center|LOCUS_20480 15515 14541 gene locus_tag LOCUS_20490 15515 14541 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_20490 16426 15512 gene locus_tag LOCUS_20500 16426 15512 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_20500 17654 16497 gene locus_tag LOCUS_20510 17654 16497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088819.1 protein_id gnl|my_center|LOCUS_20510 18303 17755 gene locus_tag LOCUS_20520 gene nbaC 18303 17755 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_20520 19268 18315 gene locus_tag LOCUS_20530 19268 18315 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969467.1 protein_id gnl|my_center|LOCUS_20530 20731 19265 gene locus_tag LOCUS_20540 20731 19265 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_20540 20876 21829 gene locus_tag LOCUS_20550 gene pcaQ 20876 21829 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036042.1 protein_id gnl|my_center|LOCUS_20550 22051 23586 gene locus_tag LOCUS_20560 22051 23586 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 protein_id gnl|my_center|LOCUS_20560 24674 23805 gene locus_tag LOCUS_20570 24674 23805 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889403.1 protein_id gnl|my_center|LOCUS_20570 25090 24854 gene locus_tag LOCUS_20580 25090 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 25766 25284 gene locus_tag LOCUS_20590 25766 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 26041 25766 gene locus_tag LOCUS_20600 26041 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 26309 27361 gene locus_tag LOCUS_20610 26309 27361 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_20610 27682 29820 gene locus_tag LOCUS_20620 27682 29820 CDS product autotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039723.1 protein_id gnl|my_center|LOCUS_20620 31383 29854 gene locus_tag LOCUS_20630 31383 29854 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_20630 32196 31417 gene locus_tag LOCUS_20640 32196 31417 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338969.1 protein_id gnl|my_center|LOCUS_20640 33748 32201 gene locus_tag LOCUS_20650 33748 32201 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706372.1 protein_id gnl|my_center|LOCUS_20650 35826 33748 gene locus_tag LOCUS_20660 35826 33748 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_20660 36602 35823 gene locus_tag LOCUS_20670 36602 35823 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229336.1 protein_id gnl|my_center|LOCUS_20670 37884 36607 gene locus_tag LOCUS_20680 gene siaM 37884 36607 CDS product sialic acid TRAP transporter large permease protein SiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR66 protein_id gnl|my_center|LOCUS_20680 38531 37881 gene locus_tag LOCUS_20690 38531 37881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 38942 38565 gene locus_tag LOCUS_20700 38942 38565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 39922 38939 gene locus_tag LOCUS_20710 39922 38939 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_20710 40644 40141 gene locus_tag LOCUS_20720 40644 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 41022 46973 gene locus_tag LOCUS_20730 41022 46973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 48106 47168 gene locus_tag LOCUS_20740 48106 47168 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975150.1 protein_id gnl|my_center|LOCUS_20740 49074 48352 gene locus_tag LOCUS_20750 49074 48352 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538160.1 protein_id gnl|my_center|LOCUS_20750 49361 51730 gene locus_tag LOCUS_20760 gene manB 49361 51730 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969567.1 protein_id gnl|my_center|LOCUS_20760 52039 53334 gene locus_tag LOCUS_20770 gene gabT 52039 53334 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975708.1 protein_id gnl|my_center|LOCUS_20770 53334 54809 gene locus_tag LOCUS_20780 gene gabD4 53334 54809 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967426.1 protein_id gnl|my_center|LOCUS_20780 55975 54893 gene locus_tag LOCUS_20790 55975 54893 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_20790 56257 56057 gene locus_tag LOCUS_20800 56257 56057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 56412 57071 gene locus_tag LOCUS_20810 56412 57071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_20810 57073 57663 gene locus_tag LOCUS_20820 57073 57663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_20820 59226 57676 gene locus_tag LOCUS_20830 59226 57676 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_20830 59735 59223 gene locus_tag LOCUS_20840 59735 59223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_20840 60889 59801 gene locus_tag LOCUS_20850 60889 59801 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_20850 62595 60913 gene locus_tag LOCUS_20860 gene hutU 62595 60913 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z9 protein_id gnl|my_center|LOCUS_20860 63392 62592 gene locus_tag LOCUS_20870 63392 62592 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973442.1 protein_id gnl|my_center|LOCUS_20870 64930 63389 gene locus_tag LOCUS_20880 gene hutH 64930 63389 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J289 protein_id gnl|my_center|LOCUS_20880 66132 64927 gene locus_tag LOCUS_20890 gene hutI 66132 64927 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS0 protein_id gnl|my_center|LOCUS_20890 66196 67560 gene locus_tag LOCUS_20900 gene hutF 66196 67560 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 protein_id gnl|my_center|LOCUS_20900 67557 68258 gene locus_tag LOCUS_20910 gene hutC 67557 68258 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 protein_id gnl|my_center|LOCUS_20910 69056 68274 gene locus_tag LOCUS_20920 69056 68274 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976307.1 protein_id gnl|my_center|LOCUS_20920 71124 69073 gene locus_tag LOCUS_20930 71124 69073 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976306.1 protein_id gnl|my_center|LOCUS_20930 72296 71133 gene locus_tag LOCUS_20940 72296 71133 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_20940 73062 72301 gene locus_tag LOCUS_20950 73062 72301 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_20950 74499 73066 gene locus_tag LOCUS_20960 gene lcdH 74499 73066 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3B2 protein_id gnl|my_center|LOCUS_20960 75116 74496 gene locus_tag LOCUS_20970 75116 74496 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_20970 76054 75137 gene locus_tag LOCUS_20980 76054 75137 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 protein_id gnl|my_center|LOCUS_20980 76132 77124 gene locus_tag LOCUS_20990 76132 77124 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528292.1 protein_id gnl|my_center|LOCUS_20990 77911 77129 gene locus_tag LOCUS_21000 77911 77129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528191.1 protein_id gnl|my_center|LOCUS_21000 78642 77911 gene locus_tag LOCUS_21010 78642 77911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706779.1 protein_id gnl|my_center|LOCUS_21010 79486 78716 gene locus_tag LOCUS_21020 79486 78716 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968662.1 protein_id gnl|my_center|LOCUS_21020 80341 79535 gene locus_tag LOCUS_21030 80341 79535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968663.1 protein_id gnl|my_center|LOCUS_21030 80453 81322 gene locus_tag LOCUS_21040 80453 81322 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_21040 81319 81948 gene locus_tag LOCUS_21050 81319 81948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 81954 83117 gene locus_tag LOCUS_21060 81954 83117 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435844.1 protein_id gnl|my_center|LOCUS_21060 83117 84715 gene locus_tag LOCUS_21070 gene ilvB1 83117 84715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968665.1 protein_id gnl|my_center|LOCUS_21070 85899 84721 gene locus_tag LOCUS_21080 gene argE 85899 84721 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C5 protein_id gnl|my_center|LOCUS_21080 86142 87161 gene locus_tag LOCUS_21090 86142 87161 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887799.1 protein_id gnl|my_center|LOCUS_21090 87154 88209 gene locus_tag LOCUS_21100 87154 88209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_21100 88231 89931 gene locus_tag LOCUS_21110 88231 89931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256685.1 protein_id gnl|my_center|LOCUS_21110 90025 91032 gene locus_tag LOCUS_21120 90025 91032 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_21120 91025 91945 gene locus_tag LOCUS_21130 91025 91945 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_21130 92847 91960 gene locus_tag LOCUS_21140 92847 91960 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973387.1 protein_id gnl|my_center|LOCUS_21140 95231 92847 gene locus_tag LOCUS_21150 95231 92847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338622.1 protein_id gnl|my_center|LOCUS_21150 98612 95250 gene locus_tag LOCUS_21160 98612 95250 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338623.1 protein_id gnl|my_center|LOCUS_21160 99324 98857 gene locus_tag LOCUS_21170 gene cheW2 99324 98857 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536237.1 protein_id gnl|my_center|LOCUS_21170 102012 99817 gene locus_tag LOCUS_21180 102012 99817 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 protein_id gnl|my_center|LOCUS_21180 102580 103095 gene locus_tag LOCUS_21190 102580 103095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 103194 103484 gene locus_tag LOCUS_21200 103194 103484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 103620 104546 gene locus_tag LOCUS_21210 103620 104546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976316.1 protein_id gnl|my_center|LOCUS_21210 104676 105839 gene locus_tag LOCUS_21220 104676 105839 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976317.1 protein_id gnl|my_center|LOCUS_21220 105981 106970 gene locus_tag LOCUS_21230 105981 106970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 protein_id gnl|my_center|LOCUS_21230 106967 107923 gene locus_tag LOCUS_21240 106967 107923 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528022.1 protein_id gnl|my_center|LOCUS_21240 107913 108728 gene locus_tag LOCUS_21250 107913 108728 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976320.1 protein_id gnl|my_center|LOCUS_21250 108746 110173 gene locus_tag LOCUS_21260 108746 110173 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528020.1 protein_id gnl|my_center|LOCUS_21260 110279 111133 gene locus_tag LOCUS_21270 gene purU 110279 111133 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDX9 protein_id gnl|my_center|LOCUS_21270 111140 112033 gene locus_tag LOCUS_21280 111140 112033 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974530.1 protein_id gnl|my_center|LOCUS_21280 113529 112753 gene locus_tag LOCUS_21290 113529 112753 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338769.1 protein_id gnl|my_center|LOCUS_21290 114827 113526 gene locus_tag LOCUS_21300 gene xylH 114827 113526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338770.1 protein_id gnl|my_center|LOCUS_21300 115948 114914 gene locus_tag LOCUS_21310 gene xylF 115948 114914 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563217.1 protein_id gnl|my_center|LOCUS_21310 116161 117384 gene locus_tag LOCUS_21320 116161 117384 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529273.1 protein_id gnl|my_center|LOCUS_21320 117569 119005 gene locus_tag LOCUS_21330 117569 119005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 119002 120657 gene locus_tag LOCUS_21340 119002 120657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 121419 120685 gene locus_tag LOCUS_21350 121419 120685 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707021.1 protein_id gnl|my_center|LOCUS_21350 121738 123366 gene locus_tag LOCUS_21360 121738 123366 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_21360 124531 123446 gene locus_tag LOCUS_21370 124531 123446 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972797.1 protein_id gnl|my_center|LOCUS_21370 125471 124620 gene locus_tag LOCUS_21380 125471 124620 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707019.1 protein_id gnl|my_center|LOCUS_21380 125712 126950 gene locus_tag LOCUS_21390 125712 126950 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_21390 127140 127994 gene locus_tag LOCUS_21400 127140 127994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544732.1 protein_id gnl|my_center|LOCUS_21400 127994 128842 gene locus_tag LOCUS_21410 127994 128842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_21410 128844 130997 gene locus_tag LOCUS_21420 gene rafA 128844 130997 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213113.1 protein_id gnl|my_center|LOCUS_21420 130990 131760 gene locus_tag LOCUS_21430 130990 131760 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528599.1 protein_id gnl|my_center|LOCUS_21430 131757 132689 gene locus_tag LOCUS_21440 131757 132689 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974641.1 protein_id gnl|my_center|LOCUS_21440 132710 133324 gene locus_tag LOCUS_21450 gene dgoA 132710 133324 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707016.1 protein_id gnl|my_center|LOCUS_21450 133321 134208 gene locus_tag LOCUS_21460 133321 134208 CDS product putative sugar lactone lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RN9 protein_id gnl|my_center|LOCUS_21460 134231 136228 gene locus_tag LOCUS_21470 134231 136228 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0S2 protein_id gnl|my_center|LOCUS_21470 136588 136298 gene locus_tag LOCUS_21480 gene parE4 136588 136298 CDS product toxin ParE4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A459 protein_id gnl|my_center|LOCUS_21480 136842 136591 gene locus_tag LOCUS_21490 136842 136591 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887017.1 protein_id gnl|my_center|LOCUS_21490 138982 136919 gene locus_tag LOCUS_21500 gene stcD2 138982 136919 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140423.1 protein_id gnl|my_center|LOCUS_21500 139491 139048 gene locus_tag LOCUS_21510 139491 139048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532330.1 protein_id gnl|my_center|LOCUS_21510 141091 139520 gene locus_tag LOCUS_21520 141091 139520 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974636.1 protein_id gnl|my_center|LOCUS_21520 141356 141159 gene locus_tag LOCUS_21530 141356 141159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 141279 142094 gene locus_tag LOCUS_21540 141279 142094 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974635.1 protein_id gnl|my_center|LOCUS_21540 143451 142084 gene locus_tag LOCUS_21550 143451 142084 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313185.1 protein_id gnl|my_center|LOCUS_21550 145311 143569 gene locus_tag LOCUS_21560 145311 143569 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707011.1 protein_id gnl|my_center|LOCUS_21560 145627 147465 gene locus_tag LOCUS_21570 gene mutL 145627 147465 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGW0 protein_id gnl|my_center|LOCUS_21570 147560 147787 gene locus_tag LOCUS_21580 147560 147787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968840.1 protein_id gnl|my_center|LOCUS_21580 148827 147799 gene locus_tag LOCUS_21590 gene lpxK 148827 147799 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGV8 protein_id gnl|my_center|LOCUS_21590 150164 148821 gene locus_tag LOCUS_21600 gene kdtA 150164 148821 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707006.1 protein_id gnl|my_center|LOCUS_21600 150928 150161 gene locus_tag LOCUS_21610 150928 150161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_21610 151196 150948 gene locus_tag LOCUS_21620 151196 150948 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313175.1 protein_id gnl|my_center|LOCUS_21620 152069 151263 gene locus_tag LOCUS_21630 152069 151263 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532346.1 protein_id gnl|my_center|LOCUS_21630 153399 152056 gene locus_tag LOCUS_21640 153399 152056 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971075.1 protein_id gnl|my_center|LOCUS_21640 153502 155319 gene locus_tag LOCUS_21650 gene kefB1 153502 155319 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968833.1 protein_id gnl|my_center|LOCUS_21650 155346 155762 gene locus_tag LOCUS_21660 155346 155762 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532348.1 protein_id gnl|my_center|LOCUS_21660 155858 157216 gene locus_tag LOCUS_21670 155858 157216 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 protein_id gnl|my_center|LOCUS_21670 158097 157213 gene locus_tag LOCUS_21680 158097 157213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 protein_id gnl|my_center|LOCUS_21680 158710 158090 gene locus_tag LOCUS_21690 158710 158090 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707000.1 protein_id gnl|my_center|LOCUS_21690 160187 158691 gene locus_tag LOCUS_21700 160187 158691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 160387 160833 gene locus_tag LOCUS_21710 gene tadA 160387 160833 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGU8 protein_id gnl|my_center|LOCUS_21710 161518 160850 gene locus_tag LOCUS_21720 161518 160850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968829.1 protein_id gnl|my_center|LOCUS_21720 164634 161704 gene locus_tag LOCUS_21730 gene ileS 164634 161704 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RR0 protein_id gnl|my_center|LOCUS_21730 165641 164889 gene locus_tag LOCUS_21740 165641 164889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 166357 165638 gene locus_tag LOCUS_21750 166357 165638 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705644.1 protein_id gnl|my_center|LOCUS_21750 167343 166354 gene locus_tag LOCUS_21760 167343 166354 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6I8 protein_id gnl|my_center|LOCUS_21760 168214 167366 gene locus_tag LOCUS_21770 168214 167366 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313164.1 protein_id gnl|my_center|LOCUS_21770 168459 168755 gene locus_tag LOCUS_21780 gene groS 168459 168755 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJG8 protein_id gnl|my_center|LOCUS_21780 168826 170475 gene locus_tag LOCUS_21790 gene groL4 168826 170475 CDS product 60 kDa chaperonin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ZQ4 protein_id gnl|my_center|LOCUS_21790 170941 171387 gene locus_tag LOCUS_21800 170941 171387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 171606 172052 gene locus_tag LOCUS_21810 171606 172052 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971065.1 protein_id gnl|my_center|LOCUS_21810 172457 172116 gene locus_tag LOCUS_21820 172457 172116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 173575 172865 gene locus_tag LOCUS_21830 gene hisG 173575 172865 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGT4 protein_id gnl|my_center|LOCUS_21830 174693 173572 gene locus_tag LOCUS_21840 gene hisZ 174693 173572 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHK2 protein_id gnl|my_center|LOCUS_21840 176386 174701 gene locus_tag LOCUS_21850 gene hisS 176386 174701 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB6 protein_id gnl|my_center|LOCUS_21850 176990 176511 gene locus_tag LOCUS_21860 176990 176511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 177879 177220 gene locus_tag LOCUS_21870 177879 177220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 178106 178975 gene locus_tag LOCUS_21880 178106 178975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_21880 179383 178979 gene locus_tag LOCUS_21890 179383 178979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_21890 179964 179332 gene locus_tag LOCUS_21900 179964 179332 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706979.1 protein_id gnl|my_center|LOCUS_21900 180216 180983 gene locus_tag LOCUS_21910 180216 180983 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968812.1 protein_id gnl|my_center|LOCUS_21910 181154 181861 gene locus_tag LOCUS_21920 181154 181861 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974602.1 protein_id gnl|my_center|LOCUS_21920 183295 181958 gene locus_tag LOCUS_21930 183295 181958 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB1 protein_id gnl|my_center|LOCUS_21930 183768 183391 gene locus_tag LOCUS_21940 183768 183391 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706975.1 protein_id gnl|my_center|LOCUS_21940 185037 183820 gene locus_tag LOCUS_21950 gene glcE2 185037 183820 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706974.1 protein_id gnl|my_center|LOCUS_21950 186521 185034 gene locus_tag LOCUS_21960 gene glcD2 186521 185034 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706973.1 protein_id gnl|my_center|LOCUS_21960 186752 187786 gene locus_tag LOCUS_21970 186752 187786 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968807.1 protein_id gnl|my_center|LOCUS_21970 187913 188740 gene locus_tag LOCUS_21980 187913 188740 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530348.1 protein_id gnl|my_center|LOCUS_21980 188737 189522 gene locus_tag LOCUS_21990 188737 189522 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 protein_id gnl|my_center|LOCUS_21990 189543 190979 gene locus_tag LOCUS_22000 189543 190979 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_22000 190976 191647 gene locus_tag LOCUS_22010 190976 191647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_22010 192348 191644 gene locus_tag LOCUS_22020 192348 191644 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_22020 192884 192348 gene locus_tag LOCUS_22030 192884 192348 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_22030 192985 193731 gene locus_tag LOCUS_22040 192985 193731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 protein_id gnl|my_center|LOCUS_22040 193906 194547 gene locus_tag LOCUS_22050 193906 194547 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708648.1 protein_id gnl|my_center|LOCUS_22050 194597 195331 gene locus_tag LOCUS_22060 194597 195331 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNA1 protein_id gnl|my_center|LOCUS_22060 195475 196848 gene locus_tag LOCUS_22070 195475 196848 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974592.1 protein_id gnl|my_center|LOCUS_22070 196958 197845 gene locus_tag LOCUS_22080 196958 197845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530340.1 protein_id gnl|my_center|LOCUS_22080 198335 198054 gene locus_tag LOCUS_22090 198335 198054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 198481 199440 gene locus_tag LOCUS_22100 198481 199440 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313123.1 protein_id gnl|my_center|LOCUS_22100 199887 199474 gene locus_tag LOCUS_22110 199887 199474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_22110 200589 199978 gene locus_tag LOCUS_22120 200589 199978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 202088 200589 gene locus_tag LOCUS_22130 gene guaB 202088 200589 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RT5 protein_id gnl|my_center|LOCUS_22130 203293 202319 gene locus_tag LOCUS_22140 203293 202319 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971018.1 protein_id gnl|my_center|LOCUS_22140 203491 204906 gene locus_tag LOCUS_22150 203491 204906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532287.1 protein_id gnl|my_center|LOCUS_22150 205602 204889 gene locus_tag LOCUS_22160 gene rlmE 205602 204889 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6F0 protein_id gnl|my_center|LOCUS_22160 207197 205599 gene locus_tag LOCUS_22170 207197 205599 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971016.1 protein_id gnl|my_center|LOCUS_22170 207470 207543 gene locus_tag LOCUS_t00200 207470 207543 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 207806 208321 gene locus_tag LOCUS_22180 207806 208321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence08 1803 391 gene locus_tag LOCUS_22190 1803 391 CDS product cytosine/uracil/thiamine/allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706524.1 protein_id gnl|my_center|LOCUS_22190 1964 1803 gene locus_tag LOCUS_22200 1964 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3525 2008 gene locus_tag LOCUS_22210 3525 2008 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_22210 5987 3537 gene locus_tag LOCUS_22220 5987 3537 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 protein_id gnl|my_center|LOCUS_22220 6164 6817 gene locus_tag LOCUS_22230 6164 6817 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887742.1 protein_id gnl|my_center|LOCUS_22230 7821 7746 gene locus_tag LOCUS_t00210 7821 7746 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8122 8889 gene locus_tag LOCUS_22240 8122 8889 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707992.1 protein_id gnl|my_center|LOCUS_22240 9846 8917 gene locus_tag LOCUS_22250 9846 8917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971854.1 protein_id gnl|my_center|LOCUS_22250 9953 11314 gene locus_tag LOCUS_22260 gene glmU 9953 11314 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PS3 protein_id gnl|my_center|LOCUS_22260 11444 13270 gene locus_tag LOCUS_22270 gene glmS2 11444 13270 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF8 protein_id gnl|my_center|LOCUS_22270 13381 14067 gene locus_tag LOCUS_22280 13381 14067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537698.1 protein_id gnl|my_center|LOCUS_22280 16190 14073 gene locus_tag LOCUS_22290 gene recG 16190 14073 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYJ6 protein_id gnl|my_center|LOCUS_22290 16284 16607 gene locus_tag LOCUS_22300 16284 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 protein_id gnl|my_center|LOCUS_22300 16604 20110 gene locus_tag LOCUS_22310 gene mfd 16604 20110 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCG2 protein_id gnl|my_center|LOCUS_22310 20985 20293 gene locus_tag LOCUS_22320 20985 20293 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 protein_id gnl|my_center|LOCUS_22320 22830 21007 gene locus_tag LOCUS_22330 22830 21007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708017.1 protein_id gnl|my_center|LOCUS_22330 23061 23738 gene locus_tag LOCUS_22340 23061 23738 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528049.1 protein_id gnl|my_center|LOCUS_22340 24174 23845 gene locus_tag LOCUS_22350 24174 23845 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528052.1 protein_id gnl|my_center|LOCUS_22350 24310 25272 gene locus_tag LOCUS_22360 24310 25272 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975578.1 protein_id gnl|my_center|LOCUS_22360 26463 25276 gene locus_tag LOCUS_22370 26463 25276 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707994.1 protein_id gnl|my_center|LOCUS_22370 26556 27488 gene locus_tag LOCUS_22380 26556 27488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531654.1 protein_id gnl|my_center|LOCUS_22380 27507 28121 gene locus_tag LOCUS_22390 27507 28121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531653.1 protein_id gnl|my_center|LOCUS_22390 28234 28884 gene locus_tag LOCUS_22400 gene pcs 28234 28884 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KJY8 protein_id gnl|my_center|LOCUS_22400 28923 29897 gene locus_tag LOCUS_22410 gene qor 28923 29897 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707996.1 protein_id gnl|my_center|LOCUS_22410 30198 31778 gene locus_tag LOCUS_22420 30198 31778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533224.1 protein_id gnl|my_center|LOCUS_22420 31768 32862 gene locus_tag LOCUS_22430 31768 32862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707998.1 protein_id gnl|my_center|LOCUS_22430 32862 33782 gene locus_tag LOCUS_22440 32862 33782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531648.1 protein_id gnl|my_center|LOCUS_22440 33859 34929 gene locus_tag LOCUS_22450 33859 34929 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975571.1 protein_id gnl|my_center|LOCUS_22450 36040 35012 gene locus_tag LOCUS_22460 36040 35012 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_22460 37621 36230 gene locus_tag LOCUS_22470 gene spuC 37621 36230 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 protein_id gnl|my_center|LOCUS_22470 37828 39249 gene locus_tag LOCUS_22480 gene spuI 37828 39249 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_22480 39452 40669 gene locus_tag LOCUS_22490 gene hemA 39452 40669 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08080 protein_id gnl|my_center|LOCUS_22490 41214 40855 gene locus_tag LOCUS_22500 41214 40855 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_22500 41545 47022 gene locus_tag LOCUS_22510 41545 47022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887375.1 protein_id gnl|my_center|LOCUS_22510 47019 49130 gene locus_tag LOCUS_22520 gene pbpC 47019 49130 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975657.1 protein_id gnl|my_center|LOCUS_22520 50096 49143 gene locus_tag LOCUS_22530 gene gbpR 50096 49143 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976017.1 protein_id gnl|my_center|LOCUS_22530 50448 52190 gene locus_tag LOCUS_22540 gene ilvD5 50448 52190 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_22540 52190 53128 gene locus_tag LOCUS_22550 gene gal 52190 53128 CDS product D-galactose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969077.1 protein_id gnl|my_center|LOCUS_22550 53429 54937 gene locus_tag LOCUS_22560 53429 54937 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969503.1 protein_id gnl|my_center|LOCUS_22560 55471 56487 gene locus_tag LOCUS_22570 55471 56487 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198073.1 protein_id gnl|my_center|LOCUS_22570 57443 56577 gene locus_tag LOCUS_22580 gene rifI 57443 56577 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 protein_id gnl|my_center|LOCUS_22580 58852 57440 gene locus_tag LOCUS_22590 58852 57440 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089298.1 protein_id gnl|my_center|LOCUS_22590 58972 59424 gene locus_tag LOCUS_22600 58972 59424 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533031.1 protein_id gnl|my_center|LOCUS_22600 59424 60224 gene locus_tag LOCUS_22610 59424 60224 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_22610 60259 61032 gene locus_tag LOCUS_22620 gene smoS 60259 61032 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708985.1 protein_id gnl|my_center|LOCUS_22620 61157 62011 gene locus_tag LOCUS_22630 61157 62011 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888328.1 protein_id gnl|my_center|LOCUS_22630 62011 62994 gene locus_tag LOCUS_22640 62011 62994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22640 62996 63754 gene locus_tag LOCUS_22650 gene livG 62996 63754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_22650 63784 64518 gene locus_tag LOCUS_22660 63784 64518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709908.1 protein_id gnl|my_center|LOCUS_22660 64563 65711 gene locus_tag LOCUS_22670 64563 65711 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_22670 65752 67398 gene locus_tag LOCUS_22680 65752 67398 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040161.1 protein_id gnl|my_center|LOCUS_22680 68064 67450 gene locus_tag LOCUS_22690 68064 67450 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820136.1 protein_id gnl|my_center|LOCUS_22690 69122 68172 gene locus_tag LOCUS_22700 69122 68172 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931057.1 protein_id gnl|my_center|LOCUS_22700 69433 69146 gene locus_tag LOCUS_22710 69433 69146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088128.1 protein_id gnl|my_center|LOCUS_22710 69565 70380 gene locus_tag LOCUS_22720 69565 70380 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460373.1 protein_id gnl|my_center|LOCUS_22720 70435 71598 gene locus_tag LOCUS_22730 70435 71598 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_22730 71595 72821 gene locus_tag LOCUS_22740 71595 72821 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086087.1 protein_id gnl|my_center|LOCUS_22740 72824 76255 gene locus_tag LOCUS_22750 72824 76255 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_22750 76585 76343 gene locus_tag LOCUS_22760 76585 76343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 76478 76876 gene locus_tag LOCUS_22770 76478 76876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 76770 77078 gene locus_tag LOCUS_22780 76770 77078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 77550 77461 gene locus_tag LOCUS_t00220 77550 77461 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 77801 77637 gene locus_tag LOCUS_22790 77801 77637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 78219 77980 gene locus_tag LOCUS_22800 78219 77980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 78441 79403 gene locus_tag LOCUS_22810 78441 79403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 79550 80707 gene locus_tag LOCUS_22820 79550 80707 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531578.1 protein_id gnl|my_center|LOCUS_22820 80802 81512 gene locus_tag LOCUS_22830 gene tmk 80802 81512 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD54 protein_id gnl|my_center|LOCUS_22830 81509 82528 gene locus_tag LOCUS_22840 81509 82528 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708141.1 protein_id gnl|my_center|LOCUS_22840 82626 84170 gene locus_tag LOCUS_22850 gene metG 82626 84170 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U910 protein_id gnl|my_center|LOCUS_22850 84176 84958 gene locus_tag LOCUS_22860 84176 84958 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316213.1 protein_id gnl|my_center|LOCUS_22860 84955 85779 gene locus_tag LOCUS_22870 84955 85779 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971667.1 protein_id gnl|my_center|LOCUS_22870 85776 86294 gene locus_tag LOCUS_22880 85776 86294 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337627.1 protein_id gnl|my_center|LOCUS_22880 86750 86331 gene locus_tag LOCUS_22890 86750 86331 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528594.1 protein_id gnl|my_center|LOCUS_22890 87256 86750 gene locus_tag LOCUS_22900 87256 86750 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528593.1 protein_id gnl|my_center|LOCUS_22900 87573 87259 gene locus_tag LOCUS_22910 87573 87259 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_22910 88795 87707 gene locus_tag LOCUS_22920 88795 87707 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525804.1 protein_id gnl|my_center|LOCUS_22920 89220 88969 gene locus_tag LOCUS_22930 89220 88969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 89167 90651 gene locus_tag LOCUS_22940 89167 90651 CDS product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529120.1 protein_id gnl|my_center|LOCUS_22940 91597 90689 gene locus_tag LOCUS_22950 91597 90689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337530.1 protein_id gnl|my_center|LOCUS_22950 92159 91710 gene locus_tag LOCUS_22960 92159 91710 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531925.1 protein_id gnl|my_center|LOCUS_22960 92472 92909 gene locus_tag LOCUS_22970 92472 92909 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_22970 92984 93352 gene locus_tag LOCUS_22980 92984 93352 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390179.1 protein_id gnl|my_center|LOCUS_22980 93345 94061 gene locus_tag LOCUS_22990 93345 94061 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_22990 94073 94708 gene locus_tag LOCUS_23000 gene tpm 94073 94708 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC3 protein_id gnl|my_center|LOCUS_23000 95009 94776 gene locus_tag LOCUS_23010 gene fdsD 95009 94776 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563132.1 protein_id gnl|my_center|LOCUS_23010 95829 94999 gene locus_tag LOCUS_23020 gene fdhD 95829 94999 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC79 protein_id gnl|my_center|LOCUS_23020 98752 95861 gene locus_tag LOCUS_23030 gene fdsA 98752 95861 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970349.1 protein_id gnl|my_center|LOCUS_23030 100309 98753 gene locus_tag LOCUS_23040 gene fdsB 100309 98753 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709577.1 protein_id gnl|my_center|LOCUS_23040 100785 100306 gene locus_tag LOCUS_23050 gene fdsG 100785 100306 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530346.1 protein_id gnl|my_center|LOCUS_23050 101776 100880 gene locus_tag LOCUS_23060 101776 100880 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528010.1 protein_id gnl|my_center|LOCUS_23060 102199 101864 gene locus_tag LOCUS_23070 102199 101864 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_23070 102701 102216 gene locus_tag LOCUS_23080 102701 102216 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971634.1 protein_id gnl|my_center|LOCUS_23080 104393 102723 gene locus_tag LOCUS_23090 104393 102723 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969242.1 protein_id gnl|my_center|LOCUS_23090 104727 104404 gene locus_tag LOCUS_23100 104727 104404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537445.1 protein_id gnl|my_center|LOCUS_23100 106183 104738 gene locus_tag LOCUS_23110 gene cysG 106183 104738 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707862.1 protein_id gnl|my_center|LOCUS_23110 106363 106965 gene locus_tag LOCUS_23120 106363 106965 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969240.1 protein_id gnl|my_center|LOCUS_23120 106981 107397 gene locus_tag LOCUS_23130 106981 107397 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 protein_id gnl|my_center|LOCUS_23130 107643 108470 gene locus_tag LOCUS_23140 gene mazG 107643 108470 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537451.1 protein_id gnl|my_center|LOCUS_23140 109166 108498 gene locus_tag LOCUS_23150 109166 108498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 protein_id gnl|my_center|LOCUS_23150 110383 109163 gene locus_tag LOCUS_23160 110383 109163 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 protein_id gnl|my_center|LOCUS_23160 111928 110681 gene locus_tag LOCUS_23170 gene hflx 111928 110681 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U5B2 protein_id gnl|my_center|LOCUS_23170 112322 112074 gene locus_tag LOCUS_23180 gene hfq 112322 112074 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q84 protein_id gnl|my_center|LOCUS_23180 114075 112606 gene locus_tag LOCUS_23190 114075 112606 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_23190 115456 114080 gene locus_tag LOCUS_23200 gene trkA 115456 114080 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 protein_id gnl|my_center|LOCUS_23200 116887 115523 gene locus_tag LOCUS_23210 gene ntrX 116887 115523 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707857.1 protein_id gnl|my_center|LOCUS_23210 119177 116877 gene locus_tag LOCUS_23220 gene ntrY 119177 116877 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969238.1 protein_id gnl|my_center|LOCUS_23220 120860 119409 gene locus_tag LOCUS_23230 120860 119409 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 protein_id gnl|my_center|LOCUS_23230 122028 120865 gene locus_tag LOCUS_23240 gene ntrB 122028 120865 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707854.1 protein_id gnl|my_center|LOCUS_23240 123041 122025 gene locus_tag LOCUS_23250 gene nifR 123041 122025 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBL4 protein_id gnl|my_center|LOCUS_23250 123203 124405 gene locus_tag LOCUS_23260 gene ispDF 123203 124405 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBL3 protein_id gnl|my_center|LOCUS_23260 124402 124926 gene locus_tag LOCUS_23270 gene cinA 124402 124926 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971625.1 protein_id gnl|my_center|LOCUS_23270 125397 124936 gene locus_tag LOCUS_23280 125397 124936 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531488.1 protein_id gnl|my_center|LOCUS_23280 125687 126046 gene locus_tag LOCUS_23290 125687 126046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 126871 126077 gene locus_tag LOCUS_23300 126871 126077 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_23300 127199 126846 gene locus_tag LOCUS_23310 127199 126846 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_23310 127563 128573 gene locus_tag LOCUS_23320 127563 128573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 protein_id gnl|my_center|LOCUS_23320 128644 129429 gene locus_tag LOCUS_23330 128644 129429 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_23330 129416 130267 gene locus_tag LOCUS_23340 129416 130267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_23340 130271 131590 gene locus_tag LOCUS_23350 130271 131590 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_23350 131594 132991 gene locus_tag LOCUS_23360 131594 132991 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_23360 133002 133583 gene locus_tag LOCUS_23370 133002 133583 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531131.1 protein_id gnl|my_center|LOCUS_23370 133583 134170 gene locus_tag LOCUS_23380 133583 134170 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_23380 134812 134177 gene locus_tag LOCUS_23390 134812 134177 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709491.1 protein_id gnl|my_center|LOCUS_23390 135832 134822 gene locus_tag LOCUS_23400 135832 134822 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536759.1 protein_id gnl|my_center|LOCUS_23400 136713 135829 gene locus_tag LOCUS_23410 136713 135829 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532317.1 protein_id gnl|my_center|LOCUS_23410 137501 139816 gene locus_tag LOCUS_23420 137501 139816 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706642.1 protein_id gnl|my_center|LOCUS_23420 140743 139889 gene locus_tag LOCUS_23430 140743 139889 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1K8 protein_id gnl|my_center|LOCUS_23430 141811 140789 gene locus_tag LOCUS_23440 141811 140789 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338028.1 protein_id gnl|my_center|LOCUS_23440 142956 141808 gene locus_tag LOCUS_23450 142956 141808 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338029.1 protein_id gnl|my_center|LOCUS_23450 144517 143018 gene locus_tag LOCUS_23460 144517 143018 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565364.1 protein_id gnl|my_center|LOCUS_23460 145398 144622 gene locus_tag LOCUS_23470 145398 144622 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_23470 146427 145402 gene locus_tag LOCUS_23480 146427 145402 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_23480 147262 146429 gene locus_tag LOCUS_23490 147262 146429 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529669.1 protein_id gnl|my_center|LOCUS_23490 147607 148233 gene locus_tag LOCUS_23500 147607 148233 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064535.1 protein_id gnl|my_center|LOCUS_23500 148230 149474 gene locus_tag LOCUS_23510 148230 149474 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_23510 149474 150445 gene locus_tag LOCUS_23520 149474 150445 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_23520 150512 151549 gene locus_tag LOCUS_23530 150512 151549 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 protein_id gnl|my_center|LOCUS_23530 151719 152150 gene locus_tag LOCUS_23540 151719 152150 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708124.1 protein_id gnl|my_center|LOCUS_23540 152356 152838 gene locus_tag LOCUS_23550 152356 152838 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970026.1 protein_id gnl|my_center|LOCUS_23550 153817 153626 gene locus_tag LOCUS_23560 153817 153626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 153997 153824 gene locus_tag LOCUS_23570 153997 153824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 154845 154027 gene locus_tag LOCUS_23580 154845 154027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 155353 155694 gene locus_tag LOCUS_23590 155353 155694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310261.1 protein_id gnl|my_center|LOCUS_23590 156843 155710 gene locus_tag LOCUS_23600 gene tgt 156843 155710 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD32 protein_id gnl|my_center|LOCUS_23600 157439 156840 gene locus_tag LOCUS_23610 157439 156840 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970805.1 protein_id gnl|my_center|LOCUS_23610 158518 157436 gene locus_tag LOCUS_23620 gene queA 158518 157436 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB05 protein_id gnl|my_center|LOCUS_23620 159106 158591 gene locus_tag LOCUS_23630 159106 158591 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB07 protein_id gnl|my_center|LOCUS_23630 159710 159144 gene locus_tag LOCUS_23640 gene ppiA 159710 159144 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD29 protein_id gnl|my_center|LOCUS_23640 160307 159816 gene locus_tag LOCUS_23650 gene coaD 160307 159816 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PY8 protein_id gnl|my_center|LOCUS_23650 160774 160514 gene locus_tag LOCUS_23660 160774 160514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 160949 160809 gene locus_tag LOCUS_23670 160949 160809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 161291 161079 gene locus_tag LOCUS_23680 161291 161079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 161660 162571 gene locus_tag LOCUS_23690 161660 162571 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_23690 162693 162818 gene locus_tag LOCUS_23700 162693 162818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 163275 162904 gene locus_tag LOCUS_23710 163275 162904 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 protein_id gnl|my_center|LOCUS_23710 163911 163372 gene locus_tag LOCUS_23720 163911 163372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 164329 163898 gene locus_tag LOCUS_23730 164329 163898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_23730 165284 164403 gene locus_tag LOCUS_23740 165284 164403 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533547.1 protein_id gnl|my_center|LOCUS_23740 165416 165949 gene locus_tag LOCUS_23750 165416 165949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 166017 166349 gene locus_tag LOCUS_23760 166017 166349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 166351 166749 gene locus_tag LOCUS_23770 166351 166749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 166960 166727 gene locus_tag LOCUS_23780 166960 166727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 167132 166944 gene locus_tag LOCUS_23790 167132 166944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 167953 167249 gene locus_tag LOCUS_23800 167953 167249 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_23800 170517 168247 gene locus_tag LOCUS_23810 170517 168247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 173652 170821 gene locus_tag LOCUS_23820 gene gyrA 173652 170821 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD09 protein_id gnl|my_center|LOCUS_23820 173848 174477 gene locus_tag LOCUS_23830 173848 174477 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q03 protein_id gnl|my_center|LOCUS_23830 174490 174792 gene locus_tag LOCUS_23840 174490 174792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888165.1 protein_id gnl|my_center|LOCUS_23840 175199 174804 gene locus_tag LOCUS_23850 175199 174804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 175698 175285 gene locus_tag LOCUS_23860 175698 175285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_23860 176196 175786 gene locus_tag LOCUS_23870 176196 175786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 176773 176255 gene locus_tag LOCUS_23880 gene ssb 176773 176255 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L50 protein_id gnl|my_center|LOCUS_23880 177181 180102 gene locus_tag LOCUS_23890 gene uvrA 177181 180102 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8V5 protein_id gnl|my_center|LOCUS_23890 180184 180429 gene locus_tag LOCUS_23900 180184 180429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 180398 180640 gene locus_tag LOCUS_23910 180398 180640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 180637 180813 gene locus_tag LOCUS_23920 180637 180813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 180810 181610 gene locus_tag LOCUS_23930 180810 181610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708096.1 protein_id gnl|my_center|LOCUS_23930 182925 181657 gene locus_tag LOCUS_23940 182925 181657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974710.1 protein_id gnl|my_center|LOCUS_23940 183144 183629 gene locus_tag LOCUS_23950 183144 183629 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_23950 185006 183753 gene locus_tag LOCUS_23960 185006 183753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974677.1 protein_id gnl|my_center|LOCUS_23960 185126 185959 gene locus_tag LOCUS_23970 185126 185959 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530001.1 protein_id gnl|my_center|LOCUS_23970 187435 185963 gene locus_tag LOCUS_23980 187435 185963 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9A3 protein_id gnl|my_center|LOCUS_23980 187817 188155 gene locus_tag LOCUS_23990 gene glnB 187817 188155 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508042.1 protein_id gnl|my_center|LOCUS_23990 188214 189623 gene locus_tag LOCUS_24000 gene glnA 188214 189623 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIN7 protein_id gnl|my_center|LOCUS_24000 >Feature sequence09 259 678 gene locus_tag LOCUS_24010 259 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 675 1205 gene locus_tag LOCUS_24020 675 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1202 1900 gene locus_tag LOCUS_24030 1202 1900 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S48 protein_id gnl|my_center|LOCUS_24030 2107 1937 gene locus_tag LOCUS_24040 2107 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2907 2104 gene locus_tag LOCUS_24050 2907 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970721.1 protein_id gnl|my_center|LOCUS_24050 2845 3096 gene locus_tag LOCUS_24060 2845 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3940 3074 gene locus_tag LOCUS_24070 gene fixP3 3940 3074 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ZX5 protein_id gnl|my_center|LOCUS_24070 4101 3928 gene locus_tag LOCUS_24080 4101 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4835 4101 gene locus_tag LOCUS_24090 4835 4101 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970725.1 protein_id gnl|my_center|LOCUS_24090 6465 4840 gene locus_tag LOCUS_24100 6465 4840 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970726.1 protein_id gnl|my_center|LOCUS_24100 7245 6757 gene locus_tag LOCUS_24110 7245 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030561.1 protein_id gnl|my_center|LOCUS_24110 7583 7296 gene locus_tag LOCUS_24120 7583 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7857 7585 gene locus_tag LOCUS_24130 7857 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 8477 7857 gene locus_tag LOCUS_24140 8477 7857 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310196.1 protein_id gnl|my_center|LOCUS_24140 9064 8516 gene locus_tag LOCUS_24150 9064 8516 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967664.1 protein_id gnl|my_center|LOCUS_24150 10438 9083 gene locus_tag LOCUS_24160 10438 9083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707565.1 protein_id gnl|my_center|LOCUS_24160 10745 10500 gene locus_tag LOCUS_24170 10745 10500 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707564.1 protein_id gnl|my_center|LOCUS_24170 11032 11553 gene locus_tag LOCUS_24180 11032 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 11550 11780 gene locus_tag LOCUS_24190 11550 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 11777 12019 gene locus_tag LOCUS_24200 11777 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 12068 12220 gene locus_tag LOCUS_24210 12068 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 12499 12969 gene locus_tag LOCUS_24220 12499 12969 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339224.1 protein_id gnl|my_center|LOCUS_24220 13119 14825 gene locus_tag LOCUS_24230 13119 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 14936 15949 gene locus_tag LOCUS_24240 14936 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970412.1 protein_id gnl|my_center|LOCUS_24240 16185 18170 gene locus_tag LOCUS_24250 16185 18170 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_24250 18167 18991 gene locus_tag LOCUS_24260 18167 18991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337372.1 protein_id gnl|my_center|LOCUS_24260 18991 19950 gene locus_tag LOCUS_24270 18991 19950 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 protein_id gnl|my_center|LOCUS_24270 19953 20330 gene locus_tag LOCUS_24280 19953 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 20330 21409 gene locus_tag LOCUS_24290 20330 21409 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_24290 21520 22836 gene locus_tag LOCUS_24300 21520 22836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_24300 22926 23765 gene locus_tag LOCUS_24310 22926 23765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_24310 23864 24466 gene locus_tag LOCUS_24320 23864 24466 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338205.1 protein_id gnl|my_center|LOCUS_24320 24468 25631 gene locus_tag LOCUS_24330 24468 25631 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_24330 25688 26074 gene locus_tag LOCUS_24340 25688 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 26074 26454 gene locus_tag LOCUS_24350 26074 26454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_24350 26454 28070 gene locus_tag LOCUS_24360 gene mccA 26454 28070 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975572.1 protein_id gnl|my_center|LOCUS_24360 28125 28385 gene locus_tag LOCUS_24370 28125 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 28373 28822 gene locus_tag LOCUS_24380 28373 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 28819 30819 gene locus_tag LOCUS_24390 gene mccB 28819 30819 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887261.1 protein_id gnl|my_center|LOCUS_24390 30871 31485 gene locus_tag LOCUS_24400 30871 31485 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708402.1 protein_id gnl|my_center|LOCUS_24400 31655 34297 gene locus_tag LOCUS_24410 31655 34297 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708396.1 protein_id gnl|my_center|LOCUS_24410 34448 34672 gene locus_tag LOCUS_24420 34448 34672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969630.1 protein_id gnl|my_center|LOCUS_24420 34769 35260 gene locus_tag LOCUS_24430 34769 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552023.1 protein_id gnl|my_center|LOCUS_24430 35418 37979 gene locus_tag LOCUS_24440 35418 37979 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709080.1 protein_id gnl|my_center|LOCUS_24440 38021 38869 gene locus_tag LOCUS_24450 38021 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531154.1 protein_id gnl|my_center|LOCUS_24450 38968 39813 gene locus_tag LOCUS_24460 38968 39813 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708389.1 protein_id gnl|my_center|LOCUS_24460 39961 40728 gene locus_tag LOCUS_24470 39961 40728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 41752 40745 gene locus_tag LOCUS_24480 41752 40745 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531159.1 protein_id gnl|my_center|LOCUS_24480 42052 41864 gene locus_tag LOCUS_24490 42052 41864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 42156 43076 gene locus_tag LOCUS_24500 42156 43076 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_24500 43196 43561 gene locus_tag LOCUS_24510 43196 43561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 44789 43575 gene locus_tag LOCUS_24520 44789 43575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720126.1 protein_id gnl|my_center|LOCUS_24520 46919 44883 gene locus_tag LOCUS_24530 46919 44883 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_24530 47892 46927 gene locus_tag LOCUS_24540 47892 46927 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 protein_id gnl|my_center|LOCUS_24540 49071 47971 gene locus_tag LOCUS_24550 49071 47971 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UAD8 protein_id gnl|my_center|LOCUS_24550 49658 49068 gene locus_tag LOCUS_24560 49658 49068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531169.1 protein_id gnl|my_center|LOCUS_24560 49956 49651 gene locus_tag LOCUS_24570 49956 49651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969616.1 protein_id gnl|my_center|LOCUS_24570 49955 50182 gene locus_tag LOCUS_24580 49955 50182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 50869 50099 gene locus_tag LOCUS_24590 50869 50099 CDS product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969612.1 protein_id gnl|my_center|LOCUS_24590 51803 51159 gene locus_tag LOCUS_24600 51803 51159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384935.1 protein_id gnl|my_center|LOCUS_24600 52475 51921 gene locus_tag LOCUS_24610 52475 51921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531173.1 protein_id gnl|my_center|LOCUS_24610 53546 52848 gene locus_tag LOCUS_24620 53546 52848 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_24620 53798 55387 gene locus_tag LOCUS_24630 53798 55387 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975913.1 protein_id gnl|my_center|LOCUS_24630 55501 56217 gene locus_tag LOCUS_24640 55501 56217 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969610.1 protein_id gnl|my_center|LOCUS_24640 56746 57312 gene locus_tag LOCUS_24650 56746 57312 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708362.1 protein_id gnl|my_center|LOCUS_24650 57309 59333 gene locus_tag LOCUS_24660 57309 59333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531189.1 protein_id gnl|my_center|LOCUS_24660 59583 60185 gene locus_tag LOCUS_24670 59583 60185 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391188.1 protein_id gnl|my_center|LOCUS_24670 61284 60274 gene locus_tag LOCUS_24680 61284 60274 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708358.1 protein_id gnl|my_center|LOCUS_24680 62508 61453 gene locus_tag LOCUS_24690 62508 61453 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975906.1 protein_id gnl|my_center|LOCUS_24690 63388 62501 gene locus_tag LOCUS_24700 63388 62501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974853.1 protein_id gnl|my_center|LOCUS_24700 64600 63593 gene locus_tag LOCUS_24710 64600 63593 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707373.1 protein_id gnl|my_center|LOCUS_24710 65611 67077 gene locus_tag LOCUS_24720 gene cobQ 65611 67077 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDR9 protein_id gnl|my_center|LOCUS_24720 67144 67356 gene locus_tag LOCUS_24730 67144 67356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 67553 67732 gene locus_tag LOCUS_24740 gene cbtB 67553 67732 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708714.1 protein_id gnl|my_center|LOCUS_24740 67745 68470 gene locus_tag LOCUS_24750 67745 68470 CDS product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 protein_id gnl|my_center|LOCUS_24750 68467 68991 gene locus_tag LOCUS_24760 gene cobU 68467 68991 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530724.1 protein_id gnl|my_center|LOCUS_24760 68996 70048 gene locus_tag LOCUS_24770 gene cobW 68996 70048 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 protein_id gnl|my_center|LOCUS_24770 70053 73928 gene locus_tag LOCUS_24780 gene cobN 70053 73928 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708348.1 protein_id gnl|my_center|LOCUS_24780 73977 74411 gene locus_tag LOCUS_24790 73977 74411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 74475 75119 gene locus_tag LOCUS_24800 74475 75119 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975896.1 protein_id gnl|my_center|LOCUS_24800 75133 75564 gene locus_tag LOCUS_24810 75133 75564 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975895.1 protein_id gnl|my_center|LOCUS_24810 76355 75570 gene locus_tag LOCUS_24820 76355 75570 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ92 protein_id gnl|my_center|LOCUS_24820 76494 77378 gene locus_tag LOCUS_24830 76494 77378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 77630 77887 gene locus_tag LOCUS_24840 77630 77887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 77891 79117 gene locus_tag LOCUS_24850 77891 79117 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_24850 79121 79762 gene locus_tag LOCUS_24860 gene cobH 79121 79762 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_24860 79755 80996 gene locus_tag LOCUS_24870 79755 80996 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_24870 80993 81721 gene locus_tag LOCUS_24880 gene cobI 80993 81721 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199182.1 protein_id gnl|my_center|LOCUS_24880 81718 83577 gene locus_tag LOCUS_24890 gene cobJ 81718 83577 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526968.1 protein_id gnl|my_center|LOCUS_24890 83574 84356 gene locus_tag LOCUS_24900 83574 84356 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_24900 85061 84366 gene locus_tag LOCUS_24910 gene cobK 85061 84366 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_24910 86160 85051 gene locus_tag LOCUS_24920 gene cbiD 86160 85051 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8GDE1 protein_id gnl|my_center|LOCUS_24920 86269 87114 gene locus_tag LOCUS_24930 gene cobA 86269 87114 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969585.1 protein_id gnl|my_center|LOCUS_24930 87111 88409 gene locus_tag LOCUS_24940 gene cobB 87111 88409 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDQ9 protein_id gnl|my_center|LOCUS_24940 88413 89432 gene locus_tag LOCUS_24950 88413 89432 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975882.1 protein_id gnl|my_center|LOCUS_24950 89432 90403 gene locus_tag LOCUS_24960 gene cobD 89432 90403 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDQ7 protein_id gnl|my_center|LOCUS_24960 90646 90966 gene locus_tag LOCUS_24970 90646 90966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 92050 91079 gene locus_tag LOCUS_24980 gene msbB 92050 91079 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316336.1 protein_id gnl|my_center|LOCUS_24980 93096 92068 gene locus_tag LOCUS_24990 93096 92068 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531222.1 protein_id gnl|my_center|LOCUS_24990 94544 93258 gene locus_tag LOCUS_25000 94544 93258 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975877.1 protein_id gnl|my_center|LOCUS_25000 95763 94558 gene locus_tag LOCUS_25010 95763 94558 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975878.1 protein_id gnl|my_center|LOCUS_25010 96245 95760 gene locus_tag LOCUS_25020 96245 95760 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969580.1 protein_id gnl|my_center|LOCUS_25020 96554 96270 gene locus_tag LOCUS_25030 gene acpXL 96554 96270 CDS product acyl carrier protein AcpXL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UF02 protein_id gnl|my_center|LOCUS_25030 98024 96675 gene locus_tag LOCUS_25040 gene hemN 98024 96675 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIV7 protein_id gnl|my_center|LOCUS_25040 98182 98907 gene locus_tag LOCUS_25050 98182 98907 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708340.1 protein_id gnl|my_center|LOCUS_25050 99231 99515 gene locus_tag LOCUS_25060 99231 99515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 99524 99928 gene locus_tag LOCUS_25070 99524 99928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 100313 101977 gene locus_tag LOCUS_25080 gene etf 100313 101977 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708572.1 protein_id gnl|my_center|LOCUS_25080 102798 102253 gene locus_tag LOCUS_25090 102798 102253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_25090 104337 103384 gene locus_tag LOCUS_25100 104337 103384 CDS product DNA/RNA helicase superfamily I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004240.1 protein_id gnl|my_center|LOCUS_25100 106045 104447 gene locus_tag LOCUS_25110 106045 104447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 protein_id gnl|my_center|LOCUS_25110 107964 106465 gene locus_tag LOCUS_25120 gene amn 107964 106465 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8Q0 protein_id gnl|my_center|LOCUS_25120 108292 108119 gene locus_tag LOCUS_25130 108292 108119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 109089 108751 gene locus_tag LOCUS_25140 109089 108751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969008.1 protein_id gnl|my_center|LOCUS_25140 109497 109826 gene locus_tag LOCUS_25150 109497 109826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974866.1 protein_id gnl|my_center|LOCUS_25150 111119 110007 gene locus_tag LOCUS_25160 111119 110007 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707388.1 protein_id gnl|my_center|LOCUS_25160 111118 111417 gene locus_tag LOCUS_25170 111118 111417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 111375 112331 gene locus_tag LOCUS_25180 111375 112331 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 protein_id gnl|my_center|LOCUS_25180 112444 113949 gene locus_tag LOCUS_25190 112444 113949 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAZ4 protein_id gnl|my_center|LOCUS_25190 114053 115540 gene locus_tag LOCUS_25200 gene glpK 114053 115540 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG71 protein_id gnl|my_center|LOCUS_25200 115672 116043 gene locus_tag LOCUS_25210 115672 116043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 117430 116057 gene locus_tag LOCUS_25220 117430 116057 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969771.1 protein_id gnl|my_center|LOCUS_25220 118702 117521 gene locus_tag LOCUS_25230 gene pobA 118702 117521 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976283.1 protein_id gnl|my_center|LOCUS_25230 119757 118699 gene locus_tag LOCUS_25240 gene pcaB 119757 118699 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973940.1 protein_id gnl|my_center|LOCUS_25240 120964 119759 gene locus_tag LOCUS_25250 120964 119759 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 protein_id gnl|my_center|LOCUS_25250 121758 120964 gene locus_tag LOCUS_25260 121758 120964 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528953.1 protein_id gnl|my_center|LOCUS_25260 122609 121755 gene locus_tag LOCUS_25270 122609 121755 CDS product 3-oxoadipate--succinyl-CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528952.1 protein_id gnl|my_center|LOCUS_25270 123232 122624 gene locus_tag LOCUS_25280 123232 122624 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532961.1 protein_id gnl|my_center|LOCUS_25280 123974 123234 gene locus_tag LOCUS_25290 gene pcaH 123974 123234 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888187.1 protein_id gnl|my_center|LOCUS_25290 124366 123971 gene locus_tag LOCUS_25300 gene pcaC 124366 123971 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976278.1 protein_id gnl|my_center|LOCUS_25300 124464 125381 gene locus_tag LOCUS_25310 124464 125381 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888190.1 protein_id gnl|my_center|LOCUS_25310 125470 126231 gene locus_tag LOCUS_25320 125470 126231 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 protein_id gnl|my_center|LOCUS_25320 126700 127845 gene locus_tag LOCUS_25330 126700 127845 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_25330 127842 130973 gene locus_tag LOCUS_25340 127842 130973 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_25340 132027 131056 gene locus_tag LOCUS_25350 132027 131056 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064942.1 protein_id gnl|my_center|LOCUS_25350 132497 133540 gene locus_tag LOCUS_25360 132497 133540 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_25360 133537 134433 gene locus_tag LOCUS_25370 133537 134433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_25370 134430 135263 gene locus_tag LOCUS_25380 134430 135263 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_25380 135297 136364 gene locus_tag LOCUS_25390 135297 136364 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 protein_id gnl|my_center|LOCUS_25390 136806 136570 gene locus_tag LOCUS_25400 136806 136570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 138028 136823 gene locus_tag LOCUS_25410 138028 136823 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968121.1 protein_id gnl|my_center|LOCUS_25410 139541 138030 gene locus_tag LOCUS_25420 139541 138030 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_25420 141142 139538 gene locus_tag LOCUS_25430 141142 139538 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_25430 141245 141865 gene locus_tag LOCUS_25440 gene betI 141245 141865 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63KK9 protein_id gnl|my_center|LOCUS_25440 142132 142998 gene locus_tag LOCUS_25450 142132 142998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 143088 143690 gene locus_tag LOCUS_25460 gene betI 143088 143690 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62CH6 protein_id gnl|my_center|LOCUS_25460 143705 144787 gene locus_tag LOCUS_25470 143705 144787 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 protein_id gnl|my_center|LOCUS_25470 145994 144906 gene locus_tag LOCUS_25480 145994 144906 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J201 protein_id gnl|my_center|LOCUS_25480 146851 146045 gene locus_tag LOCUS_25490 146851 146045 CDS product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_25490 147768 146848 gene locus_tag LOCUS_25500 147768 146848 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_25500 148002 149396 gene locus_tag LOCUS_25510 148002 149396 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339390.1 protein_id gnl|my_center|LOCUS_25510 150696 149494 gene locus_tag LOCUS_25520 150696 149494 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_25520 152208 150895 gene locus_tag LOCUS_25530 152208 150895 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_25530 152707 152201 gene locus_tag LOCUS_25540 152707 152201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 153805 152783 gene locus_tag LOCUS_25550 153805 152783 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_25550 154422 153910 gene locus_tag LOCUS_25560 154422 153910 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 protein_id gnl|my_center|LOCUS_25560 154589 155548 gene locus_tag LOCUS_25570 154589 155548 CDS product vanillate O-demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086183.1 protein_id gnl|my_center|LOCUS_25570 155559 156902 gene locus_tag LOCUS_25580 155559 156902 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086184.1 protein_id gnl|my_center|LOCUS_25580 156899 157378 gene locus_tag LOCUS_25590 156899 157378 CDS product aromatic 1,2-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 protein_id gnl|my_center|LOCUS_25590 157375 159018 gene locus_tag LOCUS_25600 157375 159018 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086186.1 protein_id gnl|my_center|LOCUS_25600 159015 160184 gene locus_tag LOCUS_25610 159015 160184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 protein_id gnl|my_center|LOCUS_25610 160181 161428 gene locus_tag LOCUS_25620 160181 161428 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086214.1 protein_id gnl|my_center|LOCUS_25620 161425 162222 gene locus_tag LOCUS_25630 161425 162222 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086215.1 protein_id gnl|my_center|LOCUS_25630 162219 162944 gene locus_tag LOCUS_25640 162219 162944 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086187.1 protein_id gnl|my_center|LOCUS_25640 163300 163112 gene locus_tag LOCUS_25650 163300 163112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25650 163886 163470 gene locus_tag LOCUS_25660 163886 163470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088906.1 protein_id gnl|my_center|LOCUS_25660 165592 164315 gene locus_tag LOCUS_25670 gene ordL 165592 164315 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 protein_id gnl|my_center|LOCUS_25670 166897 165665 gene locus_tag LOCUS_25680 gene aatB 166897 165665 CDS product aspartate aminotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58350 protein_id gnl|my_center|LOCUS_25680 168431 166905 gene locus_tag LOCUS_25690 168431 166905 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709773.1 protein_id gnl|my_center|LOCUS_25690 168431 168619 gene locus_tag LOCUS_25700 168431 168619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 170051 168654 gene locus_tag LOCUS_25710 170051 168654 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970545.1 protein_id gnl|my_center|LOCUS_25710 170158 171063 gene locus_tag LOCUS_25720 170158 171063 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 protein_id gnl|my_center|LOCUS_25720 172199 171216 gene locus_tag LOCUS_25730 172199 171216 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267240.1 protein_id gnl|my_center|LOCUS_25730 174296 172254 gene locus_tag LOCUS_25740 174296 172254 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_25740 175600 174320 gene locus_tag LOCUS_25750 175600 174320 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_25750 176130 175597 gene locus_tag LOCUS_25760 176130 175597 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336873.1 protein_id gnl|my_center|LOCUS_25760 177207 176197 gene locus_tag LOCUS_25770 177207 176197 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391960.1 protein_id gnl|my_center|LOCUS_25770 177968 177240 gene locus_tag LOCUS_25780 177968 177240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence10 121 330 gene locus_tag LOCUS_25790 121 330 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886880.1 protein_id gnl|my_center|LOCUS_25790 811 626 gene locus_tag LOCUS_25800 gene rpmF 811 626 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE65 protein_id gnl|my_center|LOCUS_25800 1639 992 gene locus_tag LOCUS_25810 gene gst8 1639 992 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970529.1 protein_id gnl|my_center|LOCUS_25810 2379 1714 gene locus_tag LOCUS_25820 gene mtgA 2379 1714 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L23 protein_id gnl|my_center|LOCUS_25820 2650 2444 gene locus_tag LOCUS_25830 2650 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2665 3582 gene locus_tag LOCUS_25840 2665 3582 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709755.1 protein_id gnl|my_center|LOCUS_25840 3755 6247 gene locus_tag LOCUS_25850 3755 6247 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529222.1 protein_id gnl|my_center|LOCUS_25850 7636 6395 gene locus_tag LOCUS_25860 gene ispG 7636 6395 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE79 protein_id gnl|my_center|LOCUS_25860 8251 7793 gene locus_tag LOCUS_25870 8251 7793 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_25870 8550 9347 gene locus_tag LOCUS_25880 8550 9347 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090097.1 protein_id gnl|my_center|LOCUS_25880 9666 9355 gene locus_tag LOCUS_25890 9666 9355 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 protein_id gnl|my_center|LOCUS_25890 10651 9806 gene locus_tag LOCUS_25900 10651 9806 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529679.1 protein_id gnl|my_center|LOCUS_25900 10780 11574 gene locus_tag LOCUS_25910 10780 11574 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969776.1 protein_id gnl|my_center|LOCUS_25910 11668 12195 gene locus_tag LOCUS_25920 11668 12195 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_25920 12192 13526 gene locus_tag LOCUS_25930 12192 13526 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_25930 13571 14623 gene locus_tag LOCUS_25940 13571 14623 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_25940 14812 16176 gene locus_tag LOCUS_25950 14812 16176 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969775.1 protein_id gnl|my_center|LOCUS_25950 16250 17638 gene locus_tag LOCUS_25960 16250 17638 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969774.1 protein_id gnl|my_center|LOCUS_25960 17635 18780 gene locus_tag LOCUS_25970 17635 18780 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976258.1 protein_id gnl|my_center|LOCUS_25970 19026 19769 gene locus_tag LOCUS_25980 19026 19769 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067347.1 protein_id gnl|my_center|LOCUS_25980 20012 23470 gene locus_tag LOCUS_25990 20012 23470 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE85 protein_id gnl|my_center|LOCUS_25990 23661 24065 gene locus_tag LOCUS_26000 23661 24065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 protein_id gnl|my_center|LOCUS_26000 24514 24083 gene locus_tag LOCUS_26010 24514 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_26010 25302 24709 gene locus_tag LOCUS_26020 25302 24709 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709752.1 protein_id gnl|my_center|LOCUS_26020 25545 26720 gene locus_tag LOCUS_26030 25545 26720 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709751.1 protein_id gnl|my_center|LOCUS_26030 26753 27478 gene locus_tag LOCUS_26040 26753 27478 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529183.1 protein_id gnl|my_center|LOCUS_26040 27565 28260 gene locus_tag LOCUS_26050 gene gst 27565 28260 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974730.1 protein_id gnl|my_center|LOCUS_26050 29152 32355 gene locus_tag LOCUS_26060 29152 32355 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067322.1 protein_id gnl|my_center|LOCUS_26060 32366 32755 gene locus_tag LOCUS_26070 32366 32755 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_26070 33029 33367 gene locus_tag LOCUS_26080 33029 33367 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_26080 33783 34355 gene locus_tag LOCUS_26090 33783 34355 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535785.1 protein_id gnl|my_center|LOCUS_26090 34864 35727 gene locus_tag LOCUS_26100 gene rpoH2 34864 35727 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XCP8 protein_id gnl|my_center|LOCUS_26100 37320 35839 gene locus_tag LOCUS_26110 37320 35839 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709743.1 protein_id gnl|my_center|LOCUS_26110 38276 37542 gene locus_tag LOCUS_26120 gene thiQ 38276 37542 CDS product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY12 protein_id gnl|my_center|LOCUS_26120 39912 38299 gene locus_tag LOCUS_26130 gene thiP 39912 38299 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067315.1 protein_id gnl|my_center|LOCUS_26130 40942 39929 gene locus_tag LOCUS_26140 gene thiB 40942 39929 CDS product thiamine transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972512.1 protein_id gnl|my_center|LOCUS_26140 41150 41803 gene locus_tag LOCUS_26150 41150 41803 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972515.1 protein_id gnl|my_center|LOCUS_26150 41806 43644 gene locus_tag LOCUS_26160 41806 43644 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972514.1 protein_id gnl|my_center|LOCUS_26160 44053 43679 gene locus_tag LOCUS_26170 44053 43679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 44248 45090 gene locus_tag LOCUS_26180 44248 45090 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 protein_id gnl|my_center|LOCUS_26180 45166 46362 gene locus_tag LOCUS_26190 45166 46362 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528870.1 protein_id gnl|my_center|LOCUS_26190 46662 47600 gene locus_tag LOCUS_26200 gene metA 46662 47600 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWE8 protein_id gnl|my_center|LOCUS_26200 47605 48069 gene locus_tag LOCUS_26210 47605 48069 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 protein_id gnl|my_center|LOCUS_26210 48317 49501 gene locus_tag LOCUS_26220 48317 49501 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 protein_id gnl|my_center|LOCUS_26220 49579 50589 gene locus_tag LOCUS_26230 gene galM 49579 50589 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9X2 protein_id gnl|my_center|LOCUS_26230 51214 50669 gene locus_tag LOCUS_26240 51214 50669 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_26240 52143 51376 gene locus_tag LOCUS_26250 52143 51376 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040191.1 protein_id gnl|my_center|LOCUS_26250 52251 52538 gene locus_tag LOCUS_26260 52251 52538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816969.1 protein_id gnl|my_center|LOCUS_26260 52550 53731 gene locus_tag LOCUS_26270 52550 53731 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_26270 53756 54688 gene locus_tag LOCUS_26280 53756 54688 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_26280 54685 55689 gene locus_tag LOCUS_26290 54685 55689 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_26290 57045 55723 gene locus_tag LOCUS_26300 57045 55723 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_26300 57572 57042 gene locus_tag LOCUS_26310 57572 57042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 58845 57565 gene locus_tag LOCUS_26320 58845 57565 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_26320 59975 58926 gene locus_tag LOCUS_26330 59975 58926 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_26330 60686 60417 gene locus_tag LOCUS_26340 60686 60417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 60588 60896 gene locus_tag LOCUS_26350 60588 60896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 61095 63443 gene locus_tag LOCUS_26360 61095 63443 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067095.1 protein_id gnl|my_center|LOCUS_26360 63462 64262 gene locus_tag LOCUS_26370 63462 64262 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 protein_id gnl|my_center|LOCUS_26370 65516 64329 gene locus_tag LOCUS_26380 gene dxr 65516 64329 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9M8 protein_id gnl|my_center|LOCUS_26380 66539 65646 gene locus_tag LOCUS_26390 66539 65646 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_26390 67320 66553 gene locus_tag LOCUS_26400 67320 66553 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528770.1 protein_id gnl|my_center|LOCUS_26400 67487 68707 gene locus_tag LOCUS_26410 67487 68707 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_26410 69604 68936 gene locus_tag LOCUS_26420 69604 68936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 70103 70654 gene locus_tag LOCUS_26430 70103 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 71788 70820 gene locus_tag LOCUS_26440 71788 70820 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_26440 73961 71790 gene locus_tag LOCUS_26450 73961 71790 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975360.1 protein_id gnl|my_center|LOCUS_26450 74556 74011 gene locus_tag LOCUS_26460 74556 74011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975361.1 protein_id gnl|my_center|LOCUS_26460 74857 74639 gene locus_tag LOCUS_26470 74857 74639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 75054 74854 gene locus_tag LOCUS_26480 75054 74854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 77385 75505 gene locus_tag LOCUS_26490 77385 75505 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708761.1 protein_id gnl|my_center|LOCUS_26490 77908 77468 gene locus_tag LOCUS_26500 77908 77468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 78414 79019 gene locus_tag LOCUS_26510 78414 79019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708763.1 protein_id gnl|my_center|LOCUS_26510 79160 79504 gene locus_tag LOCUS_26520 79160 79504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 79718 80056 gene locus_tag LOCUS_26530 79718 80056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 80373 80053 gene locus_tag LOCUS_26540 80373 80053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 80561 82489 gene locus_tag LOCUS_26550 80561 82489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 82695 83402 gene locus_tag LOCUS_26560 82695 83402 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_26560 83396 85762 gene locus_tag LOCUS_26570 83396 85762 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_26570 85769 87001 gene locus_tag LOCUS_26580 85769 87001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_26580 87255 87548 gene locus_tag LOCUS_26590 87255 87548 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084358.1 protein_id gnl|my_center|LOCUS_26590 87557 88408 gene locus_tag LOCUS_26600 87557 88408 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082850.1 protein_id gnl|my_center|LOCUS_26600 88876 88801 gene locus_tag LOCUS_t00230 88876 88801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 90128 88962 gene locus_tag LOCUS_26610 90128 88962 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529349.1 protein_id gnl|my_center|LOCUS_26610 90339 91532 gene locus_tag LOCUS_26620 90339 91532 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709238.1 protein_id gnl|my_center|LOCUS_26620 91551 92690 gene locus_tag LOCUS_26630 91551 92690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970130.1 protein_id gnl|my_center|LOCUS_26630 92940 92713 gene locus_tag LOCUS_26640 92940 92713 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970127.1 protein_id gnl|my_center|LOCUS_26640 94181 92937 gene locus_tag LOCUS_26650 94181 92937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 95334 94378 gene locus_tag LOCUS_26660 gene accA 95334 94378 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHX3 protein_id gnl|my_center|LOCUS_26660 96378 95437 gene locus_tag LOCUS_26670 gene xerD 96378 95437 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME3 protein_id gnl|my_center|LOCUS_26670 96539 96396 gene locus_tag LOCUS_26680 96539 96396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066787.1 protein_id gnl|my_center|LOCUS_26680 96787 97389 gene locus_tag LOCUS_26690 gene aroK 96787 97389 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCL5 protein_id gnl|my_center|LOCUS_26690 97386 98510 gene locus_tag LOCUS_26700 gene aroB 97386 98510 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHW9 protein_id gnl|my_center|LOCUS_26700 98507 99802 gene locus_tag LOCUS_26710 98507 99802 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_26710 100156 99854 gene locus_tag LOCUS_26720 100156 99854 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970118.1 protein_id gnl|my_center|LOCUS_26720 100303 100920 gene locus_tag LOCUS_26730 100303 100920 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066782.1 protein_id gnl|my_center|LOCUS_26730 100992 101987 gene locus_tag LOCUS_26740 100992 101987 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066781.1 protein_id gnl|my_center|LOCUS_26740 101999 103900 gene locus_tag LOCUS_26750 101999 103900 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066780.1 protein_id gnl|my_center|LOCUS_26750 103900 104922 gene locus_tag LOCUS_26760 103900 104922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970115.1 protein_id gnl|my_center|LOCUS_26760 105586 104960 gene locus_tag LOCUS_26770 105586 104960 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973191.1 protein_id gnl|my_center|LOCUS_26770 105970 105674 gene locus_tag LOCUS_26780 gene rpmB 105970 105674 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MF4 protein_id gnl|my_center|LOCUS_26780 106331 107155 gene locus_tag LOCUS_26790 106331 107155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066776.1 protein_id gnl|my_center|LOCUS_26790 107249 108106 gene locus_tag LOCUS_26800 107249 108106 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709218.1 protein_id gnl|my_center|LOCUS_26800 108103 108750 gene locus_tag LOCUS_26810 108103 108750 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529376.1 protein_id gnl|my_center|LOCUS_26810 109198 108728 gene locus_tag LOCUS_26820 109198 108728 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970112.1 protein_id gnl|my_center|LOCUS_26820 109971 109201 gene locus_tag LOCUS_26830 gene gloB 109971 109201 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHV7 protein_id gnl|my_center|LOCUS_26830 110178 110933 gene locus_tag LOCUS_26840 110178 110933 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970111.1 protein_id gnl|my_center|LOCUS_26840 111014 112111 gene locus_tag LOCUS_26850 gene hisC 111014 112111 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHV5 protein_id gnl|my_center|LOCUS_26850 112116 113060 gene locus_tag LOCUS_26860 112116 113060 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_26860 114071 113067 gene locus_tag LOCUS_26870 114071 113067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970108.1 protein_id gnl|my_center|LOCUS_26870 114215 114769 gene locus_tag LOCUS_26880 114215 114769 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J6 protein_id gnl|my_center|LOCUS_26880 115603 114749 gene locus_tag LOCUS_26890 gene plsC 115603 114749 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709210.1 protein_id gnl|my_center|LOCUS_26890 116389 115658 gene locus_tag LOCUS_26900 116389 115658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527433.1 protein_id gnl|my_center|LOCUS_26900 117387 116452 gene locus_tag LOCUS_26910 117387 116452 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970105.1 protein_id gnl|my_center|LOCUS_26910 117317 117508 gene locus_tag LOCUS_26920 117317 117508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 118096 117437 gene locus_tag LOCUS_26930 118096 117437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970104.1 protein_id gnl|my_center|LOCUS_26930 118316 118963 gene locus_tag LOCUS_26940 118316 118963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 119112 119654 gene locus_tag LOCUS_26950 gene hpt 119112 119654 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497442.1 protein_id gnl|my_center|LOCUS_26950 119754 120122 gene locus_tag LOCUS_26960 119754 120122 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709204.1 protein_id gnl|my_center|LOCUS_26960 122732 120150 gene locus_tag LOCUS_26970 122732 120150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709203.1 protein_id gnl|my_center|LOCUS_26970 124141 122873 gene locus_tag LOCUS_26980 gene lysA 124141 122873 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCI8 protein_id gnl|my_center|LOCUS_26980 124342 124151 gene locus_tag LOCUS_26990 124342 124151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 125787 124462 gene locus_tag LOCUS_27000 gene argH 125787 124462 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHU1 protein_id gnl|my_center|LOCUS_27000 125884 126558 gene locus_tag LOCUS_27010 125884 126558 CDS product thiol:disulfide interchange protein TlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709199.1 protein_id gnl|my_center|LOCUS_27010 126834 126631 gene locus_tag LOCUS_27020 126834 126631 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_27020 127461 127018 gene locus_tag LOCUS_27030 127461 127018 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_27030 128378 127497 gene locus_tag LOCUS_27040 128378 127497 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066755.1 protein_id gnl|my_center|LOCUS_27040 129437 128508 gene locus_tag LOCUS_27050 gene etfA 129437 128508 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973173.1 protein_id gnl|my_center|LOCUS_27050 130210 129461 gene locus_tag LOCUS_27060 130210 129461 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066753.1 protein_id gnl|my_center|LOCUS_27060 131224 130445 gene locus_tag LOCUS_27070 131224 130445 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970095.1 protein_id gnl|my_center|LOCUS_27070 131853 131275 gene locus_tag LOCUS_27080 131853 131275 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_27080 132125 131925 gene locus_tag LOCUS_27090 132125 131925 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066750.1 protein_id gnl|my_center|LOCUS_27090 133052 132210 gene locus_tag LOCUS_27100 133052 132210 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709192.1 protein_id gnl|my_center|LOCUS_27100 133154 134014 gene locus_tag LOCUS_27110 133154 134014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066748.1 protein_id gnl|my_center|LOCUS_27110 134109 134396 gene locus_tag LOCUS_27120 134109 134396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 135318 134398 gene locus_tag LOCUS_27130 gene gltX2 135318 134398 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709190.1 protein_id gnl|my_center|LOCUS_27130 135397 136044 gene locus_tag LOCUS_27140 135397 136044 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709189.1 protein_id gnl|my_center|LOCUS_27140 136161 136718 gene locus_tag LOCUS_27150 136161 136718 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533486.1 protein_id gnl|my_center|LOCUS_27150 137263 136787 gene locus_tag LOCUS_27160 137263 136787 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066744.1 protein_id gnl|my_center|LOCUS_27160 137895 137314 gene locus_tag LOCUS_27170 137895 137314 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_27170 138080 138164 gene locus_tag LOCUS_t00240 138080 138164 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 138350 139540 gene locus_tag LOCUS_27180 138350 139540 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_27180 139631 140659 gene locus_tag LOCUS_27190 139631 140659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 140760 140966 gene locus_tag LOCUS_27200 140760 140966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 140967 141449 gene locus_tag LOCUS_27210 140967 141449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 141446 142540 gene locus_tag LOCUS_27220 141446 142540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 142553 144106 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggctggaccgcgttctctgatctgataagct 144508 144203 gene locus_tag LOCUS_27230 gene cas2 144508 144203 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_27230 145326 144565 gene locus_tag LOCUS_27240 gene cas1 145326 144565 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_27240 148820 145548 gene locus_tag LOCUS_27250 gene cas9 148820 145548 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX87 protein_id gnl|my_center|LOCUS_27250 149473 151155 gene locus_tag LOCUS_27260 149473 151155 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709182.1 protein_id gnl|my_center|LOCUS_27260 152430 151156 gene locus_tag LOCUS_27270 152430 151156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970087.1 protein_id gnl|my_center|LOCUS_27270 153856 152435 gene locus_tag LOCUS_27280 153856 152435 CDS product polysaccharide biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973111.1 protein_id gnl|my_center|LOCUS_27280 153921 154154 gene locus_tag LOCUS_27290 153921 154154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 156986 154269 gene locus_tag LOCUS_27300 gene secA 156986 154269 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MI9 protein_id gnl|my_center|LOCUS_27300 157241 158092 gene locus_tag LOCUS_27310 gene ppiD 157241 158092 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CSN8 protein_id gnl|my_center|LOCUS_27310 158132 159373 gene locus_tag LOCUS_27320 gene argJ 158132 159373 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHR8 protein_id gnl|my_center|LOCUS_27320 159408 160166 gene locus_tag LOCUS_27330 159408 160166 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529443.1 protein_id gnl|my_center|LOCUS_27330 160171 160578 gene locus_tag LOCUS_27340 160171 160578 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709175.1 protein_id gnl|my_center|LOCUS_27340 160772 161095 gene locus_tag LOCUS_27350 160772 161095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533504.1 protein_id gnl|my_center|LOCUS_27350 161150 161314 gene locus_tag LOCUS_27360 161150 161314 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533686.1 protein_id gnl|my_center|LOCUS_27360 162144 161365 gene locus_tag LOCUS_27370 162144 161365 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973103.1 protein_id gnl|my_center|LOCUS_27370 162088 162315 gene locus_tag LOCUS_27380 162088 162315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 162462 163139 gene locus_tag LOCUS_27390 162462 163139 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709172.1 protein_id gnl|my_center|LOCUS_27390 163176 163436 gene locus_tag LOCUS_27400 163176 163436 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 protein_id gnl|my_center|LOCUS_27400 163440 164300 gene locus_tag LOCUS_27410 163440 164300 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709170.1 protein_id gnl|my_center|LOCUS_27410 164297 164722 gene locus_tag LOCUS_27420 164297 164722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709169.1 protein_id gnl|my_center|LOCUS_27420 164724 165308 gene locus_tag LOCUS_27430 164724 165308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 166063 165311 gene locus_tag LOCUS_27440 gene ubiG 166063 165311 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCF6 protein_id gnl|my_center|LOCUS_27440 166255 167529 gene locus_tag LOCUS_27450 gene lysC 166255 167529 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ7 protein_id gnl|my_center|LOCUS_27450 167677 169884 gene locus_tag LOCUS_27460 gene ptsP 167677 169884 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533522.1 protein_id gnl|my_center|LOCUS_27460 169894 170979 gene locus_tag LOCUS_27470 gene prfA 169894 170979 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MK5 protein_id gnl|my_center|LOCUS_27470 171029 171844 gene locus_tag LOCUS_27480 gene prmC 171029 171844 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG70 protein_id gnl|my_center|LOCUS_27480 172164 172940 gene locus_tag LOCUS_27490 172164 172940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973617.1 protein_id gnl|my_center|LOCUS_27490 173130 175760 gene locus_tag LOCUS_27500 gene clpB 173130 175760 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU92 protein_id gnl|my_center|LOCUS_27500 177944 175998 gene locus_tag LOCUS_27510 177944 175998 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066719.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence11 1579 116 gene locus_tag LOCUS_27520 1579 116 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528609.1 protein_id gnl|my_center|LOCUS_27520 2621 1851 gene locus_tag LOCUS_27530 2621 1851 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969394.1 protein_id gnl|my_center|LOCUS_27530 3784 2618 gene locus_tag LOCUS_27540 3784 2618 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 protein_id gnl|my_center|LOCUS_27540 4546 3938 gene locus_tag LOCUS_27550 4546 3938 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974531.1 protein_id gnl|my_center|LOCUS_27550 4941 4684 gene locus_tag LOCUS_27560 4941 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 5160 5855 gene locus_tag LOCUS_27570 5160 5855 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969819.1 protein_id gnl|my_center|LOCUS_27570 6201 6794 gene locus_tag LOCUS_27580 gene betI 6201 6794 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN0 protein_id gnl|my_center|LOCUS_27580 6791 8335 gene locus_tag LOCUS_27590 6791 8335 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532679.1 protein_id gnl|my_center|LOCUS_27590 8335 9126 gene locus_tag LOCUS_27600 8335 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 9136 10602 gene locus_tag LOCUS_27610 gene betB 9136 10602 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN4 protein_id gnl|my_center|LOCUS_27610 10973 10623 gene locus_tag LOCUS_27620 10973 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 11174 10977 gene locus_tag LOCUS_27630 11174 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 11306 12982 gene locus_tag LOCUS_27640 gene betA 11306 12982 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN3 protein_id gnl|my_center|LOCUS_27640 13714 15078 gene locus_tag LOCUS_27650 13714 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035368.1 protein_id gnl|my_center|LOCUS_27650 15273 15995 gene locus_tag LOCUS_27660 15273 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 16861 16076 gene locus_tag LOCUS_27670 gene pssB 16861 16076 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972316.1 protein_id gnl|my_center|LOCUS_27670 17136 16906 gene locus_tag LOCUS_27680 17136 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 17135 17965 gene locus_tag LOCUS_27690 gene cysH 17135 17965 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UH67 protein_id gnl|my_center|LOCUS_27690 17962 18894 gene locus_tag LOCUS_27700 gene cysD 17962 18894 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6Y4 protein_id gnl|my_center|LOCUS_27700 18894 20381 gene locus_tag LOCUS_27710 gene cysN 18894 20381 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56893 protein_id gnl|my_center|LOCUS_27710 21536 20463 gene locus_tag LOCUS_27720 21536 20463 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205693.1 protein_id gnl|my_center|LOCUS_27720 22624 23868 gene locus_tag LOCUS_27730 22624 23868 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887610.1 protein_id gnl|my_center|LOCUS_27730 24054 25001 gene locus_tag LOCUS_27740 24054 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003633.1 protein_id gnl|my_center|LOCUS_27740 28250 25065 gene locus_tag LOCUS_27750 28250 25065 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529677.1 protein_id gnl|my_center|LOCUS_27750 29491 28247 gene locus_tag LOCUS_27760 29491 28247 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976164.1 protein_id gnl|my_center|LOCUS_27760 29910 30434 gene locus_tag LOCUS_27770 gene idi 29910 30434 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z5D3 protein_id gnl|my_center|LOCUS_27770 31664 30501 gene locus_tag LOCUS_27780 31664 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 32127 31771 gene locus_tag LOCUS_27790 32127 31771 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528651.1 protein_id gnl|my_center|LOCUS_27790 32453 32124 gene locus_tag LOCUS_27800 32453 32124 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528650.1 protein_id gnl|my_center|LOCUS_27800 32527 33216 gene locus_tag LOCUS_27810 32527 33216 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968921.1 protein_id gnl|my_center|LOCUS_27810 35105 33243 gene locus_tag LOCUS_27820 35105 33243 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976355.1 protein_id gnl|my_center|LOCUS_27820 35304 35228 gene locus_tag LOCUS_t00250 35304 35228 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 35679 35431 gene locus_tag LOCUS_27830 35679 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708934.1 protein_id gnl|my_center|LOCUS_27830 35808 36986 gene locus_tag LOCUS_27840 35808 36986 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888021.1 protein_id gnl|my_center|LOCUS_27840 37081 38280 gene locus_tag LOCUS_27850 37081 38280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 38277 39413 gene locus_tag LOCUS_27860 38277 39413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 39680 40648 gene locus_tag LOCUS_27870 39680 40648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338241.1 protein_id gnl|my_center|LOCUS_27870 40645 43854 gene locus_tag LOCUS_27880 40645 43854 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338240.1 protein_id gnl|my_center|LOCUS_27880 44422 43895 gene locus_tag LOCUS_27890 gene mogA 44422 43895 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337009.1 protein_id gnl|my_center|LOCUS_27890 44784 46592 gene locus_tag LOCUS_27900 gene cheD 44784 46592 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972441.1 protein_id gnl|my_center|LOCUS_27900 48292 46679 gene locus_tag LOCUS_27910 48292 46679 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_27910 49146 48421 gene locus_tag LOCUS_27920 gene fnrN 49146 48421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971734.1 protein_id gnl|my_center|LOCUS_27920 49332 50060 gene locus_tag LOCUS_27930 49332 50060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_27930 50057 52432 gene locus_tag LOCUS_27940 50057 52432 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_27940 52437 53648 gene locus_tag LOCUS_27950 52437 53648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_27950 54376 53747 gene locus_tag LOCUS_27960 54376 53747 CDS product electron transporter SCO1/SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530973.1 protein_id gnl|my_center|LOCUS_27960 54880 54380 gene locus_tag LOCUS_27970 54880 54380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 55418 55062 gene locus_tag LOCUS_27980 55418 55062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975354.1 protein_id gnl|my_center|LOCUS_27980 56016 55621 gene locus_tag LOCUS_27990 56016 55621 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_27990 58515 56125 gene locus_tag LOCUS_28000 58515 56125 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_28000 58613 59194 gene locus_tag LOCUS_28010 58613 59194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 60836 59217 gene locus_tag LOCUS_28020 60836 59217 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_28020 61159 60995 gene locus_tag LOCUS_28030 61159 60995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 61450 62376 gene locus_tag LOCUS_28040 61450 62376 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225296.1 protein_id gnl|my_center|LOCUS_28040 62449 63705 gene locus_tag LOCUS_28050 62449 63705 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_28050 63716 64231 gene locus_tag LOCUS_28060 63716 64231 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_28060 64260 65129 gene locus_tag LOCUS_28070 64260 65129 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064335.1 protein_id gnl|my_center|LOCUS_28070 66163 65468 gene locus_tag LOCUS_28080 66163 65468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_28080 66941 66147 gene locus_tag LOCUS_28090 66941 66147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_28090 67863 66934 gene locus_tag LOCUS_28100 67863 66934 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_28100 68755 67868 gene locus_tag LOCUS_28110 68755 67868 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 protein_id gnl|my_center|LOCUS_28110 69917 68757 gene locus_tag LOCUS_28120 gene livJ 69917 68757 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837313.1 protein_id gnl|my_center|LOCUS_28120 70905 70147 gene locus_tag LOCUS_28130 70905 70147 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_28130 71141 72748 gene locus_tag LOCUS_28140 71141 72748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 73874 72828 gene locus_tag LOCUS_28150 73874 72828 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_28150 75094 73880 gene locus_tag LOCUS_28160 gene caiA 75094 73880 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_28160 75858 75103 gene locus_tag LOCUS_28170 75858 75103 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_28170 76175 76870 gene locus_tag LOCUS_28180 76175 76870 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_28180 76986 77180 gene locus_tag LOCUS_28190 76986 77180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 77111 77353 gene locus_tag LOCUS_28200 77111 77353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 78508 77696 gene locus_tag LOCUS_28210 gene menB 78508 77696 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 protein_id gnl|my_center|LOCUS_28210 79337 78555 gene locus_tag LOCUS_28220 79337 78555 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_28220 80553 79384 gene locus_tag LOCUS_28230 80553 79384 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_28230 81765 80581 gene locus_tag LOCUS_28240 81765 80581 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089103.1 protein_id gnl|my_center|LOCUS_28240 82138 83247 gene locus_tag LOCUS_28250 82138 83247 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_28250 83778 83278 gene locus_tag LOCUS_28260 83778 83278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 85433 84099 gene locus_tag LOCUS_28270 85433 84099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_28270 86686 85430 gene locus_tag LOCUS_28280 86686 85430 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039901.1 protein_id gnl|my_center|LOCUS_28280 87460 86729 gene locus_tag LOCUS_28290 87460 86729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_28290 88211 87453 gene locus_tag LOCUS_28300 88211 87453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_28300 89170 88208 gene locus_tag LOCUS_28310 89170 88208 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_28310 90055 89174 gene locus_tag LOCUS_28320 90055 89174 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_28320 91359 90151 gene locus_tag LOCUS_28330 91359 90151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_28330 91677 92471 gene locus_tag LOCUS_28340 gene fabG3 91677 92471 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707183.1 protein_id gnl|my_center|LOCUS_28340 92484 93641 gene locus_tag LOCUS_28350 92484 93641 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_28350 93686 95851 gene locus_tag LOCUS_28360 93686 95851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 96798 95848 gene locus_tag LOCUS_28370 96798 95848 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089104.1 protein_id gnl|my_center|LOCUS_28370 97610 96804 gene locus_tag LOCUS_28380 gene fadB 97610 96804 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089105.1 protein_id gnl|my_center|LOCUS_28380 97855 98040 gene locus_tag LOCUS_28390 97855 98040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 98242 98169 gene locus_tag LOCUS_t00260 98242 98169 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 99033 98452 gene locus_tag LOCUS_28400 99033 98452 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 protein_id gnl|my_center|LOCUS_28400 99227 100135 gene locus_tag LOCUS_28410 99227 100135 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707146.1 protein_id gnl|my_center|LOCUS_28410 100987 100145 gene locus_tag LOCUS_28420 100987 100145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974753.1 protein_id gnl|my_center|LOCUS_28420 101235 101666 gene locus_tag LOCUS_28430 101235 101666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 101741 102985 gene locus_tag LOCUS_28440 101741 102985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709437.1 protein_id gnl|my_center|LOCUS_28440 102982 103401 gene locus_tag LOCUS_28450 102982 103401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709436.1 protein_id gnl|my_center|LOCUS_28450 104473 103385 gene locus_tag LOCUS_28460 104473 103385 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_28460 107312 104640 gene locus_tag LOCUS_28470 gene ppdK 107312 104640 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707142.1 protein_id gnl|my_center|LOCUS_28470 107699 108841 gene locus_tag LOCUS_28480 107699 108841 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088658.1 protein_id gnl|my_center|LOCUS_28480 109820 108870 gene locus_tag LOCUS_28490 109820 108870 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201682.1 protein_id gnl|my_center|LOCUS_28490 113526 110062 gene locus_tag LOCUS_28500 gene smc 113526 110062 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHM8 protein_id gnl|my_center|LOCUS_28500 114474 113614 gene locus_tag LOCUS_28510 114474 113614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 115180 114668 gene locus_tag LOCUS_28520 115180 114668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707138.1 protein_id gnl|my_center|LOCUS_28520 115452 115640 gene locus_tag LOCUS_28530 115452 115640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 protein_id gnl|my_center|LOCUS_28530 115952 117004 gene locus_tag LOCUS_28540 gene mutY 115952 117004 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968924.1 protein_id gnl|my_center|LOCUS_28540 117001 117633 gene locus_tag LOCUS_28550 117001 117633 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971156.1 protein_id gnl|my_center|LOCUS_28550 119225 118107 gene locus_tag LOCUS_28560 119225 118107 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391267.1 protein_id gnl|my_center|LOCUS_28560 119487 119305 gene locus_tag LOCUS_28570 119487 119305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 120908 119775 gene locus_tag LOCUS_28580 gene ccrM 120908 119775 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJW0 protein_id gnl|my_center|LOCUS_28580 121170 121859 gene locus_tag LOCUS_28590 121170 121859 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971150.1 protein_id gnl|my_center|LOCUS_28590 122384 121872 gene locus_tag LOCUS_28600 122384 121872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968920.1 protein_id gnl|my_center|LOCUS_28600 122587 123990 gene locus_tag LOCUS_28610 gene thrC 122587 123990 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707124.1 protein_id gnl|my_center|LOCUS_28610 124009 125307 gene locus_tag LOCUS_28620 124009 125307 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707123.1 protein_id gnl|my_center|LOCUS_28620 125330 125953 gene locus_tag LOCUS_28630 125330 125953 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_28630 125950 128880 gene locus_tag LOCUS_28640 125950 128880 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974735.1 protein_id gnl|my_center|LOCUS_28640 129120 129557 gene locus_tag LOCUS_28650 129120 129557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 129559 130323 gene locus_tag LOCUS_28660 129559 130323 CDS product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969902.1 protein_id gnl|my_center|LOCUS_28660 132043 130364 gene locus_tag LOCUS_28670 gene fhs 132043 130364 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFQ8 protein_id gnl|my_center|LOCUS_28670 135399 132259 gene locus_tag LOCUS_28680 gene putA 135399 132259 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089996.1 protein_id gnl|my_center|LOCUS_28680 135488 135949 gene locus_tag LOCUS_28690 gene lrp 135488 135949 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089995.1 protein_id gnl|my_center|LOCUS_28690 136125 136808 gene locus_tag LOCUS_28700 136125 136808 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974644.1 protein_id gnl|my_center|LOCUS_28700 136826 137311 gene locus_tag LOCUS_28710 136826 137311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 138477 137365 gene locus_tag LOCUS_28720 138477 137365 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314644.1 protein_id gnl|my_center|LOCUS_28720 139771 138470 gene locus_tag LOCUS_28730 139771 138470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969905.1 protein_id gnl|my_center|LOCUS_28730 141684 139768 gene locus_tag LOCUS_28740 141684 139768 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066525.1 protein_id gnl|my_center|LOCUS_28740 142834 141689 gene locus_tag LOCUS_28750 142834 141689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066526.1 protein_id gnl|my_center|LOCUS_28750 143952 142864 gene locus_tag LOCUS_28760 143952 142864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066527.1 protein_id gnl|my_center|LOCUS_28760 144546 144145 gene locus_tag LOCUS_28770 144546 144145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 145273 144683 gene locus_tag LOCUS_28780 gene tdk 145273 144683 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N38 protein_id gnl|my_center|LOCUS_28780 145518 146447 gene locus_tag LOCUS_28790 145518 146447 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529956.1 protein_id gnl|my_center|LOCUS_28790 146517 147371 gene locus_tag LOCUS_28800 146517 147371 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529957.1 protein_id gnl|my_center|LOCUS_28800 147368 148429 gene locus_tag LOCUS_28810 147368 148429 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066530.1 protein_id gnl|my_center|LOCUS_28810 148480 149241 gene locus_tag LOCUS_28820 148480 149241 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_28820 149267 150022 gene locus_tag LOCUS_28830 149267 150022 CDS product pyridoxamine 5'-phosphate oxidase-like FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066531.1 protein_id gnl|my_center|LOCUS_28830 150132 150428 gene locus_tag LOCUS_28840 gene nolR 150132 150428 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314636.1 protein_id gnl|my_center|LOCUS_28840 152637 150694 gene locus_tag LOCUS_28850 152637 150694 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887884.1 protein_id gnl|my_center|LOCUS_28850 153326 152715 gene locus_tag LOCUS_28860 153326 152715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 protein_id gnl|my_center|LOCUS_28860 153771 154724 gene locus_tag LOCUS_28870 153771 154724 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920469.1 protein_id gnl|my_center|LOCUS_28870 154765 155469 gene locus_tag LOCUS_28880 154765 155469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_28880 155551 156585 gene locus_tag LOCUS_28890 155551 156585 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703041.1 protein_id gnl|my_center|LOCUS_28890 157728 156589 gene locus_tag LOCUS_28900 157728 156589 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227639.1 protein_id gnl|my_center|LOCUS_28900 160092 157819 gene locus_tag LOCUS_28910 160092 157819 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJC8 protein_id gnl|my_center|LOCUS_28910 161082 160240 gene locus_tag LOCUS_28920 161082 160240 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 protein_id gnl|my_center|LOCUS_28920 161288 162637 gene locus_tag LOCUS_28930 161288 162637 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_28930 162654 163964 gene locus_tag LOCUS_28940 162654 163964 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066584.1 protein_id gnl|my_center|LOCUS_28940 164181 164777 gene locus_tag LOCUS_28950 164181 164777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 164792 165424 gene locus_tag LOCUS_28960 164792 165424 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_28960 165424 166293 gene locus_tag LOCUS_28970 165424 166293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 167060 166311 gene locus_tag LOCUS_28980 167060 166311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 167148 167684 gene locus_tag LOCUS_28990 167148 167684 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_28990 168436 167720 gene locus_tag LOCUS_29000 168436 167720 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_29000 168837 168433 gene locus_tag LOCUS_29010 gene arsC 168837 168433 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339062.1 protein_id gnl|my_center|LOCUS_29010 169063 169821 gene locus_tag LOCUS_29020 169063 169821 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_29020 170489 169818 gene locus_tag LOCUS_29030 170489 169818 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530906.1 protein_id gnl|my_center|LOCUS_29030 170706 172034 gene locus_tag LOCUS_29040 170706 172034 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066540.1 protein_id gnl|my_center|LOCUS_29040 172037 173527 gene locus_tag LOCUS_29050 gene bauC 172037 173527 CDS product putative 3-oxopropanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I702 protein_id gnl|my_center|LOCUS_29050 173603 174853 gene locus_tag LOCUS_29060 173603 174853 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530909.1 protein_id gnl|my_center|LOCUS_29060 174857 175618 gene locus_tag LOCUS_29070 174857 175618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_29070 175658 176221 gene locus_tag LOCUS_29080 175658 176221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence12 8488 9006 gene locus_tag LOCUS_29090 8488 9006 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_29090 9051 9572 gene locus_tag LOCUS_29100 9051 9572 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_29100 9584 10105 gene locus_tag LOCUS_29110 9584 10105 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_29110 10148 11425 gene locus_tag LOCUS_29120 10148 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528767.1 protein_id gnl|my_center|LOCUS_29120 11436 11990 gene locus_tag LOCUS_29130 11436 11990 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528768.1 protein_id gnl|my_center|LOCUS_29130 12314 12027 gene locus_tag LOCUS_29140 12314 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528769.1 protein_id gnl|my_center|LOCUS_29140 12700 12317 gene locus_tag LOCUS_29150 12700 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 13245 12706 gene locus_tag LOCUS_29160 13245 12706 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528762.1 protein_id gnl|my_center|LOCUS_29160 13576 14136 gene locus_tag LOCUS_29170 13576 14136 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533014.1 protein_id gnl|my_center|LOCUS_29170 14133 15293 gene locus_tag LOCUS_29180 14133 15293 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061901.1 protein_id gnl|my_center|LOCUS_29180 15290 16426 gene locus_tag LOCUS_29190 15290 16426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533016.1 protein_id gnl|my_center|LOCUS_29190 17258 16419 gene locus_tag LOCUS_29200 17258 16419 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_29200 18129 17347 gene locus_tag LOCUS_29210 18129 17347 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975556.1 protein_id gnl|my_center|LOCUS_29210 18313 19629 gene locus_tag LOCUS_29220 18313 19629 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533024.1 protein_id gnl|my_center|LOCUS_29220 19743 20639 gene locus_tag LOCUS_29230 19743 20639 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533025.1 protein_id gnl|my_center|LOCUS_29230 20642 21508 gene locus_tag LOCUS_29240 20642 21508 CDS product maltose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 protein_id gnl|my_center|LOCUS_29240 21511 22608 gene locus_tag LOCUS_29250 21511 22608 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533027.1 protein_id gnl|my_center|LOCUS_29250 22611 23732 gene locus_tag LOCUS_29260 22611 23732 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_29260 23736 24065 gene locus_tag LOCUS_29270 23736 24065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975561.1 protein_id gnl|my_center|LOCUS_29270 24306 25373 gene locus_tag LOCUS_29280 24306 25373 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533030.1 protein_id gnl|my_center|LOCUS_29280 25376 25822 gene locus_tag LOCUS_29290 25376 25822 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533031.1 protein_id gnl|my_center|LOCUS_29290 25845 26579 gene locus_tag LOCUS_29300 25845 26579 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534628.1 protein_id gnl|my_center|LOCUS_29300 26603 27898 gene locus_tag LOCUS_29310 26603 27898 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534624.1 protein_id gnl|my_center|LOCUS_29310 27930 28769 gene locus_tag LOCUS_29320 27930 28769 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_29320 29590 28790 gene locus_tag LOCUS_29330 29590 28790 CDS product polysaccharide/polyol phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706700.1 protein_id gnl|my_center|LOCUS_29330 30365 29613 gene locus_tag LOCUS_29340 30365 29613 CDS product putative O-antigen/lipopolysaccharide transport integral membrane protein ABC transporter RfbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700955.1 protein_id gnl|my_center|LOCUS_29340 31307 30579 gene locus_tag LOCUS_29350 31307 30579 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405125.1 protein_id gnl|my_center|LOCUS_29350 32936 32175 gene locus_tag LOCUS_29360 32936 32175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 33876 33097 gene locus_tag LOCUS_29370 33876 33097 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651232.1 protein_id gnl|my_center|LOCUS_29370 34886 34029 gene locus_tag LOCUS_29380 34886 34029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 40159 34949 gene locus_tag LOCUS_29390 40159 34949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 42147 40792 gene locus_tag LOCUS_29400 42147 40792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 44197 42299 gene locus_tag LOCUS_29410 44197 42299 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532710.1 protein_id gnl|my_center|LOCUS_29410 45096 44197 gene locus_tag LOCUS_29420 gene cysD 45096 44197 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNR3 protein_id gnl|my_center|LOCUS_29420 46248 45352 gene locus_tag LOCUS_29430 46248 45352 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 protein_id gnl|my_center|LOCUS_29430 47313 46252 gene locus_tag LOCUS_29440 47313 46252 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNS7 protein_id gnl|my_center|LOCUS_29440 47885 47310 gene locus_tag LOCUS_29450 47885 47310 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061652.1 protein_id gnl|my_center|LOCUS_29450 48760 47885 gene locus_tag LOCUS_29460 48760 47885 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNS9 protein_id gnl|my_center|LOCUS_29460 49113 48829 gene locus_tag LOCUS_29470 49113 48829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 49988 49092 gene locus_tag LOCUS_29480 49988 49092 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 protein_id gnl|my_center|LOCUS_29480 51385 50426 gene locus_tag LOCUS_29490 51385 50426 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_29490 51494 52360 gene locus_tag LOCUS_29500 gene potB 51494 52360 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_29500 52360 53145 gene locus_tag LOCUS_29510 52360 53145 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_29510 53184 54329 gene locus_tag LOCUS_29520 53184 54329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 54392 55480 gene locus_tag LOCUS_29530 54392 55480 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89P52 protein_id gnl|my_center|LOCUS_29530 55477 56823 gene locus_tag LOCUS_29540 55477 56823 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_29540 56835 57761 gene locus_tag LOCUS_29550 56835 57761 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_29550 57764 58249 gene locus_tag LOCUS_29560 57764 58249 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 protein_id gnl|my_center|LOCUS_29560 58246 59268 gene locus_tag LOCUS_29570 58246 59268 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_29570 59265 60392 gene locus_tag LOCUS_29580 59265 60392 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 protein_id gnl|my_center|LOCUS_29580 60389 60736 gene locus_tag LOCUS_29590 60389 60736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527133.1 protein_id gnl|my_center|LOCUS_29590 61018 62793 gene locus_tag LOCUS_29600 61018 62793 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_29600 62801 64636 gene locus_tag LOCUS_29610 62801 64636 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975342.1 protein_id gnl|my_center|LOCUS_29610 64636 65799 gene locus_tag LOCUS_29620 64636 65799 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969301.1 protein_id gnl|my_center|LOCUS_29620 67113 65815 gene locus_tag LOCUS_29630 gene amaB 67113 65815 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_29630 67195 68754 gene locus_tag LOCUS_29640 67195 68754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975336.1 protein_id gnl|my_center|LOCUS_29640 68780 69769 gene locus_tag LOCUS_29650 68780 69769 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975337.1 protein_id gnl|my_center|LOCUS_29650 69769 71718 gene locus_tag LOCUS_29660 69769 71718 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_29660 71711 72694 gene locus_tag LOCUS_29670 71711 72694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_29670 72700 73488 gene locus_tag LOCUS_29680 72700 73488 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 protein_id gnl|my_center|LOCUS_29680 73485 74435 gene locus_tag LOCUS_29690 73485 74435 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969589.1 protein_id gnl|my_center|LOCUS_29690 75144 74629 gene locus_tag LOCUS_29700 75144 74629 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095212.1 protein_id gnl|my_center|LOCUS_29700 75429 75205 gene locus_tag LOCUS_29710 75429 75205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 75869 75462 gene locus_tag LOCUS_29720 75869 75462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 76213 75878 gene locus_tag LOCUS_29730 76213 75878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 77307 76348 gene locus_tag LOCUS_29740 77307 76348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 78546 77431 gene locus_tag LOCUS_29750 78546 77431 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084283.1 protein_id gnl|my_center|LOCUS_29750 80436 78730 gene locus_tag LOCUS_29760 80436 78730 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529277.1 protein_id gnl|my_center|LOCUS_29760 81336 80617 gene locus_tag LOCUS_29770 81336 80617 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_29770 81667 81470 gene locus_tag LOCUS_29780 81667 81470 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U6T2 protein_id gnl|my_center|LOCUS_29780 82367 81876 gene locus_tag LOCUS_29790 82367 81876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 82779 82444 gene locus_tag LOCUS_29800 82779 82444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 83902 82886 gene locus_tag LOCUS_29810 83902 82886 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529281.1 protein_id gnl|my_center|LOCUS_29810 84172 84008 gene locus_tag LOCUS_29820 84172 84008 CDS product UPF0391 membrane protein R00741 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RV0 protein_id gnl|my_center|LOCUS_29820 85042 84218 gene locus_tag LOCUS_29830 85042 84218 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708981.1 protein_id gnl|my_center|LOCUS_29830 85190 85384 gene locus_tag LOCUS_29840 85190 85384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706937.1 protein_id gnl|my_center|LOCUS_29840 85385 85969 gene locus_tag LOCUS_29850 85385 85969 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGE9 protein_id gnl|my_center|LOCUS_29850 86094 85912 gene locus_tag LOCUS_29860 86094 85912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 87492 86095 gene locus_tag LOCUS_29870 gene fumC1 87492 86095 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28894 protein_id gnl|my_center|LOCUS_29870 88018 87665 gene locus_tag LOCUS_29880 88018 87665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 88234 88500 gene locus_tag LOCUS_29890 88234 88500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 88605 89354 gene locus_tag LOCUS_29900 88605 89354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527328.1 protein_id gnl|my_center|LOCUS_29900 89466 89783 gene locus_tag LOCUS_29910 89466 89783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 91183 89798 gene locus_tag LOCUS_29920 91183 89798 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969410.1 protein_id gnl|my_center|LOCUS_29920 91342 91803 gene locus_tag LOCUS_29930 91342 91803 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969411.1 protein_id gnl|my_center|LOCUS_29930 92198 92926 gene locus_tag LOCUS_29940 92198 92926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 92923 94362 gene locus_tag LOCUS_29950 92923 94362 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_29950 94359 95813 gene locus_tag LOCUS_29960 94359 95813 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUQ1 protein_id gnl|my_center|LOCUS_29960 95849 97378 gene locus_tag LOCUS_29970 95849 97378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_29970 97472 98392 gene locus_tag LOCUS_29980 gene appB 97472 98392 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383488.1 protein_id gnl|my_center|LOCUS_29980 98392 99258 gene locus_tag LOCUS_29990 98392 99258 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 protein_id gnl|my_center|LOCUS_29990 99255 100835 gene locus_tag LOCUS_30000 99255 100835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812297.1 protein_id gnl|my_center|LOCUS_30000 100838 101617 gene locus_tag LOCUS_30010 100838 101617 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814560.1 protein_id gnl|my_center|LOCUS_30010 101654 102571 gene locus_tag LOCUS_30020 101654 102571 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 protein_id gnl|my_center|LOCUS_30020 102678 103631 gene locus_tag LOCUS_30030 gene dapA 102678 103631 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3TZB4 protein_id gnl|my_center|LOCUS_30030 103790 105016 gene locus_tag LOCUS_30040 103790 105016 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814559.1 protein_id gnl|my_center|LOCUS_30040 105988 105230 gene locus_tag LOCUS_30050 105988 105230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_30050 106758 105985 gene locus_tag LOCUS_30060 106758 105985 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391200.1 protein_id gnl|my_center|LOCUS_30060 107759 106764 gene locus_tag LOCUS_30070 107759 106764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 protein_id gnl|my_center|LOCUS_30070 108317 107874 gene locus_tag LOCUS_30080 108317 107874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 109062 108322 gene locus_tag LOCUS_30090 109062 108322 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967131.1 protein_id gnl|my_center|LOCUS_30090 110459 109059 gene locus_tag LOCUS_30100 110459 109059 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972531.1 protein_id gnl|my_center|LOCUS_30100 112404 110953 gene locus_tag LOCUS_30110 112404 110953 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_30110 113564 112401 gene locus_tag LOCUS_30120 113564 112401 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_30120 113722 115116 gene locus_tag LOCUS_30130 gene pcaB 113722 115116 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_30130 115109 116236 gene locus_tag LOCUS_30140 115109 116236 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029014.1 protein_id gnl|my_center|LOCUS_30140 116277 116759 gene locus_tag LOCUS_30150 116277 116759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 116801 117805 gene locus_tag LOCUS_30160 116801 117805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_30160 117818 119359 gene locus_tag LOCUS_30170 117818 119359 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816964.1 protein_id gnl|my_center|LOCUS_30170 119558 119367 gene locus_tag LOCUS_30180 119558 119367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 119610 120500 gene locus_tag LOCUS_30190 119610 120500 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_30190 120507 121313 gene locus_tag LOCUS_30200 120507 121313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 121363 122280 gene locus_tag LOCUS_30210 121363 122280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 123291 122608 gene locus_tag LOCUS_30220 123291 122608 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336836.1 protein_id gnl|my_center|LOCUS_30220 123452 124150 gene locus_tag LOCUS_30230 123452 124150 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 protein_id gnl|my_center|LOCUS_30230 124318 124533 gene locus_tag LOCUS_30240 124318 124533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 124517 125062 gene locus_tag LOCUS_30250 124517 125062 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089163.1 protein_id gnl|my_center|LOCUS_30250 125070 125831 gene locus_tag LOCUS_30260 125070 125831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 126321 127262 gene locus_tag LOCUS_30270 126321 127262 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_30270 127352 135700 gene locus_tag LOCUS_30280 gene ndvB 127352 135700 CDS product cyclic beta 1-2 glucan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037218.1 protein_id gnl|my_center|LOCUS_30280 136107 136523 gene locus_tag LOCUS_30290 136107 136523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 protein_id gnl|my_center|LOCUS_30290 138042 136786 gene locus_tag LOCUS_30300 138042 136786 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973590.1 protein_id gnl|my_center|LOCUS_30300 138221 138724 gene locus_tag LOCUS_30310 138221 138724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 138721 139698 gene locus_tag LOCUS_30320 138721 139698 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339125.1 protein_id gnl|my_center|LOCUS_30320 139700 141907 gene locus_tag LOCUS_30330 139700 141907 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706200.1 protein_id gnl|my_center|LOCUS_30330 141980 142210 gene locus_tag LOCUS_30340 141980 142210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 142278 143150 gene locus_tag LOCUS_30350 gene ku 142278 143150 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIG8 protein_id gnl|my_center|LOCUS_30350 143150 145636 gene locus_tag LOCUS_30360 143150 145636 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970164.1 protein_id gnl|my_center|LOCUS_30360 146057 145638 gene locus_tag LOCUS_30370 146057 145638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 146276 146494 gene locus_tag LOCUS_30380 146276 146494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530767.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence13 725 649 gene locus_tag LOCUS_t00270 725 649 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3717 1051 gene locus_tag LOCUS_30390 3717 1051 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709464.1 protein_id gnl|my_center|LOCUS_30390 4638 3940 gene locus_tag LOCUS_30400 4638 3940 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_30400 4913 5899 gene locus_tag LOCUS_30410 4913 5899 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 protein_id gnl|my_center|LOCUS_30410 6033 7547 gene locus_tag LOCUS_30420 6033 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30420 7540 7998 gene locus_tag LOCUS_30430 7540 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8934 8050 gene locus_tag LOCUS_30440 8934 8050 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_30440 10173 8983 gene locus_tag LOCUS_30450 10173 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_30450 10347 11501 gene locus_tag LOCUS_30460 10347 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_30460 11884 11615 gene locus_tag LOCUS_30470 11884 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 12356 13231 gene locus_tag LOCUS_30480 gene ureD 12356 13231 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH2 protein_id gnl|my_center|LOCUS_30480 13242 13544 gene locus_tag LOCUS_30490 gene ureA 13242 13544 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42887 protein_id gnl|my_center|LOCUS_30490 13683 14273 gene locus_tag LOCUS_30500 gene hupE 13683 14273 CDS product protein hupE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708865.1 protein_id gnl|my_center|LOCUS_30500 14301 14606 gene locus_tag LOCUS_30510 gene ureB 14301 14606 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH6 protein_id gnl|my_center|LOCUS_30510 14606 14917 gene locus_tag LOCUS_30520 14606 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 14929 15351 gene locus_tag LOCUS_30530 14929 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066608.1 protein_id gnl|my_center|LOCUS_30530 15408 17120 gene locus_tag LOCUS_30540 gene ureC 15408 17120 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH9 protein_id gnl|my_center|LOCUS_30540 17488 17655 gene locus_tag LOCUS_30550 17488 17655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 17823 18272 gene locus_tag LOCUS_30560 17823 18272 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_30560 18339 18845 gene locus_tag LOCUS_30570 18339 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 18766 19056 gene locus_tag LOCUS_30580 18766 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 19053 19712 gene locus_tag LOCUS_30590 gene ureF 19053 19712 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCI3 protein_id gnl|my_center|LOCUS_30590 19709 20341 gene locus_tag LOCUS_30600 gene ureG 19709 20341 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MY5 protein_id gnl|my_center|LOCUS_30600 21079 20345 gene locus_tag LOCUS_30610 21079 20345 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_30610 21911 21117 gene locus_tag LOCUS_30620 21911 21117 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 protein_id gnl|my_center|LOCUS_30620 22860 21916 gene locus_tag LOCUS_30630 22860 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061414.1 protein_id gnl|my_center|LOCUS_30630 24272 22863 gene locus_tag LOCUS_30640 24272 22863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708923.1 protein_id gnl|my_center|LOCUS_30640 24538 25425 gene locus_tag LOCUS_30650 24538 25425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061416.1 protein_id gnl|my_center|LOCUS_30650 27024 25426 gene locus_tag LOCUS_30660 27024 25426 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_30660 27299 31306 gene locus_tag LOCUS_30670 27299 31306 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972238.1 protein_id gnl|my_center|LOCUS_30670 32045 31293 gene locus_tag LOCUS_30680 32045 31293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976004.1 protein_id gnl|my_center|LOCUS_30680 32044 33228 gene locus_tag LOCUS_30690 32044 33228 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708916.1 protein_id gnl|my_center|LOCUS_30690 33326 34249 gene locus_tag LOCUS_30700 33326 34249 CDS product chitin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708914.1 protein_id gnl|my_center|LOCUS_30700 34246 34743 gene locus_tag LOCUS_30710 34246 34743 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972234.1 protein_id gnl|my_center|LOCUS_30710 34750 35247 gene locus_tag LOCUS_30720 gene allA 34750 35247 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UI11 protein_id gnl|my_center|LOCUS_30720 35262 35636 gene locus_tag LOCUS_30730 35262 35636 CDS product 5-hydroxyisourate hydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UG5 protein_id gnl|my_center|LOCUS_30730 37256 35958 gene locus_tag LOCUS_30740 gene gda 37256 35958 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972223.1 protein_id gnl|my_center|LOCUS_30740 38491 37253 gene locus_tag LOCUS_30750 38491 37253 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972222.1 protein_id gnl|my_center|LOCUS_30750 38865 38674 gene locus_tag LOCUS_30760 38865 38674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 38776 40086 gene locus_tag LOCUS_30770 gene ugpB 38776 40086 CDS product sn-glycerol-3-phosphate-binding periplasmic protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XG55 protein_id gnl|my_center|LOCUS_30770 40148 41029 gene locus_tag LOCUS_30780 gene ugpA 40148 41029 CDS product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 protein_id gnl|my_center|LOCUS_30780 41029 41874 gene locus_tag LOCUS_30790 gene ugpE 41029 41874 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYN3 protein_id gnl|my_center|LOCUS_30790 41881 42903 gene locus_tag LOCUS_30800 gene ugpC 41881 42903 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX40 protein_id gnl|my_center|LOCUS_30800 44490 42955 gene locus_tag LOCUS_30810 44490 42955 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 protein_id gnl|my_center|LOCUS_30810 45552 44515 gene locus_tag LOCUS_30820 45552 44515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 protein_id gnl|my_center|LOCUS_30820 46151 45666 gene locus_tag LOCUS_30830 46151 45666 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_30830 46351 47967 gene locus_tag LOCUS_30840 46351 47967 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_30840 48881 48069 gene locus_tag LOCUS_30850 48881 48069 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061553.1 protein_id gnl|my_center|LOCUS_30850 51238 48881 gene locus_tag LOCUS_30860 gene xdhB1 51238 48881 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975647.1 protein_id gnl|my_center|LOCUS_30860 52725 51241 gene locus_tag LOCUS_30870 52725 51241 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887365.1 protein_id gnl|my_center|LOCUS_30870 54013 52958 gene locus_tag LOCUS_30880 54013 52958 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886668.1 protein_id gnl|my_center|LOCUS_30880 54855 54082 gene locus_tag LOCUS_30890 gene bdhA2 54855 54082 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708902.1 protein_id gnl|my_center|LOCUS_30890 55049 56242 gene locus_tag LOCUS_30900 55049 56242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708895.1 protein_id gnl|my_center|LOCUS_30900 56478 57758 gene locus_tag LOCUS_30910 gene bacA 56478 57758 CDS product bacteroid development protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08120 protein_id gnl|my_center|LOCUS_30910 58821 57787 gene locus_tag LOCUS_30920 58821 57787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061444.1 protein_id gnl|my_center|LOCUS_30920 59241 58906 gene locus_tag LOCUS_30930 59241 58906 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_30930 59404 59991 gene locus_tag LOCUS_30940 59404 59991 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061445.1 protein_id gnl|my_center|LOCUS_30940 60123 60794 gene locus_tag LOCUS_30950 60123 60794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708891.1 protein_id gnl|my_center|LOCUS_30950 60844 62343 gene locus_tag LOCUS_30960 gene der 60844 62343 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD28 protein_id gnl|my_center|LOCUS_30960 62616 63794 gene locus_tag LOCUS_30970 62616 63794 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974649.1 protein_id gnl|my_center|LOCUS_30970 64033 64440 gene locus_tag LOCUS_30980 gene atpI 64033 64440 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK04 protein_id gnl|my_center|LOCUS_30980 64478 65227 gene locus_tag LOCUS_30990 gene atpB 64478 65227 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHB5 protein_id gnl|my_center|LOCUS_30990 65294 65521 gene locus_tag LOCUS_31000 65294 65521 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_31000 65587 66171 gene locus_tag LOCUS_31010 gene atpF2 65587 66171 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RM6 protein_id gnl|my_center|LOCUS_31010 66187 66666 gene locus_tag LOCUS_31020 gene atpF1 66187 66666 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RM5 protein_id gnl|my_center|LOCUS_31020 67466 66822 gene locus_tag LOCUS_31030 gene rnhB 67466 66822 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6M8 protein_id gnl|my_center|LOCUS_31030 68802 67645 gene locus_tag LOCUS_31040 68802 67645 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707034.1 protein_id gnl|my_center|LOCUS_31040 68993 69511 gene locus_tag LOCUS_31050 68993 69511 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971097.1 protein_id gnl|my_center|LOCUS_31050 70405 69530 gene locus_tag LOCUS_31060 gene ispE 70405 69530 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHP8 protein_id gnl|my_center|LOCUS_31060 72331 70418 gene locus_tag LOCUS_31070 72331 70418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968860.1 protein_id gnl|my_center|LOCUS_31070 73485 72469 gene locus_tag LOCUS_31080 73485 72469 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974661.1 protein_id gnl|my_center|LOCUS_31080 73618 73863 gene locus_tag LOCUS_31090 73618 73863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 74269 73874 gene locus_tag LOCUS_31100 74269 73874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 74150 74740 gene locus_tag LOCUS_31110 74150 74740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 74871 75728 gene locus_tag LOCUS_31120 74871 75728 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974664.1 protein_id gnl|my_center|LOCUS_31120 75799 75990 gene locus_tag LOCUS_31130 75799 75990 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532834.1 protein_id gnl|my_center|LOCUS_31130 76132 77085 gene locus_tag LOCUS_31140 gene glyQ 76132 77085 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHD1 protein_id gnl|my_center|LOCUS_31140 77226 77591 gene locus_tag LOCUS_31150 77226 77591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 79120 77657 gene locus_tag LOCUS_31160 79120 77657 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972843.1 protein_id gnl|my_center|LOCUS_31160 79441 80001 gene locus_tag LOCUS_31170 79441 80001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968864.1 protein_id gnl|my_center|LOCUS_31170 80032 81948 gene locus_tag LOCUS_31180 80032 81948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707047.1 protein_id gnl|my_center|LOCUS_31180 82049 84391 gene locus_tag LOCUS_31190 gene glyS 82049 84391 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T912 protein_id gnl|my_center|LOCUS_31190 84945 84523 gene locus_tag LOCUS_31200 84945 84523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707054.1 protein_id gnl|my_center|LOCUS_31200 84914 85090 gene locus_tag LOCUS_31210 84914 85090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 86447 85170 gene locus_tag LOCUS_31220 gene purD 86447 85170 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 protein_id gnl|my_center|LOCUS_31220 86623 87597 gene locus_tag LOCUS_31230 gene ubiA 86623 87597 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK36 protein_id gnl|my_center|LOCUS_31230 88228 87662 gene locus_tag LOCUS_31240 88228 87662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707061.1 protein_id gnl|my_center|LOCUS_31240 89846 88413 gene locus_tag LOCUS_31250 89846 88413 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707063.1 protein_id gnl|my_center|LOCUS_31250 90056 91348 gene locus_tag LOCUS_31260 90056 91348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086718.1 protein_id gnl|my_center|LOCUS_31260 92360 91389 gene locus_tag LOCUS_31270 92360 91389 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHF1 protein_id gnl|my_center|LOCUS_31270 92812 94593 gene locus_tag LOCUS_31280 92812 94593 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532808.1 protein_id gnl|my_center|LOCUS_31280 94642 95400 gene locus_tag LOCUS_31290 94642 95400 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532807.1 protein_id gnl|my_center|LOCUS_31290 97632 96373 gene locus_tag LOCUS_31300 97632 96373 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707074.1 protein_id gnl|my_center|LOCUS_31300 98396 97629 gene locus_tag LOCUS_31310 98396 97629 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707075.1 protein_id gnl|my_center|LOCUS_31310 98719 98456 gene locus_tag LOCUS_31320 98719 98456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 100782 98851 gene locus_tag LOCUS_31330 gene dxs 100782 98851 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RJ1 protein_id gnl|my_center|LOCUS_31330 101836 100910 gene locus_tag LOCUS_31340 101836 100910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974696.1 protein_id gnl|my_center|LOCUS_31340 102118 101873 gene locus_tag LOCUS_31350 gene xseB 102118 101873 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RI9 protein_id gnl|my_center|LOCUS_31350 103048 102122 gene locus_tag LOCUS_31360 103048 102122 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 protein_id gnl|my_center|LOCUS_31360 103663 103103 gene locus_tag LOCUS_31370 103663 103103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 104327 105520 gene locus_tag LOCUS_31380 104327 105520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971122.1 protein_id gnl|my_center|LOCUS_31380 105668 106459 gene locus_tag LOCUS_31390 105668 106459 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087721.1 protein_id gnl|my_center|LOCUS_31390 107578 106478 gene locus_tag LOCUS_31400 gene ribA 107578 106478 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHI9 protein_id gnl|my_center|LOCUS_31400 108685 107591 gene locus_tag LOCUS_31410 gene aroC 108685 107591 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RH3 protein_id gnl|my_center|LOCUS_31410 108908 109168 gene locus_tag LOCUS_31420 108908 109168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532345.1 protein_id gnl|my_center|LOCUS_31420 109795 109205 gene locus_tag LOCUS_31430 109795 109205 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532346.1 protein_id gnl|my_center|LOCUS_31430 110650 109838 gene locus_tag LOCUS_31440 gene fabI 110650 109838 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX9 protein_id gnl|my_center|LOCUS_31440 111790 110765 gene locus_tag LOCUS_31450 111790 110765 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968903.1 protein_id gnl|my_center|LOCUS_31450 112234 111971 gene locus_tag LOCUS_31460 112234 111971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 112233 112496 gene locus_tag LOCUS_31470 112233 112496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 112468 113082 gene locus_tag LOCUS_31480 gene pdxH 112468 113082 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Z5 protein_id gnl|my_center|LOCUS_31480 114177 113125 gene locus_tag LOCUS_31490 114177 113125 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707094.1 protein_id gnl|my_center|LOCUS_31490 115350 114310 gene locus_tag LOCUS_31500 115350 114310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 116015 115626 gene locus_tag LOCUS_31510 116015 115626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_31510 117597 116182 gene locus_tag LOCUS_31520 gene tldD 117597 116182 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309817.1 protein_id gnl|my_center|LOCUS_31520 118276 117746 gene locus_tag LOCUS_31530 gene ialB 118276 117746 CDS product invasion protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532333.1 protein_id gnl|my_center|LOCUS_31530 118646 119521 gene locus_tag LOCUS_31540 118646 119521 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6U4 protein_id gnl|my_center|LOCUS_31540 119540 121195 gene locus_tag LOCUS_31550 gene coxA 119540 121195 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U5I4 protein_id gnl|my_center|LOCUS_31550 121329 122276 gene locus_tag LOCUS_31560 gene ctaB 121329 122276 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ3 protein_id gnl|my_center|LOCUS_31560 122279 122428 gene locus_tag LOCUS_31570 122279 122428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 122439 123047 gene locus_tag LOCUS_31580 gene ctaG 122439 123047 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_31580 123111 123986 gene locus_tag LOCUS_31590 123111 123986 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_31590 124086 124469 gene locus_tag LOCUS_31600 124086 124469 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_31600 124456 125208 gene locus_tag LOCUS_31610 124456 125208 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ9 protein_id gnl|my_center|LOCUS_31610 125277 125642 gene locus_tag LOCUS_31620 125277 125642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_31620 125672 126670 gene locus_tag LOCUS_31630 gene ispH 125672 126670 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58673 protein_id gnl|my_center|LOCUS_31630 126673 127653 gene locus_tag LOCUS_31640 gene thrB 126673 127653 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RG1 protein_id gnl|my_center|LOCUS_31640 127650 128114 gene locus_tag LOCUS_31650 gene rnhA 127650 128114 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA7 protein_id gnl|my_center|LOCUS_31650 128621 128136 gene locus_tag LOCUS_31660 128621 128136 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707118.1 protein_id gnl|my_center|LOCUS_31660 129455 128715 gene locus_tag LOCUS_31670 129455 128715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707119.1 protein_id gnl|my_center|LOCUS_31670 129854 130483 gene locus_tag LOCUS_31680 129854 130483 CDS product UPF0301 protein R00917 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RF8 protein_id gnl|my_center|LOCUS_31680 >Feature sequence14 455 1798 gene locus_tag LOCUS_31690 455 1798 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_31690 1910 2944 gene locus_tag LOCUS_31700 1910 2944 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086816.1 protein_id gnl|my_center|LOCUS_31700 2948 4147 gene locus_tag LOCUS_31710 2948 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 4166 4924 gene locus_tag LOCUS_31720 4166 4924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_31720 4921 5709 gene locus_tag LOCUS_31730 4921 5709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_31730 5965 6585 gene locus_tag LOCUS_31740 5965 6585 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_31740 7258 7082 gene locus_tag LOCUS_31750 7258 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 8008 7601 gene locus_tag LOCUS_31760 8008 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 8529 8026 gene locus_tag LOCUS_31770 8529 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 9488 8526 gene locus_tag LOCUS_31780 9488 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 9682 9461 gene locus_tag LOCUS_31790 9682 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 10226 9834 gene locus_tag LOCUS_31800 10226 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 10930 10223 gene locus_tag LOCUS_31810 10930 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808629.1 protein_id gnl|my_center|LOCUS_31810 12362 11568 gene locus_tag LOCUS_31820 12362 11568 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087556.1 protein_id gnl|my_center|LOCUS_31820 13766 12477 gene locus_tag LOCUS_31830 13766 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064550.1 protein_id gnl|my_center|LOCUS_31830 14283 13771 gene locus_tag LOCUS_31840 14283 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 15352 14381 gene locus_tag LOCUS_31850 15352 14381 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336874.1 protein_id gnl|my_center|LOCUS_31850 16249 15377 gene locus_tag LOCUS_31860 16249 15377 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039775.1 protein_id gnl|my_center|LOCUS_31860 16630 17682 gene locus_tag LOCUS_31870 16630 17682 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_31870 17778 18389 gene locus_tag LOCUS_31880 17778 18389 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383446.1 protein_id gnl|my_center|LOCUS_31880 18386 19672 gene locus_tag LOCUS_31890 18386 19672 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 protein_id gnl|my_center|LOCUS_31890 19689 20486 gene locus_tag LOCUS_31900 19689 20486 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 protein_id gnl|my_center|LOCUS_31900 21539 20595 gene locus_tag LOCUS_31910 21539 20595 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_31910 22553 21819 gene locus_tag LOCUS_31920 22553 21819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 23039 24064 gene locus_tag LOCUS_31930 23039 24064 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089533.1 protein_id gnl|my_center|LOCUS_31930 24227 24766 gene locus_tag LOCUS_31940 24227 24766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 24769 26046 gene locus_tag LOCUS_31950 24769 26046 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_31950 26997 26167 gene locus_tag LOCUS_31960 26997 26167 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064596.1 protein_id gnl|my_center|LOCUS_31960 29122 27053 gene locus_tag LOCUS_31970 gene bioW 29122 27053 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225692.1 protein_id gnl|my_center|LOCUS_31970 30485 29124 gene locus_tag LOCUS_31980 30485 29124 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_31980 30927 32768 gene locus_tag LOCUS_31990 30927 32768 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887690.1 protein_id gnl|my_center|LOCUS_31990 32775 34238 gene locus_tag LOCUS_32000 gene davD 32775 34238 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_32000 34323 34928 gene locus_tag LOCUS_32010 34323 34928 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_32010 35220 36080 gene locus_tag LOCUS_32020 35220 36080 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089123.1 protein_id gnl|my_center|LOCUS_32020 37479 36088 gene locus_tag LOCUS_32030 37479 36088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089102.1 protein_id gnl|my_center|LOCUS_32030 38551 37712 gene locus_tag LOCUS_32040 38551 37712 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870943.1 protein_id gnl|my_center|LOCUS_32040 39797 38988 gene locus_tag LOCUS_32050 39797 38988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_32050 41526 39958 gene locus_tag LOCUS_32060 41526 39958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 43305 41689 gene locus_tag LOCUS_32070 43305 41689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338614.1 protein_id gnl|my_center|LOCUS_32070 44726 44337 gene locus_tag LOCUS_32080 44726 44337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32080 46117 44843 gene locus_tag LOCUS_32090 46117 44843 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887705.1 protein_id gnl|my_center|LOCUS_32090 49214 46110 gene locus_tag LOCUS_32100 49214 46110 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_32100 50512 49211 gene locus_tag LOCUS_32110 50512 49211 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_32110 50985 50593 gene locus_tag LOCUS_32120 50985 50593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 51419 51051 gene locus_tag LOCUS_32130 51419 51051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 51596 52222 gene locus_tag LOCUS_32140 gene slmA 51596 52222 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T90 protein_id gnl|my_center|LOCUS_32140 52353 53132 gene locus_tag LOCUS_32150 52353 53132 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_32150 53192 54226 gene locus_tag LOCUS_32160 53192 54226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361494.1 protein_id gnl|my_center|LOCUS_32160 54238 57033 gene locus_tag LOCUS_32170 gene rbbA 54238 57033 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 protein_id gnl|my_center|LOCUS_32170 57035 58153 gene locus_tag LOCUS_32180 gene yhhJ 57035 58153 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_32180 59494 58184 gene locus_tag LOCUS_32190 59494 58184 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 protein_id gnl|my_center|LOCUS_32190 60180 59521 gene locus_tag LOCUS_32200 60180 59521 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_32200 60326 60709 gene locus_tag LOCUS_32210 60326 60709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201003.1 protein_id gnl|my_center|LOCUS_32210 60904 61368 gene locus_tag LOCUS_32220 60904 61368 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_32220 61390 63597 gene locus_tag LOCUS_32230 61390 63597 CDS product NADPH flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 protein_id gnl|my_center|LOCUS_32230 63578 64522 gene locus_tag LOCUS_32240 63578 64522 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3Y8 protein_id gnl|my_center|LOCUS_32240 67124 64611 gene locus_tag LOCUS_32250 67124 64611 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 protein_id gnl|my_center|LOCUS_32250 68393 67254 gene locus_tag LOCUS_32260 68393 67254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 68569 69825 gene locus_tag LOCUS_32270 68569 69825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 69822 70598 gene locus_tag LOCUS_32280 69822 70598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 70591 71391 gene locus_tag LOCUS_32290 gene nqrC 70591 71391 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHC8 protein_id gnl|my_center|LOCUS_32290 71395 72057 gene locus_tag LOCUS_32300 gene nqrD 71395 72057 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_32300 72054 72665 gene locus_tag LOCUS_32310 gene nqrE 72054 72665 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_32310 72662 73882 gene locus_tag LOCUS_32320 gene nqrF 72662 73882 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EID5 protein_id gnl|my_center|LOCUS_32320 73887 74861 gene locus_tag LOCUS_32330 73887 74861 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MB1 protein_id gnl|my_center|LOCUS_32330 74872 75039 gene locus_tag LOCUS_32340 74872 75039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 75036 75428 gene locus_tag LOCUS_32350 75036 75428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 76259 76002 gene locus_tag LOCUS_32360 76259 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 76374 76847 gene locus_tag LOCUS_32370 76374 76847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 76978 77643 gene locus_tag LOCUS_32380 76978 77643 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_32380 77640 79004 gene locus_tag LOCUS_32390 77640 79004 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_32390 79312 79533 gene locus_tag LOCUS_32400 79312 79533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 80829 79720 gene locus_tag LOCUS_32410 80829 79720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_32410 81702 80842 gene locus_tag LOCUS_32420 81702 80842 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_32420 82609 81704 gene locus_tag LOCUS_32430 82609 81704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973969.1 protein_id gnl|my_center|LOCUS_32430 84026 82674 gene locus_tag LOCUS_32440 84026 82674 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940045.1 protein_id gnl|my_center|LOCUS_32440 85114 84065 gene locus_tag LOCUS_32450 85114 84065 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_32450 86643 85222 gene locus_tag LOCUS_32460 86643 85222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 87380 86643 gene locus_tag LOCUS_32470 87380 86643 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889470.1 protein_id gnl|my_center|LOCUS_32470 88902 87430 gene locus_tag LOCUS_32480 88902 87430 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 protein_id gnl|my_center|LOCUS_32480 89819 88899 gene locus_tag LOCUS_32490 89819 88899 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_32490 90847 89825 gene locus_tag LOCUS_32500 gene dhaK1 90847 89825 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_32500 91389 90844 gene locus_tag LOCUS_32510 91389 90844 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_32510 92168 91386 gene locus_tag LOCUS_32520 92168 91386 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_32520 93920 92274 gene locus_tag LOCUS_32530 93920 92274 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_32530 94294 93923 gene locus_tag LOCUS_32540 94294 93923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 95451 94291 gene locus_tag LOCUS_32550 95451 94291 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_32550 96665 95463 gene locus_tag LOCUS_32560 96665 95463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063812.1 protein_id gnl|my_center|LOCUS_32560 <98105 97379 gene locus_tag LOCUS_32570 <98105 97379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920584.1:IS110 family transposase >Feature sequence15 1629 415 gene locus_tag LOCUS_32580 1629 415 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710170.1 protein_id gnl|my_center|LOCUS_32580 2048 1626 gene locus_tag LOCUS_32590 gene vapC 2048 1626 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCU0 protein_id gnl|my_center|LOCUS_32590 2326 2045 gene locus_tag LOCUS_32600 2326 2045 CDS product plasmid stability protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529622.1 protein_id gnl|my_center|LOCUS_32600 2948 2511 gene locus_tag LOCUS_32610 2948 2511 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_32610 3620 3180 gene locus_tag LOCUS_32620 3620 3180 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094803.1 protein_id gnl|my_center|LOCUS_32620 5197 3614 gene locus_tag LOCUS_32630 5197 3614 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY5 protein_id gnl|my_center|LOCUS_32630 5981 5202 gene locus_tag LOCUS_32640 gene ubiE 5981 5202 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY6 protein_id gnl|my_center|LOCUS_32640 6172 7068 gene locus_tag LOCUS_32650 gene mutM 6172 7068 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIH4 protein_id gnl|my_center|LOCUS_32650 7133 7906 gene locus_tag LOCUS_32660 7133 7906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_32660 8103 8369 gene locus_tag LOCUS_32670 gene rpsT 8103 8369 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY9 protein_id gnl|my_center|LOCUS_32670 9245 10696 gene locus_tag LOCUS_32680 gene dnaA 9245 10696 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEI2 protein_id gnl|my_center|LOCUS_32680 10915 12033 gene locus_tag LOCUS_32690 gene dnaN 10915 12033 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1R0 protein_id gnl|my_center|LOCUS_32690 12103 13254 gene locus_tag LOCUS_32700 gene recF 12103 13254 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBZ9 protein_id gnl|my_center|LOCUS_32700 13247 14005 gene locus_tag LOCUS_32710 13247 14005 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067598.1 protein_id gnl|my_center|LOCUS_32710 15180 14140 gene locus_tag LOCUS_32720 15180 14140 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067582.1 protein_id gnl|my_center|LOCUS_32720 15484 15984 gene locus_tag LOCUS_32730 15484 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067581.1 protein_id gnl|my_center|LOCUS_32730 17887 16055 gene locus_tag LOCUS_32740 gene ilvD 17887 16055 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RV97 protein_id gnl|my_center|LOCUS_32740 18627 18088 gene locus_tag LOCUS_32750 gene irr 18627 18088 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968450.1 protein_id gnl|my_center|LOCUS_32750 18759 19274 gene locus_tag LOCUS_32760 gene fabA 18759 19274 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D235 protein_id gnl|my_center|LOCUS_32760 19347 20570 gene locus_tag LOCUS_32770 gene fabB 19347 20570 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970685.1 protein_id gnl|my_center|LOCUS_32770 20606 21415 gene locus_tag LOCUS_32780 20606 21415 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT9 protein_id gnl|my_center|LOCUS_32780 22169 21504 gene locus_tag LOCUS_32790 22169 21504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 24474 22354 gene locus_tag LOCUS_32800 gene pnp 24474 22354 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SW0 protein_id gnl|my_center|LOCUS_32800 25085 24816 gene locus_tag LOCUS_32810 gene rpsO 25085 24816 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ54 protein_id gnl|my_center|LOCUS_32810 25621 25268 gene locus_tag LOCUS_32820 25621 25268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 25784 26494 gene locus_tag LOCUS_32830 25784 26494 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCW0 protein_id gnl|my_center|LOCUS_32830 27441 26506 gene locus_tag LOCUS_32840 gene truB 27441 26506 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SW2 protein_id gnl|my_center|LOCUS_32840 27904 27443 gene locus_tag LOCUS_32850 27904 27443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 28328 27906 gene locus_tag LOCUS_32860 gene rbfA 28328 27906 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ52 protein_id gnl|my_center|LOCUS_32860 31009 28418 gene locus_tag LOCUS_32870 gene infB 31009 28418 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC66 protein_id gnl|my_center|LOCUS_32870 31728 31102 gene locus_tag LOCUS_32880 31728 31102 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970646.1 protein_id gnl|my_center|LOCUS_32880 33398 31755 gene locus_tag LOCUS_32890 gene nusA 33398 31755 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SW5 protein_id gnl|my_center|LOCUS_32890 34192 33590 gene locus_tag LOCUS_32900 gene rimP 34192 33590 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC63 protein_id gnl|my_center|LOCUS_32900 35162 34419 gene locus_tag LOCUS_32910 gene trmB 35162 34419 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SI3 protein_id gnl|my_center|LOCUS_32910 36427 35186 gene locus_tag LOCUS_32920 gene metK 36427 35186 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706637.1 protein_id gnl|my_center|LOCUS_32920 37134 36715 gene locus_tag LOCUS_32930 37134 36715 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5H5 protein_id gnl|my_center|LOCUS_32930 38859 37288 gene locus_tag LOCUS_32940 gene lnt 38859 37288 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID7 protein_id gnl|my_center|LOCUS_32940 38377 38296 gene locus_tag LOCUS_t00280 38377 38296 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40334 39138 gene locus_tag LOCUS_32950 40334 39138 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974258.1 protein_id gnl|my_center|LOCUS_32950 40809 40294 gene locus_tag LOCUS_32960 gene ybeY 40809 40294 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF10 protein_id gnl|my_center|LOCUS_32960 41855 40806 gene locus_tag LOCUS_32970 41855 40806 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_32970 43319 41886 gene locus_tag LOCUS_32980 gene miaB 43319 41886 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF08 protein_id gnl|my_center|LOCUS_32980 44159 43362 gene locus_tag LOCUS_32990 44159 43362 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974254.1 protein_id gnl|my_center|LOCUS_32990 44632 44207 gene locus_tag LOCUS_33000 gene fur 44632 44207 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 protein_id gnl|my_center|LOCUS_33000 45189 44698 gene locus_tag LOCUS_33010 45189 44698 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974253.1 protein_id gnl|my_center|LOCUS_33010 45872 45189 gene locus_tag LOCUS_33020 45872 45189 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974252.1 protein_id gnl|my_center|LOCUS_33020 46528 45965 gene locus_tag LOCUS_33030 46528 45965 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527690.1 protein_id gnl|my_center|LOCUS_33030 47144 46653 gene locus_tag LOCUS_33040 47144 46653 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310195.1 protein_id gnl|my_center|LOCUS_33040 48299 47235 gene locus_tag LOCUS_33050 gene trpS 48299 47235 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF02 protein_id gnl|my_center|LOCUS_33050 49977 48412 gene locus_tag LOCUS_33060 49977 48412 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T788 protein_id gnl|my_center|LOCUS_33060 52834 49994 gene locus_tag LOCUS_33070 gene glnD 52834 49994 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEZ9 protein_id gnl|my_center|LOCUS_33070 54398 52941 gene locus_tag LOCUS_33080 54398 52941 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532574.1 protein_id gnl|my_center|LOCUS_33080 55503 54391 gene locus_tag LOCUS_33090 55503 54391 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532575.1 protein_id gnl|my_center|LOCUS_33090 55715 56440 gene locus_tag LOCUS_33100 55715 56440 CDS product cysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533444.1 protein_id gnl|my_center|LOCUS_33100 57488 56598 gene locus_tag LOCUS_33110 gene yafC 57488 56598 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208002.1 protein_id gnl|my_center|LOCUS_33110 57574 58752 gene locus_tag LOCUS_33120 57574 58752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 protein_id gnl|my_center|LOCUS_33120 59823 59023 gene locus_tag LOCUS_33130 gene nth 59823 59023 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T20 protein_id gnl|my_center|LOCUS_33130 59885 60355 gene locus_tag LOCUS_33140 59885 60355 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968398.1 protein_id gnl|my_center|LOCUS_33140 60434 61318 gene locus_tag LOCUS_33150 60434 61318 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 protein_id gnl|my_center|LOCUS_33150 62049 61414 gene locus_tag LOCUS_33160 gene gpmA 62049 61414 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T25 protein_id gnl|my_center|LOCUS_33160 62909 62079 gene locus_tag LOCUS_33170 gene dapB 62909 62079 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58326 protein_id gnl|my_center|LOCUS_33170 64738 62906 gene locus_tag LOCUS_33180 64738 62906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968394.1 protein_id gnl|my_center|LOCUS_33180 65868 64843 gene locus_tag LOCUS_33190 gene glk 65868 64843 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T27 protein_id gnl|my_center|LOCUS_33190 66364 65945 gene locus_tag LOCUS_33200 gene mgsA 66364 65945 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBY3 protein_id gnl|my_center|LOCUS_33200 67559 66465 gene locus_tag LOCUS_33210 gene mepA 67559 66465 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709953.1 protein_id gnl|my_center|LOCUS_33210 69389 67641 gene locus_tag LOCUS_33220 69389 67641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 69602 70633 gene locus_tag LOCUS_33230 69602 70633 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_33230 70630 71013 gene locus_tag LOCUS_33240 70630 71013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 72005 71019 gene locus_tag LOCUS_33250 72005 71019 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528301.1 protein_id gnl|my_center|LOCUS_33250 73505 72111 gene locus_tag LOCUS_33260 gene pbeF 73505 72111 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_33260 74088 73750 gene locus_tag LOCUS_33270 74088 73750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 74440 74162 gene locus_tag LOCUS_33280 74440 74162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33280 75150 74440 gene locus_tag LOCUS_33290 75150 74440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33290 77652 75241 gene locus_tag LOCUS_33300 gene pheT 77652 75241 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIN4 protein_id gnl|my_center|LOCUS_33300 78751 77666 gene locus_tag LOCUS_33310 gene pheS 78751 77666 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCQ0 protein_id gnl|my_center|LOCUS_33310 79302 78901 gene locus_tag LOCUS_33320 gene rplT 79302 78901 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF73 protein_id gnl|my_center|LOCUS_33320 79540 79340 gene locus_tag LOCUS_33330 gene rpmI 79540 79340 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF72 protein_id gnl|my_center|LOCUS_33330 80203 79805 gene locus_tag LOCUS_33340 80203 79805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 80534 81331 gene locus_tag LOCUS_33350 80534 81331 CDS product 2-hydroxymuconic semialdehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710084.1 protein_id gnl|my_center|LOCUS_33350 81571 82137 gene locus_tag LOCUS_33360 81571 82137 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970764.1 protein_id gnl|my_center|LOCUS_33360 83481 82252 gene locus_tag LOCUS_33370 83481 82252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974577.1 protein_id gnl|my_center|LOCUS_33370 85855 83939 gene locus_tag LOCUS_33380 85855 83939 CDS product PII uridylyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 protein_id gnl|my_center|LOCUS_33380 87193 86210 gene locus_tag LOCUS_33390 87193 86210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067678.1 protein_id gnl|my_center|LOCUS_33390 87337 88155 gene locus_tag LOCUS_33400 87337 88155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_33400 88516 88776 gene locus_tag LOCUS_33410 88516 88776 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528670.1 protein_id gnl|my_center|LOCUS_33410 88878 90143 gene locus_tag LOCUS_33420 88878 90143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 91421 90192 gene locus_tag LOCUS_33430 91421 90192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 92905 91658 gene locus_tag LOCUS_33440 92905 91658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 93256 95064 gene locus_tag LOCUS_33450 gene lepA 93256 95064 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCA2 protein_id gnl|my_center|LOCUS_33450 96065 95109 gene locus_tag LOCUS_33460 96065 95109 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_33460 96317 96403 gene locus_tag LOCUS_t00290 96317 96403 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 96484 96720 gene locus_tag LOCUS_33470 96484 96720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 97526 96831 gene locus_tag LOCUS_33480 97526 96831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531751.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence16 1341 187 gene locus_tag LOCUS_33490 gene aspB 1341 187 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312615.1 protein_id gnl|my_center|LOCUS_33490 1582 2964 gene locus_tag LOCUS_33500 1582 2964 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531361.1 protein_id gnl|my_center|LOCUS_33500 3023 3787 gene locus_tag LOCUS_33510 3023 3787 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533078.1 protein_id gnl|my_center|LOCUS_33510 4050 4526 gene locus_tag LOCUS_33520 gene accB 4050 4526 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971548.1 protein_id gnl|my_center|LOCUS_33520 4539 5888 gene locus_tag LOCUS_33530 4539 5888 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975142.1 protein_id gnl|my_center|LOCUS_33530 5923 6543 gene locus_tag LOCUS_33540 gene aat 5923 6543 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U825 protein_id gnl|my_center|LOCUS_33540 6949 7476 gene locus_tag LOCUS_33550 6949 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 7803 8882 gene locus_tag LOCUS_33560 7803 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 9397 8966 gene locus_tag LOCUS_33570 9397 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707674.1 protein_id gnl|my_center|LOCUS_33570 9912 9514 gene locus_tag LOCUS_33580 9912 9514 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975139.1 protein_id gnl|my_center|LOCUS_33580 10480 10016 gene locus_tag LOCUS_33590 10480 10016 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707672.1 protein_id gnl|my_center|LOCUS_33590 10765 10974 gene locus_tag LOCUS_33600 10765 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 11620 11123 gene locus_tag LOCUS_33610 11620 11123 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533058.1 protein_id gnl|my_center|LOCUS_33610 12378 11713 gene locus_tag LOCUS_33620 12378 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088740.1 protein_id gnl|my_center|LOCUS_33620 13890 12388 gene locus_tag LOCUS_33630 gene gatB 13890 12388 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAA7 protein_id gnl|my_center|LOCUS_33630 14078 14362 gene locus_tag LOCUS_33640 14078 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525379.1 protein_id gnl|my_center|LOCUS_33640 14985 14461 gene locus_tag LOCUS_33650 14985 14461 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707666.1 protein_id gnl|my_center|LOCUS_33650 15376 15633 gene locus_tag LOCUS_33660 15376 15633 CDS product UPF0386 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFS6 protein_id gnl|my_center|LOCUS_33660 17173 15692 gene locus_tag LOCUS_33670 gene gatA 17173 15692 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAA3 protein_id gnl|my_center|LOCUS_33670 17652 17170 gene locus_tag LOCUS_33680 17652 17170 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_33680 17944 17657 gene locus_tag LOCUS_33690 gene gatC 17944 17657 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAW8 protein_id gnl|my_center|LOCUS_33690 18797 18075 gene locus_tag LOCUS_33700 18797 18075 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ88 protein_id gnl|my_center|LOCUS_33700 19099 19395 gene locus_tag LOCUS_33710 gene phnA 19099 19395 CDS product alkylphosphonate uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_33710 19404 19901 gene locus_tag LOCUS_33720 19404 19901 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFT1 protein_id gnl|my_center|LOCUS_33720 20237 19887 gene locus_tag LOCUS_33730 20237 19887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975131.1 protein_id gnl|my_center|LOCUS_33730 20809 20234 gene locus_tag LOCUS_33740 20809 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 21026 21958 gene locus_tag LOCUS_33750 21026 21958 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707661.1 protein_id gnl|my_center|LOCUS_33750 23617 21959 gene locus_tag LOCUS_33760 23617 21959 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707660.1 protein_id gnl|my_center|LOCUS_33760 23735 24679 gene locus_tag LOCUS_33770 gene pyrB 23735 24679 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U811 protein_id gnl|my_center|LOCUS_33770 24676 25962 gene locus_tag LOCUS_33780 gene pyrC 24676 25962 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QL6 protein_id gnl|my_center|LOCUS_33780 26014 26631 gene locus_tag LOCUS_33790 gene plsY 26014 26631 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QL7 protein_id gnl|my_center|LOCUS_33790 26631 27782 gene locus_tag LOCUS_33800 gene smf 26631 27782 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969165.1 protein_id gnl|my_center|LOCUS_33800 28043 27798 gene locus_tag LOCUS_33810 28043 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 28262 30889 gene locus_tag LOCUS_33820 gene topA 28262 30889 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ93 protein_id gnl|my_center|LOCUS_33820 30892 33255 gene locus_tag LOCUS_33830 gene rnr 30892 33255 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA92 protein_id gnl|my_center|LOCUS_33830 33318 33764 gene locus_tag LOCUS_33840 33318 33764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969162.1 protein_id gnl|my_center|LOCUS_33840 33761 34480 gene locus_tag LOCUS_33850 33761 34480 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975120.1 protein_id gnl|my_center|LOCUS_33850 34492 35676 gene locus_tag LOCUS_33860 34492 35676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707651.1 protein_id gnl|my_center|LOCUS_33860 35769 35936 gene locus_tag LOCUS_33870 gene rpmG 35769 35936 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U802 protein_id gnl|my_center|LOCUS_33870 37845 36472 gene locus_tag LOCUS_33880 gene pleD 37845 36472 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537641.1 protein_id gnl|my_center|LOCUS_33880 38232 37861 gene locus_tag LOCUS_33890 38232 37861 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 protein_id gnl|my_center|LOCUS_33890 38416 38718 gene locus_tag LOCUS_33900 38416 38718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975116.1 protein_id gnl|my_center|LOCUS_33900 38715 39371 gene locus_tag LOCUS_33910 38715 39371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707646.1 protein_id gnl|my_center|LOCUS_33910 40134 41381 gene locus_tag LOCUS_33920 gene dinB1 40134 41381 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFV3 protein_id gnl|my_center|LOCUS_33920 41475 42680 gene locus_tag LOCUS_33930 41475 42680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 46308 42745 gene locus_tag LOCUS_33940 gene dnaE1 46308 42745 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM9 protein_id gnl|my_center|LOCUS_33940 47081 46809 gene locus_tag LOCUS_33950 47081 46809 CDS product DNA-binding protein HRm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531811.1 protein_id gnl|my_center|LOCUS_33950 49803 47371 gene locus_tag LOCUS_33960 gene lon 49803 47371 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA47 protein_id gnl|my_center|LOCUS_33960 50725 50063 gene locus_tag LOCUS_33970 50725 50063 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_33970 52377 50722 gene locus_tag LOCUS_33980 52377 50722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 52390 52650 gene locus_tag LOCUS_33990 52390 52650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 52908 54587 gene locus_tag LOCUS_34000 52908 54587 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527964.1 protein_id gnl|my_center|LOCUS_34000 56042 54762 gene locus_tag LOCUS_34010 gene clpX 56042 54762 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA45 protein_id gnl|my_center|LOCUS_34010 56986 56360 gene locus_tag LOCUS_34020 gene clpP 56986 56360 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA44 protein_id gnl|my_center|LOCUS_34020 57583 58791 gene locus_tag LOCUS_34030 57583 58791 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532195.1 protein_id gnl|my_center|LOCUS_34030 59154 58810 gene locus_tag LOCUS_34040 59154 58810 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 protein_id gnl|my_center|LOCUS_34040 59261 59749 gene locus_tag LOCUS_34050 59261 59749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875932.1 protein_id gnl|my_center|LOCUS_34050 60050 59754 gene locus_tag LOCUS_34060 60050 59754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 60933 60133 gene locus_tag LOCUS_34070 60933 60133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 62354 61071 gene locus_tag LOCUS_34080 62354 61071 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707601.1 protein_id gnl|my_center|LOCUS_34080 63112 62576 gene locus_tag LOCUS_34090 63112 62576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 63736 63191 gene locus_tag LOCUS_34100 63736 63191 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_34100 63871 64236 gene locus_tag LOCUS_34110 63871 64236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530090.1 protein_id gnl|my_center|LOCUS_34110 65103 64669 gene locus_tag LOCUS_34120 65103 64669 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_34120 66089 65259 gene locus_tag LOCUS_34130 66089 65259 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707598.1 protein_id gnl|my_center|LOCUS_34130 66310 66747 gene locus_tag LOCUS_34140 66310 66747 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975057.1 protein_id gnl|my_center|LOCUS_34140 67016 67480 gene locus_tag LOCUS_34150 gene rplM 67016 67480 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7T7 protein_id gnl|my_center|LOCUS_34150 67483 67965 gene locus_tag LOCUS_34160 gene rpsI 67483 67965 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGF4 protein_id gnl|my_center|LOCUS_34160 69181 68084 gene locus_tag LOCUS_34170 69181 68084 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061853.1 protein_id gnl|my_center|LOCUS_34170 69349 70299 gene locus_tag LOCUS_34180 69349 70299 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532211.1 protein_id gnl|my_center|LOCUS_34180 70386 71321 gene locus_tag LOCUS_34190 gene argC 70386 71321 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 protein_id gnl|my_center|LOCUS_34190 71668 71381 gene locus_tag LOCUS_34200 71668 71381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 72867 71716 gene locus_tag LOCUS_34210 gene ctaA 72867 71716 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QR8 protein_id gnl|my_center|LOCUS_34210 73048 73266 gene locus_tag LOCUS_34220 73048 73266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 73426 74658 gene locus_tag LOCUS_34230 73426 74658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969124.1 protein_id gnl|my_center|LOCUS_34230 76902 74782 gene locus_tag LOCUS_34240 76902 74782 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707586.1 protein_id gnl|my_center|LOCUS_34240 77126 77701 gene locus_tag LOCUS_34250 77126 77701 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529250.1 protein_id gnl|my_center|LOCUS_34250 77706 78887 gene locus_tag LOCUS_34260 77706 78887 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707584.1 protein_id gnl|my_center|LOCUS_34260 78936 80501 gene locus_tag LOCUS_34270 78936 80501 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969121.1 protein_id gnl|my_center|LOCUS_34270 80498 81760 gene locus_tag LOCUS_34280 80498 81760 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529257.1 protein_id gnl|my_center|LOCUS_34280 81905 81829 gene locus_tag LOCUS_t00300 81905 81829 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 82366 82193 gene locus_tag LOCUS_34290 82366 82193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence17 <1 1083 gene locus_tag LOCUS_34300 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969947.1:dihydropyrimidinase 1178 1960 gene locus_tag LOCUS_34310 1178 1960 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709001.1 protein_id gnl|my_center|LOCUS_34310 1950 2435 gene locus_tag LOCUS_34320 1950 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 2432 2767 gene locus_tag LOCUS_34330 2432 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528672.1 protein_id gnl|my_center|LOCUS_34330 2764 3651 gene locus_tag LOCUS_34340 2764 3651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530914.1 protein_id gnl|my_center|LOCUS_34340 3648 4757 gene locus_tag LOCUS_34350 3648 4757 CDS product nitrate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530915.1 protein_id gnl|my_center|LOCUS_34350 4792 5757 gene locus_tag LOCUS_34360 4792 5757 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530916.1 protein_id gnl|my_center|LOCUS_34360 5841 7541 gene locus_tag LOCUS_34370 gene ade1 5841 7541 CDS product adenine deaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXF0 protein_id gnl|my_center|LOCUS_34370 9282 7594 gene locus_tag LOCUS_34380 gene aglA2 9282 7594 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708888.1 protein_id gnl|my_center|LOCUS_34380 9478 11466 gene locus_tag LOCUS_34390 9478 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 11970 11476 gene locus_tag LOCUS_34400 gene aau3 11970 11476 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310047.1 protein_id gnl|my_center|LOCUS_34400 12070 13251 gene locus_tag LOCUS_34410 12070 13251 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_34410 14413 13259 gene locus_tag LOCUS_34420 14413 13259 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RN2 protein_id gnl|my_center|LOCUS_34420 15541 14510 gene locus_tag LOCUS_34430 15541 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970722.1 protein_id gnl|my_center|LOCUS_34430 17289 15754 gene locus_tag LOCUS_34440 17289 15754 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382024.1 protein_id gnl|my_center|LOCUS_34440 17730 17299 gene locus_tag LOCUS_34450 17730 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 18823 17819 gene locus_tag LOCUS_34460 18823 17819 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 protein_id gnl|my_center|LOCUS_34460 18918 19604 gene locus_tag LOCUS_34470 gene tctD 18918 19604 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 protein_id gnl|my_center|LOCUS_34470 19601 21028 gene locus_tag LOCUS_34480 gene tctE 19601 21028 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 protein_id gnl|my_center|LOCUS_34480 21025 22101 gene locus_tag LOCUS_34490 gene afuA 21025 22101 CDS product periplasmic iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638696.2 protein_id gnl|my_center|LOCUS_34490 24473 22290 gene locus_tag LOCUS_34500 24473 22290 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336961.1 protein_id gnl|my_center|LOCUS_34500 25628 24612 gene locus_tag LOCUS_34510 25628 24612 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972206.1 protein_id gnl|my_center|LOCUS_34510 28079 25770 gene locus_tag LOCUS_34520 gene rhf 28079 25770 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 protein_id gnl|my_center|LOCUS_34520 28201 28875 gene locus_tag LOCUS_34530 28201 28875 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_34530 30069 28924 gene locus_tag LOCUS_34540 30069 28924 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_34540 31088 30183 gene locus_tag LOCUS_34550 31088 30183 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_34550 32568 31132 gene locus_tag LOCUS_34560 32568 31132 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 protein_id gnl|my_center|LOCUS_34560 34159 32579 gene locus_tag LOCUS_34570 gene mttB 34159 32579 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708704.1 protein_id gnl|my_center|LOCUS_34570 36640 34193 gene locus_tag LOCUS_34580 36640 34193 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887734.1 protein_id gnl|my_center|LOCUS_34580 39084 36637 gene locus_tag LOCUS_34590 39084 36637 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708706.1 protein_id gnl|my_center|LOCUS_34590 39216 40067 gene locus_tag LOCUS_34600 39216 40067 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708707.1 protein_id gnl|my_center|LOCUS_34600 41272 40112 gene locus_tag LOCUS_34610 41272 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_34610 43113 41560 gene locus_tag LOCUS_34620 gene dagA 43113 41560 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_34620 43561 43124 gene locus_tag LOCUS_34630 43561 43124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 43780 44250 gene locus_tag LOCUS_34640 43780 44250 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388413.1 protein_id gnl|my_center|LOCUS_34640 45502 44315 gene locus_tag LOCUS_34650 gene uxuA 45502 44315 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24215 protein_id gnl|my_center|LOCUS_34650 45684 45499 gene locus_tag LOCUS_34660 45684 45499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 46074 46778 gene locus_tag LOCUS_34670 46074 46778 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720652.1 protein_id gnl|my_center|LOCUS_34670 46775 47668 gene locus_tag LOCUS_34680 gene kdgK 46775 47668 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969920.1 protein_id gnl|my_center|LOCUS_34680 50081 47760 gene locus_tag LOCUS_34690 gene hypF 50081 47760 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0L9 protein_id gnl|my_center|LOCUS_34690 50524 50081 gene locus_tag LOCUS_34700 50524 50081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 52215 50521 gene locus_tag LOCUS_34710 gene hoxX 52215 50521 CDS product hydrogenase maturation factor HoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31907 protein_id gnl|my_center|LOCUS_34710 53256 52219 gene locus_tag LOCUS_34720 gene hypE 53256 52219 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_34720 54404 53253 gene locus_tag LOCUS_34730 gene hypD2 54404 53253 CDS product hydrogenase expression/formation protein hypD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31904 protein_id gnl|my_center|LOCUS_34730 54655 54401 gene locus_tag LOCUS_34740 gene hypC 54655 54401 CDS product hydrogenase assembly protein HupF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_34740 55527 54667 gene locus_tag LOCUS_34750 gene hypB 55527 54667 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338275.1 protein_id gnl|my_center|LOCUS_34750 55868 55527 gene locus_tag LOCUS_34760 gene hypA2 55868 55527 CDS product putative hydrogenase nickel incorporation protein HypA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45256 protein_id gnl|my_center|LOCUS_34760 56131 55868 gene locus_tag LOCUS_34770 56131 55868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 56924 56358 gene locus_tag LOCUS_34780 gene ubiX 56924 56358 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0P4 protein_id gnl|my_center|LOCUS_34780 58429 56921 gene locus_tag LOCUS_34790 gene ubiD 58429 56921 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338245.1 protein_id gnl|my_center|LOCUS_34790 58562 59098 gene locus_tag LOCUS_34800 58562 59098 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720630.1 protein_id gnl|my_center|LOCUS_34800 59095 60075 gene locus_tag LOCUS_34810 59095 60075 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 protein_id gnl|my_center|LOCUS_34810 60095 61015 gene locus_tag LOCUS_34820 60095 61015 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720628.1 protein_id gnl|my_center|LOCUS_34820 62254 61061 gene locus_tag LOCUS_34830 62254 61061 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967702.1 protein_id gnl|my_center|LOCUS_34830 62685 62272 gene locus_tag LOCUS_34840 62685 62272 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529490.1 protein_id gnl|my_center|LOCUS_34840 63530 62682 gene locus_tag LOCUS_34850 63530 62682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529491.1 protein_id gnl|my_center|LOCUS_34850 64750 63542 gene locus_tag LOCUS_34860 64750 63542 CDS product UPF0261 protein RA0729 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92YY3 protein_id gnl|my_center|LOCUS_34860 64873 65493 gene locus_tag LOCUS_34870 64873 65493 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529493.1 protein_id gnl|my_center|LOCUS_34870 65830 67140 gene locus_tag LOCUS_34880 65830 67140 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970660.1 protein_id gnl|my_center|LOCUS_34880 67225 68130 gene locus_tag LOCUS_34890 67225 68130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970661.1 protein_id gnl|my_center|LOCUS_34890 68132 69094 gene locus_tag LOCUS_34900 68132 69094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967708.1 protein_id gnl|my_center|LOCUS_34900 69091 69363 gene locus_tag LOCUS_34910 69091 69363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 69363 70451 gene locus_tag LOCUS_34920 69363 70451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529498.1 protein_id gnl|my_center|LOCUS_34920 70451 71521 gene locus_tag LOCUS_34930 70451 71521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970665.1 protein_id gnl|my_center|LOCUS_34930 72706 71726 gene locus_tag LOCUS_34940 72706 71726 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967711.1 protein_id gnl|my_center|LOCUS_34940 73469 72738 gene locus_tag LOCUS_34950 73469 72738 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529506.1 protein_id gnl|my_center|LOCUS_34950 74635 73466 gene locus_tag LOCUS_34960 74635 73466 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967713.1 protein_id gnl|my_center|LOCUS_34960 75583 74693 gene locus_tag LOCUS_34970 75583 74693 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_34970 75843 76676 gene locus_tag LOCUS_34980 75843 76676 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970670.1 protein_id gnl|my_center|LOCUS_34980 76851 77906 gene locus_tag LOCUS_34990 76851 77906 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709444.1 protein_id gnl|my_center|LOCUS_34990 77923 79110 gene locus_tag LOCUS_35000 77923 79110 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_35000 79416 79156 gene locus_tag LOCUS_35010 79416 79156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 79480 79728 gene locus_tag LOCUS_35020 79480 79728 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_35020 79801 80001 gene locus_tag LOCUS_35030 79801 80001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 80144 80527 gene locus_tag LOCUS_35040 gene TRm10-1a 80144 80527 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975501.1 protein_id gnl|my_center|LOCUS_35040 80665 81087 gene locus_tag LOCUS_35050 gene TRm10-1b-2 80665 81087 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975504.1 protein_id gnl|my_center|LOCUS_35050 81586 81059 gene locus_tag LOCUS_35060 81586 81059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence18 4115 4840 gene locus_tag LOCUS_35070 4115 4840 CDS product MltA-interacting MipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532361.1 protein_id gnl|my_center|LOCUS_35070 5180 4932 gene locus_tag LOCUS_35080 5180 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 5472 6308 gene locus_tag LOCUS_35090 5472 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 6311 7459 gene locus_tag LOCUS_35100 6311 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 7483 8208 gene locus_tag LOCUS_35110 7483 8208 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943645.1 protein_id gnl|my_center|LOCUS_35110 8201 9211 gene locus_tag LOCUS_35120 8201 9211 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887290.1 protein_id gnl|my_center|LOCUS_35120 9192 9878 gene locus_tag LOCUS_35130 9192 9878 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_35130 10347 9904 gene locus_tag LOCUS_35140 10347 9904 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 protein_id gnl|my_center|LOCUS_35140 10600 11523 gene locus_tag LOCUS_35150 gene argI 10600 11523 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J346 protein_id gnl|my_center|LOCUS_35150 11561 12613 gene locus_tag LOCUS_35160 gene ocd 11561 12613 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_35160 12684 13166 gene locus_tag LOCUS_35170 12684 13166 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_35170 13396 14331 gene locus_tag LOCUS_35180 13396 14331 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 protein_id gnl|my_center|LOCUS_35180 14413 15423 gene locus_tag LOCUS_35190 gene alc 14413 15423 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92VC1 protein_id gnl|my_center|LOCUS_35190 15612 16970 gene locus_tag LOCUS_35200 15612 16970 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_35200 17714 17052 gene locus_tag LOCUS_35210 gene ppe 17714 17052 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WX4 protein_id gnl|my_center|LOCUS_35210 17915 18307 gene locus_tag LOCUS_35220 17915 18307 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256880.1 protein_id gnl|my_center|LOCUS_35220 19555 18341 gene locus_tag LOCUS_35230 19555 18341 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_35230 19749 20951 gene locus_tag LOCUS_35240 19749 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 20948 22120 gene locus_tag LOCUS_35250 20948 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 22269 22994 gene locus_tag LOCUS_35260 gene wbmP 22269 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_35260 22981 23760 gene locus_tag LOCUS_35270 22981 23760 CDS product cephalosporin hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_35270 23999 24925 gene locus_tag LOCUS_35280 23999 24925 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_35280 24925 26280 gene locus_tag LOCUS_35290 24925 26280 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709033.1 protein_id gnl|my_center|LOCUS_35290 26280 27275 gene locus_tag LOCUS_35300 26280 27275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709032.1 protein_id gnl|my_center|LOCUS_35300 27272 28003 gene locus_tag LOCUS_35310 27272 28003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_35310 28120 28470 gene locus_tag LOCUS_35320 28120 28470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 protein_id gnl|my_center|LOCUS_35320 28623 29744 gene locus_tag LOCUS_35330 28623 29744 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_35330 29945 30835 gene locus_tag LOCUS_35340 29945 30835 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709590.1 protein_id gnl|my_center|LOCUS_35340 30832 31758 gene locus_tag LOCUS_35350 gene sitB 30832 31758 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973878.1 protein_id gnl|my_center|LOCUS_35350 31755 32618 gene locus_tag LOCUS_35360 gene sitC 31755 32618 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970362.1 protein_id gnl|my_center|LOCUS_35360 32615 33466 gene locus_tag LOCUS_35370 32615 33466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067128.1 protein_id gnl|my_center|LOCUS_35370 34262 33573 gene locus_tag LOCUS_35380 34262 33573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331366.1 protein_id gnl|my_center|LOCUS_35380 34648 34259 gene locus_tag LOCUS_35390 34648 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345299.1 protein_id gnl|my_center|LOCUS_35390 35329 35030 gene locus_tag LOCUS_35400 35329 35030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 35913 37052 gene locus_tag LOCUS_35410 gene gcvT 35913 37052 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I88 protein_id gnl|my_center|LOCUS_35410 37076 37438 gene locus_tag LOCUS_35420 gene gcvH 37076 37438 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFD5 protein_id gnl|my_center|LOCUS_35420 37441 40293 gene locus_tag LOCUS_35430 gene gcvP 37441 40293 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q11 protein_id gnl|my_center|LOCUS_35430 41285 40350 gene locus_tag LOCUS_35440 41285 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 43335 41290 gene locus_tag LOCUS_35450 43335 41290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970097.1 protein_id gnl|my_center|LOCUS_35450 45791 43425 gene locus_tag LOCUS_35460 gene celB 45791 43425 CDS product cellulose synthase BcsB subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887619.1 protein_id gnl|my_center|LOCUS_35460 48045 45784 gene locus_tag LOCUS_35470 gene celA 48045 45784 CDS product cellulose synthase catalytic subunit (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887618.1 protein_id gnl|my_center|LOCUS_35470 48430 49053 gene locus_tag LOCUS_35480 48430 49053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 49216 49025 gene locus_tag LOCUS_35490 49216 49025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 49215 50279 gene locus_tag LOCUS_35500 49215 50279 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969954.1 protein_id gnl|my_center|LOCUS_35500 50290 53583 gene locus_tag LOCUS_35510 50290 53583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969955.1 protein_id gnl|my_center|LOCUS_35510 53789 53613 gene locus_tag LOCUS_35520 53789 53613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 53924 54160 gene locus_tag LOCUS_35530 53924 54160 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088648.1 protein_id gnl|my_center|LOCUS_35530 54432 54356 gene locus_tag LOCUS_t00310 54432 54356 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 55074 54616 gene locus_tag LOCUS_35540 55074 54616 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706919.1 protein_id gnl|my_center|LOCUS_35540 55318 59442 gene locus_tag LOCUS_35550 55318 59442 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971015.1 protein_id gnl|my_center|LOCUS_35550 59913 60272 gene locus_tag LOCUS_35560 59913 60272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531701.1 protein_id gnl|my_center|LOCUS_35560 62362 60410 gene locus_tag LOCUS_35570 gene acsA2 62362 60410 CDS product acetoacetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R3 protein_id gnl|my_center|LOCUS_35570 62534 64408 gene locus_tag LOCUS_35580 62534 64408 CDS product membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530252.1 protein_id gnl|my_center|LOCUS_35580 64593 64835 gene locus_tag LOCUS_35590 64593 64835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 65681 64860 gene locus_tag LOCUS_35600 65681 64860 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530251.1 protein_id gnl|my_center|LOCUS_35600 66600 65692 gene locus_tag LOCUS_35610 66600 65692 CDS product putrescine/spermidine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 protein_id gnl|my_center|LOCUS_35610 67750 66611 gene locus_tag LOCUS_35620 gene potG 67750 66611 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RX3 protein_id gnl|my_center|LOCUS_35620 68918 67824 gene locus_tag LOCUS_35630 68918 67824 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U689 protein_id gnl|my_center|LOCUS_35630 70607 69168 gene locus_tag LOCUS_35640 70607 69168 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530246.1 protein_id gnl|my_center|LOCUS_35640 70855 72144 gene locus_tag LOCUS_35650 gene aceA 70855 72144 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 protein_id gnl|my_center|LOCUS_35650 72223 72459 gene locus_tag LOCUS_35660 72223 72459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706908.1 protein_id gnl|my_center|LOCUS_35660 73789 72590 gene locus_tag LOCUS_35670 73789 72590 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 protein_id gnl|my_center|LOCUS_35670 74460 74068 gene locus_tag LOCUS_35680 74460 74068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence19 1437 349 gene locus_tag LOCUS_35690 gene aglK 1437 349 CDS product alpha-glucoside transport ATP-binding protein AglK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R9 protein_id gnl|my_center|LOCUS_35690 3144 1468 gene locus_tag LOCUS_35700 gene aglA1 3144 1468 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706896.1 protein_id gnl|my_center|LOCUS_35700 4297 3155 gene locus_tag LOCUS_35710 gene aglG 4297 3155 CDS product alpha-glucoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384636.1 protein_id gnl|my_center|LOCUS_35710 5550 4309 gene locus_tag LOCUS_35720 5550 4309 CDS product alpha-glucoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384637.1 protein_id gnl|my_center|LOCUS_35720 6960 5629 gene locus_tag LOCUS_35730 gene aglE 6960 5629 CDS product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 protein_id gnl|my_center|LOCUS_35730 7315 8382 gene locus_tag LOCUS_35740 7315 8382 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528260.1 protein_id gnl|my_center|LOCUS_35740 8977 8501 gene locus_tag LOCUS_35750 8977 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 10093 9194 gene locus_tag LOCUS_35760 gene folD2 10093 9194 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RY3 protein_id gnl|my_center|LOCUS_35760 12780 10237 gene locus_tag LOCUS_35770 12780 10237 CDS product succinoglycan biosynthesis protein ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530230.1 protein_id gnl|my_center|LOCUS_35770 13509 14774 gene locus_tag LOCUS_35780 13509 14774 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530229.1 protein_id gnl|my_center|LOCUS_35780 15708 14845 gene locus_tag LOCUS_35790 15708 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530228.1 protein_id gnl|my_center|LOCUS_35790 16546 15767 gene locus_tag LOCUS_35800 16546 15767 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 protein_id gnl|my_center|LOCUS_35800 17943 16675 gene locus_tag LOCUS_35810 17943 16675 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530226.1 protein_id gnl|my_center|LOCUS_35810 18069 18983 gene locus_tag LOCUS_35820 18069 18983 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530225.1 protein_id gnl|my_center|LOCUS_35820 19618 19076 gene locus_tag LOCUS_35830 19618 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972639.1 protein_id gnl|my_center|LOCUS_35830 19986 19615 gene locus_tag LOCUS_35840 19986 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970991.1 protein_id gnl|my_center|LOCUS_35840 20570 19992 gene locus_tag LOCUS_35850 20570 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968751.1 protein_id gnl|my_center|LOCUS_35850 21034 20627 gene locus_tag LOCUS_35860 21034 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970989.1 protein_id gnl|my_center|LOCUS_35860 21791 21036 gene locus_tag LOCUS_35870 gene fliR 21791 21036 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG49 protein_id gnl|my_center|LOCUS_35870 23875 21788 gene locus_tag LOCUS_35880 gene flhA 23875 21788 CDS product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970987.1 protein_id gnl|my_center|LOCUS_35880 24387 24121 gene locus_tag LOCUS_35890 gene fliQ 24387 24121 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529857.1 protein_id gnl|my_center|LOCUS_35890 24852 24448 gene locus_tag LOCUS_35900 24852 24448 CDS product flagellar basal body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529774.1 protein_id gnl|my_center|LOCUS_35900 25292 24843 gene locus_tag LOCUS_35910 gene flbT 25292 24843 CDS product putative flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U659 protein_id gnl|my_center|LOCUS_35910 25636 25289 gene locus_tag LOCUS_35920 gene flaF 25636 25289 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974489.1 protein_id gnl|my_center|LOCUS_35920 26741 25689 gene locus_tag LOCUS_35930 26741 25689 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U657 protein_id gnl|my_center|LOCUS_35930 28209 26746 gene locus_tag LOCUS_35940 gene flgK 28209 26746 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706878.1 protein_id gnl|my_center|LOCUS_35940 29504 28242 gene locus_tag LOCUS_35950 29504 28242 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFU9 protein_id gnl|my_center|LOCUS_35950 30294 29623 gene locus_tag LOCUS_35960 30294 29623 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706876.1 protein_id gnl|my_center|LOCUS_35960 31162 30575 gene locus_tag LOCUS_35970 31162 30575 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974484.1 protein_id gnl|my_center|LOCUS_35970 32642 31095 gene locus_tag LOCUS_35980 gene motD 32642 31095 CDS product chemotaxis protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706874.1 protein_id gnl|my_center|LOCUS_35980 33871 32639 gene locus_tag LOCUS_35990 33871 32639 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974482.1 protein_id gnl|my_center|LOCUS_35990 35337 34087 gene locus_tag LOCUS_36000 gene motB 35337 34087 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706872.1 protein_id gnl|my_center|LOCUS_36000 35954 35334 gene locus_tag LOCUS_36010 35954 35334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970980.1 protein_id gnl|my_center|LOCUS_36010 37227 36262 gene locus_tag LOCUS_36020 37227 36262 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG34 protein_id gnl|my_center|LOCUS_36020 38505 37531 gene locus_tag LOCUS_36030 38505 37531 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG34 protein_id gnl|my_center|LOCUS_36030 39744 38770 gene locus_tag LOCUS_36040 39744 38770 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG34 protein_id gnl|my_center|LOCUS_36040 40860 40123 gene locus_tag LOCUS_36050 gene fliP 40860 40123 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U643 protein_id gnl|my_center|LOCUS_36050 41351 40857 gene locus_tag LOCUS_36060 gene fliL 41351 40857 CDS product flagellar basal body protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313009.1 protein_id gnl|my_center|LOCUS_36060 42067 41363 gene locus_tag LOCUS_36070 gene flgH 42067 41363 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52950 protein_id gnl|my_center|LOCUS_36070 42591 42064 gene locus_tag LOCUS_36080 42591 42064 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706863.1 protein_id gnl|my_center|LOCUS_36080 43739 42588 gene locus_tag LOCUS_36090 gene flgI 43739 42588 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U639 protein_id gnl|my_center|LOCUS_36090 44143 43736 gene locus_tag LOCUS_36100 gene flgA 44143 43736 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52947 protein_id gnl|my_center|LOCUS_36100 45021 44233 gene locus_tag LOCUS_36110 45021 44233 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U637 protein_id gnl|my_center|LOCUS_36110 45367 45032 gene locus_tag LOCUS_36120 gene fliE 45367 45032 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52945 protein_id gnl|my_center|LOCUS_36120 45789 45364 gene locus_tag LOCUS_36130 gene flgC 45789 45364 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG22 protein_id gnl|my_center|LOCUS_36130 46166 45789 gene locus_tag LOCUS_36140 gene flgB 46166 45789 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG21 protein_id gnl|my_center|LOCUS_36140 46849 46295 gene locus_tag LOCUS_36150 46849 46295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706856.1 protein_id gnl|my_center|LOCUS_36150 48225 46846 gene locus_tag LOCUS_36160 gene fliI 48225 46846 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34171 protein_id gnl|my_center|LOCUS_36160 49006 48281 gene locus_tag LOCUS_36170 49006 48281 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFX1 protein_id gnl|my_center|LOCUS_36170 49788 49006 gene locus_tag LOCUS_36180 49788 49006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968728.1 protein_id gnl|my_center|LOCUS_36180 49995 50870 gene locus_tag LOCUS_36190 gene motA 49995 50870 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P97215 protein_id gnl|my_center|LOCUS_36190 50875 51828 gene locus_tag LOCUS_36200 gene fliM 50875 51828 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706851.1 protein_id gnl|my_center|LOCUS_36200 51888 52538 gene locus_tag LOCUS_36210 51888 52538 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U627 protein_id gnl|my_center|LOCUS_36210 52540 53595 gene locus_tag LOCUS_36220 gene fliG 52540 53595 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54244 protein_id gnl|my_center|LOCUS_36220 53608 54699 gene locus_tag LOCUS_36230 gene flhB 53608 54699 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974456.1 protein_id gnl|my_center|LOCUS_36230 54696 55148 gene locus_tag LOCUS_36240 54696 55148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706847.1 protein_id gnl|my_center|LOCUS_36240 55907 55167 gene locus_tag LOCUS_36250 gene agrR 55907 55167 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970955.1 protein_id gnl|my_center|LOCUS_36250 56595 55924 gene locus_tag LOCUS_36260 56595 55924 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968723.1 protein_id gnl|my_center|LOCUS_36260 58676 56982 gene locus_tag LOCUS_36270 gene fliF 58676 56982 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54239 protein_id gnl|my_center|LOCUS_36270 59268 58876 gene locus_tag LOCUS_36280 59268 58876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706843.1 protein_id gnl|my_center|LOCUS_36280 59833 59279 gene locus_tag LOCUS_36290 gene cheD 59833 59279 CDS product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1A4 protein_id gnl|my_center|LOCUS_36290 60222 59830 gene locus_tag LOCUS_36300 60222 59830 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974449.1 protein_id gnl|my_center|LOCUS_36300 61289 60219 gene locus_tag LOCUS_36310 gene cheB2 61289 60219 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG04 protein_id gnl|my_center|LOCUS_36310 62173 61292 gene locus_tag LOCUS_36320 gene cheR 62173 61292 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1A6 protein_id gnl|my_center|LOCUS_36320 62625 62170 gene locus_tag LOCUS_36330 62625 62170 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974446.1 protein_id gnl|my_center|LOCUS_36330 64928 62640 gene locus_tag LOCUS_36340 gene cheA2 64928 62640 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706837.1 protein_id gnl|my_center|LOCUS_36340 65307 64942 gene locus_tag LOCUS_36350 gene cheY 65307 64942 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493773.1 protein_id gnl|my_center|LOCUS_36350 65603 65304 gene locus_tag LOCUS_36360 65603 65304 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974443.1 protein_id gnl|my_center|LOCUS_36360 67226 65670 gene locus_tag LOCUS_36370 67226 65670 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706834.1 protein_id gnl|my_center|LOCUS_36370 69055 67979 gene locus_tag LOCUS_36380 69055 67979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968501.1 protein_id gnl|my_center|LOCUS_36380 70143 69052 gene locus_tag LOCUS_36390 70143 69052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710123.1 protein_id gnl|my_center|LOCUS_36390 71816 70143 gene locus_tag LOCUS_36400 71816 70143 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527913.1 protein_id gnl|my_center|LOCUS_36400 72351 72022 gene locus_tag LOCUS_36410 72351 72022 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709667.1 protein_id gnl|my_center|LOCUS_36410 73637 72363 gene locus_tag LOCUS_36420 73637 72363 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067724.1 protein_id gnl|my_center|LOCUS_36420 74202 73669 gene locus_tag LOCUS_36430 74202 73669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence20 401 1564 gene locus_tag LOCUS_36440 401 1564 CDS product NADH:flavin oxidoreductase / NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064652.1 protein_id gnl|my_center|LOCUS_36440 2768 1653 gene locus_tag LOCUS_36450 2768 1653 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709787.1 protein_id gnl|my_center|LOCUS_36450 3653 2772 gene locus_tag LOCUS_36460 3653 2772 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067373.1 protein_id gnl|my_center|LOCUS_36460 4549 3653 gene locus_tag LOCUS_36470 4549 3653 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067374.1 protein_id gnl|my_center|LOCUS_36470 5859 4636 gene locus_tag LOCUS_36480 5859 4636 CDS product putative sugar-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KZ7 protein_id gnl|my_center|LOCUS_36480 6049 7080 gene locus_tag LOCUS_36490 6049 7080 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709783.1 protein_id gnl|my_center|LOCUS_36490 7969 7094 gene locus_tag LOCUS_36500 7969 7094 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967736.1 protein_id gnl|my_center|LOCUS_36500 9107 7959 gene locus_tag LOCUS_36510 9107 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967737.1 protein_id gnl|my_center|LOCUS_36510 9890 9120 gene locus_tag LOCUS_36520 gene fabG 9890 9120 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967738.1 protein_id gnl|my_center|LOCUS_36520 11032 9887 gene locus_tag LOCUS_36530 11032 9887 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 protein_id gnl|my_center|LOCUS_36530 11174 12190 gene locus_tag LOCUS_36540 11174 12190 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_36540 12187 12666 gene locus_tag LOCUS_36550 12187 12666 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089134.1 protein_id gnl|my_center|LOCUS_36550 13940 12657 gene locus_tag LOCUS_36560 gene ttuD2 13940 12657 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976202.1 protein_id gnl|my_center|LOCUS_36560 14248 13937 gene locus_tag LOCUS_36570 14248 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 15089 14313 gene locus_tag LOCUS_36580 15089 14313 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967742.1 protein_id gnl|my_center|LOCUS_36580 16668 15082 gene locus_tag LOCUS_36590 16668 15082 CDS product acetate CoA-transferase YdiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92YU3 protein_id gnl|my_center|LOCUS_36590 16788 17606 gene locus_tag LOCUS_36600 16788 17606 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967744.1 protein_id gnl|my_center|LOCUS_36600 19278 17677 gene locus_tag LOCUS_36610 19278 17677 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967746.1 protein_id gnl|my_center|LOCUS_36610 20777 19278 gene locus_tag LOCUS_36620 20777 19278 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967747.1 protein_id gnl|my_center|LOCUS_36620 21178 20879 gene locus_tag LOCUS_36630 21178 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 21747 21178 gene locus_tag LOCUS_36640 gene fldA 21747 21178 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67866 protein_id gnl|my_center|LOCUS_36640 22787 21753 gene locus_tag LOCUS_36650 22787 21753 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967748.1 protein_id gnl|my_center|LOCUS_36650 23765 22824 gene locus_tag LOCUS_36660 23765 22824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967749.1 protein_id gnl|my_center|LOCUS_36660 25280 23775 gene locus_tag LOCUS_36670 25280 23775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_36670 26225 25290 gene locus_tag LOCUS_36680 26225 25290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527033.1 protein_id gnl|my_center|LOCUS_36680 27456 26347 gene locus_tag LOCUS_36690 27456 26347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967751.1 protein_id gnl|my_center|LOCUS_36690 27742 28383 gene locus_tag LOCUS_36700 27742 28383 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 protein_id gnl|my_center|LOCUS_36700 28860 28423 gene locus_tag LOCUS_36710 28860 28423 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383119.1 protein_id gnl|my_center|LOCUS_36710 30606 28960 gene locus_tag LOCUS_36720 30606 28960 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 protein_id gnl|my_center|LOCUS_36720 31125 30883 gene locus_tag LOCUS_36730 31125 30883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36730 31478 31185 gene locus_tag LOCUS_36740 31478 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36740 31881 32630 gene locus_tag LOCUS_36750 31881 32630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086813.1 protein_id gnl|my_center|LOCUS_36750 32623 33339 gene locus_tag LOCUS_36760 32623 33339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_36760 33392 34594 gene locus_tag LOCUS_36770 33392 34594 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_36770 34670 35557 gene locus_tag LOCUS_36780 34670 35557 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_36780 35557 36534 gene locus_tag LOCUS_36790 35557 36534 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_36790 37082 36891 gene locus_tag LOCUS_36800 37082 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 37168 38046 gene locus_tag LOCUS_36810 37168 38046 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_36810 38081 39325 gene locus_tag LOCUS_36820 38081 39325 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_36820 39400 40272 gene locus_tag LOCUS_36830 39400 40272 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_36830 40269 41261 gene locus_tag LOCUS_36840 40269 41261 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085708.1 protein_id gnl|my_center|LOCUS_36840 41254 42000 gene locus_tag LOCUS_36850 41254 42000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869390.1 protein_id gnl|my_center|LOCUS_36850 41993 42697 gene locus_tag LOCUS_36860 41993 42697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_36860 42694 43977 gene locus_tag LOCUS_36870 42694 43977 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 protein_id gnl|my_center|LOCUS_36870 43974 44480 gene locus_tag LOCUS_36880 43974 44480 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_36880 44477 45343 gene locus_tag LOCUS_36890 44477 45343 CDS product isocitrate lyase-family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_36890 45343 47079 gene locus_tag LOCUS_36900 45343 47079 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_36900 47076 49127 gene locus_tag LOCUS_36910 47076 49127 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_36910 49131 49745 gene locus_tag LOCUS_36920 49131 49745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_36920 49747 51180 gene locus_tag LOCUS_36930 49747 51180 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_36930 51689 51898 gene locus_tag LOCUS_36940 51689 51898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776229.1 protein_id gnl|my_center|LOCUS_36940 51929 52150 gene locus_tag LOCUS_36950 51929 52150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 52366 52596 gene locus_tag LOCUS_36960 52366 52596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 52862 53794 gene locus_tag LOCUS_36970 52862 53794 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_36970 54726 54082 gene locus_tag LOCUS_36980 54726 54082 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085711.1 protein_id gnl|my_center|LOCUS_36980 55952 54723 gene locus_tag LOCUS_36990 55952 54723 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390890.1 protein_id gnl|my_center|LOCUS_36990 56743 55949 gene locus_tag LOCUS_37000 56743 55949 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083183.1 protein_id gnl|my_center|LOCUS_37000 57030 56740 gene locus_tag LOCUS_37010 57030 56740 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707193.1 protein_id gnl|my_center|LOCUS_37010 58325 57042 gene locus_tag LOCUS_37020 58325 57042 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720648.1 protein_id gnl|my_center|LOCUS_37020 58870 58322 gene locus_tag LOCUS_37030 58870 58322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 59942 58938 gene locus_tag LOCUS_37040 59942 58938 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_37040 60070 61164 gene locus_tag LOCUS_37050 60070 61164 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085565.1 protein_id gnl|my_center|LOCUS_37050 61161 62183 gene locus_tag LOCUS_37060 61161 62183 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_37060 62185 62859 gene locus_tag LOCUS_37070 62185 62859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707195.1 protein_id gnl|my_center|LOCUS_37070 65062 63695 gene locus_tag LOCUS_37080 65062 63695 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967543.1 protein_id gnl|my_center|LOCUS_37080 66598 65084 gene locus_tag LOCUS_37090 66598 65084 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886945.1 protein_id gnl|my_center|LOCUS_37090 66828 66595 gene locus_tag LOCUS_37100 66828 66595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886946.1 protein_id gnl|my_center|LOCUS_37100 67276 66908 gene locus_tag LOCUS_37110 67276 66908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 67831 67418 gene locus_tag LOCUS_37120 67831 67418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 68223 67828 gene locus_tag LOCUS_37130 68223 67828 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_37130 68700 68293 gene locus_tag LOCUS_37140 68700 68293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 69225 68704 gene locus_tag LOCUS_37150 69225 68704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37150 69430 69248 gene locus_tag LOCUS_37160 69430 69248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 69946 69578 gene locus_tag LOCUS_37170 69946 69578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37170 71648 70134 gene locus_tag LOCUS_37180 71648 70134 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587107.1 protein_id gnl|my_center|LOCUS_37180 <72765 72200 gene locus_tag LOCUS_37190 <72765 72200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012602241.1:transposase >Feature sequence21 146 1120 gene locus_tag LOCUS_37200 146 1120 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 protein_id gnl|my_center|LOCUS_37200 1209 2357 gene locus_tag LOCUS_37210 gene gci 1209 2357 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 protein_id gnl|my_center|LOCUS_37210 3104 3433 gene locus_tag LOCUS_37220 3104 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37220 3841 4089 gene locus_tag LOCUS_37230 3841 4089 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706111.1 protein_id gnl|my_center|LOCUS_37230 4086 4499 gene locus_tag LOCUS_37240 gene vapC 4086 4499 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBE3 protein_id gnl|my_center|LOCUS_37240 4758 4546 gene locus_tag LOCUS_37250 4758 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37250 5747 5154 gene locus_tag LOCUS_37260 5747 5154 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084470.1 protein_id gnl|my_center|LOCUS_37260 6263 6054 gene locus_tag LOCUS_37270 6263 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 7616 6477 gene locus_tag LOCUS_37280 gene menC 7616 6477 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZP3 protein_id gnl|my_center|LOCUS_37280 8474 7647 gene locus_tag LOCUS_37290 8474 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 9337 8474 gene locus_tag LOCUS_37300 9337 8474 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762885.1 protein_id gnl|my_center|LOCUS_37300 10218 9334 gene locus_tag LOCUS_37310 10218 9334 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 protein_id gnl|my_center|LOCUS_37310 11138 10221 gene locus_tag LOCUS_37320 gene appB 11138 10221 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383488.1 protein_id gnl|my_center|LOCUS_37320 12787 11249 gene locus_tag LOCUS_37330 12787 11249 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_37330 12942 13721 gene locus_tag LOCUS_37340 12942 13721 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389098.1 protein_id gnl|my_center|LOCUS_37340 15438 14308 gene locus_tag LOCUS_37350 15438 14308 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 protein_id gnl|my_center|LOCUS_37350 16322 15435 gene locus_tag LOCUS_37360 16322 15435 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_37360 16454 17875 gene locus_tag LOCUS_37370 16454 17875 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_37370 17889 18881 gene locus_tag LOCUS_37380 17889 18881 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_37380 18981 19526 gene locus_tag LOCUS_37390 18981 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 19528 20817 gene locus_tag LOCUS_37400 19528 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039977.1 protein_id gnl|my_center|LOCUS_37400 20814 21227 gene locus_tag LOCUS_37410 20814 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 21971 21279 gene locus_tag LOCUS_37420 21971 21279 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_37420 22663 21968 gene locus_tag LOCUS_37430 22663 21968 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_37430 23580 22723 gene locus_tag LOCUS_37440 23580 22723 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865184.1 protein_id gnl|my_center|LOCUS_37440 23933 23580 gene locus_tag LOCUS_37450 23933 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 25247 23967 gene locus_tag LOCUS_37460 25247 23967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_37460 25711 25244 gene locus_tag LOCUS_37470 25711 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 26718 25732 gene locus_tag LOCUS_37480 26718 25732 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974199.1 protein_id gnl|my_center|LOCUS_37480 27241 27675 gene locus_tag LOCUS_37490 27241 27675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 27822 29900 gene locus_tag LOCUS_37500 27822 29900 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969300.1 protein_id gnl|my_center|LOCUS_37500 29890 31650 gene locus_tag LOCUS_37510 29890 31650 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_37510 32409 31816 gene locus_tag LOCUS_37520 32409 31816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969298.1 protein_id gnl|my_center|LOCUS_37520 32900 32406 gene locus_tag LOCUS_37530 32900 32406 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969297.1 protein_id gnl|my_center|LOCUS_37530 33538 32897 gene locus_tag LOCUS_37540 33538 32897 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969296.1 protein_id gnl|my_center|LOCUS_37540 34473 33550 gene locus_tag LOCUS_37550 34473 33550 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530291.1 protein_id gnl|my_center|LOCUS_37550 35486 34479 gene locus_tag LOCUS_37560 35486 34479 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969294.1 protein_id gnl|my_center|LOCUS_37560 36497 35517 gene locus_tag LOCUS_37570 36497 35517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_37570 37564 36485 gene locus_tag LOCUS_37580 37564 36485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_37580 39087 37561 gene locus_tag LOCUS_37590 39087 37561 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969291.1 protein_id gnl|my_center|LOCUS_37590 40164 39157 gene locus_tag LOCUS_37600 40164 39157 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969290.1 protein_id gnl|my_center|LOCUS_37600 40356 41240 gene locus_tag LOCUS_37610 40356 41240 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_37610 41237 42016 gene locus_tag LOCUS_37620 41237 42016 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969288.1 protein_id gnl|my_center|LOCUS_37620 43502 42723 gene locus_tag LOCUS_37630 43502 42723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807400.1 protein_id gnl|my_center|LOCUS_37630 44308 43499 gene locus_tag LOCUS_37640 44308 43499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_37640 45285 44308 gene locus_tag LOCUS_37650 45285 44308 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807397.1 protein_id gnl|my_center|LOCUS_37650 45457 47535 gene locus_tag LOCUS_37660 45457 47535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870478.1 protein_id gnl|my_center|LOCUS_37660 47554 49299 gene locus_tag LOCUS_37670 gene hyuB 47554 49299 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_37670 49299 50144 gene locus_tag LOCUS_37680 49299 50144 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887867.1 protein_id gnl|my_center|LOCUS_37680 50180 50881 gene locus_tag LOCUS_37690 50180 50881 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887871.1 protein_id gnl|my_center|LOCUS_37690 50910 51719 gene locus_tag LOCUS_37700 50910 51719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087151.1 protein_id gnl|my_center|LOCUS_37700 52220 51774 gene locus_tag LOCUS_37710 52220 51774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37710 53601 52897 gene locus_tag LOCUS_37720 53601 52897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 55383 53614 gene locus_tag LOCUS_37730 gene acd 55383 53614 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_37730 56533 57450 gene locus_tag LOCUS_37740 56533 57450 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 protein_id gnl|my_center|LOCUS_37740 57883 57488 gene locus_tag LOCUS_37750 57883 57488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 57773 58288 gene locus_tag LOCUS_37760 57773 58288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 58281 59018 gene locus_tag LOCUS_37770 58281 59018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086099.1 protein_id gnl|my_center|LOCUS_37770 59015 59752 gene locus_tag LOCUS_37780 59015 59752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086098.1 protein_id gnl|my_center|LOCUS_37780 59791 60618 gene locus_tag LOCUS_37790 59791 60618 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184775.1 protein_id gnl|my_center|LOCUS_37790 60676 61815 gene locus_tag LOCUS_37800 60676 61815 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039923.1 protein_id gnl|my_center|LOCUS_37800 61981 63120 gene locus_tag LOCUS_37810 61981 63120 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q09 protein_id gnl|my_center|LOCUS_37810 63160 63942 gene locus_tag LOCUS_37820 63160 63942 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807981.1 protein_id gnl|my_center|LOCUS_37820 63956 64837 gene locus_tag LOCUS_37830 63956 64837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086106.1 protein_id gnl|my_center|LOCUS_37830 64840 66093 gene locus_tag LOCUS_37840 gene amaB 64840 66093 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086107.1 protein_id gnl|my_center|LOCUS_37840 66083 67594 gene locus_tag LOCUS_37850 66083 67594 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898298.1 protein_id gnl|my_center|LOCUS_37850 67745 68038 gene locus_tag LOCUS_37860 67745 68038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 69113 68940 gene locus_tag LOCUS_37870 69113 68940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 70480 69098 gene locus_tag LOCUS_37880 70480 69098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 70578 70862 gene locus_tag LOCUS_37890 70578 70862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence22 841 194 gene locus_tag LOCUS_37900 gene msrQ 841 194 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QE8 protein_id gnl|my_center|LOCUS_37900 1791 844 gene locus_tag LOCUS_37910 gene msrP 1791 844 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB06 protein_id gnl|my_center|LOCUS_37910 2085 3620 gene locus_tag LOCUS_37920 2085 3620 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971956.1 protein_id gnl|my_center|LOCUS_37920 3624 4937 gene locus_tag LOCUS_37930 3624 4937 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707778.1 protein_id gnl|my_center|LOCUS_37930 4998 6011 gene locus_tag LOCUS_37940 4998 6011 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDK1 protein_id gnl|my_center|LOCUS_37940 6417 6073 gene locus_tag LOCUS_37950 6417 6073 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_37950 6923 7471 gene locus_tag LOCUS_37960 gene hemG 6923 7471 CDS product oxygen-independent protoporphyrinogen oxidase HemG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 protein_id gnl|my_center|LOCUS_37960 7605 7979 gene locus_tag LOCUS_37970 gene crcB 7605 7979 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMF4 protein_id gnl|my_center|LOCUS_37970 8017 9006 gene locus_tag LOCUS_37980 gene rluC 8017 9006 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QE2 protein_id gnl|my_center|LOCUS_37980 9003 9650 gene locus_tag LOCUS_37990 9003 9650 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971648.1 protein_id gnl|my_center|LOCUS_37990 9667 10449 gene locus_tag LOCUS_38000 9667 10449 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971649.1 protein_id gnl|my_center|LOCUS_38000 10627 11481 gene locus_tag LOCUS_38010 10627 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 12481 11648 gene locus_tag LOCUS_38020 12481 11648 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE68 protein_id gnl|my_center|LOCUS_38020 13646 12537 gene locus_tag LOCUS_38030 gene adhC1 13646 12537 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QD7 protein_id gnl|my_center|LOCUS_38030 14235 13840 gene locus_tag LOCUS_38040 14235 13840 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975202.1 protein_id gnl|my_center|LOCUS_38040 15309 14641 gene locus_tag LOCUS_38050 15309 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 15967 15353 gene locus_tag LOCUS_38060 gene lipB 15967 15353 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U899 protein_id gnl|my_center|LOCUS_38060 15902 16333 gene locus_tag LOCUS_38070 15902 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 16298 16384 gene locus_tag LOCUS_t00320 16298 16384 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16721 16593 gene locus_tag LOCUS_38080 16721 16593 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313811.1 protein_id gnl|my_center|LOCUS_38080 17901 16738 gene locus_tag LOCUS_38090 gene cydB 17901 16738 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 protein_id gnl|my_center|LOCUS_38090 19517 17907 gene locus_tag LOCUS_38100 gene cydA 19517 17907 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 protein_id gnl|my_center|LOCUS_38100 21334 19661 gene locus_tag LOCUS_38110 gene cydC 21334 19661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 protein_id gnl|my_center|LOCUS_38110 22998 21331 gene locus_tag LOCUS_38120 gene cydD 22998 21331 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973554.1 protein_id gnl|my_center|LOCUS_38120 23130 23618 gene locus_tag LOCUS_38130 23130 23618 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720045.1 protein_id gnl|my_center|LOCUS_38130 24100 23813 gene locus_tag LOCUS_38140 24100 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 24518 25954 gene locus_tag LOCUS_38150 24518 25954 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 protein_id gnl|my_center|LOCUS_38150 26041 26427 gene locus_tag LOCUS_38160 26041 26427 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515319.1 protein_id gnl|my_center|LOCUS_38160 26916 26452 gene locus_tag LOCUS_38170 26916 26452 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969210.1 protein_id gnl|my_center|LOCUS_38170 27963 26977 gene locus_tag LOCUS_38180 27963 26977 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971701.1 protein_id gnl|my_center|LOCUS_38180 29048 28110 gene locus_tag LOCUS_38190 29048 28110 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067123.1 protein_id gnl|my_center|LOCUS_38190 29359 29045 gene locus_tag LOCUS_38200 29359 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 protein_id gnl|my_center|LOCUS_38200 30051 29356 gene locus_tag LOCUS_38210 30051 29356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975213.1 protein_id gnl|my_center|LOCUS_38210 30644 32044 gene locus_tag LOCUS_38220 30644 32044 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707802.1 protein_id gnl|my_center|LOCUS_38220 32089 32388 gene locus_tag LOCUS_38230 32089 32388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706751.1 protein_id gnl|my_center|LOCUS_38230 32595 33032 gene locus_tag LOCUS_38240 32595 33032 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 protein_id gnl|my_center|LOCUS_38240 33143 33934 gene locus_tag LOCUS_38250 33143 33934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531779.1 protein_id gnl|my_center|LOCUS_38250 33931 34626 gene locus_tag LOCUS_38260 33931 34626 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_38260 36102 34708 gene locus_tag LOCUS_38270 36102 34708 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969214.1 protein_id gnl|my_center|LOCUS_38270 36396 36725 gene locus_tag LOCUS_38280 36396 36725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707880.1 protein_id gnl|my_center|LOCUS_38280 36938 37306 gene locus_tag LOCUS_38290 gene clpS2 36938 37306 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBP3 protein_id gnl|my_center|LOCUS_38290 37318 39858 gene locus_tag LOCUS_38300 gene clpA 37318 39858 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969251.1 protein_id gnl|my_center|LOCUS_38300 40155 40814 gene locus_tag LOCUS_38310 40155 40814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708801.1 protein_id gnl|my_center|LOCUS_38310 41016 41744 gene locus_tag LOCUS_38320 41016 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707883.1 protein_id gnl|my_center|LOCUS_38320 41741 42094 gene locus_tag LOCUS_38330 41741 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975289.1 protein_id gnl|my_center|LOCUS_38330 42661 42179 gene locus_tag LOCUS_38340 42661 42179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314354.1 protein_id gnl|my_center|LOCUS_38340 43214 44158 gene locus_tag LOCUS_38350 43214 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_38350 44612 44184 gene locus_tag LOCUS_38360 44612 44184 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971569.1 protein_id gnl|my_center|LOCUS_38360 45937 44699 gene locus_tag LOCUS_38370 45937 44699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_38370 46765 46028 gene locus_tag LOCUS_38380 46765 46028 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975292.1 protein_id gnl|my_center|LOCUS_38380 47240 46773 gene locus_tag LOCUS_38390 47240 46773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971572.1 protein_id gnl|my_center|LOCUS_38390 47368 48213 gene locus_tag LOCUS_38400 47368 48213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707889.1 protein_id gnl|my_center|LOCUS_38400 48423 49727 gene locus_tag LOCUS_38410 48423 49727 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971311.1 protein_id gnl|my_center|LOCUS_38410 49703 50026 gene locus_tag LOCUS_38420 49703 50026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 49939 50772 gene locus_tag LOCUS_38430 gene rpsB 49939 50772 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K2 protein_id gnl|my_center|LOCUS_38430 50925 51848 gene locus_tag LOCUS_38440 gene tsf 50925 51848 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM2 protein_id gnl|my_center|LOCUS_38440 51954 52676 gene locus_tag LOCUS_38450 gene pyrH 51954 52676 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM1 protein_id gnl|my_center|LOCUS_38450 52742 53302 gene locus_tag LOCUS_38460 gene frr 52742 53302 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q52 protein_id gnl|my_center|LOCUS_38460 53329 54084 gene locus_tag LOCUS_38470 gene uppS 53329 54084 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q51 protein_id gnl|my_center|LOCUS_38470 54084 54920 gene locus_tag LOCUS_38480 gene cdsA 54084 54920 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q50 protein_id gnl|my_center|LOCUS_38480 55020 56153 gene locus_tag LOCUS_38490 55020 56153 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_38490 56357 58723 gene locus_tag LOCUS_38500 gene omp 56357 58723 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q48 protein_id gnl|my_center|LOCUS_38500 58774 59847 gene locus_tag LOCUS_38510 gene lpxD 58774 59847 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q47 protein_id gnl|my_center|LOCUS_38510 59844 60317 gene locus_tag LOCUS_38520 gene fabZ 59844 60317 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8L1 protein_id gnl|my_center|LOCUS_38520 60314 61144 gene locus_tag LOCUS_38530 gene lpxA 60314 61144 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR2 protein_id gnl|my_center|LOCUS_38530 61150 62031 gene locus_tag LOCUS_38540 61150 62031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707901.1 protein_id gnl|my_center|LOCUS_38540 62031 63191 gene locus_tag LOCUS_38550 gene lpxB 62031 63191 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969263.1 protein_id gnl|my_center|LOCUS_38550 64665 63403 gene locus_tag LOCUS_38560 gene gltA 64665 63403 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33915 protein_id gnl|my_center|LOCUS_38560 65009 67471 gene locus_tag LOCUS_38570 65009 67471 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975315.1 protein_id gnl|my_center|LOCUS_38570 68490 67774 gene locus_tag LOCUS_38580 gene lexA 68490 67774 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCJ7 protein_id gnl|my_center|LOCUS_38580 >Feature sequence23 254 2206 gene locus_tag LOCUS_38590 gene acsA 254 2206 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL16 protein_id gnl|my_center|LOCUS_38590 2530 2348 gene locus_tag LOCUS_38600 2530 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3515 3288 gene locus_tag LOCUS_38610 3515 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38610 4001 3600 gene locus_tag LOCUS_38620 4001 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38620 4392 4201 gene locus_tag LOCUS_38630 4392 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4840 4421 gene locus_tag LOCUS_38640 4840 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38640 6197 4926 gene locus_tag LOCUS_38650 6197 4926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_38650 7339 6203 gene locus_tag LOCUS_38660 7339 6203 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_38660 8847 7336 gene locus_tag LOCUS_38670 8847 7336 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256433.1 protein_id gnl|my_center|LOCUS_38670 9945 8914 gene locus_tag LOCUS_38680 9945 8914 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_38680 10393 12354 gene locus_tag LOCUS_38690 10393 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 13421 13332 gene locus_tag LOCUS_t00330 13421 13332 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13740 14132 gene locus_tag LOCUS_38700 13740 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710011.1 protein_id gnl|my_center|LOCUS_38700 14192 14845 gene locus_tag LOCUS_38710 gene msrA 14192 14845 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF08 protein_id gnl|my_center|LOCUS_38710 15050 16042 gene locus_tag LOCUS_38720 15050 16042 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968424.1 protein_id gnl|my_center|LOCUS_38720 16274 16897 gene locus_tag LOCUS_38730 16274 16897 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710060.1 protein_id gnl|my_center|LOCUS_38730 17236 18219 gene locus_tag LOCUS_38740 17236 18219 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531569.1 protein_id gnl|my_center|LOCUS_38740 19989 18283 gene locus_tag LOCUS_38750 19989 18283 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC83 protein_id gnl|my_center|LOCUS_38750 20776 20129 gene locus_tag LOCUS_38760 gene cmk 20776 20129 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SV4 protein_id gnl|my_center|LOCUS_38760 21422 20787 gene locus_tag LOCUS_38770 21422 20787 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_38770 22154 21513 gene locus_tag LOCUS_38780 22154 21513 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_38780 23509 22151 gene locus_tag LOCUS_38790 gene aroA 23509 22151 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC80 protein_id gnl|my_center|LOCUS_38790 23733 24137 gene locus_tag LOCUS_38800 23733 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 24309 24384 gene locus_tag LOCUS_t00340 24309 24384 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24659 26098 gene locus_tag LOCUS_38810 24659 26098 CDS product prenyltransferase UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531146.1 protein_id gnl|my_center|LOCUS_38810 26098 27444 gene locus_tag LOCUS_38820 26098 27444 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707831.1 protein_id gnl|my_center|LOCUS_38820 27544 28539 gene locus_tag LOCUS_38830 gene gpsA 27544 28539 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV4 protein_id gnl|my_center|LOCUS_38830 28698 30953 gene locus_tag LOCUS_38840 28698 30953 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 protein_id gnl|my_center|LOCUS_38840 30993 32420 gene locus_tag LOCUS_38850 gene noeK 30993 32420 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972275.1 protein_id gnl|my_center|LOCUS_38850 32815 32486 gene locus_tag LOCUS_38860 gene ebr 32815 32486 CDS product quaternary ammonium compound efflux SMR transporter QacE delta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679427.1 protein_id gnl|my_center|LOCUS_38860 34524 33079 gene locus_tag LOCUS_38870 34524 33079 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336795.1 protein_id gnl|my_center|LOCUS_38870 36313 35063 gene locus_tag LOCUS_38880 36313 35063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067634.1 protein_id gnl|my_center|LOCUS_38880 36760 36371 gene locus_tag LOCUS_38890 36760 36371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 37377 36772 gene locus_tag LOCUS_38900 gene recR 37377 36772 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_38900 37729 37406 gene locus_tag LOCUS_38910 37729 37406 CDS product nucleoid-associated protein R00231 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SX1 protein_id gnl|my_center|LOCUS_38910 39637 37796 gene locus_tag LOCUS_38920 39637 37796 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970650.1 protein_id gnl|my_center|LOCUS_38920 39938 40342 gene locus_tag LOCUS_38930 39938 40342 CDS product diadenosine tetraphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067629.1 protein_id gnl|my_center|LOCUS_38930 40346 41308 gene locus_tag LOCUS_38940 40346 41308 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067628.1 protein_id gnl|my_center|LOCUS_38940 42218 41331 gene locus_tag LOCUS_38950 gene pheA 42218 41331 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533422.1 protein_id gnl|my_center|LOCUS_38950 42892 42245 gene locus_tag LOCUS_38960 gene kdsB 42892 42245 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC49 protein_id gnl|my_center|LOCUS_38960 43173 43727 gene locus_tag LOCUS_38970 43173 43727 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710018.1 protein_id gnl|my_center|LOCUS_38970 43872 45701 gene locus_tag LOCUS_38980 43872 45701 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531957.1 protein_id gnl|my_center|LOCUS_38980 45861 46964 gene locus_tag LOCUS_38990 45861 46964 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310022.1 protein_id gnl|my_center|LOCUS_38990 46961 48112 gene locus_tag LOCUS_39000 46961 48112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970713.1 protein_id gnl|my_center|LOCUS_39000 48109 49758 gene locus_tag LOCUS_39010 48109 49758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_39010 49767 50732 gene locus_tag LOCUS_39020 49767 50732 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_39020 51599 50739 gene locus_tag LOCUS_39030 51599 50739 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968389.1 protein_id gnl|my_center|LOCUS_39030 51963 51601 gene locus_tag LOCUS_39040 51963 51601 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537743.1 protein_id gnl|my_center|LOCUS_39040 53431 52037 gene locus_tag LOCUS_39050 53431 52037 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067561.1 protein_id gnl|my_center|LOCUS_39050 53704 54390 gene locus_tag LOCUS_39060 53704 54390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709944.1 protein_id gnl|my_center|LOCUS_39060 55725 54712 gene locus_tag LOCUS_39070 55725 54712 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 protein_id gnl|my_center|LOCUS_39070 56749 55739 gene locus_tag LOCUS_39080 56749 55739 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709941.1 protein_id gnl|my_center|LOCUS_39080 58261 56762 gene locus_tag LOCUS_39090 58261 56762 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067557.1 protein_id gnl|my_center|LOCUS_39090 59574 58288 gene locus_tag LOCUS_39100 gene cpaE1 59574 58288 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709939.1 protein_id gnl|my_center|LOCUS_39100 60321 59620 gene locus_tag LOCUS_39110 gene cpaD 60321 59620 CDS product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709938.1 protein_id gnl|my_center|LOCUS_39110 61877 60336 gene locus_tag LOCUS_39120 61877 60336 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067554.1 protein_id gnl|my_center|LOCUS_39120 62695 61886 gene locus_tag LOCUS_39130 gene cpaB1 62695 61886 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968380.1 protein_id gnl|my_center|LOCUS_39130 63505 62990 gene locus_tag LOCUS_39140 gene cpaA1 63505 62990 CDS product type 4 prepilin peptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968379.1 protein_id gnl|my_center|LOCUS_39140 63810 63625 gene locus_tag LOCUS_39150 gene pilA1 63810 63625 CDS product PilA pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709934.1 protein_id gnl|my_center|LOCUS_39150 >Feature sequence24 279 1088 gene locus_tag LOCUS_39160 279 1088 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067309.1 protein_id gnl|my_center|LOCUS_39160 1222 2055 gene locus_tag LOCUS_39170 1222 2055 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528865.1 protein_id gnl|my_center|LOCUS_39170 2258 3076 gene locus_tag LOCUS_39180 2258 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 3231 3506 gene locus_tag LOCUS_39190 3231 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 3590 4225 gene locus_tag LOCUS_39200 3590 4225 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_39200 5181 4207 gene locus_tag LOCUS_39210 5181 4207 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708907.1 protein_id gnl|my_center|LOCUS_39210 5277 5510 gene locus_tag LOCUS_39220 5277 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 5589 6134 gene locus_tag LOCUS_39230 5589 6134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706943.1 protein_id gnl|my_center|LOCUS_39230 6364 7773 gene locus_tag LOCUS_39240 gene leuC 6364 7773 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9V0 protein_id gnl|my_center|LOCUS_39240 8312 9463 gene locus_tag LOCUS_39250 8312 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 10133 9501 gene locus_tag LOCUS_39260 10133 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 10154 10627 gene locus_tag LOCUS_39270 10154 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 10860 11255 gene locus_tag LOCUS_39280 10860 11255 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709624.1 protein_id gnl|my_center|LOCUS_39280 11269 11658 gene locus_tag LOCUS_39290 11269 11658 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709623.1 protein_id gnl|my_center|LOCUS_39290 11665 13506 gene locus_tag LOCUS_39300 gene sdhA 11665 13506 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHJ8 protein_id gnl|my_center|LOCUS_39300 13513 14055 gene locus_tag LOCUS_39310 13513 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 14063 14842 gene locus_tag LOCUS_39320 gene sdhB 14063 14842 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHJ9 protein_id gnl|my_center|LOCUS_39320 15092 16480 gene locus_tag LOCUS_39330 15092 16480 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971435.1 protein_id gnl|my_center|LOCUS_39330 17644 16499 gene locus_tag LOCUS_39340 17644 16499 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_39340 18748 17768 gene locus_tag LOCUS_39350 18748 17768 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_39350 18839 19789 gene locus_tag LOCUS_39360 18839 19789 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_39360 19920 21281 gene locus_tag LOCUS_39370 19920 21281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 protein_id gnl|my_center|LOCUS_39370 21376 21717 gene locus_tag LOCUS_39380 21376 21717 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I69 protein_id gnl|my_center|LOCUS_39380 21849 22451 gene locus_tag LOCUS_39390 gene msrA 21849 22451 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9U3 protein_id gnl|my_center|LOCUS_39390 22566 22979 gene locus_tag LOCUS_39400 22566 22979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 23146 23679 gene locus_tag LOCUS_39410 gene omp19 23146 23679 CDS product outer membrane lipoprotein omp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q926C0 protein_id gnl|my_center|LOCUS_39410 23720 24892 gene locus_tag LOCUS_39420 23720 24892 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 protein_id gnl|my_center|LOCUS_39420 25058 26020 gene locus_tag LOCUS_39430 gene mdh 25058 26020 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EYJ6 protein_id gnl|my_center|LOCUS_39430 26057 27253 gene locus_tag LOCUS_39440 gene sucC 26057 27253 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIV6 protein_id gnl|my_center|LOCUS_39440 27258 28160 gene locus_tag LOCUS_39450 gene sucD 27258 28160 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LJ5 protein_id gnl|my_center|LOCUS_39450 28193 28603 gene locus_tag LOCUS_39460 28193 28603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 28666 31656 gene locus_tag LOCUS_39470 gene sucA 28666 31656 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 protein_id gnl|my_center|LOCUS_39470 31716 33011 gene locus_tag LOCUS_39480 gene sucB2 31716 33011 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9T6 protein_id gnl|my_center|LOCUS_39480 33022 33531 gene locus_tag LOCUS_39490 33022 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709611.1 protein_id gnl|my_center|LOCUS_39490 33556 34962 gene locus_tag LOCUS_39500 33556 34962 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW3 protein_id gnl|my_center|LOCUS_39500 34997 35482 gene locus_tag LOCUS_39510 34997 35482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709608.1 protein_id gnl|my_center|LOCUS_39510 35959 35606 gene locus_tag LOCUS_39520 35959 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 37148 36060 gene locus_tag LOCUS_39530 37148 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972447.1 protein_id gnl|my_center|LOCUS_39530 38376 37360 gene locus_tag LOCUS_39540 38376 37360 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090238.1 protein_id gnl|my_center|LOCUS_39540 39421 38471 gene locus_tag LOCUS_39550 gene xerC 39421 38471 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S9 protein_id gnl|my_center|LOCUS_39550 39695 40603 gene locus_tag LOCUS_39560 39695 40603 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067143.1 protein_id gnl|my_center|LOCUS_39560 41390 40737 gene locus_tag LOCUS_39570 gene tal 41390 40737 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK3 protein_id gnl|my_center|LOCUS_39570 41487 43691 gene locus_tag LOCUS_39580 gene priA 41487 43691 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK4 protein_id gnl|my_center|LOCUS_39580 43794 45536 gene locus_tag LOCUS_39590 43794 45536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 46252 45572 gene locus_tag LOCUS_39600 46252 45572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 46833 46588 gene locus_tag LOCUS_39610 46833 46588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 46960 47814 gene locus_tag LOCUS_39620 46960 47814 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531192.1 protein_id gnl|my_center|LOCUS_39620 47846 48322 gene locus_tag LOCUS_39630 47846 48322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 50179 48443 gene locus_tag LOCUS_39640 50179 48443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971737.1 protein_id gnl|my_center|LOCUS_39640 50609 50181 gene locus_tag LOCUS_39650 50609 50181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315456.1 protein_id gnl|my_center|LOCUS_39650 51226 51615 gene locus_tag LOCUS_39660 51226 51615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529034.1 protein_id gnl|my_center|LOCUS_39660 51869 52429 gene locus_tag LOCUS_39670 gene atpH 51869 52429 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM4 protein_id gnl|my_center|LOCUS_39670 >Feature sequence25 <1 839 gene locus_tag LOCUS_39680 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974233.1:transposase 836 1594 gene locus_tag LOCUS_39690 gene istB 836 1594 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_39690 2852 2067 gene locus_tag LOCUS_39700 2852 2067 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_39700 4022 2862 gene locus_tag LOCUS_39710 gene pyrG 4022 2862 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974704.1 protein_id gnl|my_center|LOCUS_39710 4206 5405 gene locus_tag LOCUS_39720 gene aatA 4206 5405 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBU9 protein_id gnl|my_center|LOCUS_39720 6389 5466 gene locus_tag LOCUS_39730 gene dapA 6389 5466 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HF16 protein_id gnl|my_center|LOCUS_39730 7586 6414 gene locus_tag LOCUS_39740 7586 6414 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_39740 8679 7588 gene locus_tag LOCUS_39750 8679 7588 CDS product chloromuconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974706.1 protein_id gnl|my_center|LOCUS_39750 9840 8683 gene locus_tag LOCUS_39760 gene argE 9840 8683 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_39760 10609 9869 gene locus_tag LOCUS_39770 10609 9869 CDS product amino acid ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313623.1 protein_id gnl|my_center|LOCUS_39770 11334 10606 gene locus_tag LOCUS_39780 11334 10606 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313622.1 protein_id gnl|my_center|LOCUS_39780 12259 11435 gene locus_tag LOCUS_39790 12259 11435 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 protein_id gnl|my_center|LOCUS_39790 12687 13493 gene locus_tag LOCUS_39800 12687 13493 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974709.1 protein_id gnl|my_center|LOCUS_39800 13701 13850 gene locus_tag LOCUS_39810 13701 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 13851 14351 gene locus_tag LOCUS_39820 13851 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39820 14341 14646 gene locus_tag LOCUS_39830 14341 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 16512 15007 gene locus_tag LOCUS_39840 16512 15007 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 protein_id gnl|my_center|LOCUS_39840 17579 16668 gene locus_tag LOCUS_39850 17579 16668 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090676.1 protein_id gnl|my_center|LOCUS_39850 18751 17576 gene locus_tag LOCUS_39860 18751 17576 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_39860 19781 18765 gene locus_tag LOCUS_39870 gene pdxA2 19781 18765 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1Q5 protein_id gnl|my_center|LOCUS_39870 21058 19778 gene locus_tag LOCUS_39880 21058 19778 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 protein_id gnl|my_center|LOCUS_39880 21618 21055 gene locus_tag LOCUS_39890 21618 21055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 22669 21686 gene locus_tag LOCUS_39900 22669 21686 CDS product periplasmic substrate-binding transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_39900 23171 22818 gene locus_tag LOCUS_39910 23171 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 23076 23477 gene locus_tag LOCUS_39920 23076 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39920 24828 24064 gene locus_tag LOCUS_39930 gene dthD 24828 24064 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYC2 protein_id gnl|my_center|LOCUS_39930 25366 24833 gene locus_tag LOCUS_39940 25366 24833 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_39940 27570 25381 gene locus_tag LOCUS_39950 27570 25381 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_39950 28565 27711 gene locus_tag LOCUS_39960 28565 27711 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_39960 29706 28708 gene locus_tag LOCUS_39970 29706 28708 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_39970 31136 29793 gene locus_tag LOCUS_39980 gene accC 31136 29793 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_038245.2 protein_id gnl|my_center|LOCUS_39980 32164 31193 gene locus_tag LOCUS_39990 32164 31193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065050.1 protein_id gnl|my_center|LOCUS_39990 33340 32195 gene locus_tag LOCUS_40000 33340 32195 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_40000 33754 33368 gene locus_tag LOCUS_40010 33754 33368 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_40010 34980 33766 gene locus_tag LOCUS_40020 34980 33766 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_40020 36481 35003 gene locus_tag LOCUS_40030 36481 35003 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_40030 37059 36478 gene locus_tag LOCUS_40040 37059 36478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 37875 37087 gene locus_tag LOCUS_40050 37875 37087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808732.1 protein_id gnl|my_center|LOCUS_40050 38717 37872 gene locus_tag LOCUS_40060 38717 37872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083244.1 protein_id gnl|my_center|LOCUS_40060 39787 38714 gene locus_tag LOCUS_40070 39787 38714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 39978 40799 gene locus_tag LOCUS_40080 39978 40799 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807828.1 protein_id gnl|my_center|LOCUS_40080 41500 40919 gene locus_tag LOCUS_40090 41500 40919 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 protein_id gnl|my_center|LOCUS_40090 42227 41631 gene locus_tag LOCUS_40100 gene fabG 42227 41631 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_40100 42144 42383 gene locus_tag LOCUS_40110 42144 42383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 42571 43473 gene locus_tag LOCUS_40120 42571 43473 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 protein_id gnl|my_center|LOCUS_40120 43554 44072 gene locus_tag LOCUS_40130 43554 44072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence26 5900 7066 gene locus_tag LOCUS_40140 5900 7066 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529852.1 protein_id gnl|my_center|LOCUS_40140 8452 7241 gene locus_tag LOCUS_40150 gene moeA 8452 7241 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_40150 8958 8458 gene locus_tag LOCUS_40160 gene moaC 8958 8458 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF1 protein_id gnl|my_center|LOCUS_40160 9774 8959 gene locus_tag LOCUS_40170 gene trpC 9774 8959 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PR9 protein_id gnl|my_center|LOCUS_40170 10813 9779 gene locus_tag LOCUS_40180 gene trpD 10813 9779 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UER8 protein_id gnl|my_center|LOCUS_40180 12727 10838 gene locus_tag LOCUS_40190 gene ppiD 12727 10838 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708007.1 protein_id gnl|my_center|LOCUS_40190 14584 13064 gene locus_tag LOCUS_40200 gene aldA 14584 13064 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_40200 15716 14691 gene locus_tag LOCUS_40210 15716 14691 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087553.1 protein_id gnl|my_center|LOCUS_40210 16045 16509 gene locus_tag LOCUS_40220 16045 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 16607 17377 gene locus_tag LOCUS_40230 gene tpiA1 16607 17377 CDS product triosephosphate isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QA1 protein_id gnl|my_center|LOCUS_40230 17508 17915 gene locus_tag LOCUS_40240 17508 17915 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531735.1 protein_id gnl|my_center|LOCUS_40240 18071 19708 gene locus_tag LOCUS_40250 gene pyrG 18071 19708 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E2 protein_id gnl|my_center|LOCUS_40250 20183 19797 gene locus_tag LOCUS_40260 20183 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 20773 20396 gene locus_tag LOCUS_40270 20773 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708435.1 protein_id gnl|my_center|LOCUS_40270 21624 20950 gene locus_tag LOCUS_40280 21624 20950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 21909 23312 gene locus_tag LOCUS_40290 21909 23312 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_40290 23702 24019 gene locus_tag LOCUS_40300 23702 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 24344 24754 gene locus_tag LOCUS_40310 24344 24754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 25579 24824 gene locus_tag LOCUS_40320 25579 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 25875 26768 gene locus_tag LOCUS_40330 25875 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534734.1 protein_id gnl|my_center|LOCUS_40330 26765 27610 gene locus_tag LOCUS_40340 gene kdsA 26765 27610 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMI6 protein_id gnl|my_center|LOCUS_40340 29647 27704 gene locus_tag LOCUS_40350 29647 27704 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887969.1 protein_id gnl|my_center|LOCUS_40350 30105 31379 gene locus_tag LOCUS_40360 gene eno 30105 31379 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q98 protein_id gnl|my_center|LOCUS_40360 31553 31861 gene locus_tag LOCUS_40370 31553 31861 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707839.1 protein_id gnl|my_center|LOCUS_40370 32009 33046 gene locus_tag LOCUS_40380 gene pdhA 32009 33046 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R9N5 protein_id gnl|my_center|LOCUS_40380 33061 34449 gene locus_tag LOCUS_40390 gene pdhB 33061 34449 CDS product pyruvate dehydrogenase E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R9N4 protein_id gnl|my_center|LOCUS_40390 34465 35847 gene locus_tag LOCUS_40400 gene pdhC 34465 35847 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R9N3 protein_id gnl|my_center|LOCUS_40400 35882 36433 gene locus_tag LOCUS_40410 35882 36433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 36504 36755 gene locus_tag LOCUS_40420 36504 36755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 36802 37452 gene locus_tag LOCUS_40430 36802 37452 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707844.1 protein_id gnl|my_center|LOCUS_40430 37631 37867 gene locus_tag LOCUS_40440 37631 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 protein_id gnl|my_center|LOCUS_40440 37928 38512 gene locus_tag LOCUS_40450 37928 38512 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969229.1 protein_id gnl|my_center|LOCUS_40450 38525 39988 gene locus_tag LOCUS_40460 gene lpdA 38525 39988 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ30 protein_id gnl|my_center|LOCUS_40460 39985 40236 gene locus_tag LOCUS_40470 39985 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 40236 40514 gene locus_tag LOCUS_40480 40236 40514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 40543 41526 gene locus_tag LOCUS_40490 gene lipA 40543 41526 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8F5 protein_id gnl|my_center|LOCUS_40490 >Feature sequence27 1783 476 gene locus_tag LOCUS_40500 1783 476 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525075.1 protein_id gnl|my_center|LOCUS_40500 3507 1780 gene locus_tag LOCUS_40510 gene prsD 3507 1780 CDS product type I secretion system ATP-binding protein PrsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ANN4 protein_id gnl|my_center|LOCUS_40510 9192 3619 gene locus_tag LOCUS_40520 9192 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 9562 10968 gene locus_tag LOCUS_40530 9562 10968 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976168.1 protein_id gnl|my_center|LOCUS_40530 10973 11608 gene locus_tag LOCUS_40540 10973 11608 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061283.1 protein_id gnl|my_center|LOCUS_40540 12511 11660 gene locus_tag LOCUS_40550 12511 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 12757 13572 gene locus_tag LOCUS_40560 12757 13572 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140962.1 protein_id gnl|my_center|LOCUS_40560 14966 13809 gene locus_tag LOCUS_40570 14966 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 15210 15121 gene locus_tag LOCUS_t00350 15210 15121 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16011 17105 gene locus_tag LOCUS_40580 16011 17105 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532601.1 protein_id gnl|my_center|LOCUS_40580 17291 17106 gene locus_tag LOCUS_40590 17291 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 17367 19133 gene locus_tag LOCUS_40600 17367 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 19290 20087 gene locus_tag LOCUS_40610 19290 20087 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529735.1 protein_id gnl|my_center|LOCUS_40610 21066 20131 gene locus_tag LOCUS_40620 21066 20131 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 protein_id gnl|my_center|LOCUS_40620 23197 21140 gene locus_tag LOCUS_40630 23197 21140 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974874.1 protein_id gnl|my_center|LOCUS_40630 23504 24385 gene locus_tag LOCUS_40640 gene dapA 23504 24385 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGL3 protein_id gnl|my_center|LOCUS_40640 24388 24870 gene locus_tag LOCUS_40650 gene smpB 24388 24870 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7A0 protein_id gnl|my_center|LOCUS_40650 25688 25095 gene locus_tag LOCUS_40660 25688 25095 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974877.1 protein_id gnl|my_center|LOCUS_40660 26064 26468 gene locus_tag LOCUS_40670 gene rpoZ 26064 26468 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R52 protein_id gnl|my_center|LOCUS_40670 26601 28841 gene locus_tag LOCUS_40680 26601 28841 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707400.1 protein_id gnl|my_center|LOCUS_40680 29089 29658 gene locus_tag LOCUS_40690 29089 29658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 protein_id gnl|my_center|LOCUS_40690 29655 30056 gene locus_tag LOCUS_40700 gene acpS 29655 30056 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S2 protein_id gnl|my_center|LOCUS_40700 30295 31041 gene locus_tag LOCUS_40710 gene lepB 30295 31041 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R48 protein_id gnl|my_center|LOCUS_40710 31038 31763 gene locus_tag LOCUS_40720 gene rnc 31038 31763 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S4 protein_id gnl|my_center|LOCUS_40720 31756 32694 gene locus_tag LOCUS_40730 gene era 31756 32694 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7A9 protein_id gnl|my_center|LOCUS_40730 32712 33482 gene locus_tag LOCUS_40740 gene recO 32712 33482 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8T8 protein_id gnl|my_center|LOCUS_40740 35006 33771 gene locus_tag LOCUS_40750 35006 33771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 protein_id gnl|my_center|LOCUS_40750 35204 35854 gene locus_tag LOCUS_40760 35204 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 35965 37086 gene locus_tag LOCUS_40770 gene nadA 35965 37086 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U4 protein_id gnl|my_center|LOCUS_40770 37138 38736 gene locus_tag LOCUS_40780 gene nadB 37138 38736 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8U5 protein_id gnl|my_center|LOCUS_40780 38740 39615 gene locus_tag LOCUS_40790 gene nadC 38740 39615 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969041.1 protein_id gnl|my_center|LOCUS_40790 39761 40657 gene locus_tag LOCUS_40800 39761 40657 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337530.1 protein_id gnl|my_center|LOCUS_40800 42397 40775 gene locus_tag LOCUS_40810 42397 40775 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_40810 42850 42449 gene locus_tag LOCUS_40820 42850 42449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence28 1715 1326 gene locus_tag LOCUS_40830 gene nsrR 1715 1326 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_40830 1803 1961 gene locus_tag LOCUS_40840 1803 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 2044 2403 gene locus_tag LOCUS_40850 2044 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_40850 2899 2504 gene locus_tag LOCUS_40860 2899 2504 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531054.1 protein_id gnl|my_center|LOCUS_40860 3545 2886 gene locus_tag LOCUS_40870 3545 2886 CDS product nitrile hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_40870 4210 3542 gene locus_tag LOCUS_40880 4210 3542 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531052.1 protein_id gnl|my_center|LOCUS_40880 5038 4538 gene locus_tag LOCUS_40890 5038 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 5964 5368 gene locus_tag LOCUS_40900 5964 5368 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 protein_id gnl|my_center|LOCUS_40900 6099 6944 gene locus_tag LOCUS_40910 6099 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708542.1 protein_id gnl|my_center|LOCUS_40910 7532 6960 gene locus_tag LOCUS_40920 gene ilvH 7532 6960 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534906.1 protein_id gnl|my_center|LOCUS_40920 9386 7611 gene locus_tag LOCUS_40930 gene ilvI 9386 7611 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NR5 protein_id gnl|my_center|LOCUS_40930 9710 11611 gene locus_tag LOCUS_40940 9710 11611 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708546.1 protein_id gnl|my_center|LOCUS_40940 12473 11691 gene locus_tag LOCUS_40950 12473 11691 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531037.1 protein_id gnl|my_center|LOCUS_40950 13469 12567 gene locus_tag LOCUS_40960 gene miaA 13469 12567 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NR2 protein_id gnl|my_center|LOCUS_40960 13468 14358 gene locus_tag LOCUS_40970 gene serB 13468 14358 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708549.1 protein_id gnl|my_center|LOCUS_40970 14355 14909 gene locus_tag LOCUS_40980 14355 14909 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531034.1 protein_id gnl|my_center|LOCUS_40980 16454 14979 gene locus_tag LOCUS_40990 16454 14979 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531033.1 protein_id gnl|my_center|LOCUS_40990 16748 16560 gene locus_tag LOCUS_41000 16748 16560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976146.1 protein_id gnl|my_center|LOCUS_41000 17698 16766 gene locus_tag LOCUS_41010 gene hflC 17698 16766 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIC9 protein_id gnl|my_center|LOCUS_41010 18810 17698 gene locus_tag LOCUS_41020 gene hflK 18810 17698 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534926.1 protein_id gnl|my_center|LOCUS_41020 19497 18958 gene locus_tag LOCUS_41030 gene folA 19497 18958 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ7 protein_id gnl|my_center|LOCUS_41030 19673 19494 gene locus_tag LOCUS_41040 19673 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 20673 21053 gene locus_tag LOCUS_41050 20673 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 21278 22273 gene locus_tag LOCUS_41060 21278 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 22292 22723 gene locus_tag LOCUS_41070 22292 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 23733 22984 gene locus_tag LOCUS_41080 23733 22984 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 protein_id gnl|my_center|LOCUS_41080 24221 23745 gene locus_tag LOCUS_41090 24221 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_41090 24449 24817 gene locus_tag LOCUS_41100 24449 24817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 24918 26324 gene locus_tag LOCUS_41110 gene ftsP 24918 26324 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XU22 protein_id gnl|my_center|LOCUS_41110 27547 26627 gene locus_tag LOCUS_41120 gene thyA 27547 26627 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEE8 protein_id gnl|my_center|LOCUS_41120 27503 27733 gene locus_tag LOCUS_41130 27503 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 28292 27984 gene locus_tag LOCUS_41140 28292 27984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311776.1 protein_id gnl|my_center|LOCUS_41140 29059 29622 gene locus_tag LOCUS_41150 29059 29622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969716.1 protein_id gnl|my_center|LOCUS_41150 29635 29829 gene locus_tag LOCUS_41160 29635 29829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708586.1 protein_id gnl|my_center|LOCUS_41160 29833 30084 gene locus_tag LOCUS_41170 29833 30084 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311773.1 protein_id gnl|my_center|LOCUS_41170 34167 30145 gene locus_tag LOCUS_41180 34167 30145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708588.1 protein_id gnl|my_center|LOCUS_41180 35656 34241 gene locus_tag LOCUS_41190 gene dld 35656 34241 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969720.1 protein_id gnl|my_center|LOCUS_41190 >Feature sequence29 1355 366 gene locus_tag LOCUS_41200 1355 366 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974905.1 protein_id gnl|my_center|LOCUS_41200 1925 1362 gene locus_tag LOCUS_41210 1925 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532678.1 protein_id gnl|my_center|LOCUS_41210 2545 1931 gene locus_tag LOCUS_41220 2545 1931 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532680.1 protein_id gnl|my_center|LOCUS_41220 3415 2549 gene locus_tag LOCUS_41230 3415 2549 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532568.1 protein_id gnl|my_center|LOCUS_41230 4254 3499 gene locus_tag LOCUS_41240 4254 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974909.1 protein_id gnl|my_center|LOCUS_41240 4544 4275 gene locus_tag LOCUS_41250 4544 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969047.1 protein_id gnl|my_center|LOCUS_41250 5066 4638 gene locus_tag LOCUS_41260 5066 4638 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707435.1 protein_id gnl|my_center|LOCUS_41260 6147 5122 gene locus_tag LOCUS_41270 6147 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 6688 6230 gene locus_tag LOCUS_41280 6688 6230 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974911.1 protein_id gnl|my_center|LOCUS_41280 6766 7512 gene locus_tag LOCUS_41290 6766 7512 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707437.1 protein_id gnl|my_center|LOCUS_41290 7517 8140 gene locus_tag LOCUS_41300 7517 8140 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_41300 8312 9871 gene locus_tag LOCUS_41310 gene cysS 8312 9871 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7D9 protein_id gnl|my_center|LOCUS_41310 10509 10925 gene locus_tag LOCUS_41320 10509 10925 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_41320 10922 11410 gene locus_tag LOCUS_41330 10922 11410 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707441.1 protein_id gnl|my_center|LOCUS_41330 11407 11904 gene locus_tag LOCUS_41340 11407 11904 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707441.1 protein_id gnl|my_center|LOCUS_41340 11901 12383 gene locus_tag LOCUS_41350 11901 12383 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969049.1 protein_id gnl|my_center|LOCUS_41350 12504 13466 gene locus_tag LOCUS_41360 12504 13466 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLM6 protein_id gnl|my_center|LOCUS_41360 13463 15082 gene locus_tag LOCUS_41370 gene leuA2 13463 15082 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969053.1 protein_id gnl|my_center|LOCUS_41370 15227 16165 gene locus_tag LOCUS_41380 15227 16165 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707444.1 protein_id gnl|my_center|LOCUS_41380 16781 16152 gene locus_tag LOCUS_41390 16781 16152 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D018 protein_id gnl|my_center|LOCUS_41390 16905 18947 gene locus_tag LOCUS_41400 16905 18947 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707446.1 protein_id gnl|my_center|LOCUS_41400 19005 19406 gene locus_tag LOCUS_41410 19005 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 19403 21301 gene locus_tag LOCUS_41420 19403 21301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707447.1 protein_id gnl|my_center|LOCUS_41420 21470 22168 gene locus_tag LOCUS_41430 gene psd 21470 22168 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FDI9 protein_id gnl|my_center|LOCUS_41430 22200 23087 gene locus_tag LOCUS_41440 gene pssA 22200 23087 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971369.1 protein_id gnl|my_center|LOCUS_41440 25393 23135 gene locus_tag LOCUS_41450 25393 23135 CDS product 2-acyl-glycerophospho-ethanolamine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532541.1 protein_id gnl|my_center|LOCUS_41450 26260 25523 gene locus_tag LOCUS_41460 26260 25523 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_41460 27736 26270 gene locus_tag LOCUS_41470 gene purF 27736 26270 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ7 protein_id gnl|my_center|LOCUS_41470 28348 27788 gene locus_tag LOCUS_41480 28348 27788 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707452.1 protein_id gnl|my_center|LOCUS_41480 29821 28412 gene locus_tag LOCUS_41490 gene radA 29821 28412 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R08 protein_id gnl|my_center|LOCUS_41490 31025 29991 gene locus_tag LOCUS_41500 31025 29991 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9A3 protein_id gnl|my_center|LOCUS_41500 32666 31134 gene locus_tag LOCUS_41510 gene dnaC 32666 31134 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJI0 protein_id gnl|my_center|LOCUS_41510 33481 33056 gene locus_tag LOCUS_41520 33481 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 33791 35410 gene locus_tag LOCUS_41530 gene fixN 33791 35410 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316285.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence30 3168 199 gene locus_tag LOCUS_41540 gene rne 3168 199 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U830 protein_id gnl|my_center|LOCUS_41540 4103 5239 gene locus_tag LOCUS_41550 gene amiC 4103 5239 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969181.1 protein_id gnl|my_center|LOCUS_41550 5450 7900 gene locus_tag LOCUS_41560 5450 7900 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975149.1 protein_id gnl|my_center|LOCUS_41560 8183 9148 gene locus_tag LOCUS_41570 gene prfB 8183 9148 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAC3 protein_id gnl|my_center|LOCUS_41570 9819 9199 gene locus_tag LOCUS_41580 9819 9199 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973697.1 protein_id gnl|my_center|LOCUS_41580 10478 9909 gene locus_tag LOCUS_41590 10478 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969184.1 protein_id gnl|my_center|LOCUS_41590 11268 10504 gene locus_tag LOCUS_41600 gene nadK 11268 10504 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAC5 protein_id gnl|my_center|LOCUS_41600 13327 11486 gene locus_tag LOCUS_41610 13327 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 14160 16034 gene locus_tag LOCUS_41620 14160 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 16666 16424 gene locus_tag LOCUS_41630 16666 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 18125 16881 gene locus_tag LOCUS_41640 18125 16881 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_41640 18593 18129 gene locus_tag LOCUS_41650 18593 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 18699 18887 gene locus_tag LOCUS_41660 18699 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 19238 19426 gene locus_tag LOCUS_41670 19238 19426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 19423 20178 gene locus_tag LOCUS_41680 19423 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 20175 20342 gene locus_tag LOCUS_41690 20175 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 21112 21795 gene locus_tag LOCUS_41700 21112 21795 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819919.1 protein_id gnl|my_center|LOCUS_41700 21861 22883 gene locus_tag LOCUS_41710 21861 22883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_41710 22894 23175 gene locus_tag LOCUS_41720 22894 23175 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_41720 23190 24341 gene locus_tag LOCUS_41730 23190 24341 CDS product carbohydrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_41730 24440 25471 gene locus_tag LOCUS_41740 24440 25471 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_41740 25535 27475 gene locus_tag LOCUS_41750 25535 27475 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869733.1 protein_id gnl|my_center|LOCUS_41750 27734 27492 gene locus_tag LOCUS_41760 27734 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 27905 28132 gene locus_tag LOCUS_41770 27905 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 28644 28129 gene locus_tag LOCUS_41780 28644 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 29788 30108 gene locus_tag LOCUS_41790 29788 30108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 30203 30502 gene locus_tag LOCUS_41800 30203 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 31078 30872 gene locus_tag LOCUS_41810 31078 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 31879 31211 gene locus_tag LOCUS_41820 31879 31211 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391060.1 protein_id gnl|my_center|LOCUS_41820 >Feature sequence31 353 865 gene locus_tag LOCUS_41830 353 865 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339039.1 protein_id gnl|my_center|LOCUS_41830 1350 835 gene locus_tag LOCUS_41840 1350 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004192.1 protein_id gnl|my_center|LOCUS_41840 1237 2034 gene locus_tag LOCUS_41850 gene qoxB 1237 2034 CDS product QoxB, Quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004190.1 protein_id gnl|my_center|LOCUS_41850 2031 4514 gene locus_tag LOCUS_41860 gene qoxA 2031 4514 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 protein_id gnl|my_center|LOCUS_41860 4532 4834 gene locus_tag LOCUS_41870 4532 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339036.1 protein_id gnl|my_center|LOCUS_41870 4831 5439 gene locus_tag LOCUS_41880 4831 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338544.1 protein_id gnl|my_center|LOCUS_41880 5581 7821 gene locus_tag LOCUS_41890 5581 7821 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064977.1 protein_id gnl|my_center|LOCUS_41890 7818 9107 gene locus_tag LOCUS_41900 7818 9107 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085214.1 protein_id gnl|my_center|LOCUS_41900 9107 11194 gene locus_tag LOCUS_41910 9107 11194 CDS product fatty-acid oxidation protein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085215.1 protein_id gnl|my_center|LOCUS_41910 11187 13049 gene locus_tag LOCUS_41920 11187 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_41920 13532 13179 gene locus_tag LOCUS_41930 13532 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 14489 13824 gene locus_tag LOCUS_41940 14489 13824 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_41940 15477 14524 gene locus_tag LOCUS_41950 15477 14524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530476.1 protein_id gnl|my_center|LOCUS_41950 16435 15479 gene locus_tag LOCUS_41960 16435 15479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530475.1 protein_id gnl|my_center|LOCUS_41960 17953 16478 gene locus_tag LOCUS_41970 17953 16478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530474.1 protein_id gnl|my_center|LOCUS_41970 19151 18075 gene locus_tag LOCUS_41980 19151 18075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968050.1 protein_id gnl|my_center|LOCUS_41980 19678 20229 gene locus_tag LOCUS_41990 19678 20229 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 protein_id gnl|my_center|LOCUS_41990 20274 21398 gene locus_tag LOCUS_42000 20274 21398 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530471.1 protein_id gnl|my_center|LOCUS_42000 21420 21911 gene locus_tag LOCUS_42010 21420 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 22062 22373 gene locus_tag LOCUS_42020 22062 22373 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974686.1 protein_id gnl|my_center|LOCUS_42020 22945 24093 gene locus_tag LOCUS_42030 22945 24093 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970059.1 protein_id gnl|my_center|LOCUS_42030 24090 25145 gene locus_tag LOCUS_42040 gene repB2 24090 25145 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968236.1 protein_id gnl|my_center|LOCUS_42040 25302 26612 gene locus_tag LOCUS_42050 25302 26612 CDS product putative replication protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55391 protein_id gnl|my_center|LOCUS_42050 26677 26931 gene locus_tag LOCUS_42060 26677 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 26919 27209 gene locus_tag LOCUS_42070 26919 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 28413 27244 gene locus_tag LOCUS_42080 28413 27244 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 protein_id gnl|my_center|LOCUS_42080 28539 29495 gene locus_tag LOCUS_42090 28539 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525334.1 protein_id gnl|my_center|LOCUS_42090 29498 30181 gene locus_tag LOCUS_42100 29498 30181 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525335.1 protein_id gnl|my_center|LOCUS_42100 30594 30343 gene locus_tag LOCUS_42110 30594 30343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 >Feature sequence32 725 2698 gene locus_tag LOCUS_42120 725 2698 CDS product serralysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970172.1 protein_id gnl|my_center|LOCUS_42120 3713 3144 gene locus_tag LOCUS_42130 3713 3144 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWR1 protein_id gnl|my_center|LOCUS_42130 6040 3719 gene locus_tag LOCUS_42140 gene bisC 6040 3719 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209844.1 protein_id gnl|my_center|LOCUS_42140 7607 6060 gene locus_tag LOCUS_42150 7607 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809544.1 protein_id gnl|my_center|LOCUS_42150 9121 7604 gene locus_tag LOCUS_42160 9121 7604 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533071.1 protein_id gnl|my_center|LOCUS_42160 9798 9124 gene locus_tag LOCUS_42170 gene fucA 9798 9124 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337432.1 protein_id gnl|my_center|LOCUS_42170 10853 9807 gene locus_tag LOCUS_42180 10853 9807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887821.1 protein_id gnl|my_center|LOCUS_42180 12071 10866 gene locus_tag LOCUS_42190 12071 10866 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113883.1 protein_id gnl|my_center|LOCUS_42190 12851 12084 gene locus_tag LOCUS_42200 12851 12084 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_42200 13657 12848 gene locus_tag LOCUS_42210 gene gctA 13657 12848 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_42210 13938 15086 gene locus_tag LOCUS_42220 13938 15086 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92YB6 protein_id gnl|my_center|LOCUS_42220 15083 16882 gene locus_tag LOCUS_42230 15083 16882 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970339.1 protein_id gnl|my_center|LOCUS_42230 16935 18011 gene locus_tag LOCUS_42240 16935 18011 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 protein_id gnl|my_center|LOCUS_42240 18161 18886 gene locus_tag LOCUS_42250 18161 18886 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064562.1 protein_id gnl|my_center|LOCUS_42250 18960 20396 gene locus_tag LOCUS_42260 18960 20396 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_42260 20405 21805 gene locus_tag LOCUS_42270 20405 21805 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_42270 22510 21881 gene locus_tag LOCUS_42280 22510 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 24181 22556 gene locus_tag LOCUS_42290 24181 22556 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T815 protein_id gnl|my_center|LOCUS_42290 24323 25201 gene locus_tag LOCUS_42300 24323 25201 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970252.1 protein_id gnl|my_center|LOCUS_42300 25427 25221 gene locus_tag LOCUS_42310 25427 25221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence33 45 1574 gene locus_tag LOCUS_42320 gene atpA 45 1574 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM3 protein_id gnl|my_center|LOCUS_42320 1602 2480 gene locus_tag LOCUS_42330 gene atpG 1602 2480 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK7 protein_id gnl|my_center|LOCUS_42330 2728 2477 gene locus_tag LOCUS_42340 2728 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 2631 4043 gene locus_tag LOCUS_42350 gene atpD 2631 4043 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S1 protein_id gnl|my_center|LOCUS_42350 4122 4520 gene locus_tag LOCUS_42360 gene atpC 4122 4520 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL34 protein_id gnl|my_center|LOCUS_42360 5215 4685 gene locus_tag LOCUS_42370 5215 4685 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141970.1 protein_id gnl|my_center|LOCUS_42370 5923 5387 gene locus_tag LOCUS_42380 gene rppH 5923 5387 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDW5 protein_id gnl|my_center|LOCUS_42380 7182 5935 gene locus_tag LOCUS_42390 7182 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709663.1 protein_id gnl|my_center|LOCUS_42390 8605 7283 gene locus_tag LOCUS_42400 gene ctpA 8605 7283 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531244.1 protein_id gnl|my_center|LOCUS_42400 10025 8595 gene locus_tag LOCUS_42410 10025 8595 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709661.1 protein_id gnl|my_center|LOCUS_42410 10697 10116 gene locus_tag LOCUS_42420 gene rlmH 10697 10116 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB0 protein_id gnl|my_center|LOCUS_42420 11416 10952 gene locus_tag LOCUS_42430 gene rsfS 11416 10952 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Y3 protein_id gnl|my_center|LOCUS_42430 12104 11463 gene locus_tag LOCUS_42440 gene nadD 12104 11463 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Y2 protein_id gnl|my_center|LOCUS_42440 13387 12104 gene locus_tag LOCUS_42450 gene proA 13387 12104 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS1 protein_id gnl|my_center|LOCUS_42450 14640 13498 gene locus_tag LOCUS_42460 gene proB1 14640 13498 CDS product glutamate 5-kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB3 protein_id gnl|my_center|LOCUS_42460 15692 14643 gene locus_tag LOCUS_42470 gene obg 15692 14643 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB4 protein_id gnl|my_center|LOCUS_42470 16578 15937 gene locus_tag LOCUS_42480 16578 15937 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709653.1 protein_id gnl|my_center|LOCUS_42480 16980 16711 gene locus_tag LOCUS_42490 gene rpmA 16980 16711 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_42490 17673 17059 gene locus_tag LOCUS_42500 gene rplU 17673 17059 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLY2 protein_id gnl|my_center|LOCUS_42500 18001 18090 gene locus_tag LOCUS_t00360 18001 18090 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19021 18371 gene locus_tag LOCUS_42510 19021 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 18993 21287 gene locus_tag LOCUS_42520 18993 21287 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_42520 21310 22086 gene locus_tag LOCUS_42530 21310 22086 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TW8 protein_id gnl|my_center|LOCUS_42530 23394 22180 gene locus_tag LOCUS_42540 23394 22180 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310902.1 protein_id gnl|my_center|LOCUS_42540 23659 24645 gene locus_tag LOCUS_42550 23659 24645 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970046.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence34 1539 133 gene locus_tag LOCUS_42560 1539 133 CDS product Tat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 protein_id gnl|my_center|LOCUS_42560 1729 1923 gene locus_tag LOCUS_42570 1729 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 3379 2030 gene locus_tag LOCUS_42580 3379 2030 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258112.1 protein_id gnl|my_center|LOCUS_42580 3664 5103 gene locus_tag LOCUS_42590 3664 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 5649 5293 gene locus_tag LOCUS_42600 5649 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974781.1 protein_id gnl|my_center|LOCUS_42600 6700 5810 gene locus_tag LOCUS_42610 6700 5810 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706961.1 protein_id gnl|my_center|LOCUS_42610 6911 7324 gene locus_tag LOCUS_42620 6911 7324 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92K42 protein_id gnl|my_center|LOCUS_42620 7330 8304 gene locus_tag LOCUS_42630 7330 8304 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974647.1 protein_id gnl|my_center|LOCUS_42630 8597 9793 gene locus_tag LOCUS_42640 8597 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 10193 11080 gene locus_tag LOCUS_42650 10193 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 11511 10987 gene locus_tag LOCUS_42660 11511 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 13150 12569 gene locus_tag LOCUS_42670 13150 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 13801 13199 gene locus_tag LOCUS_42680 13801 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 14922 13996 gene locus_tag LOCUS_42690 14922 13996 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_42690 15078 17582 gene locus_tag LOCUS_42700 gene pcrA 15078 17582 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXZ3 protein_id gnl|my_center|LOCUS_42700 17799 18674 gene locus_tag LOCUS_42710 17799 18674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 18879 19604 gene locus_tag LOCUS_42720 18879 19604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 20431 19847 gene locus_tag LOCUS_42730 20431 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 21079 20660 gene locus_tag LOCUS_42740 21079 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 21455 21201 gene locus_tag LOCUS_42750 21455 21201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 21415 21699 gene locus_tag LOCUS_42760 21415 21699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 21806 23620 gene locus_tag LOCUS_42770 21806 23620 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030822.1 protein_id gnl|my_center|LOCUS_42770 24124 23636 gene locus_tag LOCUS_42780 24124 23636 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence35 536 303 gene locus_tag LOCUS_42790 536 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42790 1220 627 gene locus_tag LOCUS_42800 1220 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 1874 1266 gene locus_tag LOCUS_42810 1874 1266 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKY7 protein_id gnl|my_center|LOCUS_42810 2722 1928 gene locus_tag LOCUS_42820 2722 1928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810326.1 protein_id gnl|my_center|LOCUS_42820 3620 2715 gene locus_tag LOCUS_42830 3620 2715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389858.1 protein_id gnl|my_center|LOCUS_42830 4671 3691 gene locus_tag LOCUS_42840 4671 3691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067274.1 protein_id gnl|my_center|LOCUS_42840 4887 5342 gene locus_tag LOCUS_42850 4887 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 6126 7175 gene locus_tag LOCUS_42860 gene amiC 6126 7175 CDS product negative amidase regulator, AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339160.1 protein_id gnl|my_center|LOCUS_42860 7172 7783 gene locus_tag LOCUS_42870 7172 7783 CDS product transcriptional antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723885.1 protein_id gnl|my_center|LOCUS_42870 7755 8651 gene locus_tag LOCUS_42880 7755 8651 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528535.1 protein_id gnl|my_center|LOCUS_42880 8651 9571 gene locus_tag LOCUS_42890 8651 9571 CDS product glutathione ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723881.1 protein_id gnl|my_center|LOCUS_42890 9600 11210 gene locus_tag LOCUS_42900 9600 11210 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339159.1 protein_id gnl|my_center|LOCUS_42900 11219 12178 gene locus_tag LOCUS_42910 11219 12178 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339158.1 protein_id gnl|my_center|LOCUS_42910 12175 13953 gene locus_tag LOCUS_42920 12175 13953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339157.1 protein_id gnl|my_center|LOCUS_42920 14073 13852 gene locus_tag LOCUS_42930 14073 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 14945 14238 gene locus_tag LOCUS_42940 14945 14238 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_42940 15223 14987 gene locus_tag LOCUS_42950 15223 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 16268 15309 gene locus_tag LOCUS_42960 16268 15309 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064258.1 protein_id gnl|my_center|LOCUS_42960 17023 16280 gene locus_tag LOCUS_42970 17023 16280 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF82 protein_id gnl|my_center|LOCUS_42970 17751 17020 gene locus_tag LOCUS_42980 17751 17020 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 protein_id gnl|my_center|LOCUS_42980 17846 18724 gene locus_tag LOCUS_42990 17846 18724 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811576.1 protein_id gnl|my_center|LOCUS_42990 18776 19855 gene locus_tag LOCUS_43000 18776 19855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088045.1 protein_id gnl|my_center|LOCUS_43000 19955 21892 gene locus_tag LOCUS_43010 19955 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 21905 22423 gene locus_tag LOCUS_43020 21905 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 >Feature sequence36 1020 262 gene locus_tag LOCUS_43030 1020 262 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339634.1 protein_id gnl|my_center|LOCUS_43030 2213 1017 gene locus_tag LOCUS_43040 2213 1017 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_43040 2501 3238 gene locus_tag LOCUS_43050 gene glnH 2501 3238 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388693.1 protein_id gnl|my_center|LOCUS_43050 3295 3951 gene locus_tag LOCUS_43060 gene glnP 3295 3951 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202330.1 protein_id gnl|my_center|LOCUS_43060 3948 4676 gene locus_tag LOCUS_43070 gene glnQ 3948 4676 CDS product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523231.1 protein_id gnl|my_center|LOCUS_43070 5681 6580 gene locus_tag LOCUS_43080 5681 6580 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723319.1 protein_id gnl|my_center|LOCUS_43080 6659 7102 gene locus_tag LOCUS_43090 6659 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 7428 7276 gene locus_tag LOCUS_43100 7428 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43100 7705 7445 gene locus_tag LOCUS_43110 7705 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 7864 8238 gene locus_tag LOCUS_43120 7864 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 8676 8960 gene locus_tag LOCUS_43130 8676 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 9700 9302 gene locus_tag LOCUS_43140 9700 9302 CDS product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 protein_id gnl|my_center|LOCUS_43140 11154 9697 gene locus_tag LOCUS_43150 11154 9697 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_43150 12247 11147 gene locus_tag LOCUS_43160 12247 11147 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_43160 13079 12249 gene locus_tag LOCUS_43170 13079 12249 CDS product silent information regulator protein Sir2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533453.1 protein_id gnl|my_center|LOCUS_43170 13222 15687 gene locus_tag LOCUS_43180 13222 15687 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_43180 15684 16790 gene locus_tag LOCUS_43190 15684 16790 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 protein_id gnl|my_center|LOCUS_43190 16787 17902 gene locus_tag LOCUS_43200 16787 17902 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_43200 17899 19002 gene locus_tag LOCUS_43210 17899 19002 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_43210 19013 20299 gene locus_tag LOCUS_43220 19013 20299 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_43220 >Feature sequence37 273 127 gene locus_tag LOCUS_43230 273 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 384 920 gene locus_tag LOCUS_43240 384 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43240 1799 912 gene locus_tag LOCUS_43250 1799 912 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531634.1 protein_id gnl|my_center|LOCUS_43250 3234 2176 gene locus_tag LOCUS_43260 3234 2176 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 protein_id gnl|my_center|LOCUS_43260 5154 3238 gene locus_tag LOCUS_43270 5154 3238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_43270 6412 5330 gene locus_tag LOCUS_43280 6412 5330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_43280 7412 6474 gene locus_tag LOCUS_43290 7412 6474 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_43290 9187 7409 gene locus_tag LOCUS_43300 gene betA 9187 7409 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN3 protein_id gnl|my_center|LOCUS_43300 9500 9207 gene locus_tag LOCUS_43310 9500 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 9723 10655 gene locus_tag LOCUS_43320 9723 10655 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532854.1 protein_id gnl|my_center|LOCUS_43320 11080 11005 gene locus_tag LOCUS_t00370 11080 11005 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12111 11191 gene locus_tag LOCUS_43330 12111 11191 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976065.1 protein_id gnl|my_center|LOCUS_43330 12906 12160 gene locus_tag LOCUS_43340 12906 12160 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708454.1 protein_id gnl|my_center|LOCUS_43340 14019 12913 gene locus_tag LOCUS_43350 14019 12913 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708455.1 protein_id gnl|my_center|LOCUS_43350 14714 14088 gene locus_tag LOCUS_43360 14714 14088 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976140.1 protein_id gnl|my_center|LOCUS_43360 14965 15237 gene locus_tag LOCUS_43370 14965 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 15747 15986 gene locus_tag LOCUS_43380 15747 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 16346 16020 gene locus_tag LOCUS_43390 16346 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 16625 17485 gene locus_tag LOCUS_43400 16625 17485 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SH9 protein_id gnl|my_center|LOCUS_43400 >Feature sequence38 145 852 gene locus_tag LOCUS_43410 145 852 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407276.1 protein_id gnl|my_center|LOCUS_43410 849 1526 gene locus_tag LOCUS_43420 849 1526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105543.1 protein_id gnl|my_center|LOCUS_43420 1537 2310 gene locus_tag LOCUS_43430 1537 2310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 protein_id gnl|my_center|LOCUS_43430 2307 3464 gene locus_tag LOCUS_43440 2307 3464 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGJ4 protein_id gnl|my_center|LOCUS_43440 3492 4331 gene locus_tag LOCUS_43450 gene nocT 3492 4331 CDS product nopaline-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35120 protein_id gnl|my_center|LOCUS_43450 5088 7706 gene locus_tag LOCUS_43460 5088 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038875.1 protein_id gnl|my_center|LOCUS_43460 8392 7910 gene locus_tag LOCUS_43470 8392 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 9013 9270 gene locus_tag LOCUS_43480 9013 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 9267 10160 gene locus_tag LOCUS_43490 9267 10160 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975760.1 protein_id gnl|my_center|LOCUS_43490 10738 11499 gene locus_tag LOCUS_43500 gene phnC 10738 11499 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB5 protein_id gnl|my_center|LOCUS_43500 11535 12410 gene locus_tag LOCUS_43510 11535 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 12413 13216 gene locus_tag LOCUS_43520 12413 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 13219 14241 gene locus_tag LOCUS_43530 13219 14241 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_43530 14235 15134 gene locus_tag LOCUS_43540 14235 15134 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_43540 15831 15514 gene locus_tag LOCUS_43550 15831 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970276.1 protein_id gnl|my_center|LOCUS_43550 16601 16467 gene locus_tag LOCUS_43560 16601 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 >Feature sequence39 1702 416 gene locus_tag LOCUS_43570 1702 416 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 protein_id gnl|my_center|LOCUS_43570 2186 1704 gene locus_tag LOCUS_43580 2186 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 3291 2269 gene locus_tag LOCUS_43590 3291 2269 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970533.1 protein_id gnl|my_center|LOCUS_43590 4014 3313 gene locus_tag LOCUS_43600 4014 3313 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862000.1 protein_id gnl|my_center|LOCUS_43600 4339 6435 gene locus_tag LOCUS_43610 4339 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870478.1 protein_id gnl|my_center|LOCUS_43610 6432 8216 gene locus_tag LOCUS_43620 6432 8216 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_43620 8213 8998 gene locus_tag LOCUS_43630 8213 8998 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530406.1 protein_id gnl|my_center|LOCUS_43630 10756 9206 gene locus_tag LOCUS_43640 10756 9206 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 protein_id gnl|my_center|LOCUS_43640 10934 11908 gene locus_tag LOCUS_43650 10934 11908 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090692.1 protein_id gnl|my_center|LOCUS_43650 11948 12709 gene locus_tag LOCUS_43660 11948 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087151.1 protein_id gnl|my_center|LOCUS_43660 12706 13656 gene locus_tag LOCUS_43670 12706 13656 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970419.1 protein_id gnl|my_center|LOCUS_43670 13915 13736 gene locus_tag LOCUS_43680 13915 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 15584 14082 gene locus_tag LOCUS_43690 15584 14082 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 protein_id gnl|my_center|LOCUS_43690 15976 16626 gene locus_tag LOCUS_43700 15976 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence40 2966 114 gene locus_tag LOCUS_43710 2966 114 CDS product superfamily II DNA/RNA helicase and SNF2 family-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707160.1 protein_id gnl|my_center|LOCUS_43710 4384 2963 gene locus_tag LOCUS_43720 4384 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 5289 4381 gene locus_tag LOCUS_43730 5289 4381 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707158.1 protein_id gnl|my_center|LOCUS_43730 7483 5297 gene locus_tag LOCUS_43740 7483 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_43740 7729 9297 gene locus_tag LOCUS_43750 7729 9297 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123361.1 protein_id gnl|my_center|LOCUS_43750 9294 10487 gene locus_tag LOCUS_43760 gene hsdS 9294 10487 CDS product restriction modification system S chain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123362.1 protein_id gnl|my_center|LOCUS_43760 10494 13913 gene locus_tag LOCUS_43770 10494 13913 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_43770 14541 14466 gene locus_tag LOCUS_t00380 14541 14466 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15544 14651 gene locus_tag LOCUS_43780 15544 14651 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975157.1 protein_id gnl|my_center|LOCUS_43780 15828 15912 gene locus_tag LOCUS_t00390 15828 15912 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 15932 16005 gene locus_tag LOCUS_t00400 15932 16005 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence41 805 119 gene locus_tag LOCUS_43790 805 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 protein_id gnl|my_center|LOCUS_43790 958 1452 gene locus_tag LOCUS_43800 958 1452 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 protein_id gnl|my_center|LOCUS_43800 2359 1508 gene locus_tag LOCUS_43810 2359 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 3965 2553 gene locus_tag LOCUS_43820 3965 2553 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDN4 protein_id gnl|my_center|LOCUS_43820 4331 4173 gene locus_tag LOCUS_43830 4331 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 6664 4328 gene locus_tag LOCUS_43840 gene fixI1 6664 4328 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708322.1 protein_id gnl|my_center|LOCUS_43840 7170 6661 gene locus_tag LOCUS_43850 gene fixH 7170 6661 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971693.1 protein_id gnl|my_center|LOCUS_43850 8753 7170 gene locus_tag LOCUS_43860 gene fixG 8753 7170 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708324.1 protein_id gnl|my_center|LOCUS_43860 9942 8827 gene locus_tag LOCUS_43870 gene gcvT 9942 8827 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBX4 protein_id gnl|my_center|LOCUS_43870 11211 10051 gene locus_tag LOCUS_43880 11211 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 11235 12050 gene locus_tag LOCUS_43890 11235 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141758.1 protein_id gnl|my_center|LOCUS_43890 14386 12209 gene locus_tag LOCUS_43900 14386 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 15654 14791 gene locus_tag LOCUS_43910 gene fixP 15654 14791 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIY8 protein_id gnl|my_center|LOCUS_43910 15810 15658 gene locus_tag LOCUS_43920 gene fixQ1 15810 15658 CDS product FixQ1 nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967642.1 protein_id gnl|my_center|LOCUS_43920 <16344 15823 gene locus_tag LOCUS_43930 <16344 15823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971696.1:cytochrome c oxidase, cbb3-type subunit II >Feature sequence42 1068 3074 gene locus_tag LOCUS_43940 1068 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 4359 3166 gene locus_tag LOCUS_43950 4359 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 4660 4845 gene locus_tag LOCUS_43960 4660 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 5365 5967 gene locus_tag LOCUS_43970 gene sodB 5365 5967 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8H7 protein_id gnl|my_center|LOCUS_43970 6156 6602 gene locus_tag LOCUS_43980 gene cycF 6156 6602 CDS product cytochrome C556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537236.1 protein_id gnl|my_center|LOCUS_43980 6643 7566 gene locus_tag LOCUS_43990 gene cycG 6643 7566 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707312.1 protein_id gnl|my_center|LOCUS_43990 8838 7651 gene locus_tag LOCUS_44000 8838 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709392.1 protein_id gnl|my_center|LOCUS_44000 11141 9048 gene locus_tag LOCUS_44010 11141 9048 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974801.1 protein_id gnl|my_center|LOCUS_44010 12297 11293 gene locus_tag LOCUS_44020 12297 11293 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968948.1 protein_id gnl|my_center|LOCUS_44020 12672 13322 gene locus_tag LOCUS_44030 12672 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 13654 14727 gene locus_tag LOCUS_44040 13654 14727 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FW8 protein_id gnl|my_center|LOCUS_44040 14960 15802 gene locus_tag LOCUS_44050 14960 15802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_44050 >Feature sequence43 1125 274 gene locus_tag LOCUS_44060 1125 274 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZSZ7 protein_id gnl|my_center|LOCUS_44060 2129 1128 gene locus_tag LOCUS_44070 gene arcB 2129 1128 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CED3 protein_id gnl|my_center|LOCUS_44070 2293 2616 gene locus_tag LOCUS_44080 2293 2616 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_44080 2724 3044 gene locus_tag LOCUS_44090 2724 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391157.1 protein_id gnl|my_center|LOCUS_44090 3041 3328 gene locus_tag LOCUS_44100 3041 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 3325 4083 gene locus_tag LOCUS_44110 3325 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390638.1 protein_id gnl|my_center|LOCUS_44110 4083 4613 gene locus_tag LOCUS_44120 4083 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390639.1 protein_id gnl|my_center|LOCUS_44120 4715 5011 gene locus_tag LOCUS_44130 4715 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 5136 5795 gene locus_tag LOCUS_44140 5136 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 5796 6173 gene locus_tag LOCUS_44150 5796 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 6359 6658 gene locus_tag LOCUS_44160 6359 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 7858 8832 gene locus_tag LOCUS_44170 7858 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974798.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44170 8960 9562 gene locus_tag LOCUS_44180 8960 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974880.1 protein_id gnl|my_center|LOCUS_44180 9571 9969 gene locus_tag LOCUS_44190 9571 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974881.1 protein_id gnl|my_center|LOCUS_44190 >Feature sequence44 786 1187 gene locus_tag LOCUS_44200 786 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313063.1 protein_id gnl|my_center|LOCUS_44200 3059 1242 gene locus_tag LOCUS_44210 gene edd 3059 1242 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S0 protein_id gnl|my_center|LOCUS_44210 3872 3150 gene locus_tag LOCUS_44220 3872 3150 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974508.1 protein_id gnl|my_center|LOCUS_44220 5334 3859 gene locus_tag LOCUS_44230 gene zwf 5334 3859 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U679 protein_id gnl|my_center|LOCUS_44230 5902 6429 gene locus_tag LOCUS_44240 5902 6429 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931012.1 protein_id gnl|my_center|LOCUS_44240 7802 6516 gene locus_tag LOCUS_44250 7802 6516 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974510.1 protein_id gnl|my_center|LOCUS_44250 9251 7815 gene locus_tag LOCUS_44260 9251 7815 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974511.1 protein_id gnl|my_center|LOCUS_44260 9538 12069 gene locus_tag LOCUS_44270 9538 12069 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706906.1 protein_id gnl|my_center|LOCUS_44270 >Feature sequence45 789 211 gene locus_tag LOCUS_44280 789 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 1525 1097 gene locus_tag LOCUS_44290 gene rplQ 1525 1097 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U884 protein_id gnl|my_center|LOCUS_44290 2581 1571 gene locus_tag LOCUS_44300 gene rpoA 2581 1571 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q925Z2 protein_id gnl|my_center|LOCUS_44300 3078 2686 gene locus_tag LOCUS_44310 gene rpsK 3078 2686 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB02 protein_id gnl|my_center|LOCUS_44310 3587 3219 gene locus_tag LOCUS_44320 gene rpsM 3587 3219 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U881 protein_id gnl|my_center|LOCUS_44320 4513 3929 gene locus_tag LOCUS_44330 gene adk 4513 3929 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME5 protein_id gnl|my_center|LOCUS_44330 5871 4510 gene locus_tag LOCUS_44340 gene secY 5871 4510 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF0 protein_id gnl|my_center|LOCUS_44340 6538 6050 gene locus_tag LOCUS_44350 gene rplO 6538 6050 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U878 protein_id gnl|my_center|LOCUS_44350 6755 6555 gene locus_tag LOCUS_44360 gene rpmD 6755 6555 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68995 protein_id gnl|my_center|LOCUS_44360 7354 6794 gene locus_tag LOCUS_44370 gene rpsE 7354 6794 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U876 protein_id gnl|my_center|LOCUS_44370 7762 7400 gene locus_tag LOCUS_44380 gene rplR 7762 7400 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF4 protein_id gnl|my_center|LOCUS_44380 8308 7775 gene locus_tag LOCUS_44390 gene rplF 8308 7775 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF5 protein_id gnl|my_center|LOCUS_44390 >Feature sequence46 3 125 gene locus_tag LOCUS_44400 3 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 389 568 gene locus_tag LOCUS_44410 389 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 1023 754 gene locus_tag LOCUS_44420 1023 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 2256 1036 gene locus_tag LOCUS_44430 2256 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 2343 3341 gene locus_tag LOCUS_44440 2343 3341 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085570.1 protein_id gnl|my_center|LOCUS_44440 3338 3532 gene locus_tag LOCUS_44450 3338 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 4146 3589 gene locus_tag LOCUS_44460 4146 3589 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707548.1 protein_id gnl|my_center|LOCUS_44460 4736 4407 gene locus_tag LOCUS_44470 gene ihfA 4736 4407 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7Q6 protein_id gnl|my_center|LOCUS_44470 5878 4907 gene locus_tag LOCUS_44480 gene fabH 5878 4907 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7Q5 protein_id gnl|my_center|LOCUS_44480 6946 5888 gene locus_tag LOCUS_44490 gene plsX 6946 5888 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QT5 protein_id gnl|my_center|LOCUS_44490 7606 7043 gene locus_tag LOCUS_44500 7606 7043 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975023.1 protein_id gnl|my_center|LOCUS_44500 8156 7617 gene locus_tag LOCUS_44510 8156 7617 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312818.1 protein_id gnl|my_center|LOCUS_44510 >Feature sequence47 807 535 gene locus_tag LOCUS_44520 807 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 1239 1054 gene locus_tag LOCUS_44530 1239 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 1963 1568 gene locus_tag LOCUS_44540 1963 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 2210 1956 gene locus_tag LOCUS_44550 2210 1956 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KNX6 protein_id gnl|my_center|LOCUS_44550 2464 2649 gene locus_tag LOCUS_44560 2464 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 3964 2915 gene locus_tag LOCUS_44570 3964 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533367.1 protein_id gnl|my_center|LOCUS_44570 4158 5039 gene locus_tag LOCUS_44580 4158 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 5318 6358 gene locus_tag LOCUS_44590 gene ABC-MSP 5318 6358 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083034.1 protein_id gnl|my_center|LOCUS_44590 >Feature sequence48 2897 1566 gene locus_tag LOCUS_44600 2897 1566 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315231.1 protein_id gnl|my_center|LOCUS_44600 4758 2935 gene locus_tag LOCUS_44610 4758 2935 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529876.1 protein_id gnl|my_center|LOCUS_44610 >Feature sequence49 733 269 gene locus_tag LOCUS_44620 733 269 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384122.1 protein_id gnl|my_center|LOCUS_44620 1338 865 gene locus_tag LOCUS_44630 1338 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384123.1 protein_id gnl|my_center|LOCUS_44630 1937 1344 gene locus_tag LOCUS_44640 1937 1344 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_44640 3353 2028 gene locus_tag LOCUS_44650 gene mntH 3353 2028 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEM1 protein_id gnl|my_center|LOCUS_44650 <4208 3553 gene locus_tag LOCUS_44660 <4208 3553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887528.1:metal transporter >Feature sequence50 >Feature sequence51 >Feature sequence52 506 204 gene locus_tag LOCUS_44670 506 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 898 599 gene locus_tag LOCUS_44680 898 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 1390 1106 gene locus_tag LOCUS_44690 1390 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886942.1 protein_id gnl|my_center|LOCUS_44690 1921 1442 gene locus_tag LOCUS_44700 1921 1442 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886835.1 protein_id gnl|my_center|LOCUS_44700 2434 2195 gene locus_tag LOCUS_44710 2434 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 >Feature sequence53 <1504 657 gene locus_tag LOCUS_44720 <1504 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974367.1:antirestriction protein >Feature sequence54 1045 56 gene locus_tag LOCUS_44730 1045 56 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118645.1 protein_id gnl|my_center|LOCUS_44730