>Feature sequence0001 1266 2129 gene locus_tag LOCUS_00010 1266 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383548.1 protein_id gnl|my_center|LOCUS_00010 2294 2722 gene locus_tag LOCUS_00020 2294 2722 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_00020 2830 3333 gene locus_tag LOCUS_00030 2830 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3925 3311 gene locus_tag LOCUS_00040 3925 3311 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_00040 4394 4044 gene locus_tag LOCUS_00050 4394 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4936 4442 gene locus_tag LOCUS_00060 4936 4442 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382949.1 protein_id gnl|my_center|LOCUS_00060 5177 5686 gene locus_tag LOCUS_00070 gene fabA 5177 5686 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXE1 protein_id gnl|my_center|LOCUS_00070 5731 6960 gene locus_tag LOCUS_00080 gene fabB 5731 6960 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382947.1 protein_id gnl|my_center|LOCUS_00080 7412 7080 gene locus_tag LOCUS_00090 7412 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 protein_id gnl|my_center|LOCUS_00090 7618 8406 gene locus_tag LOCUS_00100 gene fabI 7618 8406 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXE3 protein_id gnl|my_center|LOCUS_00100 8559 10136 gene locus_tag LOCUS_00110 8559 10136 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198976.1 protein_id gnl|my_center|LOCUS_00110 10749 10141 gene locus_tag LOCUS_00120 10749 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_00120 11004 11783 gene locus_tag LOCUS_00130 11004 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11855 12544 gene locus_tag LOCUS_00140 11855 12544 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_00140 12537 13376 gene locus_tag LOCUS_00150 12537 13376 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337350.1 protein_id gnl|my_center|LOCUS_00150 13430 14215 gene locus_tag LOCUS_00160 13430 14215 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337348.1 protein_id gnl|my_center|LOCUS_00160 14208 14969 gene locus_tag LOCUS_00170 14208 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_00170 >Feature sequence0002 343 1170 gene locus_tag LOCUS_00180 343 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 3579 2518 gene locus_tag LOCUS_00190 3579 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 4538 3576 gene locus_tag LOCUS_00200 4538 3576 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_00200 5461 4538 gene locus_tag LOCUS_00210 5461 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 6693 5458 gene locus_tag LOCUS_00220 6693 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 7041 8021 gene locus_tag LOCUS_00230 7041 8021 CDS product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 protein_id gnl|my_center|LOCUS_00230 8248 10227 gene locus_tag LOCUS_00240 8248 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338775.1 protein_id gnl|my_center|LOCUS_00240 10233 10883 gene locus_tag LOCUS_00250 10233 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 11912 10902 gene locus_tag LOCUS_00260 11912 10902 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346805.1 protein_id gnl|my_center|LOCUS_00260 >Feature sequence0003 63 860 gene locus_tag LOCUS_00270 63 860 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268507.1 protein_id gnl|my_center|LOCUS_00270 871 1254 gene locus_tag LOCUS_00280 871 1254 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706955.1 protein_id gnl|my_center|LOCUS_00280 1656 2507 gene locus_tag LOCUS_00290 1656 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 2401 3000 gene locus_tag LOCUS_00300 2401 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 3528 3452 gene locus_tag LOCUS_t00010 3528 3452 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4521 3577 gene locus_tag LOCUS_00310 4521 3577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383444.1 protein_id gnl|my_center|LOCUS_00310 4624 4908 gene locus_tag LOCUS_00320 4624 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 6063 4960 gene locus_tag LOCUS_00330 gene leuB 6063 4960 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ3 protein_id gnl|my_center|LOCUS_00330 7054 6122 gene locus_tag LOCUS_00340 7054 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338548.1 protein_id gnl|my_center|LOCUS_00340 6935 7207 gene locus_tag LOCUS_00350 6935 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 8106 7171 gene locus_tag LOCUS_00360 8106 7171 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338549.1 protein_id gnl|my_center|LOCUS_00360 8373 9026 gene locus_tag LOCUS_00370 8373 9026 CDS product acetyl-CoA--acetoacetyl-CoA transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389137.1 protein_id gnl|my_center|LOCUS_00370 9038 9694 gene locus_tag LOCUS_00380 9038 9694 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389136.1 protein_id gnl|my_center|LOCUS_00380 9987 10226 gene locus_tag LOCUS_00390 9987 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 10785 10267 gene locus_tag LOCUS_00400 10785 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382851.1 protein_id gnl|my_center|LOCUS_00400 11507 10902 gene locus_tag LOCUS_00410 gene leuD 11507 10902 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ0 protein_id gnl|my_center|LOCUS_00410 >Feature sequence0004 <1 832 gene locus_tag LOCUS_00420 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338603.1:peptidase M23 875 2200 gene locus_tag LOCUS_00430 gene ctpA 875 2200 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 protein_id gnl|my_center|LOCUS_00430 2250 2729 gene locus_tag LOCUS_00440 gene ialA 2250 2729 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5P3 protein_id gnl|my_center|LOCUS_00440 3999 2737 gene locus_tag LOCUS_00450 gene MltB 3999 2737 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_00450 6354 4240 gene locus_tag LOCUS_00460 gene rnr 6354 4240 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYS4 protein_id gnl|my_center|LOCUS_00460 6998 6429 gene locus_tag LOCUS_00470 6998 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 protein_id gnl|my_center|LOCUS_00470 7441 7016 gene locus_tag LOCUS_00480 gene ElaA 7441 7016 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 protein_id gnl|my_center|LOCUS_00480 8595 7438 gene locus_tag LOCUS_00490 gene dapE 8595 7438 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYS2 protein_id gnl|my_center|LOCUS_00490 8939 10021 gene locus_tag LOCUS_00500 8939 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 10081 11133 gene locus_tag LOCUS_00510 10081 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence0005 519 13 gene locus_tag LOCUS_00520 519 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 1356 520 gene locus_tag LOCUS_00530 1356 520 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728413.1 protein_id gnl|my_center|LOCUS_00530 1745 1356 gene locus_tag LOCUS_00540 1745 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2890 1757 gene locus_tag LOCUS_00550 2890 1757 CDS product chloromuconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 protein_id gnl|my_center|LOCUS_00550 3887 3018 gene locus_tag LOCUS_00560 3887 3018 CDS product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_00560 4091 4819 gene locus_tag LOCUS_00570 4091 4819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533095.1 protein_id gnl|my_center|LOCUS_00570 4806 5561 gene locus_tag LOCUS_00580 4806 5561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_00580 5561 6427 gene locus_tag LOCUS_00590 5561 6427 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533093.1 protein_id gnl|my_center|LOCUS_00590 6432 7427 gene locus_tag LOCUS_00600 6432 7427 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533092.1 protein_id gnl|my_center|LOCUS_00600 8525 7467 gene locus_tag LOCUS_00610 8525 7467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972096.1 protein_id gnl|my_center|LOCUS_00610 9349 8522 gene locus_tag LOCUS_00620 9349 8522 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388257.1 protein_id gnl|my_center|LOCUS_00620 10272 9346 gene locus_tag LOCUS_00630 10272 9346 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976265.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence0006 <1 801 gene locus_tag LOCUS_00640 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533090.1:6-chlorohydroxyquinol-1,2-dioxygenase 2353 869 gene locus_tag LOCUS_00650 2353 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_00650 2904 2365 gene locus_tag LOCUS_00660 2904 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3930 2995 gene locus_tag LOCUS_00670 3930 2995 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_00670 4261 5175 gene locus_tag LOCUS_00680 4261 5175 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 protein_id gnl|my_center|LOCUS_00680 5535 6674 gene locus_tag LOCUS_00690 5535 6674 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600796.1 protein_id gnl|my_center|LOCUS_00690 6708 7130 gene locus_tag LOCUS_00700 6708 7130 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_00700 7164 8456 gene locus_tag LOCUS_00710 7164 8456 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_00710 9365 8544 gene locus_tag LOCUS_00720 gene glpR 9365 8544 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338237.1 protein_id gnl|my_center|LOCUS_00720 >Feature sequence0007 2756 2382 gene locus_tag LOCUS_00730 2756 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 4442 3837 gene locus_tag LOCUS_00740 4442 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4595 4855 gene locus_tag LOCUS_00750 4595 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 5079 5579 gene locus_tag LOCUS_00760 5079 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5576 7723 gene locus_tag LOCUS_00770 5576 7723 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538175.1 protein_id gnl|my_center|LOCUS_00770 7713 8666 gene locus_tag LOCUS_00780 7713 8666 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385737.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence0008 1801 1064 gene locus_tag LOCUS_00790 1801 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 2632 2120 gene locus_tag LOCUS_00800 2632 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 3306 3230 gene locus_tag LOCUS_t00020 3306 3230 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4833 3382 gene locus_tag LOCUS_00810 4833 3382 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 protein_id gnl|my_center|LOCUS_00810 6224 4851 gene locus_tag LOCUS_00820 gene merA1 6224 4851 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_00820 6943 6221 gene locus_tag LOCUS_00830 6943 6221 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338687.1 protein_id gnl|my_center|LOCUS_00830 7214 7348 gene locus_tag LOCUS_00840 gene rpmH 7214 7348 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y590 protein_id gnl|my_center|LOCUS_00840 7500 7844 gene locus_tag LOCUS_00850 gene rnpA 7500 7844 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 protein_id gnl|my_center|LOCUS_00850 7841 8149 gene locus_tag LOCUS_00860 7841 8149 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y592 protein_id gnl|my_center|LOCUS_00860 8156 9037 gene locus_tag LOCUS_00870 gene ttcA 8156 9037 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY8 protein_id gnl|my_center|LOCUS_00870 >Feature sequence0009 513 307 gene locus_tag LOCUS_00880 513 307 CDS product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385116.1 protein_id gnl|my_center|LOCUS_00880 561 1853 gene locus_tag LOCUS_00890 561 1853 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385115.1 protein_id gnl|my_center|LOCUS_00890 2094 3692 gene locus_tag LOCUS_00900 2094 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338717.1 protein_id gnl|my_center|LOCUS_00900 3741 5330 gene locus_tag LOCUS_00910 gene purH 3741 5330 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D3 protein_id gnl|my_center|LOCUS_00910 5340 5813 gene locus_tag LOCUS_00920 gene LspA 5340 5813 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU9 protein_id gnl|my_center|LOCUS_00920 5872 6363 gene locus_tag LOCUS_00930 5872 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338716.1 protein_id gnl|my_center|LOCUS_00930 6588 7934 gene locus_tag LOCUS_00940 6588 7934 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003733.1 protein_id gnl|my_center|LOCUS_00940 7931 9238 gene locus_tag LOCUS_00950 7931 9238 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338715.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence0010 58 927 gene locus_tag LOCUS_00960 58 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 1018 1302 gene locus_tag LOCUS_00970 1018 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 1837 3468 gene locus_tag LOCUS_00980 1837 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6968 3675 gene locus_tag LOCUS_00990 6968 3675 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344102.1 protein_id gnl|my_center|LOCUS_00990 7544 7870 gene locus_tag LOCUS_01000 7544 7870 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 protein_id gnl|my_center|LOCUS_01000 7927 8298 gene locus_tag LOCUS_01010 7927 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8508 8675 gene locus_tag LOCUS_01020 8508 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01020 8722 9015 gene locus_tag LOCUS_01030 8722 9015 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390830.1 protein_id gnl|my_center|LOCUS_01030 >Feature sequence0011 <1 705 gene locus_tag LOCUS_01040 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYH3:tRNA modification GTPase MnmE 729 2597 gene locus_tag LOCUS_01050 gene mnmG 729 2597 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y689 protein_id gnl|my_center|LOCUS_01050 2597 3214 gene locus_tag LOCUS_01060 gene rsmG 2597 3214 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH5 protein_id gnl|my_center|LOCUS_01060 3207 4007 gene locus_tag LOCUS_01070 gene parA 3207 4007 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721721.1 protein_id gnl|my_center|LOCUS_01070 4131 4919 gene locus_tag LOCUS_01080 gene spo0J 4131 4919 CDS product chromosome segregation DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003743.1 protein_id gnl|my_center|LOCUS_01080 5806 4916 gene locus_tag LOCUS_01090 5806 4916 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385470.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01090 6459 6076 gene locus_tag LOCUS_01100 6459 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531294.1 protein_id gnl|my_center|LOCUS_01100 7076 6456 gene locus_tag LOCUS_01110 gene ham1 7076 6456 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI1 protein_id gnl|my_center|LOCUS_01110 7789 7076 gene locus_tag LOCUS_01120 gene rph 7789 7076 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI2 protein_id gnl|my_center|LOCUS_01120 7909 8973 gene locus_tag LOCUS_01130 gene hrcA 7909 8973 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI3 protein_id gnl|my_center|LOCUS_01130 >Feature sequence0012 788 1243 gene locus_tag LOCUS_01140 788 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 1756 1253 gene locus_tag LOCUS_01150 1756 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 2717 1920 gene locus_tag LOCUS_01160 2717 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529732.1 protein_id gnl|my_center|LOCUS_01160 3406 2789 gene locus_tag LOCUS_01170 3406 2789 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970598.1 protein_id gnl|my_center|LOCUS_01170 4118 3495 gene locus_tag LOCUS_01180 4118 3495 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974531.1 protein_id gnl|my_center|LOCUS_01180 4220 4939 gene locus_tag LOCUS_01190 4220 4939 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315869.1 protein_id gnl|my_center|LOCUS_01190 5336 4995 gene locus_tag LOCUS_01200 5336 4995 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_01200 5778 7055 gene locus_tag LOCUS_01210 5778 7055 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 protein_id gnl|my_center|LOCUS_01210 7700 7152 gene locus_tag LOCUS_01220 gene ccmG 7700 7152 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 protein_id gnl|my_center|LOCUS_01220 7848 7693 gene locus_tag LOCUS_01230 gene ccmD 7848 7693 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5I3 protein_id gnl|my_center|LOCUS_01230 8582 7845 gene locus_tag LOCUS_01240 gene ccmC 8582 7845 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840365.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence0013 <1 867 gene locus_tag LOCUS_01250 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338611.1:nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein 864 1628 gene locus_tag LOCUS_01260 864 1628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338612.1 protein_id gnl|my_center|LOCUS_01260 2053 3111 gene locus_tag LOCUS_01270 gene rsgA 2053 3111 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1K8 protein_id gnl|my_center|LOCUS_01270 3201 4982 gene locus_tag LOCUS_01280 gene dnaX 3201 4982 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383690.1 protein_id gnl|my_center|LOCUS_01280 5036 5380 gene locus_tag LOCUS_01290 gene YbaB 5036 5380 CDS product nucleoid-associated protein YbaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ7 protein_id gnl|my_center|LOCUS_01290 5388 5984 gene locus_tag LOCUS_01300 gene recR 5388 5984 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA83 protein_id gnl|my_center|LOCUS_01300 6824 6075 gene locus_tag LOCUS_01310 6824 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383062.1 protein_id gnl|my_center|LOCUS_01310 6965 7606 gene locus_tag LOCUS_01320 6965 7606 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383061.1 protein_id gnl|my_center|LOCUS_01320 8656 7658 gene locus_tag LOCUS_01330 8656 7658 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_01330 9072 8653 gene locus_tag LOCUS_01340 9072 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence0014 542 1864 gene locus_tag LOCUS_01350 542 1864 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_01350 1864 2583 gene locus_tag LOCUS_01360 1864 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3113 2580 gene locus_tag LOCUS_01370 3113 2580 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223268.1 protein_id gnl|my_center|LOCUS_01370 3182 4060 gene locus_tag LOCUS_01380 3182 4060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710105.1 protein_id gnl|my_center|LOCUS_01380 5896 4118 gene locus_tag LOCUS_01390 5896 4118 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_01390 7648 5972 gene locus_tag LOCUS_01400 7648 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_01400 8177 7764 gene locus_tag LOCUS_01410 8177 7764 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_01410 <8884 8272 gene locus_tag LOCUS_01420 <8884 8272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527134.1:MBL fold hydrolase >Feature sequence0015 299 598 gene locus_tag LOCUS_01430 gene ihfA 299 598 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_01430 636 2105 gene locus_tag LOCUS_01440 636 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 2244 2320 gene locus_tag LOCUS_t00030 2244 2320 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2424 3497 gene locus_tag LOCUS_01450 gene dcd 2424 3497 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337605.1 protein_id gnl|my_center|LOCUS_01450 5005 3521 gene locus_tag LOCUS_01460 5005 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5581 5273 gene locus_tag LOCUS_01470 5581 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6382 5726 gene locus_tag LOCUS_01480 6382 5726 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J285 protein_id gnl|my_center|LOCUS_01480 7173 6379 gene locus_tag LOCUS_01490 7173 6379 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720098.1 protein_id gnl|my_center|LOCUS_01490 8227 7181 gene locus_tag LOCUS_01500 8227 7181 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J283 protein_id gnl|my_center|LOCUS_01500 <8786 8234 gene locus_tag LOCUS_01510 <8786 8234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337864.1:sporulation protein >Feature sequence0016 2154 664 gene locus_tag LOCUS_01520 2154 664 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_01520 2716 3384 gene locus_tag LOCUS_01530 2716 3384 CDS product potassium transporter KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384842.1 protein_id gnl|my_center|LOCUS_01530 3388 4722 gene locus_tag LOCUS_01540 gene yubG 3388 4722 CDS product Ktr system potassium transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384841.1 protein_id gnl|my_center|LOCUS_01540 5459 5064 gene locus_tag LOCUS_01550 5459 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5782 5426 gene locus_tag LOCUS_01560 5782 5426 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259467.1 protein_id gnl|my_center|LOCUS_01560 7265 5784 gene locus_tag LOCUS_01570 7265 5784 CDS product acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083800.1 protein_id gnl|my_center|LOCUS_01570 8038 7271 gene locus_tag LOCUS_01580 8038 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 8631 8035 gene locus_tag LOCUS_01590 8631 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence0017 1447 533 gene locus_tag LOCUS_01600 1447 533 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_01600 2291 1503 gene locus_tag LOCUS_01610 gene xthA1 2291 1503 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385540.1 protein_id gnl|my_center|LOCUS_01610 3156 2470 gene locus_tag LOCUS_01620 3156 2470 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_01620 3293 4414 gene locus_tag LOCUS_01630 gene ribA 3293 4414 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZK7 protein_id gnl|my_center|LOCUS_01630 4411 4905 gene locus_tag LOCUS_01640 4411 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561673.1 protein_id gnl|my_center|LOCUS_01640 5595 4939 gene locus_tag LOCUS_01650 5595 4939 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385539.1 protein_id gnl|my_center|LOCUS_01650 5815 6891 gene locus_tag LOCUS_01660 5815 6891 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538064.1 protein_id gnl|my_center|LOCUS_01660 7036 7605 gene locus_tag LOCUS_01670 7036 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence0018 2465 3721 gene locus_tag LOCUS_01680 2465 3721 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707551.1 protein_id gnl|my_center|LOCUS_01680 3887 5053 gene locus_tag LOCUS_01690 3887 5053 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 protein_id gnl|my_center|LOCUS_01690 5300 6535 gene locus_tag LOCUS_01700 gene rpoN 5300 6535 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0I5 protein_id gnl|my_center|LOCUS_01700 7929 6796 gene locus_tag LOCUS_01710 7929 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 <8624 7937 gene locus_tag LOCUS_01720 <8624 7937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388796.1:LysR family transcriptional regulator >Feature sequence0019 <1 1552 gene locus_tag LOCUS_01730 <1 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086601.1:aldehyde dehydrogenase 1832 1647 gene locus_tag LOCUS_01740 1832 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2217 2038 gene locus_tag LOCUS_01750 2217 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2238 2399 gene locus_tag LOCUS_01760 2238 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2649 4295 gene locus_tag LOCUS_01770 2649 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4545 5270 gene locus_tag LOCUS_01780 4545 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5270 6553 gene locus_tag LOCUS_01790 5270 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102743.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence0020 2024 729 gene locus_tag LOCUS_01800 gene flgE1 2024 729 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYA0 protein_id gnl|my_center|LOCUS_01800 2967 2116 gene locus_tag LOCUS_01810 gene motB1 2967 2116 CDS product chemotaxis MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003749.1 protein_id gnl|my_center|LOCUS_01810 4168 3125 gene locus_tag LOCUS_01820 4168 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532894.1 protein_id gnl|my_center|LOCUS_01820 5131 4181 gene locus_tag LOCUS_01830 5131 4181 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532895.1 protein_id gnl|my_center|LOCUS_01830 5730 5128 gene locus_tag LOCUS_01840 5730 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532896.1 protein_id gnl|my_center|LOCUS_01840 6933 5800 gene locus_tag LOCUS_01850 6933 5800 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532897.1 protein_id gnl|my_center|LOCUS_01850 7199 7023 gene locus_tag LOCUS_01860 7199 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 <8478 7226 gene locus_tag LOCUS_01870 <8478 7226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896012.1:ammonium transporter >Feature sequence0021 2431 1433 gene locus_tag LOCUS_01880 2431 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3466 2465 gene locus_tag LOCUS_01890 3466 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3538 4851 gene locus_tag LOCUS_01900 3538 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 5296 4904 gene locus_tag LOCUS_01910 5296 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6591 5410 gene locus_tag LOCUS_01920 6591 5410 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338713.1 protein_id gnl|my_center|LOCUS_01920 8279 6591 gene locus_tag LOCUS_01930 gene mutL 8279 6591 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C8 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0022 <1 810 gene locus_tag LOCUS_01940 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336784.1:aspartate aminotransferase 821 3793 gene locus_tag LOCUS_01950 821 3793 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336785.1 protein_id gnl|my_center|LOCUS_01950 3875 4489 gene locus_tag LOCUS_01960 3875 4489 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E7 protein_id gnl|my_center|LOCUS_01960 5078 4494 gene locus_tag LOCUS_01970 5078 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722170.1 protein_id gnl|my_center|LOCUS_01970 6066 5185 gene locus_tag LOCUS_01980 6066 5185 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_01980 6152 6478 gene locus_tag LOCUS_01990 6152 6478 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 protein_id gnl|my_center|LOCUS_01990 6994 6503 gene locus_tag LOCUS_02000 6994 6503 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336789.1 protein_id gnl|my_center|LOCUS_02000 7328 6984 gene locus_tag LOCUS_02010 gene arsI 7328 6984 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RIS6 protein_id gnl|my_center|LOCUS_02010 7419 7871 gene locus_tag LOCUS_02020 7419 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385513.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence0023 571 443 gene locus_tag LOCUS_02030 571 443 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383171.1 protein_id gnl|my_center|LOCUS_02030 1749 586 gene locus_tag LOCUS_02040 gene cydB 1749 586 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 protein_id gnl|my_center|LOCUS_02040 3368 1755 gene locus_tag LOCUS_02050 gene cydA 3368 1755 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 protein_id gnl|my_center|LOCUS_02050 5253 3622 gene locus_tag LOCUS_02060 gene cydC 5253 3622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 protein_id gnl|my_center|LOCUS_02060 6953 5250 gene locus_tag LOCUS_02070 gene cydD 6953 5250 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973554.1 protein_id gnl|my_center|LOCUS_02070 >Feature sequence0024 2646 1303 gene locus_tag LOCUS_02080 2646 1303 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 protein_id gnl|my_center|LOCUS_02080 2825 4111 gene locus_tag LOCUS_02090 2825 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 4226 4789 gene locus_tag LOCUS_02100 4226 4789 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973659.1 protein_id gnl|my_center|LOCUS_02100 4980 5867 gene locus_tag LOCUS_02110 4980 5867 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970789.1 protein_id gnl|my_center|LOCUS_02110 5871 6557 gene locus_tag LOCUS_02120 gene glxC 5871 6557 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707986.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence0025 903 355 gene locus_tag LOCUS_02130 903 355 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945913.1 protein_id gnl|my_center|LOCUS_02130 1041 1400 gene locus_tag LOCUS_02140 1041 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1604 3247 gene locus_tag LOCUS_02150 gene pyrG 1604 3247 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0Z1 protein_id gnl|my_center|LOCUS_02150 3958 3326 gene locus_tag LOCUS_02160 3958 3326 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_02160 4493 4050 gene locus_tag LOCUS_02170 4493 4050 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_02170 4576 5169 gene locus_tag LOCUS_02180 4576 5169 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383211.1 protein_id gnl|my_center|LOCUS_02180 5254 6165 gene locus_tag LOCUS_02190 5254 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532260.1 protein_id gnl|my_center|LOCUS_02190 6265 6708 gene locus_tag LOCUS_02200 6265 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence0026 781 380 gene locus_tag LOCUS_02210 781 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1167 781 gene locus_tag LOCUS_02220 gene cheY2 1167 781 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719588.1 protein_id gnl|my_center|LOCUS_02220 2084 1167 gene locus_tag LOCUS_02230 gene cheR 2084 1167 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG03 protein_id gnl|my_center|LOCUS_02230 2548 2081 gene locus_tag LOCUS_02240 gene cheW 2548 2081 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87715 protein_id gnl|my_center|LOCUS_02240 4865 2553 gene locus_tag LOCUS_02250 gene cheA 4865 2553 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52880 protein_id gnl|my_center|LOCUS_02250 5241 4876 gene locus_tag LOCUS_02260 gene cheY1 5241 4876 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337489.1 protein_id gnl|my_center|LOCUS_02260 5519 5238 gene locus_tag LOCUS_02270 5519 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 6677 5703 gene locus_tag LOCUS_02280 gene glk 6677 5703 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337814.1 protein_id gnl|my_center|LOCUS_02280 <7585 6681 gene locus_tag LOCUS_02290 <7585 6681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y846:beta-glucosidase >Feature sequence0027 886 2070 gene locus_tag LOCUS_02300 886 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_02300 2130 2960 gene locus_tag LOCUS_02310 gene xthA 2130 2960 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 protein_id gnl|my_center|LOCUS_02310 4575 3049 gene locus_tag LOCUS_02320 gene der 4575 3049 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y1 protein_id gnl|my_center|LOCUS_02320 6082 4754 gene locus_tag LOCUS_02330 6082 4754 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_02330 6809 6156 gene locus_tag LOCUS_02340 6809 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337666.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence0028 269 661 gene locus_tag LOCUS_02350 269 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 2232 931 gene locus_tag LOCUS_02360 2232 931 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_02360 3573 2236 gene locus_tag LOCUS_02370 3573 2236 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338052.1 protein_id gnl|my_center|LOCUS_02370 3854 4333 gene locus_tag LOCUS_02380 gene accB 3854 4333 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720335.1 protein_id gnl|my_center|LOCUS_02380 4346 5692 gene locus_tag LOCUS_02390 gene accC 4346 5692 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338054.1 protein_id gnl|my_center|LOCUS_02390 5920 5708 gene locus_tag LOCUS_02400 5920 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5840 6421 gene locus_tag LOCUS_02410 gene aat 5840 6421 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1H1 protein_id gnl|my_center|LOCUS_02410 6924 6385 gene locus_tag LOCUS_02420 6924 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7397 6921 gene locus_tag LOCUS_02430 7397 6921 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence0029 2606 102 gene locus_tag LOCUS_02440 2606 102 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114950.1 protein_id gnl|my_center|LOCUS_02440 4144 2789 gene locus_tag LOCUS_02450 4144 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 <7363 4228 gene locus_tag LOCUS_02460 <7363 4228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:adhesin >Feature sequence0030 815 99 gene locus_tag LOCUS_02470 815 99 CDS product branched-chain amino acid transporter AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_02470 1943 939 gene locus_tag LOCUS_02480 1943 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336974.1 protein_id gnl|my_center|LOCUS_02480 2442 1972 gene locus_tag LOCUS_02490 gene greA 2442 1972 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8F7 protein_id gnl|my_center|LOCUS_02490 2840 4492 gene locus_tag LOCUS_02500 2840 4492 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336975.1 protein_id gnl|my_center|LOCUS_02500 4614 6320 gene locus_tag LOCUS_02510 4614 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537447.1 protein_id gnl|my_center|LOCUS_02510 6327 7157 gene locus_tag LOCUS_02520 gene ispE 6327 7157 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_02520 >Feature sequence0031 1664 1224 gene locus_tag LOCUS_02530 1664 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2403 1651 gene locus_tag LOCUS_02540 2403 1651 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_02540 5669 2403 gene locus_tag LOCUS_02550 5669 2403 CDS product type I restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_02550 6950 5685 gene locus_tag LOCUS_02560 6950 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence0032 331 1416 gene locus_tag LOCUS_02570 331 1416 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_02570 2130 1483 gene locus_tag LOCUS_02580 2130 1483 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338579.1 protein_id gnl|my_center|LOCUS_02580 2687 2127 gene locus_tag LOCUS_02590 2687 2127 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383306.1 protein_id gnl|my_center|LOCUS_02590 3892 2687 gene locus_tag LOCUS_02600 3892 2687 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 protein_id gnl|my_center|LOCUS_02600 3982 4470 gene locus_tag LOCUS_02610 3982 4470 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338576.1 protein_id gnl|my_center|LOCUS_02610 5356 4508 gene locus_tag LOCUS_02620 5356 4508 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_02620 5654 5349 gene locus_tag LOCUS_02630 5654 5349 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_02630 6825 5647 gene locus_tag LOCUS_02640 6825 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003715.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence0033 <1 613 gene locus_tag LOCUS_02650 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532989.1:acetylornithine deacetylase 625 1800 gene locus_tag LOCUS_02660 625 1800 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808070.1 protein_id gnl|my_center|LOCUS_02660 1869 3239 gene locus_tag LOCUS_02670 1869 3239 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390560.1 protein_id gnl|my_center|LOCUS_02670 3236 6352 gene locus_tag LOCUS_02680 3236 6352 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_02680 <7068 6396 gene locus_tag LOCUS_02690 <7068 6396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638382.2:alpha,alpha-trehalose-phosphate synthase >Feature sequence0034 1509 592 gene locus_tag LOCUS_02700 1509 592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088891.1 protein_id gnl|my_center|LOCUS_02700 2624 1506 gene locus_tag LOCUS_02710 2624 1506 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706460.1 protein_id gnl|my_center|LOCUS_02710 3964 2729 gene locus_tag LOCUS_02720 3964 2729 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088889.1 protein_id gnl|my_center|LOCUS_02720 4798 3983 gene locus_tag LOCUS_02730 4798 3983 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_02730 5866 4940 gene locus_tag LOCUS_02740 5866 4940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 protein_id gnl|my_center|LOCUS_02740 6351 6103 gene locus_tag LOCUS_02750 6351 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6364 6717 gene locus_tag LOCUS_02760 6364 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence0035 <1 2898 gene locus_tag LOCUS_02770 <1 2898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336808.1:double-strand break repair helicase AddA 2956 3276 gene locus_tag LOCUS_02780 gene trxA 2956 3276 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B4 protein_id gnl|my_center|LOCUS_02780 3388 3945 gene locus_tag LOCUS_02790 gene hslV 3388 3945 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B2 protein_id gnl|my_center|LOCUS_02790 3942 5246 gene locus_tag LOCUS_02800 gene hslU 3942 5246 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B1 protein_id gnl|my_center|LOCUS_02800 5876 5256 gene locus_tag LOCUS_02810 5876 5256 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338814.1 protein_id gnl|my_center|LOCUS_02810 6835 5873 gene locus_tag LOCUS_02820 6835 5873 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence0036 1598 195 gene locus_tag LOCUS_02830 1598 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338326.1 protein_id gnl|my_center|LOCUS_02830 1705 2490 gene locus_tag LOCUS_02840 gene truA 1705 2490 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7F3 protein_id gnl|my_center|LOCUS_02840 2586 2735 gene locus_tag LOCUS_02850 2586 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2930 4678 gene locus_tag LOCUS_02860 2930 4678 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_02860 5476 4760 gene locus_tag LOCUS_02870 5476 4760 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061725.1 protein_id gnl|my_center|LOCUS_02870 <6680 5852 gene locus_tag LOCUS_02880 <6680 5852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385587.1:chlorohydrolase >Feature sequence0037 <1 1004 gene locus_tag LOCUS_02890 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3M8U4:quinolinate synthase A 1010 2614 gene locus_tag LOCUS_02900 1010 2614 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUG1 protein_id gnl|my_center|LOCUS_02900 2611 3462 gene locus_tag LOCUS_02910 gene nadC 2611 3462 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085327.1 protein_id gnl|my_center|LOCUS_02910 4037 3636 gene locus_tag LOCUS_02920 4037 3636 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_02920 4966 4073 gene locus_tag LOCUS_02930 4966 4073 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_02930 5140 5601 gene locus_tag LOCUS_02940 5140 5601 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 protein_id gnl|my_center|LOCUS_02940 <6653 5725 gene locus_tag LOCUS_02950 <6653 5725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887895.1:multidrug ABC transporter ATP-binding protein >Feature sequence0038 538 1155 gene locus_tag LOCUS_02960 538 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 1429 1770 gene locus_tag LOCUS_02970 1429 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2595 1867 gene locus_tag LOCUS_02980 2595 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383017.1 protein_id gnl|my_center|LOCUS_02980 2820 4397 gene locus_tag LOCUS_02990 2820 4397 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537864.1 protein_id gnl|my_center|LOCUS_02990 4409 4786 gene locus_tag LOCUS_03000 4409 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139977.1 protein_id gnl|my_center|LOCUS_03000 5784 4852 gene locus_tag LOCUS_03010 5784 4852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918077.1 protein_id gnl|my_center|LOCUS_03010 5986 6168 gene locus_tag LOCUS_03020 5986 6168 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence0039 1676 69 gene locus_tag LOCUS_03030 gene nusA 1676 69 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN7 protein_id gnl|my_center|LOCUS_03030 2278 1691 gene locus_tag LOCUS_03040 gene rimP 2278 1691 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN8 protein_id gnl|my_center|LOCUS_03040 3428 2451 gene locus_tag LOCUS_03050 gene pip 3428 2451 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y661 protein_id gnl|my_center|LOCUS_03050 3498 4244 gene locus_tag LOCUS_03060 gene ubiG 3498 4244 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM5 protein_id gnl|my_center|LOCUS_03060 4697 4248 gene locus_tag LOCUS_03070 4697 4248 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 protein_id gnl|my_center|LOCUS_03070 5530 4694 gene locus_tag LOCUS_03080 5530 4694 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385446.1 protein_id gnl|my_center|LOCUS_03080 5791 5534 gene locus_tag LOCUS_03090 gene grxC 5791 5534 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_03090 <6555 5827 gene locus_tag LOCUS_03100 <6555 5827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338779.1:amidophosphoribosyltransferase >Feature sequence0040 <1 527 gene locus_tag LOCUS_03110 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066579.1:mannitol ABC transporter permease 550 1554 gene locus_tag LOCUS_03120 gene smoK 550 1554 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 protein_id gnl|my_center|LOCUS_03120 1551 2324 gene locus_tag LOCUS_03130 gene smoS 1551 2324 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708985.1 protein_id gnl|my_center|LOCUS_03130 2332 3801 gene locus_tag LOCUS_03140 gene mtlK 2332 3801 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337991.1 protein_id gnl|my_center|LOCUS_03140 4592 3786 gene locus_tag LOCUS_03150 gene znuB2 4592 3786 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262760.1 protein_id gnl|my_center|LOCUS_03150 5368 4589 gene locus_tag LOCUS_03160 gene znuC 5368 4589 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWB5 protein_id gnl|my_center|LOCUS_03160 5853 5365 gene locus_tag LOCUS_03170 gene zur 5853 5365 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339419.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence0041 <1 1330 gene locus_tag LOCUS_03180 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338818.1:ABC transporter ATP-binding protein 1327 2331 gene locus_tag LOCUS_03190 1327 2331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 protein_id gnl|my_center|LOCUS_03190 2366 3301 gene locus_tag LOCUS_03200 2366 3301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 protein_id gnl|my_center|LOCUS_03200 3458 4348 gene locus_tag LOCUS_03210 3458 4348 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_03210 4383 6071 gene locus_tag LOCUS_03220 4383 6071 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0042 2024 594 gene locus_tag LOCUS_03230 2024 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538034.1 protein_id gnl|my_center|LOCUS_03230 3707 2028 gene locus_tag LOCUS_03240 3707 2028 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 protein_id gnl|my_center|LOCUS_03240 4654 3722 gene locus_tag LOCUS_03250 4654 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4933 4754 gene locus_tag LOCUS_03260 4933 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5875 4946 gene locus_tag LOCUS_03270 5875 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence0043 <1 727 gene locus_tag LOCUS_03280 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338863.1:flagellar hook protein FlgL 727 1830 gene locus_tag LOCUS_03290 gene flgI2 727 1830 CDS product flagellar P-ring protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY97 protein_id gnl|my_center|LOCUS_03290 2190 1927 gene locus_tag LOCUS_03300 gene rpsT 2190 1927 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY62 protein_id gnl|my_center|LOCUS_03300 3121 2345 gene locus_tag LOCUS_03310 3121 2345 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721912.1 protein_id gnl|my_center|LOCUS_03310 4035 3184 gene locus_tag LOCUS_03320 gene mutM 4035 3184 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_03320 4122 4874 gene locus_tag LOCUS_03330 gene ubiE 4122 4874 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY65 protein_id gnl|my_center|LOCUS_03330 >Feature sequence0044 452 90 gene locus_tag LOCUS_03340 452 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 990 442 gene locus_tag LOCUS_03350 990 442 CDS product regulatory protein TetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525185.1 protein_id gnl|my_center|LOCUS_03350 2928 1627 gene locus_tag LOCUS_03360 gene ordL1 2928 1627 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 protein_id gnl|my_center|LOCUS_03360 4304 2928 gene locus_tag LOCUS_03370 4304 2928 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532930.1 protein_id gnl|my_center|LOCUS_03370 4419 5114 gene locus_tag LOCUS_03380 4419 5114 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_03380 5357 5169 gene locus_tag LOCUS_03390 5357 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 <6393 5541 gene locus_tag LOCUS_03400 <6393 5541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ66:adenine deaminase >Feature sequence0045 226 1833 gene locus_tag LOCUS_03410 226 1833 CDS product peptide ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 protein_id gnl|my_center|LOCUS_03410 3434 1872 gene locus_tag LOCUS_03420 3434 1872 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841606.1 protein_id gnl|my_center|LOCUS_03420 4354 3650 gene locus_tag LOCUS_03430 4354 3650 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720869.1 protein_id gnl|my_center|LOCUS_03430 4472 4816 gene locus_tag LOCUS_03440 gene clpS 4472 4816 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J022 protein_id gnl|my_center|LOCUS_03440 4832 5839 gene locus_tag LOCUS_03450 4832 5839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338416.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence0046 237 374 gene locus_tag LOCUS_03460 237 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 388 1983 gene locus_tag LOCUS_03470 388 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337781.1 protein_id gnl|my_center|LOCUS_03470 1980 2921 gene locus_tag LOCUS_03480 gene xerD 1980 2921 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2I7 protein_id gnl|my_center|LOCUS_03480 3754 2948 gene locus_tag LOCUS_03490 3754 2948 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528465.1 protein_id gnl|my_center|LOCUS_03490 4094 3903 gene locus_tag LOCUS_03500 4094 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4424 5791 gene locus_tag LOCUS_03510 gene corB 4424 5791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337783.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0047 2650 1577 gene locus_tag LOCUS_03520 2650 1577 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_03520 3702 2647 gene locus_tag LOCUS_03530 3702 2647 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383346.1 protein_id gnl|my_center|LOCUS_03530 4101 4262 gene locus_tag LOCUS_03540 4101 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5349 4393 gene locus_tag LOCUS_03550 5349 4393 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence0048 1269 544 gene locus_tag LOCUS_03560 gene nanR 1269 544 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G0E1Z6 protein_id gnl|my_center|LOCUS_03560 2322 1438 gene locus_tag LOCUS_03570 gene purU 2322 1438 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEQ2 protein_id gnl|my_center|LOCUS_03570 3288 2398 gene locus_tag LOCUS_03580 gene folD 3288 2398 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_03580 3626 3288 gene locus_tag LOCUS_03590 3626 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 <6190 3841 gene locus_tag LOCUS_03600 <6190 3841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532909.1:sarcosine oxidase subunit alpha >Feature sequence0049 1635 391 gene locus_tag LOCUS_03610 gene nuoD 1635 391 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F8 protein_id gnl|my_center|LOCUS_03610 2532 1636 gene locus_tag LOCUS_03620 2532 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3133 2534 gene locus_tag LOCUS_03630 gene nuoC 3133 2534 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F9 protein_id gnl|my_center|LOCUS_03630 3678 3145 gene locus_tag LOCUS_03640 gene nuoB1 3678 3145 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3G0 protein_id gnl|my_center|LOCUS_03640 4034 3669 gene locus_tag LOCUS_03650 gene nuoA 4034 3669 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3X4 protein_id gnl|my_center|LOCUS_03650 5546 4344 gene locus_tag LOCUS_03660 gene wecE 5546 4344 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 protein_id gnl|my_center|LOCUS_03660 6175 5543 gene locus_tag LOCUS_03670 gene gph 6175 5543 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337538.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence0050 <1 992 gene locus_tag LOCUS_03680 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139929.1:molybdopterin biosynthesis protein 989 1735 gene locus_tag LOCUS_03690 gene thiD 989 1735 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_03690 1961 2191 gene locus_tag LOCUS_03700 1961 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3716 2343 gene locus_tag LOCUS_03710 3716 2343 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972344.1 protein_id gnl|my_center|LOCUS_03710 4384 3713 gene locus_tag LOCUS_03720 gene basR 4384 3713 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820363.1 protein_id gnl|my_center|LOCUS_03720 4515 5615 gene locus_tag LOCUS_03730 4515 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706264.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0051 3138 1054 gene locus_tag LOCUS_03740 gene glgX1 3138 1054 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D9 protein_id gnl|my_center|LOCUS_03740 4568 3135 gene locus_tag LOCUS_03750 gene glgA 4568 3135 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNH6 protein_id gnl|my_center|LOCUS_03750 5839 4565 gene locus_tag LOCUS_03760 gene glgC 5839 4565 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNH7 protein_id gnl|my_center|LOCUS_03760 >Feature sequence0052 703 1677 gene locus_tag LOCUS_03770 703 1677 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 protein_id gnl|my_center|LOCUS_03770 1906 2844 gene locus_tag LOCUS_03780 1906 2844 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_03780 2898 3146 gene locus_tag LOCUS_03790 2898 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 protein_id gnl|my_center|LOCUS_03790 3749 3138 gene locus_tag LOCUS_03800 gene mobA 3749 3138 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKR0 protein_id gnl|my_center|LOCUS_03800 3858 4364 gene locus_tag LOCUS_03810 3858 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4468 5052 gene locus_tag LOCUS_03820 4468 5052 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence0053 1579 1037 gene locus_tag LOCUS_03830 1579 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2778 1663 gene locus_tag LOCUS_03840 2778 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4656 2959 gene locus_tag LOCUS_03850 4656 2959 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 protein_id gnl|my_center|LOCUS_03850 4926 5426 gene locus_tag LOCUS_03860 4926 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence0054 202 2292 gene locus_tag LOCUS_03870 gene flhA 202 2292 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385152.1 protein_id gnl|my_center|LOCUS_03870 2289 3065 gene locus_tag LOCUS_03880 gene fliR1 2289 3065 CDS product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338876.1 protein_id gnl|my_center|LOCUS_03880 3065 4159 gene locus_tag LOCUS_03890 gene fhlB 3065 4159 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338877.1 protein_id gnl|my_center|LOCUS_03890 4159 4527 gene locus_tag LOCUS_03900 4159 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 5052 4543 gene locus_tag LOCUS_03910 5052 4543 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140007.1 protein_id gnl|my_center|LOCUS_03910 5789 5064 gene locus_tag LOCUS_03920 gene flgH 5789 5064 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY79 protein_id gnl|my_center|LOCUS_03920 6069 5803 gene locus_tag LOCUS_03930 6069 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0055 3 749 gene locus_tag LOCUS_03940 3 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 746 1192 gene locus_tag LOCUS_03950 746 1192 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527967.1 protein_id gnl|my_center|LOCUS_03950 1204 3348 gene locus_tag LOCUS_03960 1204 3348 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_03960 3360 4910 gene locus_tag LOCUS_03970 3360 4910 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0056 457 221 gene locus_tag LOCUS_03980 457 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 368 1459 gene locus_tag LOCUS_03990 368 1459 CDS product D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530258.1 protein_id gnl|my_center|LOCUS_03990 1463 2221 gene locus_tag LOCUS_04000 1463 2221 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_04000 2233 2964 gene locus_tag LOCUS_04010 2233 2964 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434102.1 protein_id gnl|my_center|LOCUS_04010 2996 3724 gene locus_tag LOCUS_04020 gene rdh 2996 3724 CDS product ribitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315914.1 protein_id gnl|my_center|LOCUS_04020 3988 4173 gene locus_tag LOCUS_04030 3988 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5669 5412 gene locus_tag LOCUS_04040 5669 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6034 5693 gene locus_tag LOCUS_04050 6034 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence0057 443 75 gene locus_tag LOCUS_04060 443 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 671 447 gene locus_tag LOCUS_04070 671 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 721 1629 gene locus_tag LOCUS_04080 721 1629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419994.1 protein_id gnl|my_center|LOCUS_04080 1766 2287 gene locus_tag LOCUS_04090 1766 2287 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026937.1 protein_id gnl|my_center|LOCUS_04090 3163 2453 gene locus_tag LOCUS_04100 3163 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4259 3507 gene locus_tag LOCUS_04110 gene linC 4259 3507 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337180.1 protein_id gnl|my_center|LOCUS_04110 5512 4889 gene locus_tag LOCUS_04120 gene ampD 5512 4889 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337369.1 protein_id gnl|my_center|LOCUS_04120 6024 5596 gene locus_tag LOCUS_04130 6024 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence0058 <1 615 gene locus_tag LOCUS_04140 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064233.1:LysR family transcriptional regulator 906 1856 gene locus_tag LOCUS_04150 906 1856 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339285.1 protein_id gnl|my_center|LOCUS_04150 1953 2438 gene locus_tag LOCUS_04160 1953 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2441 3994 gene locus_tag LOCUS_04170 2441 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969453.1 protein_id gnl|my_center|LOCUS_04170 4029 4634 gene locus_tag LOCUS_04180 4029 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064232.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence0059 715 80 gene locus_tag LOCUS_04190 715 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563682.1 protein_id gnl|my_center|LOCUS_04190 993 727 gene locus_tag LOCUS_04200 993 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722578.1 protein_id gnl|my_center|LOCUS_04200 1522 1124 gene locus_tag LOCUS_04210 1522 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 1707 2273 gene locus_tag LOCUS_04220 1707 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 3556 2348 gene locus_tag LOCUS_04230 3556 2348 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969673.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence0060 1007 843 gene locus_tag LOCUS_04240 1007 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2346 1087 gene locus_tag LOCUS_04250 2346 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140185.1 protein_id gnl|my_center|LOCUS_04250 2306 2557 gene locus_tag LOCUS_04260 2306 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3104 2661 gene locus_tag LOCUS_04270 3104 2661 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 protein_id gnl|my_center|LOCUS_04270 3346 3657 gene locus_tag LOCUS_04280 3346 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4532 3687 gene locus_tag LOCUS_04290 4532 3687 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_04290 4728 5150 gene locus_tag LOCUS_04300 gene dksA 4728 5150 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J6 protein_id gnl|my_center|LOCUS_04300 >Feature sequence0061 <1 647 gene locus_tag LOCUS_04310 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331334.1:phosphomannomutase 773 2863 gene locus_tag LOCUS_04320 773 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_04320 3116 4369 gene locus_tag LOCUS_04330 3116 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4573 4845 gene locus_tag LOCUS_04340 4573 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5041 5556 gene locus_tag LOCUS_04350 5041 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence0062 <1 1288 gene locus_tag LOCUS_04360 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140017.1:leucyl aminopeptidase 1285 2097 gene locus_tag LOCUS_04370 1285 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140018.1 protein_id gnl|my_center|LOCUS_04370 2446 2105 gene locus_tag LOCUS_04380 2446 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_04380 3048 2755 gene locus_tag LOCUS_04390 3048 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3737 3045 gene locus_tag LOCUS_04400 3737 3045 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_04400 4056 5033 gene locus_tag LOCUS_04410 4056 5033 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383291.1 protein_id gnl|my_center|LOCUS_04410 5073 5531 gene locus_tag LOCUS_04420 5073 5531 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ9 protein_id gnl|my_center|LOCUS_04420 >Feature sequence0063 157 348 gene locus_tag LOCUS_04430 157 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 685 398 gene locus_tag LOCUS_04440 685 398 CDS product Usg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719779.1 protein_id gnl|my_center|LOCUS_04440 935 3679 gene locus_tag LOCUS_04450 gene gyrA 935 3679 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J348 protein_id gnl|my_center|LOCUS_04450 4170 5483 gene locus_tag LOCUS_04460 gene trmFO 4170 5483 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J349 protein_id gnl|my_center|LOCUS_04460 5494 5697 gene locus_tag LOCUS_04470 5494 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence0064 382 2181 gene locus_tag LOCUS_04480 382 2181 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_04480 2244 3296 gene locus_tag LOCUS_04490 gene bdhA 2244 3296 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34788 protein_id gnl|my_center|LOCUS_04490 4287 3334 gene locus_tag LOCUS_04500 4287 3334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346805.1 protein_id gnl|my_center|LOCUS_04500 5333 4326 gene locus_tag LOCUS_04510 5333 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 <5842 5338 gene locus_tag LOCUS_04520 <5842 5338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976185.1:ABC transporter ATP-binding protein >Feature sequence0065 2516 411 gene locus_tag LOCUS_04530 gene pqiB 2516 411 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385065.1 protein_id gnl|my_center|LOCUS_04530 3162 2527 gene locus_tag LOCUS_04540 3162 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04540 3773 3129 gene locus_tag LOCUS_04550 3773 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 >Feature sequence0066 924 229 gene locus_tag LOCUS_04560 924 229 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562094.1 protein_id gnl|my_center|LOCUS_04560 1235 2506 gene locus_tag LOCUS_04570 1235 2506 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338164.1 protein_id gnl|my_center|LOCUS_04570 3625 2606 gene locus_tag LOCUS_04580 3625 2606 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338210.1 protein_id gnl|my_center|LOCUS_04580 4221 3622 gene locus_tag LOCUS_04590 4221 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338211.1 protein_id gnl|my_center|LOCUS_04590 5066 4332 gene locus_tag LOCUS_04600 5066 4332 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 protein_id gnl|my_center|LOCUS_04600 5354 5076 gene locus_tag LOCUS_04610 5354 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338213.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence0067 416 210 gene locus_tag LOCUS_04620 416 210 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537734.1 protein_id gnl|my_center|LOCUS_04620 1980 721 gene locus_tag LOCUS_04630 1980 721 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031334.1 protein_id gnl|my_center|LOCUS_04630 3693 2038 gene locus_tag LOCUS_04640 3693 2038 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720754.1 protein_id gnl|my_center|LOCUS_04640 3754 4362 gene locus_tag LOCUS_04650 3754 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5248 4373 gene locus_tag LOCUS_04660 5248 4373 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086786.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence0068 2859 4019 gene locus_tag LOCUS_04670 2859 4019 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707734.1 protein_id gnl|my_center|LOCUS_04670 4024 4611 gene locus_tag LOCUS_04680 4024 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4722 4955 gene locus_tag LOCUS_04690 4722 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence0069 981 319 gene locus_tag LOCUS_04700 981 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04700 2514 985 gene locus_tag LOCUS_04710 2514 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 2624 3277 gene locus_tag LOCUS_04720 gene tal 2624 3277 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7E7 protein_id gnl|my_center|LOCUS_04720 4476 3340 gene locus_tag LOCUS_04730 4476 3340 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972567.1 protein_id gnl|my_center|LOCUS_04730 <5711 4601 gene locus_tag LOCUS_04740 <5711 4601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058017.1:prenyltransferase >Feature sequence0070 1 855 gene locus_tag LOCUS_04750 1 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 857 1321 gene locus_tag LOCUS_04760 857 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2307 1339 gene locus_tag LOCUS_04770 gene dusA 2307 1339 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y788 protein_id gnl|my_center|LOCUS_04770 3357 2833 gene locus_tag LOCUS_04780 3357 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3552 4277 gene locus_tag LOCUS_04790 3552 4277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence0071 519 22 gene locus_tag LOCUS_04800 gene mucS 519 22 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139949.1 protein_id gnl|my_center|LOCUS_04800 982 668 gene locus_tag LOCUS_04810 982 668 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383983.1 protein_id gnl|my_center|LOCUS_04810 1126 2328 gene locus_tag LOCUS_04820 gene aatA 1126 2328 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720951.1 protein_id gnl|my_center|LOCUS_04820 2325 2738 gene locus_tag LOCUS_04830 2325 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4091 2754 gene locus_tag LOCUS_04840 4091 2754 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_04840 5078 4188 gene locus_tag LOCUS_04850 5078 4188 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707740.1 protein_id gnl|my_center|LOCUS_04850 5672 5112 gene locus_tag LOCUS_04860 5672 5112 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338220.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence0072 <1 792 gene locus_tag LOCUS_04870 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088041.1:5-carboxymethyl-2-hydroxymuconate isomerase 831 1628 gene locus_tag LOCUS_04880 831 1628 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088039.1 protein_id gnl|my_center|LOCUS_04880 2193 1639 gene locus_tag LOCUS_04890 2193 1639 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 protein_id gnl|my_center|LOCUS_04890 3216 2311 gene locus_tag LOCUS_04900 gene rfbA 3216 2311 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y751 protein_id gnl|my_center|LOCUS_04900 4063 3209 gene locus_tag LOCUS_04910 4063 3209 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382899.1 protein_id gnl|my_center|LOCUS_04910 5109 4060 gene locus_tag LOCUS_04920 gene rfbB 5109 4060 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5T6 protein_id gnl|my_center|LOCUS_04920 <5690 5106 gene locus_tag LOCUS_04930 <5690 5106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385393.1:dTDP-4-dehydrorhamnose 3,5-epimerase >Feature sequence0073 483 1877 gene locus_tag LOCUS_04940 gene regB 483 1877 CDS product sensor histidine kinase RegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C1 protein_id gnl|my_center|LOCUS_04940 1874 3544 gene locus_tag LOCUS_04950 1874 3544 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336803.1 protein_id gnl|my_center|LOCUS_04950 3809 4690 gene locus_tag LOCUS_04960 3809 4690 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336805.1 protein_id gnl|my_center|LOCUS_04960 4750 5343 gene locus_tag LOCUS_04970 4750 5343 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336806.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence0074 1838 663 gene locus_tag LOCUS_04980 1838 663 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841641.1 protein_id gnl|my_center|LOCUS_04980 2815 1988 gene locus_tag LOCUS_04990 2815 1988 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383374.1 protein_id gnl|my_center|LOCUS_04990 3171 4448 gene locus_tag LOCUS_05000 3171 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5013 4417 gene locus_tag LOCUS_05010 5013 4417 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338439.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence0075 334 888 gene locus_tag LOCUS_05020 gene regA 334 888 CDS product photosynthetic apparatus regulatory protein RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53228 protein_id gnl|my_center|LOCUS_05020 1839 943 gene locus_tag LOCUS_05030 1839 943 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109209.1 protein_id gnl|my_center|LOCUS_05030 1937 2143 gene locus_tag LOCUS_05040 1937 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2696 2106 gene locus_tag LOCUS_05050 2696 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722215.1 protein_id gnl|my_center|LOCUS_05050 2854 4245 gene locus_tag LOCUS_05060 gene ahcY 2854 4245 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C7 protein_id gnl|my_center|LOCUS_05060 4418 4759 gene locus_tag LOCUS_05070 4418 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538054.1 protein_id gnl|my_center|LOCUS_05070 5501 5058 gene locus_tag LOCUS_05080 5501 5058 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence0076 656 1429 gene locus_tag LOCUS_05090 656 1429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537472.1 protein_id gnl|my_center|LOCUS_05090 1753 1439 gene locus_tag LOCUS_05100 1753 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3458 1860 gene locus_tag LOCUS_05110 gene pckA 3458 1860 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V6 protein_id gnl|my_center|LOCUS_05110 3837 4538 gene locus_tag LOCUS_05120 3837 4538 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence0077 912 13 gene locus_tag LOCUS_05130 912 13 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 protein_id gnl|my_center|LOCUS_05130 1563 949 gene locus_tag LOCUS_05140 1563 949 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969792.1 protein_id gnl|my_center|LOCUS_05140 1450 2571 gene locus_tag LOCUS_05150 1450 2571 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971259.1 protein_id gnl|my_center|LOCUS_05150 3343 2603 gene locus_tag LOCUS_05160 3343 2603 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J055 protein_id gnl|my_center|LOCUS_05160 5250 3469 gene locus_tag LOCUS_05170 5250 3469 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0078 465 635 gene locus_tag LOCUS_05180 465 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1552 767 gene locus_tag LOCUS_05190 1552 767 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040746.1 protein_id gnl|my_center|LOCUS_05190 3023 1545 gene locus_tag LOCUS_05200 3023 1545 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_05200 3529 3062 gene locus_tag LOCUS_05210 3529 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4494 3526 gene locus_tag LOCUS_05220 4494 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 protein_id gnl|my_center|LOCUS_05220 <5479 4877 gene locus_tag LOCUS_05230 <5479 4877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525335.1:transcriptional regulator >Feature sequence0079 376 813 gene locus_tag LOCUS_05240 376 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05240 814 2187 gene locus_tag LOCUS_05250 814 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05250 2672 2196 gene locus_tag LOCUS_05260 2672 2196 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086192.1 protein_id gnl|my_center|LOCUS_05260 3153 2665 gene locus_tag LOCUS_05270 3153 2665 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086193.1 protein_id gnl|my_center|LOCUS_05270 3682 3185 gene locus_tag LOCUS_05280 3682 3185 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_05280 5256 3679 gene locus_tag LOCUS_05290 gene iorB 5256 3679 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence0080 359 778 gene locus_tag LOCUS_05300 gene osmC 359 778 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338337.1 protein_id gnl|my_center|LOCUS_05300 2487 880 gene locus_tag LOCUS_05310 gene prfC 2487 880 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D9 protein_id gnl|my_center|LOCUS_05310 3735 2737 gene locus_tag LOCUS_05320 3735 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4224 5003 gene locus_tag LOCUS_05330 gene fabG1 4224 5003 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337557.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0081 759 1241 gene locus_tag LOCUS_05340 759 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139947.1 protein_id gnl|my_center|LOCUS_05340 1433 1245 gene locus_tag LOCUS_05350 1433 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1621 1697 gene locus_tag LOCUS_t00040 1621 1697 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2882 2469 gene locus_tag LOCUS_05360 2882 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3280 2909 gene locus_tag LOCUS_05370 3280 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3603 3277 gene locus_tag LOCUS_05380 3603 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 3699 3956 gene locus_tag LOCUS_05390 3699 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0082 620 1168 gene locus_tag LOCUS_05400 620 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337047.1 protein_id gnl|my_center|LOCUS_05400 1684 1226 gene locus_tag LOCUS_05410 1684 1226 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563806.1 protein_id gnl|my_center|LOCUS_05410 1883 3046 gene locus_tag LOCUS_05420 gene carA 1883 3046 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5B0 protein_id gnl|my_center|LOCUS_05420 >Feature sequence0083 <1 1119 gene locus_tag LOCUS_05430 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888327.1:ABC transporter substrate-binding protein 1249 2379 gene locus_tag LOCUS_05440 1249 2379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888327.1 protein_id gnl|my_center|LOCUS_05440 2466 3344 gene locus_tag LOCUS_05450 2466 3344 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888328.1 protein_id gnl|my_center|LOCUS_05450 3341 4312 gene locus_tag LOCUS_05460 3341 4312 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888329.1 protein_id gnl|my_center|LOCUS_05460 4309 5061 gene locus_tag LOCUS_05470 4309 5061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence0084 812 2107 gene locus_tag LOCUS_05480 gene glyA 812 2107 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_05480 2188 3060 gene locus_tag LOCUS_05490 2188 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_05490 3406 3035 gene locus_tag LOCUS_05500 3406 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 3459 4238 gene locus_tag LOCUS_05510 3459 4238 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_05510 4473 4288 gene locus_tag LOCUS_05520 4473 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721006.1 protein_id gnl|my_center|LOCUS_05520 4643 4470 gene locus_tag LOCUS_05530 4643 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4642 4779 gene locus_tag LOCUS_05540 4642 4779 CDS product entericidin EcnAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719243.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence0085 1776 382 gene locus_tag LOCUS_05550 1776 382 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_05550 3051 1933 gene locus_tag LOCUS_05560 gene hemZ 3051 1933 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51008 protein_id gnl|my_center|LOCUS_05560 3355 4095 gene locus_tag LOCUS_05570 gene fnrL 3355 4095 CDS product transcriptional activator protein FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51007 protein_id gnl|my_center|LOCUS_05570 5058 4219 gene locus_tag LOCUS_05580 5058 4219 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720879.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0086 63 2144 gene locus_tag LOCUS_05590 63 2144 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067106.1 protein_id gnl|my_center|LOCUS_05590 <5285 2292 gene locus_tag LOCUS_05600 <5285 2292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338240.1:multidrug transporter AcrB >Feature sequence0087 3 257 gene locus_tag LOCUS_05610 3 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 238 1557 gene locus_tag LOCUS_05620 238 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1682 1963 gene locus_tag LOCUS_05630 1682 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3537 2020 gene locus_tag LOCUS_05640 3537 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4817 3534 gene locus_tag LOCUS_05650 gene xylR 4817 3534 CDS product xylose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338771.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence0088 424 897 gene locus_tag LOCUS_05660 424 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1755 925 gene locus_tag LOCUS_05670 1755 925 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383696.1 protein_id gnl|my_center|LOCUS_05670 1878 2399 gene locus_tag LOCUS_05680 1878 2399 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720887.1 protein_id gnl|my_center|LOCUS_05680 2604 4469 gene locus_tag LOCUS_05690 gene yejA 2604 4469 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383698.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence0089 127 792 gene locus_tag LOCUS_05700 127 792 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338562.1 protein_id gnl|my_center|LOCUS_05700 789 1679 gene locus_tag LOCUS_05710 789 1679 CDS product RhaT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721079.1 protein_id gnl|my_center|LOCUS_05710 3530 1686 gene locus_tag LOCUS_05720 3530 1686 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 protein_id gnl|my_center|LOCUS_05720 3797 4669 gene locus_tag LOCUS_05730 gene dapA 3797 4669 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 protein_id gnl|my_center|LOCUS_05730 5159 4719 gene locus_tag LOCUS_05740 5159 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence0090 2860 674 gene locus_tag LOCUS_05750 2860 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3618 2857 gene locus_tag LOCUS_05760 3618 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence0091 393 1094 gene locus_tag LOCUS_05770 393 1094 CDS product polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_05770 1091 1627 gene locus_tag LOCUS_05780 1091 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1687 2886 gene locus_tag LOCUS_05790 1687 2886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562193.1 protein_id gnl|my_center|LOCUS_05790 <5152 2892 gene locus_tag LOCUS_05800 <5152 2892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2M4:transcription-repair-coupling factor >Feature sequence0092 2705 207 gene locus_tag LOCUS_05810 2705 207 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387934.1 protein_id gnl|my_center|LOCUS_05810 3304 3140 gene locus_tag LOCUS_05820 3304 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 3427 3669 gene locus_tag LOCUS_05830 3427 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3657 4073 gene locus_tag LOCUS_05840 3657 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4039 4236 gene locus_tag LOCUS_05850 4039 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4233 4730 gene locus_tag LOCUS_05860 4233 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence0093 103 1461 gene locus_tag LOCUS_05870 gene tolB 103 1461 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J041 protein_id gnl|my_center|LOCUS_05870 1544 2104 gene locus_tag LOCUS_05880 1544 2104 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720848.1 protein_id gnl|my_center|LOCUS_05880 2133 2708 gene locus_tag LOCUS_05890 2133 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05890 2718 2966 gene locus_tag LOCUS_05900 2718 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05900 3006 4265 gene locus_tag LOCUS_05910 gene tilS 3006 4265 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 protein_id gnl|my_center|LOCUS_05910 >Feature sequence0094 25 153 gene locus_tag LOCUS_05920 25 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 269 607 gene locus_tag LOCUS_05930 269 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1161 739 gene locus_tag LOCUS_05940 gene ndk 1161 739 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 protein_id gnl|my_center|LOCUS_05940 1318 3177 gene locus_tag LOCUS_05950 1318 3177 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384433.1 protein_id gnl|my_center|LOCUS_05950 3187 3810 gene locus_tag LOCUS_05960 3187 3810 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 protein_id gnl|my_center|LOCUS_05960 3884 4462 gene locus_tag LOCUS_05970 3884 4462 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384436.1 protein_id gnl|my_center|LOCUS_05970 4934 4482 gene locus_tag LOCUS_05980 4934 4482 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337829.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0095 502 798 gene locus_tag LOCUS_05990 502 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 849 1571 gene locus_tag LOCUS_06000 849 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4540 2033 gene locus_tag LOCUS_06010 4540 2033 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384750.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence0096 <1 737 gene locus_tag LOCUS_06020 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYJ1:argininosuccinate synthase 1669 794 gene locus_tag LOCUS_06030 gene rbsK 1669 794 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI7 protein_id gnl|my_center|LOCUS_06030 3957 1693 gene locus_tag LOCUS_06040 3957 1693 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139995.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence0097 658 1527 gene locus_tag LOCUS_06050 gene ilvE1 658 1527 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721560.1 protein_id gnl|my_center|LOCUS_06050 1591 2088 gene locus_tag LOCUS_06060 1591 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3002 2085 gene locus_tag LOCUS_06070 3002 2085 CDS product transporter RarD family, DMT superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003727.1 protein_id gnl|my_center|LOCUS_06070 4082 3042 gene locus_tag LOCUS_06080 gene queG 4082 3042 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYQ7 protein_id gnl|my_center|LOCUS_06080 4787 4122 gene locus_tag LOCUS_06090 gene Gst 4787 4122 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003737.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence0098 827 567 gene locus_tag LOCUS_06100 827 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4531 833 gene locus_tag LOCUS_06110 gene nrd 4531 833 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337531.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence0099 2238 1849 gene locus_tag LOCUS_06120 gene phoB 2238 1849 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_06120 2779 2264 gene locus_tag LOCUS_06130 2779 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 protein_id gnl|my_center|LOCUS_06130 4625 2808 gene locus_tag LOCUS_06140 4625 2808 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence0100 925 179 gene locus_tag LOCUS_06150 925 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06150 1779 922 gene locus_tag LOCUS_06160 1779 922 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEH9 protein_id gnl|my_center|LOCUS_06160 3242 1779 gene locus_tag LOCUS_06170 3242 1779 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_06170 4603 3239 gene locus_tag LOCUS_06180 gene accC 4603 3239 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence0101 <1 704 gene locus_tag LOCUS_06190 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2N5:elongation factor Ts 1857 1108 gene locus_tag LOCUS_06200 1857 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2425 1961 gene locus_tag LOCUS_06210 2425 1961 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887955.1 protein_id gnl|my_center|LOCUS_06210 2506 3450 gene locus_tag LOCUS_06220 gene arcA 2506 3450 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14012 protein_id gnl|my_center|LOCUS_06220 3447 4499 gene locus_tag LOCUS_06230 gene ocd 3447 4499 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence0102 1902 697 gene locus_tag LOCUS_06240 1902 697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975858.1 protein_id gnl|my_center|LOCUS_06240 3110 1899 gene locus_tag LOCUS_06250 gene phnM 3110 1899 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 protein_id gnl|my_center|LOCUS_06250 4146 3358 gene locus_tag LOCUS_06260 gene bztD 4146 3358 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 protein_id gnl|my_center|LOCUS_06260 <4943 4162 gene locus_tag LOCUS_06270 <4943 4162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336959.1:amino acid ABC transporter permease >Feature sequence0103 813 1247 gene locus_tag LOCUS_06280 813 1247 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 protein_id gnl|my_center|LOCUS_06280 1174 1602 gene locus_tag LOCUS_06290 1174 1602 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 protein_id gnl|my_center|LOCUS_06290 3101 1599 gene locus_tag LOCUS_06300 3101 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3388 3975 gene locus_tag LOCUS_06310 gene trpG 3388 3975 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence0104 1463 159 gene locus_tag LOCUS_06320 1463 159 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565567.1 protein_id gnl|my_center|LOCUS_06320 1610 3415 gene locus_tag LOCUS_06330 1610 3415 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338192.1 protein_id gnl|my_center|LOCUS_06330 3591 4040 gene locus_tag LOCUS_06340 3591 4040 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720545.1 protein_id gnl|my_center|LOCUS_06340 4307 4870 gene locus_tag LOCUS_06350 4307 4870 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720544.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence0105 1341 826 gene locus_tag LOCUS_06360 gene rimM 1341 826 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 protein_id gnl|my_center|LOCUS_06360 2015 1371 gene locus_tag LOCUS_06370 2015 1371 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG5 protein_id gnl|my_center|LOCUS_06370 2601 2215 gene locus_tag LOCUS_06380 gene rpsP 2601 2215 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ02 protein_id gnl|my_center|LOCUS_06380 2965 2651 gene locus_tag LOCUS_06390 gene pheAa 2965 2651 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721398.1 protein_id gnl|my_center|LOCUS_06390 3504 2962 gene locus_tag LOCUS_06400 3504 2962 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338682.1 protein_id gnl|my_center|LOCUS_06400 <4908 3507 gene locus_tag LOCUS_06410 <4908 3507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYZ7:signal recognition particle protein >Feature sequence0106 1421 75 gene locus_tag LOCUS_06420 gene pmbA 1421 75 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338589.1 protein_id gnl|my_center|LOCUS_06420 3073 1541 gene locus_tag LOCUS_06430 3073 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721144.1 protein_id gnl|my_center|LOCUS_06430 3186 3941 gene locus_tag LOCUS_06440 3186 3941 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_06440 3938 4552 gene locus_tag LOCUS_06450 gene crt 3938 4552 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721140.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence0107 2480 870 gene locus_tag LOCUS_06460 2480 870 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337315.1 protein_id gnl|my_center|LOCUS_06460 3483 2494 gene locus_tag LOCUS_06470 3483 2494 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719369.1 protein_id gnl|my_center|LOCUS_06470 4112 3690 gene locus_tag LOCUS_06480 gene rimI 4112 3690 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 protein_id gnl|my_center|LOCUS_06480 4685 4122 gene locus_tag LOCUS_06490 4685 4122 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence0108 1400 1137 gene locus_tag LOCUS_06500 1400 1137 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_06500 2511 1777 gene locus_tag LOCUS_06510 gene fliP1 2511 1777 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY94 protein_id gnl|my_center|LOCUS_06510 2795 2517 gene locus_tag LOCUS_06520 2795 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563345.1 protein_id gnl|my_center|LOCUS_06520 3423 2788 gene locus_tag LOCUS_06530 gene fliH1 3423 2788 CDS product flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338868.1 protein_id gnl|my_center|LOCUS_06530 <4853 3423 gene locus_tag LOCUS_06540 <4853 3423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY91:flagellar M-ring protein >Feature sequence0109 1319 561 gene locus_tag LOCUS_06550 gene modA 1319 561 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836199.1 protein_id gnl|my_center|LOCUS_06550 1726 1382 gene locus_tag LOCUS_06560 gene modE 1726 1382 CDS product molybdenum-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385097.1 protein_id gnl|my_center|LOCUS_06560 3766 1913 gene locus_tag LOCUS_06570 3766 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4767 3766 gene locus_tag LOCUS_06580 gene apbE 4767 3766 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKH5 protein_id gnl|my_center|LOCUS_06580 >Feature sequence0110 986 15 gene locus_tag LOCUS_06590 986 15 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337094.1 protein_id gnl|my_center|LOCUS_06590 1981 983 gene locus_tag LOCUS_06600 1981 983 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_06600 4529 2445 gene locus_tag LOCUS_06610 4529 2445 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence0111 1586 825 gene locus_tag LOCUS_06620 1586 825 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703348.1 protein_id gnl|my_center|LOCUS_06620 2080 1586 gene locus_tag LOCUS_06630 2080 1586 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206909.1 protein_id gnl|my_center|LOCUS_06630 3354 2080 gene locus_tag LOCUS_06640 3354 2080 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 protein_id gnl|my_center|LOCUS_06640 3772 3410 gene locus_tag LOCUS_06650 3772 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 <4825 3819 gene locus_tag LOCUS_06660 <4825 3819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084859.1:acyl-CoA dehydrogenase >Feature sequence0112 2249 450 gene locus_tag LOCUS_06670 gene ftsI 2249 450 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719253.1 protein_id gnl|my_center|LOCUS_06670 2602 2246 gene locus_tag LOCUS_06680 2602 2246 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719252.1 protein_id gnl|my_center|LOCUS_06680 3626 2616 gene locus_tag LOCUS_06690 gene rsmH 3626 2616 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N3 protein_id gnl|my_center|LOCUS_06690 4128 3628 gene locus_tag LOCUS_06700 gene mraZ 4128 3628 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y991 protein_id gnl|my_center|LOCUS_06700 >Feature sequence0113 408 647 gene locus_tag LOCUS_06710 408 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722317.1 protein_id gnl|my_center|LOCUS_06710 873 1355 gene locus_tag LOCUS_06720 873 1355 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338517.1 protein_id gnl|my_center|LOCUS_06720 3144 1432 gene locus_tag LOCUS_06730 gene sopT 3144 1432 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_06730 4393 3449 gene locus_tag LOCUS_06740 gene trxB 4393 3449 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAD8 protein_id gnl|my_center|LOCUS_06740 >Feature sequence0114 515 177 gene locus_tag LOCUS_06750 gene glnK 515 177 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721100.1 protein_id gnl|my_center|LOCUS_06750 950 2971 gene locus_tag LOCUS_06760 gene MrcB 950 2971 CDS product glycosyl transferase family 51 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003713.1 protein_id gnl|my_center|LOCUS_06760 3631 3035 gene locus_tag LOCUS_06770 3631 3035 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561627.1 protein_id gnl|my_center|LOCUS_06770 4409 3624 gene locus_tag LOCUS_06780 gene vacJ 4409 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338569.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence0115 <1 1731 gene locus_tag LOCUS_06790 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0E2:isoleucine--tRNA ligase 2088 1855 gene locus_tag LOCUS_06800 2088 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3113 2175 gene locus_tag LOCUS_06810 gene xerC 3113 2175 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 protein_id gnl|my_center|LOCUS_06810 3832 3110 gene locus_tag LOCUS_06820 3832 3110 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338318.1 protein_id gnl|my_center|LOCUS_06820 4735 3944 gene locus_tag LOCUS_06830 4735 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence0116 221 502 gene locus_tag LOCUS_06840 221 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 499 1533 gene locus_tag LOCUS_06850 499 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1530 1841 gene locus_tag LOCUS_06860 1530 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1834 2106 gene locus_tag LOCUS_06870 1834 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2227 2928 gene locus_tag LOCUS_06880 2227 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3616 2936 gene locus_tag LOCUS_06890 3616 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3693 4016 gene locus_tag LOCUS_06900 3693 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4112 4038 gene locus_tag LOCUS_t00050 4112 4038 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4404 4562 gene locus_tag LOCUS_06910 4404 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence0117 189 1289 gene locus_tag LOCUS_06920 189 1289 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_06920 2529 1390 gene locus_tag LOCUS_06930 2529 1390 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336763.1 protein_id gnl|my_center|LOCUS_06930 3615 2533 gene locus_tag LOCUS_06940 gene mutY 3615 2533 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538060.1 protein_id gnl|my_center|LOCUS_06940 3718 4254 gene locus_tag LOCUS_06950 3718 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0118 <1 896 gene locus_tag LOCUS_06960 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086110.1:hydantoin utilization protein 900 1298 gene locus_tag LOCUS_06970 900 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1415 3571 gene locus_tag LOCUS_06980 gene hyuA 1415 3571 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975280.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence0119 329 568 gene locus_tag LOCUS_06990 329 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339468.1 protein_id gnl|my_center|LOCUS_06990 759 1175 gene locus_tag LOCUS_07000 759 1175 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 protein_id gnl|my_center|LOCUS_07000 3356 2064 gene locus_tag LOCUS_07010 gene pncB 3356 2064 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY37 protein_id gnl|my_center|LOCUS_07010 3492 4049 gene locus_tag LOCUS_07020 3492 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 <4682 4050 gene locus_tag LOCUS_07030 <4682 4050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937588.1:sodium-independent anion transporter >Feature sequence0120 1587 634 gene locus_tag LOCUS_07040 gene corA 1587 634 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337604.1 protein_id gnl|my_center|LOCUS_07040 2404 1592 gene locus_tag LOCUS_07050 2404 1592 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_07050 3267 2401 gene locus_tag LOCUS_07060 3267 2401 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UHA7 protein_id gnl|my_center|LOCUS_07060 3577 3260 gene locus_tag LOCUS_07070 3577 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 <4668 3574 gene locus_tag LOCUS_07080 <4668 3574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104083.1:carbon-phosphorus lyase complex subunit PhnI >Feature sequence0121 1505 780 gene locus_tag LOCUS_07090 1505 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1828 1505 gene locus_tag LOCUS_07100 1828 1505 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 protein_id gnl|my_center|LOCUS_07100 2104 2631 gene locus_tag LOCUS_07110 2104 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4184 2733 gene locus_tag LOCUS_07120 4184 2733 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0122 488 1252 gene locus_tag LOCUS_07130 gene map2 488 1252 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y582 protein_id gnl|my_center|LOCUS_07130 1448 2236 gene locus_tag LOCUS_07140 1448 2236 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_07140 2264 2392 gene locus_tag LOCUS_07150 2264 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2496 3368 gene locus_tag LOCUS_07160 gene mtnP 2496 3368 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 protein_id gnl|my_center|LOCUS_07160 3372 3998 gene locus_tag LOCUS_07170 3372 3998 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708648.1 protein_id gnl|my_center|LOCUS_07170 4014 4556 gene locus_tag LOCUS_07180 gene apt 4014 4556 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E9 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0123 288 1208 gene locus_tag LOCUS_07190 288 1208 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 protein_id gnl|my_center|LOCUS_07190 1618 3129 gene locus_tag LOCUS_07200 1618 3129 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence0124 <1 1452 gene locus_tag LOCUS_07210 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5D7:pyruvate kinase 1518 1880 gene locus_tag LOCUS_07220 1518 1880 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384190.1 protein_id gnl|my_center|LOCUS_07220 2230 3084 gene locus_tag LOCUS_07230 2230 3084 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974515.1 protein_id gnl|my_center|LOCUS_07230 3519 3770 gene locus_tag LOCUS_07240 3519 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3763 4479 gene locus_tag LOCUS_07250 3763 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence0125 123 893 gene locus_tag LOCUS_07260 123 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2146 1253 gene locus_tag LOCUS_07270 2146 1253 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974581.1 protein_id gnl|my_center|LOCUS_07270 2332 3348 gene locus_tag LOCUS_07280 2332 3348 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974582.1 protein_id gnl|my_center|LOCUS_07280 3345 4025 gene locus_tag LOCUS_07290 gene menG 3345 4025 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085070.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence0126 1418 513 gene locus_tag LOCUS_07300 gene cobD 1418 513 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P50 protein_id gnl|my_center|LOCUS_07300 2350 1415 gene locus_tag LOCUS_07310 gene cobC 2350 1415 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338490.1 protein_id gnl|my_center|LOCUS_07310 2742 2347 gene locus_tag LOCUS_07320 2742 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2927 3292 gene locus_tag LOCUS_07330 gene osp 2927 3292 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721067.1 protein_id gnl|my_center|LOCUS_07330 4288 3314 gene locus_tag LOCUS_07340 4288 3314 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336857.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence0127 1445 2149 gene locus_tag LOCUS_07350 1445 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2239 3315 gene locus_tag LOCUS_07360 2239 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence0128 <1 1389 gene locus_tag LOCUS_07370 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383091.1:ABC transporter 1386 2471 gene locus_tag LOCUS_07380 1386 2471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339412.1 protein_id gnl|my_center|LOCUS_07380 2471 3400 gene locus_tag LOCUS_07390 2471 3400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564218.1 protein_id gnl|my_center|LOCUS_07390 3455 4537 gene locus_tag LOCUS_07400 3455 4537 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339413.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence0129 209 1300 gene locus_tag LOCUS_07410 209 1300 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338896.1 protein_id gnl|my_center|LOCUS_07410 2333 1302 gene locus_tag LOCUS_07420 2333 1302 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_07420 3690 2416 gene locus_tag LOCUS_07430 gene folC 3690 2416 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_07430 <4546 3687 gene locus_tag LOCUS_07440 <4546 3687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZC3:acetyl-coenzyme A carboxylase carboxyl transferase subunit beta >Feature sequence0130 973 80 gene locus_tag LOCUS_07450 gene serB 973 80 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385585.1 protein_id gnl|my_center|LOCUS_07450 1186 2328 gene locus_tag LOCUS_07460 gene serC 1186 2328 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338898.1 protein_id gnl|my_center|LOCUS_07460 2403 3995 gene locus_tag LOCUS_07470 2403 3995 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY52 protein_id gnl|my_center|LOCUS_07470 >Feature sequence0131 1610 1068 gene locus_tag LOCUS_07480 1610 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2379 1729 gene locus_tag LOCUS_07490 gene lipB 2379 1729 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A6 protein_id gnl|my_center|LOCUS_07490 2643 3989 gene locus_tag LOCUS_07500 2643 3989 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337050.1 protein_id gnl|my_center|LOCUS_07500 4264 4350 gene locus_tag LOCUS_t00060 4264 4350 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0132 1737 1135 gene locus_tag LOCUS_07510 1737 1135 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 protein_id gnl|my_center|LOCUS_07510 2722 1721 gene locus_tag LOCUS_07520 gene hslO 2722 1721 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ5 protein_id gnl|my_center|LOCUS_07520 2801 3232 gene locus_tag LOCUS_07530 2801 3232 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338790.1 protein_id gnl|my_center|LOCUS_07530 <4504 3222 gene locus_tag LOCUS_07540 <4504 3222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139992.1:fused response regulator/phosphatase >Feature sequence0133 1418 981 gene locus_tag LOCUS_07550 1418 981 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337528.1 protein_id gnl|my_center|LOCUS_07550 2051 1431 gene locus_tag LOCUS_07560 2051 1431 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_07560 2845 2084 gene locus_tag LOCUS_07570 2845 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268013.1 protein_id gnl|my_center|LOCUS_07570 4205 2928 gene locus_tag LOCUS_07580 gene eno 4205 2928 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3H9 protein_id gnl|my_center|LOCUS_07580 >Feature sequence0134 858 286 gene locus_tag LOCUS_07590 gene atpF1 858 286 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ15 protein_id gnl|my_center|LOCUS_07590 1393 863 gene locus_tag LOCUS_07600 gene atpF2 1393 863 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ14 protein_id gnl|my_center|LOCUS_07600 1743 1507 gene locus_tag LOCUS_07610 1743 1507 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382938.1 protein_id gnl|my_center|LOCUS_07610 2563 1802 gene locus_tag LOCUS_07620 gene atpB 2563 1802 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7H8 protein_id gnl|my_center|LOCUS_07620 2916 2560 gene locus_tag LOCUS_07630 gene atpI 2916 2560 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ11 protein_id gnl|my_center|LOCUS_07630 3148 3474 gene locus_tag LOCUS_07640 3148 3474 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563086.1 protein_id gnl|my_center|LOCUS_07640 3689 3480 gene locus_tag LOCUS_07650 3689 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence0135 610 167 gene locus_tag LOCUS_07660 610 167 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_07660 1716 841 gene locus_tag LOCUS_07670 1716 841 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537548.1 protein_id gnl|my_center|LOCUS_07670 2292 1813 gene locus_tag LOCUS_07680 2292 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3275 2355 gene locus_tag LOCUS_07690 3275 2355 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564755.1 protein_id gnl|my_center|LOCUS_07690 4298 3399 gene locus_tag LOCUS_07700 4298 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence0136 1820 294 gene locus_tag LOCUS_07710 gene gpmI 1820 294 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAA5 protein_id gnl|my_center|LOCUS_07710 2394 1924 gene locus_tag LOCUS_07720 gene rlmH 2394 1924 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 protein_id gnl|my_center|LOCUS_07720 2783 2394 gene locus_tag LOCUS_07730 2783 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4252 2936 gene locus_tag LOCUS_07740 4252 2936 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061372.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence0137 1398 661 gene locus_tag LOCUS_07750 1398 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2879 1431 gene locus_tag LOCUS_07760 gene trkH3 2879 1431 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D1 protein_id gnl|my_center|LOCUS_07760 4065 2947 gene locus_tag LOCUS_07770 gene folE2 4065 2947 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D3 protein_id gnl|my_center|LOCUS_07770 >Feature sequence0138 187 699 gene locus_tag LOCUS_07780 187 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_07780 709 2034 gene locus_tag LOCUS_07790 709 2034 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_07790 2662 2096 gene locus_tag LOCUS_07800 2662 2096 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 protein_id gnl|my_center|LOCUS_07800 2914 4074 gene locus_tag LOCUS_07810 gene gatA 2914 4074 CDS product Glu-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence0139 1303 3030 gene locus_tag LOCUS_07820 1303 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338203.1 protein_id gnl|my_center|LOCUS_07820 3027 3572 gene locus_tag LOCUS_07830 3027 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338204.1 protein_id gnl|my_center|LOCUS_07830 3584 4240 gene locus_tag LOCUS_07840 3584 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence0140 <1 853 gene locus_tag LOCUS_07850 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337304.1:3-hydroxyacyl-CoA dehydrogenase 1759 1061 gene locus_tag LOCUS_07860 1759 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2784 2119 gene locus_tag LOCUS_07870 2784 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_07870 2957 3976 gene locus_tag LOCUS_07880 2957 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336868.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence0141 2159 687 gene locus_tag LOCUS_07890 gene pstC 2159 687 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J374 protein_id gnl|my_center|LOCUS_07890 3351 2290 gene locus_tag LOCUS_07900 gene pstS 3351 2290 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383001.1 protein_id gnl|my_center|LOCUS_07900 4342 3557 gene locus_tag LOCUS_07910 4342 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence0142 961 248 gene locus_tag LOCUS_07920 gene modB 961 248 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385099.1 protein_id gnl|my_center|LOCUS_07920 1444 2022 gene locus_tag LOCUS_07930 1444 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3469 2042 gene locus_tag LOCUS_07940 3469 2042 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972148.1 protein_id gnl|my_center|LOCUS_07940 3749 3432 gene locus_tag LOCUS_07950 3749 3432 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_07950 <4342 3753 gene locus_tag LOCUS_07960 <4342 3753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972150.1:dolichol-phosphate mannosyltransferase >Feature sequence0143 58 756 gene locus_tag LOCUS_07970 gene cobB 58 756 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX94 protein_id gnl|my_center|LOCUS_07970 1408 791 gene locus_tag LOCUS_07980 1408 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1979 1476 gene locus_tag LOCUS_07990 1979 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337160.1 protein_id gnl|my_center|LOCUS_07990 2426 2019 gene locus_tag LOCUS_08000 2426 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3737 2481 gene locus_tag LOCUS_08010 3737 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_08010 4190 3903 gene locus_tag LOCUS_08020 gene rpmB 4190 3903 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4W8 protein_id gnl|my_center|LOCUS_08020 >Feature sequence0144 3431 1707 gene locus_tag LOCUS_08030 3431 1707 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337642.1 protein_id gnl|my_center|LOCUS_08030 3908 3507 gene locus_tag LOCUS_08040 3908 3507 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067120.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence0145 276 1352 gene locus_tag LOCUS_08050 276 1352 CDS product tricarballylate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704751.1 protein_id gnl|my_center|LOCUS_08050 2289 1393 gene locus_tag LOCUS_08060 2289 1393 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_08060 2378 3559 gene locus_tag LOCUS_08070 2378 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence0146 726 1619 gene locus_tag LOCUS_08080 726 1619 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085124.1 protein_id gnl|my_center|LOCUS_08080 3172 1616 gene locus_tag LOCUS_08090 3172 1616 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114060.1 protein_id gnl|my_center|LOCUS_08090 4044 3169 gene locus_tag LOCUS_08100 4044 3169 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence0147 1017 1451 gene locus_tag LOCUS_08110 1017 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4132 1514 gene locus_tag LOCUS_08120 gene clpB 4132 1514 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXZ7 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0148 <1 500 gene locus_tag LOCUS_08130 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338925.1:NAD(P)-dependent oxidoreductase 1687 494 gene locus_tag LOCUS_08140 1687 494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538115.1 protein_id gnl|my_center|LOCUS_08140 3732 1804 gene locus_tag LOCUS_08150 gene dxs2 3732 1804 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR6 protein_id gnl|my_center|LOCUS_08150 <4294 3747 gene locus_tag LOCUS_08160 <4294 3747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338741.1:farnesyl-diphosphate synthase >Feature sequence0149 3405 4079 gene locus_tag LOCUS_08170 3405 4079 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723748.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence0150 303 485 gene locus_tag LOCUS_08180 303 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08180 562 1005 gene locus_tag LOCUS_08190 562 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1123 2436 gene locus_tag LOCUS_08200 gene hisD1 1123 2436 CDS product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J079 protein_id gnl|my_center|LOCUS_08200 2429 2905 gene locus_tag LOCUS_08210 2429 2905 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J080 protein_id gnl|my_center|LOCUS_08210 2989 3369 gene locus_tag LOCUS_08220 2989 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 3382 3795 gene locus_tag LOCUS_08230 3382 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338370.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence0151 304 74 gene locus_tag LOCUS_08240 304 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1077 433 gene locus_tag LOCUS_08250 1077 433 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67024 protein_id gnl|my_center|LOCUS_08250 1182 2057 gene locus_tag LOCUS_08260 1182 2057 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_08260 3986 3240 gene locus_tag LOCUS_08270 3986 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence0152 498 2069 gene locus_tag LOCUS_08280 498 2069 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003739.1 protein_id gnl|my_center|LOCUS_08280 2838 2071 gene locus_tag LOCUS_08290 gene radC 2838 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_08290 4083 2926 gene locus_tag LOCUS_08300 gene dnaJ 4083 2926 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM8 protein_id gnl|my_center|LOCUS_08300 >Feature sequence0153 <1 773 gene locus_tag LOCUS_08310 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338772.1:outer membrane protein assembly factor 770 4093 gene locus_tag LOCUS_08320 770 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence0154 1702 794 gene locus_tag LOCUS_08330 gene rpoH1 1702 794 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3R3 protein_id gnl|my_center|LOCUS_08330 2907 1954 gene locus_tag LOCUS_08340 2907 1954 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_08340 2961 3617 gene locus_tag LOCUS_08350 2961 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 <4262 3608 gene locus_tag LOCUS_08360 <4262 3608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3R4:pseudouridine synthase >Feature sequence0155 2445 2020 gene locus_tag LOCUS_08370 2445 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3797 2886 gene locus_tag LOCUS_08380 3797 2886 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974533.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence0156 3981 538 gene locus_tag LOCUS_08390 3981 538 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence0157 231 710 gene locus_tag LOCUS_08400 231 710 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143296.1 protein_id gnl|my_center|LOCUS_08400 713 1633 gene locus_tag LOCUS_08410 713 1633 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704087.1 protein_id gnl|my_center|LOCUS_08410 1706 2257 gene locus_tag LOCUS_08420 1706 2257 CDS product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531899.1 protein_id gnl|my_center|LOCUS_08420 2341 2754 gene locus_tag LOCUS_08430 2341 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4185 2839 gene locus_tag LOCUS_08440 gene glmM 4185 2839 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C2 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0158 1141 1848 gene locus_tag LOCUS_08450 1141 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2161 1964 gene locus_tag LOCUS_08460 2161 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2519 3709 gene locus_tag LOCUS_08470 2519 3709 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence0159 1821 2699 gene locus_tag LOCUS_08480 1821 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3429 2725 gene locus_tag LOCUS_08490 3429 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3712 3440 gene locus_tag LOCUS_08500 3712 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720309.1 protein_id gnl|my_center|LOCUS_08500 3892 4107 gene locus_tag LOCUS_08510 3892 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720310.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0160 430 1227 gene locus_tag LOCUS_08520 gene pstB 430 1227 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J376 protein_id gnl|my_center|LOCUS_08520 1239 1964 gene locus_tag LOCUS_08530 gene phoU 1239 1964 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J377 protein_id gnl|my_center|LOCUS_08530 1964 2653 gene locus_tag LOCUS_08540 gene phoR1 1964 2653 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719748.1 protein_id gnl|my_center|LOCUS_08540 2886 3554 gene locus_tag LOCUS_08550 2886 3554 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385058.1 protein_id gnl|my_center|LOCUS_08550 4112 3579 gene locus_tag LOCUS_08560 4112 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence0161 1040 1969 gene locus_tag LOCUS_08570 gene phnJ 1040 1969 CDS product carbon-phosphorus lyase complex subunit PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_08570 1966 2763 gene locus_tag LOCUS_08580 gene phnK 1966 2763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_08580 2760 3479 gene locus_tag LOCUS_08590 gene phnL 2760 3479 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892101.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence0162 1161 1514 gene locus_tag LOCUS_08600 1161 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1572 2162 gene locus_tag LOCUS_08610 1572 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2213 2929 gene locus_tag LOCUS_08620 2213 2929 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920292.1 protein_id gnl|my_center|LOCUS_08620 2931 4043 gene locus_tag LOCUS_08630 2931 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531323.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence0163 652 32 gene locus_tag LOCUS_08640 652 32 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337928.1 protein_id gnl|my_center|LOCUS_08640 1550 663 gene locus_tag LOCUS_08650 1550 663 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337927.1 protein_id gnl|my_center|LOCUS_08650 2573 1623 gene locus_tag LOCUS_08660 2573 1623 CDS product hydrolase or acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003662.1 protein_id gnl|my_center|LOCUS_08660 3489 2566 gene locus_tag LOCUS_08670 gene metA 3489 2566 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J205 protein_id gnl|my_center|LOCUS_08670 >Feature sequence0164 2222 1716 gene locus_tag LOCUS_08680 2222 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2428 3099 gene locus_tag LOCUS_08690 gene flcA 2428 3099 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345344.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence0165 1175 1354 gene locus_tag LOCUS_08700 1175 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1508 2125 gene locus_tag LOCUS_08710 1508 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2182 3387 gene locus_tag LOCUS_08720 2182 3387 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383032.1 protein_id gnl|my_center|LOCUS_08720 3410 3949 gene locus_tag LOCUS_08730 3410 3949 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0166 2935 884 gene locus_tag LOCUS_08740 2935 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3600 3292 gene locus_tag LOCUS_08750 3600 3292 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719280.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence0167 248 577 gene locus_tag LOCUS_08760 248 577 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 protein_id gnl|my_center|LOCUS_08760 603 1829 gene locus_tag LOCUS_08770 603 1829 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228660.1 protein_id gnl|my_center|LOCUS_08770 1822 2487 gene locus_tag LOCUS_08780 1822 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2867 2484 gene locus_tag LOCUS_08790 2867 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence0168 65 694 gene locus_tag LOCUS_08800 65 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338872.1 protein_id gnl|my_center|LOCUS_08800 772 1641 gene locus_tag LOCUS_08810 gene motA1 772 1641 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_08810 1638 4061 gene locus_tag LOCUS_08820 1638 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence0169 153 875 gene locus_tag LOCUS_08830 gene hisA 153 875 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y412 protein_id gnl|my_center|LOCUS_08830 922 1407 gene locus_tag LOCUS_08840 922 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083642.1 protein_id gnl|my_center|LOCUS_08840 1587 2384 gene locus_tag LOCUS_08850 gene hisF 1587 2384 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50937 protein_id gnl|my_center|LOCUS_08850 2395 2709 gene locus_tag LOCUS_08860 gene hisE 2395 2709 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y414 protein_id gnl|my_center|LOCUS_08860 2727 3236 gene locus_tag LOCUS_08870 2727 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3723 3247 gene locus_tag LOCUS_08880 3723 3247 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337340.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence0170 <1 1099 gene locus_tag LOCUS_08890 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973413.1:nitrate reductase 1106 2059 gene locus_tag LOCUS_08900 1106 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_08900 2186 2479 gene locus_tag LOCUS_08910 2186 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2534 2944 gene locus_tag LOCUS_08920 2534 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3777 2965 gene locus_tag LOCUS_08930 3777 2965 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0171 64 1470 gene locus_tag LOCUS_08940 64 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1995 1483 gene locus_tag LOCUS_08950 1995 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721508.1 protein_id gnl|my_center|LOCUS_08950 2943 2035 gene locus_tag LOCUS_08960 gene truB 2943 2035 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU1 protein_id gnl|my_center|LOCUS_08960 3380 2943 gene locus_tag LOCUS_08970 gene rbfA 3380 2943 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU3 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0172 <1 861 gene locus_tag LOCUS_08980 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975337.1:peptide ABC transporter permease 870 2741 gene locus_tag LOCUS_08990 870 2741 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_08990 2738 3703 gene locus_tag LOCUS_09000 2738 3703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969280.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0173 <1 794 gene locus_tag LOCUS_09010 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337550.1:NADH-quinone oxidoreductase subunit F 800 1180 gene locus_tag LOCUS_09020 800 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1188 1685 gene locus_tag LOCUS_09030 1188 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 protein_id gnl|my_center|LOCUS_09030 1690 2112 gene locus_tag LOCUS_09040 1690 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2109 2522 gene locus_tag LOCUS_09050 2109 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence0174 2957 900 gene locus_tag LOCUS_09060 2957 900 CDS product TonB-dependent heme/hemoglobin receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530812.1 protein_id gnl|my_center|LOCUS_09060 3943 3107 gene locus_tag LOCUS_09070 3943 3107 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066558.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence0175 2366 1044 gene locus_tag LOCUS_09080 gene gltX2 2366 1044 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZQ8 protein_id gnl|my_center|LOCUS_09080 2464 2892 gene locus_tag LOCUS_09090 2464 2892 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338497.1 protein_id gnl|my_center|LOCUS_09090 3000 3929 gene locus_tag LOCUS_09100 3000 3929 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338498.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence0176 81 1304 gene locus_tag LOCUS_09110 81 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1963 1388 gene locus_tag LOCUS_09120 1963 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2892 2131 gene locus_tag LOCUS_09130 2892 2131 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FX0 protein_id gnl|my_center|LOCUS_09130 3815 2889 gene locus_tag LOCUS_09140 3815 2889 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975756.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence0177 <1 589 gene locus_tag LOCUS_09150 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227679.1:short-chain dehydrogenase/reductase 1300 863 gene locus_tag LOCUS_09160 1300 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2382 1366 gene locus_tag LOCUS_09170 2382 1366 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974578.1 protein_id gnl|my_center|LOCUS_09170 2480 3397 gene locus_tag LOCUS_09180 2480 3397 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974579.1 protein_id gnl|my_center|LOCUS_09180 3837 3547 gene locus_tag LOCUS_09190 3837 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0178 1444 278 gene locus_tag LOCUS_09200 gene argD 1444 278 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4X6 protein_id gnl|my_center|LOCUS_09200 2526 1699 gene locus_tag LOCUS_09210 2526 1699 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ34 protein_id gnl|my_center|LOCUS_09210 3401 2589 gene locus_tag LOCUS_09220 3401 2589 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence0179 632 237 gene locus_tag LOCUS_09230 632 237 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H3 protein_id gnl|my_center|LOCUS_09230 1511 642 gene locus_tag LOCUS_09240 gene rsmI 1511 642 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H4 protein_id gnl|my_center|LOCUS_09240 1624 2802 gene locus_tag LOCUS_09250 1624 2802 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence0180 <1 869 gene locus_tag LOCUS_09260 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ85:succinate--CoA ligase [ADP-forming] subunit alpha >Feature sequence0181 2223 868 gene locus_tag LOCUS_09270 gene dnaA 2223 868 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY61 protein_id gnl|my_center|LOCUS_09270 <3924 3080 gene locus_tag LOCUS_09280 <3924 3080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E9D7:acetolactate synthase >Feature sequence0182 989 591 gene locus_tag LOCUS_09290 989 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1694 1029 gene locus_tag LOCUS_09300 1694 1029 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_09300 1782 2633 gene locus_tag LOCUS_09310 1782 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_09310 >Feature sequence0183 753 1310 gene locus_tag LOCUS_09320 753 1310 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973854.1 protein_id gnl|my_center|LOCUS_09320 1389 1787 gene locus_tag LOCUS_09330 1389 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2389 1784 gene locus_tag LOCUS_09340 2389 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence0184 752 456 gene locus_tag LOCUS_09350 752 456 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 protein_id gnl|my_center|LOCUS_09350 1001 810 gene locus_tag LOCUS_09360 1001 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1829 1290 gene locus_tag LOCUS_09370 1829 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038468.1 protein_id gnl|my_center|LOCUS_09370 2773 1835 gene locus_tag LOCUS_09380 2773 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence0185 1087 806 gene locus_tag LOCUS_09390 1087 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1372 1704 gene locus_tag LOCUS_09400 1372 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1755 2045 gene locus_tag LOCUS_09410 1755 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2925 3530 gene locus_tag LOCUS_09420 2925 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0186 828 34 gene locus_tag LOCUS_09430 gene mhpR 828 34 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026422.1 protein_id gnl|my_center|LOCUS_09430 982 1917 gene locus_tag LOCUS_09440 gene mhpB 982 1917 CDS product 2,3-dihydroxyphenylpropionate/2,3-dihydroxicinnamic acid 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y3B9 protein_id gnl|my_center|LOCUS_09440 2031 2897 gene locus_tag LOCUS_09450 2031 2897 CDS product 2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 protein_id gnl|my_center|LOCUS_09450 2890 3663 gene locus_tag LOCUS_09460 gene mhpD 2890 3663 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y325 protein_id gnl|my_center|LOCUS_09460 >Feature sequence0187 1498 3462 gene locus_tag LOCUS_09470 1498 3462 CDS product two-component system sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268382.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence0188 <1 1251 gene locus_tag LOCUS_09480 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528020.1:gamma-aminobutyraldehyde dehydrogenase 1815 1396 gene locus_tag LOCUS_09490 1815 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112559.1 protein_id gnl|my_center|LOCUS_09490 3060 1885 gene locus_tag LOCUS_09500 3060 1885 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338901.1 protein_id gnl|my_center|LOCUS_09500 3830 3117 gene locus_tag LOCUS_09510 3830 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0189 1382 351 gene locus_tag LOCUS_09520 1382 351 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_09520 2908 1556 gene locus_tag LOCUS_09530 2908 1556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085050.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence0190 <1 797 gene locus_tag LOCUS_09540 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563217.1:D-xylose ABC transporter substrate-binding protein 996 2324 gene locus_tag LOCUS_09550 gene xylH 996 2324 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338770.1 protein_id gnl|my_center|LOCUS_09550 2337 3128 gene locus_tag LOCUS_09560 2337 3128 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338769.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0191 332 1690 gene locus_tag LOCUS_09570 gene secY 332 1690 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q2 protein_id gnl|my_center|LOCUS_09570 1687 2328 gene locus_tag LOCUS_09580 gene adk 1687 2328 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q1 protein_id gnl|my_center|LOCUS_09580 2554 2922 gene locus_tag LOCUS_09590 gene rpsM 2554 2922 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5B5 protein_id gnl|my_center|LOCUS_09590 2938 3330 gene locus_tag LOCUS_09600 gene rpsK 2938 3330 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5B4 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0192 943 563 gene locus_tag LOCUS_09610 943 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2306 1122 gene locus_tag LOCUS_09620 gene tyrB 2306 1122 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383317.1 protein_id gnl|my_center|LOCUS_09620 3160 2306 gene locus_tag LOCUS_09630 gene SseA 3160 2306 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_09630 3798 3316 gene locus_tag LOCUS_09640 gene smpB 3798 3316 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7U0 protein_id gnl|my_center|LOCUS_09640 >Feature sequence0193 1348 1806 gene locus_tag LOCUS_09650 1348 1806 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 protein_id gnl|my_center|LOCUS_09650 2800 1883 gene locus_tag LOCUS_09660 2800 1883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967733.1 protein_id gnl|my_center|LOCUS_09660 <3854 2831 gene locus_tag LOCUS_09670 <3854 2831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390620.1:saccharopine dehydrogenase >Feature sequence0194 <1 779 gene locus_tag LOCUS_09680 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337015.1:threonine synthase 776 2035 gene locus_tag LOCUS_09690 776 2035 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 protein_id gnl|my_center|LOCUS_09690 2080 2625 gene locus_tag LOCUS_09700 2080 2625 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722709.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence0195 599 769 gene locus_tag LOCUS_09710 599 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 776 2389 gene locus_tag LOCUS_09720 776 2389 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086186.1 protein_id gnl|my_center|LOCUS_09720 2389 3564 gene locus_tag LOCUS_09730 2389 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence0196 <1 1535 gene locus_tag LOCUS_09740 <1 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5U0:DNA topoisomerase 4 subunit A 1680 2927 gene locus_tag LOCUS_09750 1680 2927 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089976.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0197 2549 498 gene locus_tag LOCUS_09760 2549 498 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100979.1 protein_id gnl|my_center|LOCUS_09760 3232 2564 gene locus_tag LOCUS_09770 3232 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 <3812 3229 gene locus_tag LOCUS_09780 <3812 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000401853.1:helicase >Feature sequence0198 2849 873 gene locus_tag LOCUS_09790 gene cpdB 2849 873 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969356.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence0199 2 430 gene locus_tag LOCUS_09800 2 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 509 1030 gene locus_tag LOCUS_09810 509 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1030 2508 gene locus_tag LOCUS_09820 1030 2508 CDS product tripartite transporter large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_09820 3329 2565 gene locus_tag LOCUS_09830 gene maiA 3329 2565 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAA5 protein_id gnl|my_center|LOCUS_09830 >Feature sequence0200 1730 201 gene locus_tag LOCUS_09840 1730 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2066 1743 gene locus_tag LOCUS_09850 2066 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2511 2167 gene locus_tag LOCUS_09860 2511 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 <3799 2565 gene locus_tag LOCUS_09870 <3799 2565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CHY0:ATP-dependent Clp protease proteolytic subunit >Feature sequence0201 <1 623 gene locus_tag LOCUS_09880 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066917.1:3-dehydroquinate synthase 623 1447 gene locus_tag LOCUS_09890 623 1447 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_09890 1440 2990 gene locus_tag LOCUS_09900 gene glpD 1440 2990 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SG4 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0202 >Feature sequence0203 743 1705 gene locus_tag LOCUS_09910 743 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1935 3083 gene locus_tag LOCUS_09920 1935 3083 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence0204 1113 595 gene locus_tag LOCUS_09930 1113 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2589 1114 gene locus_tag LOCUS_09940 gene purF 2589 1114 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3M0 protein_id gnl|my_center|LOCUS_09940 3336 2782 gene locus_tag LOCUS_09950 3336 2782 CDS product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719609.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0205 2 1378 gene locus_tag LOCUS_09960 2 1378 CDS product protease/lipase ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338570.1 protein_id gnl|my_center|LOCUS_09960 1375 2682 gene locus_tag LOCUS_09970 1375 2682 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 protein_id gnl|my_center|LOCUS_09970 2769 3233 gene locus_tag LOCUS_09980 2769 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence0206 913 539 gene locus_tag LOCUS_09990 913 539 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719359.1 protein_id gnl|my_center|LOCUS_09990 2146 938 gene locus_tag LOCUS_10000 2146 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263666.1 protein_id gnl|my_center|LOCUS_10000 2322 2744 gene locus_tag LOCUS_10010 2322 2744 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_10010 2744 3241 gene locus_tag LOCUS_10020 2744 3241 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0207 <1 509 gene locus_tag LOCUS_10030 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527977.1:NADH:flavin oxidoreductase 506 1249 gene locus_tag LOCUS_10040 506 1249 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_10040 1246 1686 gene locus_tag LOCUS_10050 1246 1686 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_10050 1713 2141 gene locus_tag LOCUS_10060 1713 2141 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_10060 2134 2511 gene locus_tag LOCUS_10070 2134 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2655 3119 gene locus_tag LOCUS_10080 2655 3119 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 protein_id gnl|my_center|LOCUS_10080 3668 3135 gene locus_tag LOCUS_10090 3668 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence0208 783 1694 gene locus_tag LOCUS_10100 783 1694 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Q6 protein_id gnl|my_center|LOCUS_10100 2370 1717 gene locus_tag LOCUS_10110 gene rkpS 2370 1717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724800.1 protein_id gnl|my_center|LOCUS_10110 3614 2373 gene locus_tag LOCUS_10120 3614 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence0209 <3744 2566 gene locus_tag LOCUS_10130 <3744 2566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385170.1:dihydropyrimidine dehydrogenase subunit A >Feature sequence0210 606 424 gene locus_tag LOCUS_10140 606 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2042 948 gene locus_tag LOCUS_10150 2042 948 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 protein_id gnl|my_center|LOCUS_10150 2925 2035 gene locus_tag LOCUS_10160 2925 2035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707374.1 protein_id gnl|my_center|LOCUS_10160 <3736 2999 gene locus_tag LOCUS_10170 <3736 2999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971233.1:ABC transporter substrate-binding protein >Feature sequence0211 <1 708 gene locus_tag LOCUS_10180 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338637.1:zinc metalloprotease 740 1393 gene locus_tag LOCUS_10190 740 1393 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721288.1 protein_id gnl|my_center|LOCUS_10190 1685 2170 gene locus_tag LOCUS_10200 1685 2170 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976330.1 protein_id gnl|my_center|LOCUS_10200 3614 2220 gene locus_tag LOCUS_10210 gene lpdA 3614 2220 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7J5 protein_id gnl|my_center|LOCUS_10210 >Feature sequence0212 1659 655 gene locus_tag LOCUS_10220 1659 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 protein_id gnl|my_center|LOCUS_10220 2742 1828 gene locus_tag LOCUS_10230 2742 1828 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083880.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence0213 620 498 gene locus_tag LOCUS_10240 620 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1572 748 gene locus_tag LOCUS_10250 gene panB3 1572 748 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MZ4 protein_id gnl|my_center|LOCUS_10250 2455 1607 gene locus_tag LOCUS_10260 gene panC 2455 1607 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NN0 protein_id gnl|my_center|LOCUS_10260 2653 3141 gene locus_tag LOCUS_10270 2653 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3541 3203 gene locus_tag LOCUS_10280 3541 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10280 >Feature sequence0214 1336 374 gene locus_tag LOCUS_10290 1336 374 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_10290 2407 1397 gene locus_tag LOCUS_10300 2407 1397 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_10300 2515 3432 gene locus_tag LOCUS_10310 2515 3432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence0215 2273 300 gene locus_tag LOCUS_10320 2273 300 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338655.1 protein_id gnl|my_center|LOCUS_10320 3303 2338 gene locus_tag LOCUS_10330 gene ubiA 3303 2338 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ43 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0216 1211 1942 gene locus_tag LOCUS_10340 1211 1942 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815418.1 protein_id gnl|my_center|LOCUS_10340 1995 2288 gene locus_tag LOCUS_10350 1995 2288 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815429.1 protein_id gnl|my_center|LOCUS_10350 2345 2638 gene locus_tag LOCUS_10360 2345 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815427.1 protein_id gnl|my_center|LOCUS_10360 2700 3020 gene locus_tag LOCUS_10370 2700 3020 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815425.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence0217 435 1544 gene locus_tag LOCUS_10380 435 1544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 protein_id gnl|my_center|LOCUS_10380 1548 2672 gene locus_tag LOCUS_10390 1548 2672 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_10390 2696 3487 gene locus_tag LOCUS_10400 gene bztD 2696 3487 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence0218 1211 12 gene locus_tag LOCUS_10410 1211 12 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975703.1 protein_id gnl|my_center|LOCUS_10410 1354 2253 gene locus_tag LOCUS_10420 1354 2253 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887350.1 protein_id gnl|my_center|LOCUS_10420 <3644 2420 gene locus_tag LOCUS_10430 <3644 2420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:biofilm-promoting protein BpfA >Feature sequence0219 <1 854 gene locus_tag LOCUS_10440 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528657.1:hemolysin secretion protein D 858 1847 gene locus_tag LOCUS_10450 858 1847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_10450 1844 2989 gene locus_tag LOCUS_10460 1844 2989 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence0220 366 869 gene locus_tag LOCUS_10470 gene def 366 869 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH7 protein_id gnl|my_center|LOCUS_10470 881 1771 gene locus_tag LOCUS_10480 gene fmt 881 1771 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH6 protein_id gnl|my_center|LOCUS_10480 1781 2023 gene locus_tag LOCUS_10490 1781 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2033 2170 gene locus_tag LOCUS_10500 2033 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2839 2216 gene locus_tag LOCUS_10510 2839 2216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309976.1 protein_id gnl|my_center|LOCUS_10510 3297 2836 gene locus_tag LOCUS_10520 gene rnhA 3297 2836 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI4 protein_id gnl|my_center|LOCUS_10520 >Feature sequence0221 <1 602 gene locus_tag LOCUS_10530 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140381.1:SDR family oxidoreductase 2010 604 gene locus_tag LOCUS_10540 2010 604 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719496.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence0222 1099 500 gene locus_tag LOCUS_10550 1099 500 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971937.1 protein_id gnl|my_center|LOCUS_10550 1201 1566 gene locus_tag LOCUS_10560 1201 1566 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085875.1 protein_id gnl|my_center|LOCUS_10560 1563 2600 gene locus_tag LOCUS_10570 1563 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence0223 <1 1688 gene locus_tag LOCUS_10580 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706100.1:4-hydroxyphenylpyruvate dioxygenase 2466 1693 gene locus_tag LOCUS_10590 2466 1693 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_10590 2647 3402 gene locus_tag LOCUS_10600 2647 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0224 1366 434 gene locus_tag LOCUS_10610 1366 434 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973006.1 protein_id gnl|my_center|LOCUS_10610 2511 1363 gene locus_tag LOCUS_10620 gene rodA 2511 1363 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 protein_id gnl|my_center|LOCUS_10620 3587 2508 gene locus_tag LOCUS_10630 3587 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence0225 702 37 gene locus_tag LOCUS_10640 702 37 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459281.1 protein_id gnl|my_center|LOCUS_10640 1635 793 gene locus_tag LOCUS_10650 1635 793 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930396.1 protein_id gnl|my_center|LOCUS_10650 1793 3001 gene locus_tag LOCUS_10660 1793 3001 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence0226 <1 588 gene locus_tag LOCUS_10670 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528443.1:branched-chain amino acid ABC transporter permease 585 1622 gene locus_tag LOCUS_10680 585 1622 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 protein_id gnl|my_center|LOCUS_10680 1610 2353 gene locus_tag LOCUS_10690 1610 2353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_10690 2350 3057 gene locus_tag LOCUS_10700 2350 3057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 protein_id gnl|my_center|LOCUS_10700 3094 3525 gene locus_tag LOCUS_10710 3094 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence0227 338 1291 gene locus_tag LOCUS_10720 338 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1396 2313 gene locus_tag LOCUS_10730 gene rarD 1396 2313 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339225.1 protein_id gnl|my_center|LOCUS_10730 3402 2350 gene locus_tag LOCUS_10740 3402 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence0228 597 1409 gene locus_tag LOCUS_10750 597 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1918 2850 gene locus_tag LOCUS_10760 1918 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2847 3269 gene locus_tag LOCUS_10770 2847 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence0229 63 139 gene locus_tag LOCUS_t00070 63 139 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 683 426 gene locus_tag LOCUS_10780 683 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10780 1069 680 gene locus_tag LOCUS_10790 1069 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10790 1339 1115 gene locus_tag LOCUS_10800 1339 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10800 2117 1329 gene locus_tag LOCUS_10810 2117 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886998.1 protein_id gnl|my_center|LOCUS_10810 2941 2348 gene locus_tag LOCUS_10820 2941 2348 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036258.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence0230 <1 819 gene locus_tag LOCUS_10830 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:dehydrogenase 816 1277 gene locus_tag LOCUS_10840 gene pucE 816 1277 CDS product putative xanthine dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32143 protein_id gnl|my_center|LOCUS_10840 1274 2782 gene locus_tag LOCUS_10850 1274 2782 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706522.1 protein_id gnl|my_center|LOCUS_10850 3541 2858 gene locus_tag LOCUS_10860 3541 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence0231 575 648 gene locus_tag LOCUS_t00080 575 648 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 957 751 gene locus_tag LOCUS_10870 957 751 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_10870 1446 1045 gene locus_tag LOCUS_10880 1446 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2108 1443 gene locus_tag LOCUS_10890 2108 1443 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_10890 3076 2171 gene locus_tag LOCUS_10900 3076 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3445 3140 gene locus_tag LOCUS_10910 3445 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0232 1822 494 gene locus_tag LOCUS_10920 1822 494 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140029.1 protein_id gnl|my_center|LOCUS_10920 1956 3191 gene locus_tag LOCUS_10930 1956 3191 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 protein_id gnl|my_center|LOCUS_10930 3401 3201 gene locus_tag LOCUS_10940 3401 3201 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y859 protein_id gnl|my_center|LOCUS_10940 >Feature sequence0233 2308 1121 gene locus_tag LOCUS_10950 2308 1121 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 protein_id gnl|my_center|LOCUS_10950 2721 2305 gene locus_tag LOCUS_10960 2721 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3303 2875 gene locus_tag LOCUS_10970 3303 2875 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089457.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence0234 1322 783 gene locus_tag LOCUS_10980 1322 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719490.1 protein_id gnl|my_center|LOCUS_10980 2223 1315 gene locus_tag LOCUS_10990 gene mreC 2223 1315 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719491.1 protein_id gnl|my_center|LOCUS_10990 3323 2286 gene locus_tag LOCUS_11000 gene mreB 3323 2286 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719492.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0235 53 1042 gene locus_tag LOCUS_11010 53 1042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969567.1 protein_id gnl|my_center|LOCUS_11010 1039 1722 gene locus_tag LOCUS_11020 1039 1722 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969565.1 protein_id gnl|my_center|LOCUS_11020 2147 1737 gene locus_tag LOCUS_11030 2147 1737 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640293.1 protein_id gnl|my_center|LOCUS_11030 2876 2274 gene locus_tag LOCUS_11040 2876 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3509 2979 gene locus_tag LOCUS_11050 3509 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence0236 100 597 gene locus_tag LOCUS_11060 100 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 protein_id gnl|my_center|LOCUS_11060 594 1619 gene locus_tag LOCUS_11070 594 1619 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338531.1 protein_id gnl|my_center|LOCUS_11070 1692 2690 gene locus_tag LOCUS_11080 1692 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140036.1 protein_id gnl|my_center|LOCUS_11080 <3504 2674 gene locus_tag LOCUS_11090 <3504 2674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385531.1:NAD(FAD)-utilizing dehydrogenase >Feature sequence0237 3 443 gene locus_tag LOCUS_11100 3 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 440 1162 gene locus_tag LOCUS_11110 440 1162 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312398.1 protein_id gnl|my_center|LOCUS_11110 <3501 1316 gene locus_tag LOCUS_11120 <3501 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4G7:bifunctional protein PutA >Feature sequence0238 <1 523 gene locus_tag LOCUS_11130 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5F9:protoheme IX farnesyltransferase 525 686 gene locus_tag LOCUS_11140 525 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 686 1267 gene locus_tag LOCUS_11150 gene ctaG 686 1267 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F7 protein_id gnl|my_center|LOCUS_11150 1311 2114 gene locus_tag LOCUS_11160 gene coxIII 1311 2114 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 protein_id gnl|my_center|LOCUS_11160 2214 2882 gene locus_tag LOCUS_11170 gene surf-1 2214 2882 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F5 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0239 <1 576 gene locus_tag LOCUS_11180 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4P6:UvrABC system protein B 758 1147 gene locus_tag LOCUS_11190 758 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1801 1220 gene locus_tag LOCUS_11200 1801 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2118 1801 gene locus_tag LOCUS_11210 2118 1801 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 protein_id gnl|my_center|LOCUS_11210 2531 3223 gene locus_tag LOCUS_11220 gene ctrA 2531 3223 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384333.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence0240 2180 609 gene locus_tag LOCUS_11230 gene pntA 2180 609 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHR5 protein_id gnl|my_center|LOCUS_11230 2733 2290 gene locus_tag LOCUS_11240 2733 2290 CDS product S-isoprenylcysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140259.1 protein_id gnl|my_center|LOCUS_11240 2781 3275 gene locus_tag LOCUS_11250 2781 3275 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence0241 1903 632 gene locus_tag LOCUS_11260 gene rho 1903 632 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y691 protein_id gnl|my_center|LOCUS_11260 2521 2069 gene locus_tag LOCUS_11270 2521 2069 CDS product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53229 protein_id gnl|my_center|LOCUS_11270 >Feature sequence0242 <1 1202 gene locus_tag LOCUS_11280 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808393.1:lysine decarboxylase 1437 2735 gene locus_tag LOCUS_11290 gene kdtA1 1437 2735 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337457.1 protein_id gnl|my_center|LOCUS_11290 2879 3358 gene locus_tag LOCUS_11300 2879 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence0243 <1 915 gene locus_tag LOCUS_11310 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338628.1:protein meaA 976 1683 gene locus_tag LOCUS_11320 gene deoD-2 976 1683 CDS product purine nucleoside phosphorylase DeoD-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE1 protein_id gnl|my_center|LOCUS_11320 1792 2781 gene locus_tag LOCUS_11330 1792 2781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_11330 3032 2856 gene locus_tag LOCUS_11340 3032 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3406 3203 gene locus_tag LOCUS_11350 3406 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence0244 709 230 gene locus_tag LOCUS_11360 709 230 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719611.1 protein_id gnl|my_center|LOCUS_11360 1467 718 gene locus_tag LOCUS_11370 1467 718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719612.1 protein_id gnl|my_center|LOCUS_11370 2267 1464 gene locus_tag LOCUS_11380 2267 1464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_11380 3304 2264 gene locus_tag LOCUS_11390 gene alr 3304 2264 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3L4 protein_id gnl|my_center|LOCUS_11390 >Feature sequence0245 967 206 gene locus_tag LOCUS_11400 967 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2203 983 gene locus_tag LOCUS_11410 2203 983 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 protein_id gnl|my_center|LOCUS_11410 2702 2274 gene locus_tag LOCUS_11420 2702 2274 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388894.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0246 14 310 gene locus_tag LOCUS_11430 14 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 314 1333 gene locus_tag LOCUS_11440 314 1333 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_11440 1448 2053 gene locus_tag LOCUS_11450 1448 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2395 2141 gene locus_tag LOCUS_11460 2395 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11460 >Feature sequence0247 <1 2243 gene locus_tag LOCUS_11470 <1 2243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4N9:pyruvate carboxylase 3453 2287 gene locus_tag LOCUS_11480 3453 2287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816265.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence0248 1259 2029 gene locus_tag LOCUS_11490 1259 2029 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194057.1 protein_id gnl|my_center|LOCUS_11490 3384 2026 gene locus_tag LOCUS_11500 3384 2026 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence0249 <1 804 gene locus_tag LOCUS_11510 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206714.1:AraC family transcriptional regulator 1300 881 gene locus_tag LOCUS_11520 1300 881 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence0250 1463 222 gene locus_tag LOCUS_11530 1463 222 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140188.1 protein_id gnl|my_center|LOCUS_11530 1791 2390 gene locus_tag LOCUS_11540 1791 2390 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y7 protein_id gnl|my_center|LOCUS_11540 >Feature sequence0251 651 2186 gene locus_tag LOCUS_11550 651 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence0252 <1 851 gene locus_tag LOCUS_11560 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727136.1:LysR family transcriptional regulator 2321 1020 gene locus_tag LOCUS_11570 2321 1020 CDS product D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975795.1 protein_id gnl|my_center|LOCUS_11570 3280 2318 gene locus_tag LOCUS_11580 3280 2318 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061696.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence0253 432 1424 gene locus_tag LOCUS_11590 gene add 432 1424 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336865.1 protein_id gnl|my_center|LOCUS_11590 1417 2049 gene locus_tag LOCUS_11600 gene upp 1417 2049 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J642 protein_id gnl|my_center|LOCUS_11600 >Feature sequence0254 1522 473 gene locus_tag LOCUS_11610 gene cfxA 1522 473 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338843.1 protein_id gnl|my_center|LOCUS_11610 2724 1534 gene locus_tag LOCUS_11620 gene pgk 2724 1534 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y475 protein_id gnl|my_center|LOCUS_11620 <3427 2739 gene locus_tag LOCUS_11630 <3427 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IX57:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence0255 313 1365 gene locus_tag LOCUS_11640 gene chvE 313 1365 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535531.1 protein_id gnl|my_center|LOCUS_11640 1442 3010 gene locus_tag LOCUS_11650 1442 3010 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061407.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence0256 336 163 gene locus_tag LOCUS_11660 336 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 884 312 gene locus_tag LOCUS_11670 gene pduO 884 312 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_11670 1092 886 gene locus_tag LOCUS_11680 1092 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2012 1164 gene locus_tag LOCUS_11690 2012 1164 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_11690 2708 2094 gene locus_tag LOCUS_11700 2708 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence0257 1368 2342 gene locus_tag LOCUS_11710 gene thiB 1368 2342 CDS product thiamine transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338927.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence0258 1506 556 gene locus_tag LOCUS_11720 1506 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2493 1579 gene locus_tag LOCUS_11730 2493 1579 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887429.1 protein_id gnl|my_center|LOCUS_11730 3336 2533 gene locus_tag LOCUS_11740 gene phcN 3336 2533 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 protein_id gnl|my_center|LOCUS_11740 >Feature sequence0259 2121 1207 gene locus_tag LOCUS_11750 2121 1207 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_11750 3139 2132 gene locus_tag LOCUS_11760 3139 2132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence0260 331 600 gene locus_tag LOCUS_11770 331 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1053 977 gene locus_tag LOCUS_t00090 1053 977 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1461 2474 gene locus_tag LOCUS_11780 1461 2474 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence0261 227 502 gene locus_tag LOCUS_11790 227 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 505 840 gene locus_tag LOCUS_11800 505 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1500 1787 gene locus_tag LOCUS_11810 1500 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2061 2639 gene locus_tag LOCUS_11820 2061 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383261.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence0262 757 335 gene locus_tag LOCUS_11830 757 335 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 protein_id gnl|my_center|LOCUS_11830 2621 834 gene locus_tag LOCUS_11840 2621 834 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence0263 1582 299 gene locus_tag LOCUS_11850 1582 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 2067 1579 gene locus_tag LOCUS_11860 2067 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 3153 2140 gene locus_tag LOCUS_11870 3153 2140 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0264 621 1418 gene locus_tag LOCUS_11880 621 1418 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_11880 1418 2218 gene locus_tag LOCUS_11890 gene kdsB 1418 2218 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 protein_id gnl|my_center|LOCUS_11890 2406 3260 gene locus_tag LOCUS_11900 gene galU 2406 3260 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYP1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence0265 <1 1156 gene locus_tag LOCUS_11910 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338700.1:formate dehydrogenase subunit beta >Feature sequence0266 567 316 gene locus_tag LOCUS_11920 gene moaD 567 316 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX8 protein_id gnl|my_center|LOCUS_11920 1123 557 gene locus_tag LOCUS_11930 gene pgsA 1123 557 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383371.1 protein_id gnl|my_center|LOCUS_11930 3031 1142 gene locus_tag LOCUS_11940 gene uvrC 3031 1142 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX6 protein_id gnl|my_center|LOCUS_11940 >Feature sequence0267 487 65 gene locus_tag LOCUS_11950 487 65 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384603.1 protein_id gnl|my_center|LOCUS_11950 720 2141 gene locus_tag LOCUS_11960 gene gnd 720 2141 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P61 protein_id gnl|my_center|LOCUS_11960 >Feature sequence0268 1190 3169 gene locus_tag LOCUS_11970 1190 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence0269 <1 818 gene locus_tag LOCUS_11980 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y8U7:glutathione synthetase 815 1717 gene locus_tag LOCUS_11990 815 1717 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_11990 3236 1725 gene locus_tag LOCUS_12000 3236 1725 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337003.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0270 1791 1369 gene locus_tag LOCUS_12010 1791 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1925 1788 gene locus_tag LOCUS_12020 1925 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2106 1930 gene locus_tag LOCUS_12030 2106 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2695 2099 gene locus_tag LOCUS_12040 2695 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3297 2686 gene locus_tag LOCUS_12050 3297 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence0271 531 920 gene locus_tag LOCUS_12060 531 920 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_12060 1021 1371 gene locus_tag LOCUS_12070 1021 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1422 1862 gene locus_tag LOCUS_12080 1422 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence0272 <1 1659 gene locus_tag LOCUS_12090 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y9I5:threonine--tRNA ligase 1742 1873 gene locus_tag LOCUS_12100 1742 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1985 2296 gene locus_tag LOCUS_12110 1985 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2365 3249 gene locus_tag LOCUS_12120 2365 3249 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UB8 protein_id gnl|my_center|LOCUS_12120 >Feature sequence0273 170 2056 gene locus_tag LOCUS_12130 170 2056 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N8 protein_id gnl|my_center|LOCUS_12130 2158 3267 gene locus_tag LOCUS_12140 2158 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence0274 930 2291 gene locus_tag LOCUS_12150 930 2291 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0275 3 524 gene locus_tag LOCUS_12160 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1812 598 gene locus_tag LOCUS_12170 gene nhaA 1812 598 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG3 protein_id gnl|my_center|LOCUS_12170 1915 2535 gene locus_tag LOCUS_12180 1915 2535 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338485.1 protein_id gnl|my_center|LOCUS_12180 2532 3035 gene locus_tag LOCUS_12190 2532 3035 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338486.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence0276 731 222 gene locus_tag LOCUS_12200 731 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 943 731 gene locus_tag LOCUS_12210 943 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2219 1047 gene locus_tag LOCUS_12220 2219 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2903 2280 gene locus_tag LOCUS_12230 2903 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3280 3053 gene locus_tag LOCUS_12240 3280 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0277 93 692 gene locus_tag LOCUS_12250 93 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 692 1684 gene locus_tag LOCUS_12260 692 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3223 2051 gene locus_tag LOCUS_12270 gene frcR 3223 2051 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970632.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0278 1301 501 gene locus_tag LOCUS_12280 1301 501 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_12280 1460 1705 gene locus_tag LOCUS_12290 1460 1705 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722116.1 protein_id gnl|my_center|LOCUS_12290 1757 3004 gene locus_tag LOCUS_12300 1757 3004 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538063.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence0279 1084 215 gene locus_tag LOCUS_12310 1084 215 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975353.1 protein_id gnl|my_center|LOCUS_12310 1248 2138 gene locus_tag LOCUS_12320 1248 2138 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970135.1 protein_id gnl|my_center|LOCUS_12320 2705 2307 gene locus_tag LOCUS_12330 2705 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0280 <1 507 gene locus_tag LOCUS_12340 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098479.1:sugar ABC transporter substrate-binding protein 2040 697 gene locus_tag LOCUS_12350 2040 697 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 protein_id gnl|my_center|LOCUS_12350 2702 2043 gene locus_tag LOCUS_12360 2702 2043 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_12360 2846 3169 gene locus_tag LOCUS_12370 2846 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence0281 382 591 gene locus_tag LOCUS_12380 gene rpsU 382 591 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ0 protein_id gnl|my_center|LOCUS_12380 1103 744 gene locus_tag LOCUS_12390 1103 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708831.1 protein_id gnl|my_center|LOCUS_12390 2726 1206 gene locus_tag LOCUS_12400 2726 1206 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0282 1004 534 gene locus_tag LOCUS_12410 1004 534 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086994.1 protein_id gnl|my_center|LOCUS_12410 1170 2204 gene locus_tag LOCUS_12420 gene dctP 1170 2204 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_12420 2288 2785 gene locus_tag LOCUS_12430 2288 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence0283 <3255 2076 gene locus_tag LOCUS_12440 <3255 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein >Feature sequence0284 369 833 gene locus_tag LOCUS_12450 369 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 830 1234 gene locus_tag LOCUS_12460 gene acpS 830 1234 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W3 protein_id gnl|my_center|LOCUS_12460 1373 2149 gene locus_tag LOCUS_12470 1373 2149 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W2 protein_id gnl|my_center|LOCUS_12470 2146 2829 gene locus_tag LOCUS_12480 gene rnc 2146 2829 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence0285 104 1666 gene locus_tag LOCUS_12490 104 1666 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338484.1 protein_id gnl|my_center|LOCUS_12490 1980 1663 gene locus_tag LOCUS_12500 1980 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338495.1 protein_id gnl|my_center|LOCUS_12500 3063 1990 gene locus_tag LOCUS_12510 3063 1990 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence0286 218 889 gene locus_tag LOCUS_12520 218 889 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389316.1 protein_id gnl|my_center|LOCUS_12520 1705 962 gene locus_tag LOCUS_12530 1705 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2316 1828 gene locus_tag LOCUS_12540 2316 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 <3249 2438 gene locus_tag LOCUS_12550 <3249 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337889.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence0287 1207 458 gene locus_tag LOCUS_12560 1207 458 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337848.1 protein_id gnl|my_center|LOCUS_12560 1782 2429 gene locus_tag LOCUS_12570 gene gmk 1782 2429 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2A5 protein_id gnl|my_center|LOCUS_12570 2426 2956 gene locus_tag LOCUS_12580 2426 2956 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 protein_id gnl|my_center|LOCUS_12580 3164 3030 gene locus_tag LOCUS_12590 3164 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence0288 1233 2618 gene locus_tag LOCUS_12600 1233 2618 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0289 1549 65 gene locus_tag LOCUS_12610 1549 65 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969247.1 protein_id gnl|my_center|LOCUS_12610 3165 1546 gene locus_tag LOCUS_12620 3165 1546 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969245.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence0290 788 1846 gene locus_tag LOCUS_12630 788 1846 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338816.1 protein_id gnl|my_center|LOCUS_12630 1851 2975 gene locus_tag LOCUS_12640 1851 2975 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973788.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0291 1051 53 gene locus_tag LOCUS_12650 gene gapB 1051 53 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAI2 protein_id gnl|my_center|LOCUS_12650 1853 1311 gene locus_tag LOCUS_12660 1853 1311 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706645.1 protein_id gnl|my_center|LOCUS_12660 <3227 1962 gene locus_tag LOCUS_12670 <3227 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337876.1:transketolase >Feature sequence0292 170 640 gene locus_tag LOCUS_12680 170 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1451 660 gene locus_tag LOCUS_12690 gene trpA 1451 660 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9D1 protein_id gnl|my_center|LOCUS_12690 1578 2675 gene locus_tag LOCUS_12700 gene ychF 1578 2675 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZM2 protein_id gnl|my_center|LOCUS_12700 >Feature sequence0293 40 639 gene locus_tag LOCUS_12710 40 639 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_12710 636 1193 gene locus_tag LOCUS_12720 636 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720945.1 protein_id gnl|my_center|LOCUS_12720 1347 2453 gene locus_tag LOCUS_12730 gene ribBA 1347 2453 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZU9 protein_id gnl|my_center|LOCUS_12730 2457 3017 gene locus_tag LOCUS_12740 gene ribH1 2457 3017 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZV0 protein_id gnl|my_center|LOCUS_12740 >Feature sequence0294 <1 1667 gene locus_tag LOCUS_12750 <1 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090565.1:C4-dicarboxylate ABC transporter permease 1682 2440 gene locus_tag LOCUS_12760 1682 2440 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence0295 1224 673 gene locus_tag LOCUS_12770 gene bioY 1224 673 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707085.1 protein_id gnl|my_center|LOCUS_12770 2740 1499 gene locus_tag LOCUS_12780 2740 1499 CDS product MFS transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331467.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence0296 364 1413 gene locus_tag LOCUS_12790 364 1413 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW76 protein_id gnl|my_center|LOCUS_12790 <3191 1420 gene locus_tag LOCUS_12800 <3191 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339450.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence0297 102 443 gene locus_tag LOCUS_12810 102 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 514 1527 gene locus_tag LOCUS_12820 gene deoC 514 1527 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y407 protein_id gnl|my_center|LOCUS_12820 >Feature sequence0298 1422 520 gene locus_tag LOCUS_12830 gene prmC 1422 520 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X6 protein_id gnl|my_center|LOCUS_12830 2468 1419 gene locus_tag LOCUS_12840 gene prfA 2468 1419 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X7 protein_id gnl|my_center|LOCUS_12840 2949 2527 gene locus_tag LOCUS_12850 2949 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337838.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence0299 <1 732 gene locus_tag LOCUS_12860 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533153.1:acetyl-CoA carboxylase biotin carboxylase subunit 729 1604 gene locus_tag LOCUS_12870 729 1604 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187690.1 protein_id gnl|my_center|LOCUS_12870 1594 2577 gene locus_tag LOCUS_12880 1594 2577 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533155.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence0300 770 66 gene locus_tag LOCUS_12890 770 66 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_12890 1543 770 gene locus_tag LOCUS_12900 1543 770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089146.1 protein_id gnl|my_center|LOCUS_12900 2826 1537 gene locus_tag LOCUS_12910 2826 1537 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533096.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence0301 15 1016 gene locus_tag LOCUS_12920 15 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1021 2322 gene locus_tag LOCUS_12930 1021 2322 CDS product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0302 1460 1963 gene locus_tag LOCUS_12940 1460 1963 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE12 protein_id gnl|my_center|LOCUS_12940 2570 2085 gene locus_tag LOCUS_12950 2570 2085 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720045.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence0303 1538 330 gene locus_tag LOCUS_12960 gene ftsY 1538 330 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E2 protein_id gnl|my_center|LOCUS_12960 2249 1590 gene locus_tag LOCUS_12970 2249 1590 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529376.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0304 41 670 gene locus_tag LOCUS_12980 41 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086182.1 protein_id gnl|my_center|LOCUS_12980 1762 932 gene locus_tag LOCUS_12990 1762 932 CDS product non-heme chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027137.1 protein_id gnl|my_center|LOCUS_12990 1945 2928 gene locus_tag LOCUS_13000 1945 2928 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974642.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence0305 <1 610 gene locus_tag LOCUS_13010 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972711.1:peptide ABC transporter permease 612 1937 gene locus_tag LOCUS_13020 612 1937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972710.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence0306 1700 429 gene locus_tag LOCUS_13030 1700 429 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975203.1 protein_id gnl|my_center|LOCUS_13030 2203 1697 gene locus_tag LOCUS_13040 2203 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0307 1304 345 gene locus_tag LOCUS_13050 1304 345 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706378.1 protein_id gnl|my_center|LOCUS_13050 2505 1306 gene locus_tag LOCUS_13060 2505 1306 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706377.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence0308 600 25 gene locus_tag LOCUS_13070 gene PSrp1 600 25 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_13070 1578 847 gene locus_tag LOCUS_13080 1578 847 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721595.1 protein_id gnl|my_center|LOCUS_13080 2081 1578 gene locus_tag LOCUS_13090 2081 1578 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563197.1 protein_id gnl|my_center|LOCUS_13090 2698 2099 gene locus_tag LOCUS_13100 2698 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338753.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence0309 635 9 gene locus_tag LOCUS_13110 635 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1392 673 gene locus_tag LOCUS_13120 1392 673 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722382.1 protein_id gnl|my_center|LOCUS_13120 2430 1540 gene locus_tag LOCUS_13130 2430 1540 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336875.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence0310 <1 541 gene locus_tag LOCUS_13140 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969975.1:glyoxalase 687 1838 gene locus_tag LOCUS_13150 687 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1835 2806 gene locus_tag LOCUS_13160 gene kcnb2 1835 2806 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence0311 471 1265 gene locus_tag LOCUS_13170 gene thyA 471 1265 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G35 protein_id gnl|my_center|LOCUS_13170 1277 1750 gene locus_tag LOCUS_13180 gene folA 1277 1750 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0X0 protein_id gnl|my_center|LOCUS_13180 1906 2217 gene locus_tag LOCUS_13190 1906 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2985 2275 gene locus_tag LOCUS_13200 2985 2275 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence0312 2099 582 gene locus_tag LOCUS_13210 2099 582 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 protein_id gnl|my_center|LOCUS_13210 3033 2116 gene locus_tag LOCUS_13220 3033 2116 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090676.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0313 762 301 gene locus_tag LOCUS_13230 762 301 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720606.1 protein_id gnl|my_center|LOCUS_13230 1181 1834 gene locus_tag LOCUS_13240 1181 1834 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_13240 1860 2129 gene locus_tag LOCUS_13250 1860 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0314 807 199 gene locus_tag LOCUS_13260 807 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1274 804 gene locus_tag LOCUS_13270 1274 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1818 1378 gene locus_tag LOCUS_13280 gene dtd 1818 1378 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 protein_id gnl|my_center|LOCUS_13280 2735 1815 gene locus_tag LOCUS_13290 2735 1815 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence0315 1520 2695 gene locus_tag LOCUS_13300 1520 2695 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence0316 42 650 gene locus_tag LOCUS_13310 42 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337063.1 protein_id gnl|my_center|LOCUS_13310 738 1613 gene locus_tag LOCUS_13320 738 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722834.1 protein_id gnl|my_center|LOCUS_13320 1621 2115 gene locus_tag LOCUS_13330 1621 2115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337062.1 protein_id gnl|my_center|LOCUS_13330 3096 2119 gene locus_tag LOCUS_13340 3096 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence0317 1120 467 gene locus_tag LOCUS_13350 1120 467 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720416.1 protein_id gnl|my_center|LOCUS_13350 1295 1368 gene locus_tag LOCUS_t00100 1295 1368 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2516 1431 gene locus_tag LOCUS_13360 2516 1431 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003671.1 protein_id gnl|my_center|LOCUS_13360 2748 2503 gene locus_tag LOCUS_13370 2748 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2893 3045 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttgatccccgcgtgggcggggaacgctg >Feature sequence0318 <1 664 gene locus_tag LOCUS_13380 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532095.1:nickel transporter 707 1363 gene locus_tag LOCUS_13390 707 1363 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532096.1 protein_id gnl|my_center|LOCUS_13390 1380 2210 gene locus_tag LOCUS_13400 1380 2210 CDS product polar amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence0319 <1 923 gene locus_tag LOCUS_13410 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538103.1:capsule polysaccharide transporter 1116 1643 gene locus_tag LOCUS_13420 1116 1643 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140256.1 protein_id gnl|my_center|LOCUS_13420 1834 1908 gene locus_tag LOCUS_t00110 1834 1908 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0320 1690 488 gene locus_tag LOCUS_13430 1690 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2247 1687 gene locus_tag LOCUS_13440 2247 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0321 890 465 gene locus_tag LOCUS_13450 890 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1459 2253 gene locus_tag LOCUS_13460 1459 2253 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence0322 3 353 gene locus_tag LOCUS_13470 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 377 2005 gene locus_tag LOCUS_13480 377 2005 CDS product D-ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339545.1 protein_id gnl|my_center|LOCUS_13480 2325 2546 gene locus_tag LOCUS_13490 2325 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0323 1664 1588 gene locus_tag LOCUS_t00120 1664 1588 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2062 1751 gene locus_tag LOCUS_13500 2062 1751 CDS product ETC complex I subunit region inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719237.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence0324 215 1240 gene locus_tag LOCUS_13510 215 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 protein_id gnl|my_center|LOCUS_13510 1261 1410 gene locus_tag LOCUS_13520 1261 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1966 1475 gene locus_tag LOCUS_13530 gene hpaC 1966 1475 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090025.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence0325 375 827 gene locus_tag LOCUS_13540 375 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 840 2351 gene locus_tag LOCUS_13550 840 2351 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence0326 842 144 gene locus_tag LOCUS_13560 gene rplA 842 144 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5T3 protein_id gnl|my_center|LOCUS_13560 1267 842 gene locus_tag LOCUS_13570 gene rplK 1267 842 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5N0 protein_id gnl|my_center|LOCUS_13570 1928 1395 gene locus_tag LOCUS_13580 gene nusG 1928 1395 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5N1 protein_id gnl|my_center|LOCUS_13580 2370 2170 gene locus_tag LOCUS_13590 gene secE 2370 2170 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5T6 protein_id gnl|my_center|LOCUS_13590 2603 2528 gene locus_tag LOCUS_t00130 2603 2528 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0327 1618 575 gene locus_tag LOCUS_13600 1618 575 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887821.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence0328 892 260 gene locus_tag LOCUS_13610 892 260 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_13610 2203 896 gene locus_tag LOCUS_13620 2203 896 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_13620 2724 2200 gene locus_tag LOCUS_13630 2724 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3034 2840 gene locus_tag LOCUS_13640 3034 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0329 460 1440 gene locus_tag LOCUS_13650 gene nifR3 460 1440 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2L0 protein_id gnl|my_center|LOCUS_13650 1437 2519 gene locus_tag LOCUS_13660 gene ntrB 1437 2519 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719968.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0330 1488 1321 gene locus_tag LOCUS_13670 1488 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2215 1526 gene locus_tag LOCUS_13680 2215 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence0331 <1 1125 gene locus_tag LOCUS_13690 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722552.1:amino acid ABC transporter substrate-binding protein 1270 2490 gene locus_tag LOCUS_13700 gene bztB 1270 2490 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722555.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence0332 788 42 gene locus_tag LOCUS_13710 788 42 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537523.1 protein_id gnl|my_center|LOCUS_13710 1663 788 gene locus_tag LOCUS_13720 1663 788 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 protein_id gnl|my_center|LOCUS_13720 2781 1819 gene locus_tag LOCUS_13730 2781 1819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337313.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0333 1438 1881 gene locus_tag LOCUS_13740 1438 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3004 1883 gene locus_tag LOCUS_13750 gene dinB 3004 1883 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 protein_id gnl|my_center|LOCUS_13750 >Feature sequence0334 1841 543 gene locus_tag LOCUS_13760 gene gltA 1841 543 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAG7 protein_id gnl|my_center|LOCUS_13760 <3006 2137 gene locus_tag LOCUS_13770 <3006 2137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZFA3:glutamate--tRNA ligase 1 >Feature sequence0335 2168 1203 gene locus_tag LOCUS_13780 2168 1203 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13780 <3006 2216 gene locus_tag LOCUS_13790 <3006 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533453.1:silent information regulator protein Sir2 >Feature sequence0336 140 679 gene locus_tag LOCUS_13800 140 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1068 772 gene locus_tag LOCUS_13810 1068 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1375 1106 gene locus_tag LOCUS_13820 1375 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence0337 202 1080 gene locus_tag LOCUS_13830 gene fieF 202 1080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383087.1 protein_id gnl|my_center|LOCUS_13830 <2998 1086 gene locus_tag LOCUS_13840 <2998 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338342.1:peptidyl-dipeptidase Dcp >Feature sequence0338 222 917 gene locus_tag LOCUS_13850 gene thiQ 222 917 CDS product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY12 protein_id gnl|my_center|LOCUS_13850 1786 968 gene locus_tag LOCUS_13860 gene fbcC 1786 968 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722004.1 protein_id gnl|my_center|LOCUS_13860 <2996 1804 gene locus_tag LOCUS_13870 <2996 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY10:cytochrome b >Feature sequence0339 <2994 805 gene locus_tag LOCUS_13880 <2994 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722755.1:pyruvate, phosphate dikinase >Feature sequence0340 <1 585 gene locus_tag LOCUS_13890 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972746.1:spermidine/putrescine ABC transporter substrate-binding protein 662 1729 gene locus_tag LOCUS_13900 662 1729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388256.1 protein_id gnl|my_center|LOCUS_13900 1753 2631 gene locus_tag LOCUS_13910 1753 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence0341 1200 397 gene locus_tag LOCUS_13920 gene fabI-2 1200 397 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U2 protein_id gnl|my_center|LOCUS_13920 1404 2009 gene locus_tag LOCUS_13930 gene pdxH 1404 2009 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y3 protein_id gnl|my_center|LOCUS_13930 2179 2730 gene locus_tag LOCUS_13940 2179 2730 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719511.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence0342 1475 561 gene locus_tag LOCUS_13950 gene livH 1475 561 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941400.1 protein_id gnl|my_center|LOCUS_13950 2654 1542 gene locus_tag LOCUS_13960 2654 1542 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390623.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence0343 <1 1059 gene locus_tag LOCUS_13970 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337519.1:phage host specificity protein 1052 1765 gene locus_tag LOCUS_13980 1052 1765 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920229.1 protein_id gnl|my_center|LOCUS_13980 2035 2847 gene locus_tag LOCUS_13990 gene cysE 2035 2847 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0344 727 921 gene locus_tag LOCUS_14000 727 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1025 1450 gene locus_tag LOCUS_14010 1025 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1775 1455 gene locus_tag LOCUS_14020 1775 1455 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ2 protein_id gnl|my_center|LOCUS_14020 2308 1772 gene locus_tag LOCUS_14030 2308 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2377 2931 gene locus_tag LOCUS_14040 2377 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence0345 899 225 gene locus_tag LOCUS_14050 899 225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 protein_id gnl|my_center|LOCUS_14050 1796 969 gene locus_tag LOCUS_14060 1796 969 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969502.1 protein_id gnl|my_center|LOCUS_14060 2450 2166 gene locus_tag LOCUS_14070 2450 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0346 2216 417 gene locus_tag LOCUS_14080 gene thiC 2216 417 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TI9 protein_id gnl|my_center|LOCUS_14080 >Feature sequence0347 2065 1082 gene locus_tag LOCUS_14090 gene smoC 2065 1082 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337985.1 protein_id gnl|my_center|LOCUS_14090 2738 2052 gene locus_tag LOCUS_14100 2738 2052 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence0348 <1 550 gene locus_tag LOCUS_14110 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J445:histidinol-phosphate aminotransferase 547 1470 gene locus_tag LOCUS_14120 547 1470 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719447.1 protein_id gnl|my_center|LOCUS_14120 1467 2234 gene locus_tag LOCUS_14130 1467 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence0349 1 156 gene locus_tag LOCUS_14140 1 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 556 1269 gene locus_tag LOCUS_14150 gene lexA 556 1269 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA4 protein_id gnl|my_center|LOCUS_14150 >Feature sequence0350 1782 682 gene locus_tag LOCUS_14160 gene ugpC 1782 682 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCV4 protein_id gnl|my_center|LOCUS_14160 2693 1794 gene locus_tag LOCUS_14170 gene ugpE 2693 1794 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1Q5 protein_id gnl|my_center|LOCUS_14170 >Feature sequence0351 312 1007 gene locus_tag LOCUS_14180 gene mtbC 312 1007 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 protein_id gnl|my_center|LOCUS_14180 1037 1252 gene locus_tag LOCUS_14190 1037 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1266 1580 gene locus_tag LOCUS_14200 1266 1580 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_14200 1550 2209 gene locus_tag LOCUS_14210 1550 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337251.1 protein_id gnl|my_center|LOCUS_14210 2628 2215 gene locus_tag LOCUS_14220 2628 2215 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337126.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence0352 1194 574 gene locus_tag LOCUS_14230 1194 574 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_14230 2328 1297 gene locus_tag LOCUS_14240 2328 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064160.1 protein_id gnl|my_center|LOCUS_14240 <2939 2367 gene locus_tag LOCUS_14250 <2939 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807374.1:alpha/beta hydrolase >Feature sequence0353 1555 2823 gene locus_tag LOCUS_14260 1555 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0354 2815 2411 gene locus_tag LOCUS_14270 2815 2411 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975939.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence0355 <1 1614 gene locus_tag LOCUS_14280 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337804.1:methane monooxygenase 1693 2751 gene locus_tag LOCUS_14290 1693 2751 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337803.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence0356 1377 361 gene locus_tag LOCUS_14300 gene trpS 1377 361 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9W8 protein_id gnl|my_center|LOCUS_14300 1456 2154 gene locus_tag LOCUS_14310 1456 2154 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722664.1 protein_id gnl|my_center|LOCUS_14310 <2907 2169 gene locus_tag LOCUS_14320 <2907 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5H7:putative lipid II flippase MurJ >Feature sequence0357 1207 431 gene locus_tag LOCUS_14330 1207 431 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_14330 2833 1208 gene locus_tag LOCUS_14340 2833 1208 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086450.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence0358 329 907 gene locus_tag LOCUS_14350 329 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 897 1370 gene locus_tag LOCUS_14360 897 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816113.1 protein_id gnl|my_center|LOCUS_14360 2235 2387 gene locus_tag LOCUS_14370 2235 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence0359 555 325 gene locus_tag LOCUS_14380 555 325 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537908.1 protein_id gnl|my_center|LOCUS_14380 1115 633 gene locus_tag LOCUS_14390 1115 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 <2896 1187 gene locus_tag LOCUS_14400 <2896 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J273:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0360 609 235 gene locus_tag LOCUS_14410 609 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1166 741 gene locus_tag LOCUS_14420 1166 741 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 protein_id gnl|my_center|LOCUS_14420 2647 1166 gene locus_tag LOCUS_14430 gene cxp 2647 1166 CDS product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338958.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0361 2045 1344 gene locus_tag LOCUS_14440 2045 1344 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 protein_id gnl|my_center|LOCUS_14440 <2896 2087 gene locus_tag LOCUS_14450 <2896 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55604:putative ABC transporter ATP-binding protein y4oS >Feature sequence0362 2025 832 gene locus_tag LOCUS_14460 2025 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268746.1 protein_id gnl|my_center|LOCUS_14460 <2893 2022 gene locus_tag LOCUS_14470 <2893 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529351.1:ATP-binding protein >Feature sequence0363 2428 902 gene locus_tag LOCUS_14480 2428 902 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339266.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0364 <1 996 gene locus_tag LOCUS_14490 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338101.1:septum site-determining protein 2126 1002 gene locus_tag LOCUS_14500 2126 1002 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140093.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0365 1210 287 gene locus_tag LOCUS_14510 gene atpG 1210 287 CDS product ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_14510 2777 1194 gene locus_tag LOCUS_14520 2777 1194 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0366 374 138 gene locus_tag LOCUS_14530 374 138 CDS product NnrT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565642.1 protein_id gnl|my_center|LOCUS_14530 544 371 gene locus_tag LOCUS_14540 544 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2441 546 gene locus_tag LOCUS_14550 gene norD 2441 546 CDS product NorD nitric oxide reductase activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338147.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence0367 1005 79 gene locus_tag LOCUS_14560 gene oxyR 1005 79 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337740.1 protein_id gnl|my_center|LOCUS_14560 1136 2587 gene locus_tag LOCUS_14570 gene catA 1136 2587 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337739.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence0368 664 2121 gene locus_tag LOCUS_14580 gene xanB 664 2121 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence0369 565 1401 gene locus_tag LOCUS_14590 gene metF 565 1401 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G1 protein_id gnl|my_center|LOCUS_14590 2432 1398 gene locus_tag LOCUS_14600 2432 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140094.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence0370 967 218 gene locus_tag LOCUS_14610 967 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719458.1 protein_id gnl|my_center|LOCUS_14610 1030 1809 gene locus_tag LOCUS_14620 gene gloB 1030 1809 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J436 protein_id gnl|my_center|LOCUS_14620 2161 2616 gene locus_tag LOCUS_14630 2161 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence0371 <1 949 gene locus_tag LOCUS_14640 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090563.1:C4-dicarboxylate ABC transporter 953 1492 gene locus_tag LOCUS_14650 953 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1492 2814 gene locus_tag LOCUS_14660 1492 2814 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence0372 655 1542 gene locus_tag LOCUS_14670 655 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2858 1674 gene locus_tag LOCUS_14680 2858 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence0373 141 656 gene locus_tag LOCUS_14690 141 656 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703350.1 protein_id gnl|my_center|LOCUS_14690 1129 659 gene locus_tag LOCUS_14700 1129 659 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 protein_id gnl|my_center|LOCUS_14700 1275 2297 gene locus_tag LOCUS_14710 1275 2297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_14710 2294 2815 gene locus_tag LOCUS_14720 2294 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence0374 <2858 1638 gene locus_tag LOCUS_14730 <2858 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973917.1:5-dehydro-2-deoxygluconokinase >Feature sequence0375 221 1852 gene locus_tag LOCUS_14740 gene groEL3 221 1852 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2G7 protein_id gnl|my_center|LOCUS_14740 >Feature sequence0376 <1 1960 gene locus_tag LOCUS_14750 <1 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529820.1:RNA-binding protein 2107 2550 gene locus_tag LOCUS_14760 2107 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence0377 2460 1681 gene locus_tag LOCUS_14770 2460 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence0378 <1 1314 gene locus_tag LOCUS_14780 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951299.1:septum formation inhibitor Maf 1323 1700 gene locus_tag LOCUS_14790 1323 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1697 2080 gene locus_tag LOCUS_14800 1697 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2261 2103 gene locus_tag LOCUS_14810 2261 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence0379 653 1543 gene locus_tag LOCUS_14820 653 1543 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0380 <1 1190 gene locus_tag LOCUS_14830 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533088.1:ABC transporter substrate-binding protein 1200 1928 gene locus_tag LOCUS_14840 1200 1928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533087.1 protein_id gnl|my_center|LOCUS_14840 1925 2659 gene locus_tag LOCUS_14850 1925 2659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533086.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence0381 632 1351 gene locus_tag LOCUS_14860 gene pcaI 632 1351 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 protein_id gnl|my_center|LOCUS_14860 1352 2044 gene locus_tag LOCUS_14870 gene pcaJ 1352 2044 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0382 824 330 gene locus_tag LOCUS_14880 824 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 <2832 2058 gene locus_tag LOCUS_14890 <2832 2058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720280.1:metal ABC transporter substrate-binding protein >Feature sequence0383 823 449 gene locus_tag LOCUS_14900 823 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337098.1 protein_id gnl|my_center|LOCUS_14900 1587 820 gene locus_tag LOCUS_14910 gene cysH 1587 820 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J542 protein_id gnl|my_center|LOCUS_14910 <2831 1577 gene locus_tag LOCUS_14920 <2831 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337100.1:sulfite reductase >Feature sequence0384 19 405 gene locus_tag LOCUS_14930 19 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_14930 427 888 gene locus_tag LOCUS_14940 427 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 904 2352 gene locus_tag LOCUS_14950 gene cueO 904 2352 CDS product Blue copper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X947 protein_id gnl|my_center|LOCUS_14950 2618 2475 gene locus_tag LOCUS_14960 2618 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence0385 22 870 gene locus_tag LOCUS_14970 22 870 CDS product salt-stress induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385105.1 protein_id gnl|my_center|LOCUS_14970 1401 1967 gene locus_tag LOCUS_14980 gene atpH 1401 1967 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J434 protein_id gnl|my_center|LOCUS_14980 >Feature sequence0386 2 427 gene locus_tag LOCUS_14990 2 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 667 1791 gene locus_tag LOCUS_15000 667 1791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337923.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence0387 1044 505 gene locus_tag LOCUS_15010 1044 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2217 1390 gene locus_tag LOCUS_15020 gene iolB 2217 1390 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973914.1 protein_id gnl|my_center|LOCUS_15020 <2804 2246 gene locus_tag LOCUS_15030 <2804 2246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067754.1:myo-inosose-2 dehydratase >Feature sequence0388 232 1152 gene locus_tag LOCUS_15040 232 1152 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967971.1 protein_id gnl|my_center|LOCUS_15040 1570 1355 gene locus_tag LOCUS_15050 1570 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1876 2739 gene locus_tag LOCUS_15060 gene kdsA 1876 2739 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKN7 protein_id gnl|my_center|LOCUS_15060 >Feature sequence0389 303 1049 gene locus_tag LOCUS_15070 303 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1940 1404 gene locus_tag LOCUS_15080 1940 1404 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384287.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence0390 1404 286 gene locus_tag LOCUS_15090 1404 286 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_15090 1556 2392 gene locus_tag LOCUS_15100 1556 2392 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973918.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence0391 176 391 gene locus_tag LOCUS_15110 176 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 375 974 gene locus_tag LOCUS_15120 375 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 947 1447 gene locus_tag LOCUS_15130 947 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 2045 1857 gene locus_tag LOCUS_15140 2045 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence0392 716 1273 gene locus_tag LOCUS_15150 716 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1558 2511 gene locus_tag LOCUS_15160 1558 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence0393 2198 1029 gene locus_tag LOCUS_15170 gene acrA 2198 1029 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339206.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence0394 198 1271 gene locus_tag LOCUS_15180 198 1271 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_15180 1388 2362 gene locus_tag LOCUS_15190 1388 2362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315175.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence0395 1429 431 gene locus_tag LOCUS_15200 gene eutB 1429 431 CDS product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974133.1 protein_id gnl|my_center|LOCUS_15200 2244 1429 gene locus_tag LOCUS_15210 2244 1429 CDS product putative amino-acid ABC transporter ATP-binding protein y4tH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55662 protein_id gnl|my_center|LOCUS_15210 <2781 2244 gene locus_tag LOCUS_15220 <2781 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459282.1:ectoine/hydroxyectoine ABC transporter permease subunit EhuD >Feature sequence0396 722 291 gene locus_tag LOCUS_15230 722 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2255 1185 gene locus_tag LOCUS_15240 gene pheS 2255 1185 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A7 protein_id gnl|my_center|LOCUS_15240 >Feature sequence0397 <1 1641 gene locus_tag LOCUS_15250 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337471.1:oligoendopeptidase F 2034 1717 gene locus_tag LOCUS_15260 2034 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence0398 176 412 gene locus_tag LOCUS_15270 176 412 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 protein_id gnl|my_center|LOCUS_15270 1188 409 gene locus_tag LOCUS_15280 1188 409 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337691.1 protein_id gnl|my_center|LOCUS_15280 2767 1202 gene locus_tag LOCUS_15290 2767 1202 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003601.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence0399 1765 935 gene locus_tag LOCUS_15300 1765 935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891976.1 protein_id gnl|my_center|LOCUS_15300 2682 1762 gene locus_tag LOCUS_15310 2682 1762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891975.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence0400 <1 1679 gene locus_tag LOCUS_15320 <1 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337683.1:elongation factor 3 1899 2489 gene locus_tag LOCUS_15330 1899 2489 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337684.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence0401 <1 573 gene locus_tag LOCUS_15340 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973894.1:nitroreductase 1281 664 gene locus_tag LOCUS_15350 1281 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1624 1319 gene locus_tag LOCUS_15360 1624 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720593.1 protein_id gnl|my_center|LOCUS_15360 <2754 1917 gene locus_tag LOCUS_15370 <2754 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382978.1:hemolysin >Feature sequence0402 1623 310 gene locus_tag LOCUS_15380 1623 310 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338710.1 protein_id gnl|my_center|LOCUS_15380 1780 2499 gene locus_tag LOCUS_15390 1780 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence0403 298 1410 gene locus_tag LOCUS_15400 gene ydjI 298 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537911.1 protein_id gnl|my_center|LOCUS_15400 1503 1799 gene locus_tag LOCUS_15410 1503 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2206 1823 gene locus_tag LOCUS_15420 2206 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence0404 <1 693 gene locus_tag LOCUS_15430 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RV97:dihydroxy-acid dehydratase >Feature sequence0405 1090 1166 gene locus_tag LOCUS_t00140 1090 1166 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2591 1260 gene locus_tag LOCUS_15440 2591 1260 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338061.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence0406 1014 1838 gene locus_tag LOCUS_15450 1014 1838 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_15450 <2751 1883 gene locus_tag LOCUS_15460 <2751 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2J0:3-dehydroquinate synthase >Feature sequence0407 2105 570 gene locus_tag LOCUS_15470 2105 570 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083365.1 protein_id gnl|my_center|LOCUS_15470 2469 2245 gene locus_tag LOCUS_15480 2469 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0408 1456 764 gene locus_tag LOCUS_15490 gene sfsA 1456 764 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4Z6 protein_id gnl|my_center|LOCUS_15490 1497 2231 gene locus_tag LOCUS_15500 gene cinA1 1497 2231 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence0409 1857 667 gene locus_tag LOCUS_15510 1857 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337410.1 protein_id gnl|my_center|LOCUS_15510 2200 2487 gene locus_tag LOCUS_15520 2200 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence0410 398 1564 gene locus_tag LOCUS_15530 398 1564 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_15530 1576 2586 gene locus_tag LOCUS_15540 1576 2586 CDS product UDP-glucuronate 5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence0411 2528 1812 gene locus_tag LOCUS_15550 2528 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0412 1754 387 gene locus_tag LOCUS_15560 1754 387 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061938.1 protein_id gnl|my_center|LOCUS_15560 2737 1751 gene locus_tag LOCUS_15570 2737 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence0413 394 77 gene locus_tag LOCUS_15580 gene ureB 394 77 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42886 protein_id gnl|my_center|LOCUS_15580 707 405 gene locus_tag LOCUS_15590 gene ureA 707 405 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9Z0 protein_id gnl|my_center|LOCUS_15590 1567 731 gene locus_tag LOCUS_15600 gene ureD 1567 731 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J149 protein_id gnl|my_center|LOCUS_15600 >Feature sequence0414 896 123 gene locus_tag LOCUS_15610 896 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383300.1 protein_id gnl|my_center|LOCUS_15610 1692 1051 gene locus_tag LOCUS_15620 1692 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1913 2608 gene locus_tag LOCUS_15630 1913 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0415 279 1103 gene locus_tag LOCUS_15640 gene phcN 279 1103 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 protein_id gnl|my_center|LOCUS_15640 1167 2072 gene locus_tag LOCUS_15650 1167 2072 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887429.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence0416 170 538 gene locus_tag LOCUS_15660 gene mutT 170 538 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_15660 695 835 gene locus_tag LOCUS_15670 695 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2699 912 gene locus_tag LOCUS_15680 2699 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0417 361 1194 gene locus_tag LOCUS_15690 361 1194 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089555.1 protein_id gnl|my_center|LOCUS_15690 1264 1926 gene locus_tag LOCUS_15700 1264 1926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_15700 1947 2705 gene locus_tag LOCUS_15710 1947 2705 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence0418 1571 771 gene locus_tag LOCUS_15720 1571 771 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085944.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence0419 <1 510 gene locus_tag LOCUS_15730 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3P6:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 2459 546 gene locus_tag LOCUS_15740 2459 546 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719583.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence0420 505 888 gene locus_tag LOCUS_15750 505 888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 protein_id gnl|my_center|LOCUS_15750 1153 1980 gene locus_tag LOCUS_15760 1153 1980 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0421 1161 946 gene locus_tag LOCUS_15770 1161 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2690 1536 gene locus_tag LOCUS_15780 gene murF 2690 1536 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NL7 protein_id gnl|my_center|LOCUS_15780 >Feature sequence0422 1576 248 gene locus_tag LOCUS_15790 1576 248 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 protein_id gnl|my_center|LOCUS_15790 1694 2167 gene locus_tag LOCUS_15800 1694 2167 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975746.1 protein_id gnl|my_center|LOCUS_15800 2684 2256 gene locus_tag LOCUS_15810 2684 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0423 32 730 gene locus_tag LOCUS_15820 32 730 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_15820 717 1928 gene locus_tag LOCUS_15830 717 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence0424 2116 1547 gene locus_tag LOCUS_15840 2116 1547 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_15840 >Feature sequence0425 2159 1320 gene locus_tag LOCUS_15850 2159 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence0426 1175 186 gene locus_tag LOCUS_15860 1175 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2210 1248 gene locus_tag LOCUS_15870 gene mdh 2210 1248 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 protein_id gnl|my_center|LOCUS_15870 >Feature sequence0427 <1 641 gene locus_tag LOCUS_15880 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531128.1:ABC transporter ATP-binding protein 651 1946 gene locus_tag LOCUS_15890 651 1946 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence0428 701 1057 gene locus_tag LOCUS_15900 gene rpsF 701 1057 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1M1 protein_id gnl|my_center|LOCUS_15900 1079 1306 gene locus_tag LOCUS_15910 gene rpsR 1079 1306 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1M0 protein_id gnl|my_center|LOCUS_15910 1318 1920 gene locus_tag LOCUS_15920 gene rplI 1318 1920 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L9 protein_id gnl|my_center|LOCUS_15920 2126 2611 gene locus_tag LOCUS_15930 2126 2611 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720830.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence0429 2381 1983 gene locus_tag LOCUS_15940 2381 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence0430 <1 1266 gene locus_tag LOCUS_15950 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086300.1:sulfite dehydrogenase 1247 2332 gene locus_tag LOCUS_15960 1247 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0431 <1 665 gene locus_tag LOCUS_15970 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022315.1:DUF4386 domain-containing protein >Feature sequence0432 <1 1602 gene locus_tag LOCUS_15980 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706260.1:membrane protein >Feature sequence0433 1436 588 gene locus_tag LOCUS_15990 1436 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence0434 >Feature sequence0435 1440 478 gene locus_tag LOCUS_16000 1440 478 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066949.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence0436 1101 82 gene locus_tag LOCUS_16010 1101 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence0437 162 1472 gene locus_tag LOCUS_16020 162 1472 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence0438 <1 1127 gene locus_tag LOCUS_16030 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4N0:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1124 2557 gene locus_tag LOCUS_16040 gene murF 1124 2557 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M9 protein_id gnl|my_center|LOCUS_16040 >Feature sequence0439 398 48 gene locus_tag LOCUS_16050 398 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383732.1 protein_id gnl|my_center|LOCUS_16050 998 588 gene locus_tag LOCUS_16060 gene atpC1 998 588 CDS product ATP synthase epsilon chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J430 protein_id gnl|my_center|LOCUS_16060 2558 1134 gene locus_tag LOCUS_16070 gene atpD 2558 1134 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAC1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence0440 1483 836 gene locus_tag LOCUS_16080 gene engB 1483 836 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY4 protein_id gnl|my_center|LOCUS_16080 2599 1502 gene locus_tag LOCUS_16090 2599 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0441 <1 1331 gene locus_tag LOCUS_16100 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336830.1:polysaccharide deacetylase 1328 2155 gene locus_tag LOCUS_16110 1328 2155 CDS product allantoin catabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383774.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence0442 1716 814 gene locus_tag LOCUS_16120 1716 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338667.1 protein_id gnl|my_center|LOCUS_16120 <2597 1713 gene locus_tag LOCUS_16130 <2597 1713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338668.1:ATPase AAA >Feature sequence0443 270 881 gene locus_tag LOCUS_16140 270 881 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538005.1 protein_id gnl|my_center|LOCUS_16140 936 1523 gene locus_tag LOCUS_16150 936 1523 CDS product N-acyl-L-homoserine lactone synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385295.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence0444 2043 871 gene locus_tag LOCUS_16160 gene dgt 2043 871 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J320 protein_id gnl|my_center|LOCUS_16160 2256 2588 gene locus_tag LOCUS_16170 2256 2588 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence0445 293 532 gene locus_tag LOCUS_16180 293 532 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337658.1 protein_id gnl|my_center|LOCUS_16180 1428 604 gene locus_tag LOCUS_16190 1428 604 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_16190 >Feature sequence0446 1192 2547 gene locus_tag LOCUS_16200 1192 2547 CDS product protein involved in propionate catabolism inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972972.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence0447 66 578 gene locus_tag LOCUS_16210 66 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 584 1876 gene locus_tag LOCUS_16220 584 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038965.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence0448 >Feature sequence0449 579 1355 gene locus_tag LOCUS_16230 gene cobV 579 1355 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3P7 protein_id gnl|my_center|LOCUS_16230 1956 1441 gene locus_tag LOCUS_16240 1956 1441 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence0450 187 816 gene locus_tag LOCUS_16250 gene gst 187 816 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571791.1 protein_id gnl|my_center|LOCUS_16250 816 1739 gene locus_tag LOCUS_16260 816 1739 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086554.1 protein_id gnl|my_center|LOCUS_16260 1841 2341 gene locus_tag LOCUS_16270 1841 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0451 1297 650 gene locus_tag LOCUS_16280 1297 650 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721366.1 protein_id gnl|my_center|LOCUS_16280 2261 1335 gene locus_tag LOCUS_16290 2261 1335 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338675.1 protein_id gnl|my_center|LOCUS_16290 2568 2359 gene locus_tag LOCUS_16300 2568 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence0452 2001 718 gene locus_tag LOCUS_16310 gene aglE 2001 718 CDS product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0453 877 1851 gene locus_tag LOCUS_16320 877 1851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339222.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence0454 758 2374 gene locus_tag LOCUS_16330 758 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537591.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence0455 >Feature sequence0456 1357 449 gene locus_tag LOCUS_16340 gene ycaN 1357 449 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207437.1 protein_id gnl|my_center|LOCUS_16340 1453 1923 gene locus_tag LOCUS_16350 1453 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1950 2279 gene locus_tag LOCUS_16360 1950 2279 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388091.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence0457 415 744 gene locus_tag LOCUS_16370 415 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389769.1 protein_id gnl|my_center|LOCUS_16370 1598 750 gene locus_tag LOCUS_16380 1598 750 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339073.1 protein_id gnl|my_center|LOCUS_16380 2203 1595 gene locus_tag LOCUS_16390 gene eda 2203 1595 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339194.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence0458 <1 1614 gene locus_tag LOCUS_16400 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001239259.1:DEAD/DEAH box helicase >Feature sequence0459 1480 2121 gene locus_tag LOCUS_16410 1480 2121 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence0460 386 1378 gene locus_tag LOCUS_16420 gene tsaD 386 1378 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPD3 protein_id gnl|my_center|LOCUS_16420 2106 1375 gene locus_tag LOCUS_16430 2106 1375 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence0461 <1 650 gene locus_tag LOCUS_16440 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535402.1:8-oxoguanine deaminase 682 1194 gene locus_tag LOCUS_16450 682 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720349.1 protein_id gnl|my_center|LOCUS_16450 1322 1825 gene locus_tag LOCUS_16460 1322 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 <2527 1887 gene locus_tag LOCUS_16470 <2527 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140073.1:guanine deaminase >Feature sequence0462 846 364 gene locus_tag LOCUS_16480 846 364 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888412.1 protein_id gnl|my_center|LOCUS_16480 1319 849 gene locus_tag LOCUS_16490 1319 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1726 1947 gene locus_tag LOCUS_16500 1726 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence0463 >Feature sequence0464 745 317 gene locus_tag LOCUS_16510 745 317 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122325.1 protein_id gnl|my_center|LOCUS_16510 1826 750 gene locus_tag LOCUS_16520 gene rsgA2 1826 750 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_16520 >Feature sequence0465 1138 2148 gene locus_tag LOCUS_16530 1138 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence0466 2471 1647 gene locus_tag LOCUS_16540 2471 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence0467 <1 712 gene locus_tag LOCUS_16550 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2W8:outer membrane protein assembly factor BamA 712 1422 gene locus_tag LOCUS_16560 712 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1583 2047 gene locus_tag LOCUS_16570 gene fabZ 1583 2047 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2W6 protein_id gnl|my_center|LOCUS_16570 >Feature sequence0468 2499 523 gene locus_tag LOCUS_16580 2499 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066951.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0469 735 1376 gene locus_tag LOCUS_16590 gene eda 735 1376 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719793.1 protein_id gnl|my_center|LOCUS_16590 1743 1435 gene locus_tag LOCUS_16600 1743 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719792.1 protein_id gnl|my_center|LOCUS_16600 <2499 1785 gene locus_tag LOCUS_16610 <2499 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J336:glutamate-ammonia-ligase adenylyltransferase >Feature sequence0470 451 188 gene locus_tag LOCUS_16620 451 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 812 1936 gene locus_tag LOCUS_16630 812 1936 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393451.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence0471 2149 848 gene locus_tag LOCUS_16640 2149 848 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0472 <1 921 gene locus_tag LOCUS_16650 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337346.1:tetracycline resistance MFS efflux pump 998 1210 gene locus_tag LOCUS_16660 998 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0473 1283 39 gene locus_tag LOCUS_16670 gene rpoN4 1283 39 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337807.1 protein_id gnl|my_center|LOCUS_16670 1402 2376 gene locus_tag LOCUS_16680 1402 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence0474 <1 1135 gene locus_tag LOCUS_16690 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974525.1:histidine kinase 1132 1779 gene locus_tag LOCUS_16700 1132 1779 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974526.1 protein_id gnl|my_center|LOCUS_16700 2055 1819 gene locus_tag LOCUS_16710 2055 1819 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence0475 <1 553 gene locus_tag LOCUS_16720 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707629.1:DNA-binding protein 1693 560 gene locus_tag LOCUS_16730 1693 560 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 protein_id gnl|my_center|LOCUS_16730 2009 2083 gene locus_tag LOCUS_t00150 2009 2083 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2423 2184 gene locus_tag LOCUS_16740 2423 2184 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974362.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence0476 1868 498 gene locus_tag LOCUS_16750 1868 498 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence0477 404 1231 gene locus_tag LOCUS_16760 gene dapD 404 1231 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5Q0 protein_id gnl|my_center|LOCUS_16760 1322 1564 gene locus_tag LOCUS_16770 1322 1564 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385353.1 protein_id gnl|my_center|LOCUS_16770 1660 2010 gene locus_tag LOCUS_16780 1660 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841891.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0478 <1 759 gene locus_tag LOCUS_16790 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970274.1:xylulokinase 846 1856 gene locus_tag LOCUS_16800 846 1856 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707199.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0479 858 61 gene locus_tag LOCUS_16810 858 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2398 1109 gene locus_tag LOCUS_16820 gene tyrS 2398 1109 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAG0 protein_id gnl|my_center|LOCUS_16820 >Feature sequence0480 1827 676 gene locus_tag LOCUS_16830 1827 676 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337288.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence0481 336 689 gene locus_tag LOCUS_16840 336 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537917.1 protein_id gnl|my_center|LOCUS_16840 686 1759 gene locus_tag LOCUS_16850 gene pyrD 686 1759 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ94 protein_id gnl|my_center|LOCUS_16850 <2467 1767 gene locus_tag LOCUS_16860 <2467 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337311.1:MATE family efflux transporter >Feature sequence0482 264 623 gene locus_tag LOCUS_16870 264 623 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG81 protein_id gnl|my_center|LOCUS_16870 628 1863 gene locus_tag LOCUS_16880 628 1863 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972222.1 protein_id gnl|my_center|LOCUS_16880 <2464 1871 gene locus_tag LOCUS_16890 <2464 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339421.1:galactose mutarotase >Feature sequence0483 1349 444 gene locus_tag LOCUS_16900 1349 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence0484 811 1452 gene locus_tag LOCUS_16910 811 1452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385577.1 protein_id gnl|my_center|LOCUS_16910 <2460 1711 gene locus_tag LOCUS_16920 <2460 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061405.1:LysR family transcriptional regulator >Feature sequence0485 1427 375 gene locus_tag LOCUS_16930 1427 375 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_16930 1426 1695 gene locus_tag LOCUS_16940 1426 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1706 2086 gene locus_tag LOCUS_16950 1706 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2138 2341 gene locus_tag LOCUS_16960 2138 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence0486 856 125 gene locus_tag LOCUS_16970 856 125 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 protein_id gnl|my_center|LOCUS_16970 1695 853 gene locus_tag LOCUS_16980 1695 853 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887377.1 protein_id gnl|my_center|LOCUS_16980 2454 1699 gene locus_tag LOCUS_16990 2454 1699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence0487 1178 285 gene locus_tag LOCUS_17000 1178 285 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093500.1 protein_id gnl|my_center|LOCUS_17000 1273 1581 gene locus_tag LOCUS_17010 1273 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence0488 492 1211 gene locus_tag LOCUS_17020 492 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 1208 1882 gene locus_tag LOCUS_17030 1208 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17030 2024 2284 gene locus_tag LOCUS_17040 2024 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence0489 439 1116 gene locus_tag LOCUS_17050 gene birA 439 1116 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140172.1 protein_id gnl|my_center|LOCUS_17050 1117 1896 gene locus_tag LOCUS_17060 gene coaX 1117 1896 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3E2 protein_id gnl|my_center|LOCUS_17060 >Feature sequence0490 757 437 gene locus_tag LOCUS_17070 gene nirD 757 437 CDS product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003519747.1 protein_id gnl|my_center|LOCUS_17070 <2446 754 gene locus_tag LOCUS_17080 <2446 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061458.1:nitrite reductase large subunit >Feature sequence0491 1358 690 gene locus_tag LOCUS_17090 1358 690 CDS product acyl CoA:acetate/3-ketoacid CoA transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525293.1 protein_id gnl|my_center|LOCUS_17090 2037 1345 gene locus_tag LOCUS_17100 2037 1345 CDS product acetyl-CoA--acetoacetyl-CoA transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389226.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence0492 <1 748 gene locus_tag LOCUS_17110 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813858.1:ABC transporter ATP-binding protein 774 1979 gene locus_tag LOCUS_17120 774 1979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence0493 303 668 gene locus_tag LOCUS_17130 303 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0494 1182 565 gene locus_tag LOCUS_17140 1182 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1396 1184 gene locus_tag LOCUS_17150 1396 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1630 1448 gene locus_tag LOCUS_17160 1630 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 <2435 1630 gene locus_tag LOCUS_17170 <2435 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537717.1:Fe-S cluster assembly protein SufB >Feature sequence0495 >Feature sequence0496 268 1212 gene locus_tag LOCUS_17180 268 1212 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_17180 1640 1230 gene locus_tag LOCUS_17190 1640 1230 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537899.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence0497 1052 699 gene locus_tag LOCUS_17200 1052 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1329 1039 gene locus_tag LOCUS_17210 gene cheL 1329 1039 CDS product peptidoglycan hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385132.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence0498 <1 1222 gene locus_tag LOCUS_17220 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707562.1:protein norD 2147 1212 gene locus_tag LOCUS_17230 gene cbbR 2147 1212 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338845.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence0499 225 860 gene locus_tag LOCUS_17240 gene dnaJ 225 860 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384513.1 protein_id gnl|my_center|LOCUS_17240 1929 952 gene locus_tag LOCUS_17250 1929 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003633.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0500 <1 523 gene locus_tag LOCUS_17260 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338666.1:LytTR family transcriptional regulator >Feature sequence0501 1611 508 gene locus_tag LOCUS_17270 1611 508 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706460.1 protein_id gnl|my_center|LOCUS_17270 <2417 1613 gene locus_tag LOCUS_17280 <2417 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706461.1:BMP family ABC transporter substrate-binding protein >Feature sequence0502 382 1059 gene locus_tag LOCUS_17290 382 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 1693 1262 gene locus_tag LOCUS_17300 1693 1262 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388135.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence0503 101 817 gene locus_tag LOCUS_17310 101 817 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336798.1 protein_id gnl|my_center|LOCUS_17310 900 2135 gene locus_tag LOCUS_17320 900 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385402.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence0504 1651 599 gene locus_tag LOCUS_17330 1651 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_17330 2059 1688 gene locus_tag LOCUS_17340 2059 1688 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence0505 2195 1419 gene locus_tag LOCUS_17350 2195 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0506 958 260 gene locus_tag LOCUS_17360 958 260 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014162.1 protein_id gnl|my_center|LOCUS_17360 <2411 955 gene locus_tag LOCUS_17370 <2411 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383344.1:ACR family transporter >Feature sequence0507 2391 2191 gene locus_tag LOCUS_17380 2391 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0508 >Feature sequence0509 954 25 gene locus_tag LOCUS_17390 954 25 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_17390 1917 1123 gene locus_tag LOCUS_17400 gene sohB 1917 1123 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338698.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence0510 <1 922 gene locus_tag LOCUS_17410 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719967.1:nitrogen regulation protein NR(I) >Feature sequence0511 661 2235 gene locus_tag LOCUS_17420 661 2235 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969283.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence0512 <1 888 gene locus_tag LOCUS_17430 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918501.1:nitrite reductase large subunit >Feature sequence0513 666 274 gene locus_tag LOCUS_17440 666 274 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 protein_id gnl|my_center|LOCUS_17440 747 2075 gene locus_tag LOCUS_17450 747 2075 CDS product ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338885.1 protein_id gnl|my_center|LOCUS_17450 2392 2072 gene locus_tag LOCUS_17460 2392 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence0514 >Feature sequence0515 124 1215 gene locus_tag LOCUS_17470 124 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336820.1 protein_id gnl|my_center|LOCUS_17470 1592 2215 gene locus_tag LOCUS_17480 gene clpP 1592 2215 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1G6 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0516 328 62 gene locus_tag LOCUS_17490 328 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 812 459 gene locus_tag LOCUS_17500 812 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1177 1320 gene locus_tag LOCUS_17510 1177 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence0517 1243 98 gene locus_tag LOCUS_17520 gene mnmA 1243 98 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_17520 1369 1647 gene locus_tag LOCUS_17530 1369 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719769.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence0518 1515 250 gene locus_tag LOCUS_17540 gene pyrC 1515 250 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ48 protein_id gnl|my_center|LOCUS_17540 2027 1512 gene locus_tag LOCUS_17550 2027 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0519 211 699 gene locus_tag LOCUS_17560 211 699 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence0520 575 198 gene locus_tag LOCUS_17570 575 198 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562919.1 protein_id gnl|my_center|LOCUS_17570 1315 572 gene locus_tag LOCUS_17580 1315 572 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_17580 1522 1607 gene locus_tag LOCUS_t00160 1522 1607 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0521 532 1515 gene locus_tag LOCUS_17590 532 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2164 1934 gene locus_tag LOCUS_17600 2164 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence0522 89 1336 gene locus_tag LOCUS_17610 89 1336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392994.1 protein_id gnl|my_center|LOCUS_17610 1401 2255 gene locus_tag LOCUS_17620 gene cpdA 1401 2255 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0523 493 1515 gene locus_tag LOCUS_17630 gene asd 493 1515 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY28 protein_id gnl|my_center|LOCUS_17630 >Feature sequence0524 <1 765 gene locus_tag LOCUS_17640 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583525.1:ABC transporter ATP-binding protein >Feature sequence0525 1377 493 gene locus_tag LOCUS_17650 1377 493 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968108.1 protein_id gnl|my_center|LOCUS_17650 <2366 1403 gene locus_tag LOCUS_17660 <2366 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535402.1:8-oxoguanine deaminase >Feature sequence0526 653 1108 gene locus_tag LOCUS_17670 653 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1565 1131 gene locus_tag LOCUS_17680 1565 1131 CDS product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0527 515 108 gene locus_tag LOCUS_17690 515 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_17690 677 1432 gene locus_tag LOCUS_17700 677 1432 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707992.1 protein_id gnl|my_center|LOCUS_17700 1435 2034 gene locus_tag LOCUS_17710 1435 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence0528 >Feature sequence0529 <1 1013 gene locus_tag LOCUS_17720 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0Z3:adenylosuccinate synthetase 1022 1258 gene locus_tag LOCUS_17730 1022 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0530 <1 690 gene locus_tag LOCUS_17740 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3HKG3:transport permease protein >Feature sequence0531 1802 576 gene locus_tag LOCUS_17750 gene wecE 1802 576 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0532 >Feature sequence0533 1873 893 gene locus_tag LOCUS_17760 1873 893 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389120.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0534 2063 588 gene locus_tag LOCUS_17770 2063 588 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence0535 >Feature sequence0536 376 221 gene locus_tag LOCUS_17780 376 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1129 488 gene locus_tag LOCUS_17790 1129 488 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537566.1 protein_id gnl|my_center|LOCUS_17790 <2332 1294 gene locus_tag LOCUS_17800 <2332 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389303.1:cystathionine beta-lyase >Feature sequence0537 938 81 gene locus_tag LOCUS_17810 938 81 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_17810 1805 954 gene locus_tag LOCUS_17820 1805 954 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence0538 265 1179 gene locus_tag LOCUS_17830 gene glxA 265 1179 CDS product HTH-type transcriptional regulator GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87389 protein_id gnl|my_center|LOCUS_17830 <2331 1235 gene locus_tag LOCUS_17840 <2331 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067497.1:type III glutamate--ammonia ligase >Feature sequence0539 928 317 gene locus_tag LOCUS_17850 928 317 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_17850 <2328 930 gene locus_tag LOCUS_17860 <2328 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086439.1:FAD-binding dehydrogenase >Feature sequence0540 36 569 gene locus_tag LOCUS_17870 36 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 protein_id gnl|my_center|LOCUS_17870 1080 580 gene locus_tag LOCUS_17880 1080 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 protein_id gnl|my_center|LOCUS_17880 <2325 1151 gene locus_tag LOCUS_17890 <2325 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338785.1:RNA methyltransferase >Feature sequence0541 <1 1134 gene locus_tag LOCUS_17900 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:C4-dicarboxylate ABC transporter permease 1220 2278 gene locus_tag LOCUS_17910 gene macA 1220 2278 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence0542 727 2181 gene locus_tag LOCUS_17920 gene zwf 727 2181 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6U6 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0543 2121 1996 gene locus_tag LOCUS_17930 2121 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence0544 <2321 1647 gene locus_tag LOCUS_17940 <2321 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537423.1:nucleotidyltransferase >Feature sequence0545 1484 2200 gene locus_tag LOCUS_17950 1484 2200 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence0546 1474 725 gene locus_tag LOCUS_17960 1474 725 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_17960 2258 1485 gene locus_tag LOCUS_17970 2258 1485 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence0547 461 1648 gene locus_tag LOCUS_17980 gene pgk 461 1648 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I6 protein_id gnl|my_center|LOCUS_17980 >Feature sequence0548 <1 1395 gene locus_tag LOCUS_17990 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZI8:3-isopropylmalate dehydratase large subunit >Feature sequence0549 <2302 1669 gene locus_tag LOCUS_18000 <2302 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729469.1:2OG-Fe(II) oxygenase >Feature sequence0550 1140 2045 gene locus_tag LOCUS_18010 gene coxII 1140 2045 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G0 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0551 <1 777 gene locus_tag LOCUS_18020 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140038.1:ATP synthase subunit beta 774 1532 gene locus_tag LOCUS_18030 774 1532 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J663 protein_id gnl|my_center|LOCUS_18030 1877 1996 gene locus_tag LOCUS_18040 1877 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence0552 <1 776 gene locus_tag LOCUS_18050 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5L4:acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha 1424 819 gene locus_tag LOCUS_18060 1424 819 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920433.1 protein_id gnl|my_center|LOCUS_18060 2225 1482 gene locus_tag LOCUS_18070 2225 1482 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338448.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence0553 1582 1295 gene locus_tag LOCUS_18080 gene gatC 1582 1295 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 protein_id gnl|my_center|LOCUS_18080 <2287 1650 gene locus_tag LOCUS_18090 <2287 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140133.1:membrane protein >Feature sequence0554 <1 891 gene locus_tag LOCUS_18100 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338906.1:ATP-dependent DNA helicase RecQ <2284 911 gene locus_tag LOCUS_18110 <2284 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338904.1:sensor histidine kinase >Feature sequence0555 <1 1060 gene locus_tag LOCUS_18120 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337854.1:type I secretion protein <2283 1267 gene locus_tag LOCUS_18130 <2283 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000122710.1:MFS transporter >Feature sequence0556 >Feature sequence0557 1605 322 gene locus_tag LOCUS_18140 1605 322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533096.1 protein_id gnl|my_center|LOCUS_18140 2203 1769 gene locus_tag LOCUS_18150 2203 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence0558 <1 1533 gene locus_tag LOCUS_18160 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003581.1:ATP-dependent helicase MgpS 1560 1955 gene locus_tag LOCUS_18170 1560 1955 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence0559 1915 899 gene locus_tag LOCUS_18180 1915 899 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331274.1 protein_id gnl|my_center|LOCUS_18180 2179 1922 gene locus_tag LOCUS_18190 2179 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence0560 <1 863 gene locus_tag LOCUS_18200 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530537.1:AraC family transcriptional regulator 1202 831 gene locus_tag LOCUS_18210 1202 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1870 1292 gene locus_tag LOCUS_18220 1870 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence0561 478 1185 gene locus_tag LOCUS_18230 478 1185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_18230 1186 2199 gene locus_tag LOCUS_18240 1186 2199 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence0562 512 2119 gene locus_tag LOCUS_18250 512 2119 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104293.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence0563 539 27 gene locus_tag LOCUS_18260 539 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1162 536 gene locus_tag LOCUS_18270 1162 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1902 1450 gene locus_tag LOCUS_18280 1902 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0564 1863 325 gene locus_tag LOCUS_18290 1863 325 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 protein_id gnl|my_center|LOCUS_18290 2248 1877 gene locus_tag LOCUS_18300 2248 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence0565 <1 1990 gene locus_tag LOCUS_18310 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538175.1:integrase >Feature sequence0566 1160 972 gene locus_tag LOCUS_18320 1160 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1111 1572 gene locus_tag LOCUS_18330 1111 1572 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_18330 1572 2015 gene locus_tag LOCUS_18340 1572 2015 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence0567 2012 1518 gene locus_tag LOCUS_18350 2012 1518 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence0568 <1 1401 gene locus_tag LOCUS_18360 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704330.1:C4-dicarboxylate ABC transporter 1398 1829 gene locus_tag LOCUS_18370 1398 1829 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0569 818 501 gene locus_tag LOCUS_18380 818 501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_18380 1068 889 gene locus_tag LOCUS_18390 1068 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1485 1072 gene locus_tag LOCUS_18400 1485 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 <2232 1476 gene locus_tag LOCUS_18410 <2232 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089212.1:hydrolase glyoxylase >Feature sequence0570 505 38 gene locus_tag LOCUS_18420 gene nrdR 505 38 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W6 protein_id gnl|my_center|LOCUS_18420 1058 639 gene locus_tag LOCUS_18430 1058 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976348.1 protein_id gnl|my_center|LOCUS_18430 1543 1055 gene locus_tag LOCUS_18440 1543 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1877 1617 gene locus_tag LOCUS_18450 1877 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence0571 <1 1119 gene locus_tag LOCUS_18460 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974504.1:alpha-glucosidase >Feature sequence0572 >Feature sequence0573 297 1490 gene locus_tag LOCUS_18470 gene yjiB 297 1490 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_18470 1502 2137 gene locus_tag LOCUS_18480 1502 2137 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707287.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence0574 >Feature sequence0575 121 1551 gene locus_tag LOCUS_18490 gene pykA 121 1551 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M1 protein_id gnl|my_center|LOCUS_18490 1585 1809 gene locus_tag LOCUS_18500 1585 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 1942 2142 gene locus_tag LOCUS_18510 gene rpmI 1942 2142 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A5 protein_id gnl|my_center|LOCUS_18510 >Feature sequence0576 1095 109 gene locus_tag LOCUS_18520 gene ftsQ 1095 109 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L7 protein_id gnl|my_center|LOCUS_18520 2000 1083 gene locus_tag LOCUS_18530 gene ddl 2000 1083 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L8 protein_id gnl|my_center|LOCUS_18530 >Feature sequence0577 761 330 gene locus_tag LOCUS_18540 761 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1028 2149 gene locus_tag LOCUS_18550 1028 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence0578 1184 468 gene locus_tag LOCUS_18560 1184 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719167.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence0579 52 309 gene locus_tag LOCUS_18570 52 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1673 450 gene locus_tag LOCUS_18580 1673 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence0580 >Feature sequence0581 2184 685 gene locus_tag LOCUS_18590 2184 685 CDS product 2-keto-gluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence0582 1829 846 gene locus_tag LOCUS_18600 1829 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence0583 14 847 gene locus_tag LOCUS_18610 14 847 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338780.1 protein_id gnl|my_center|LOCUS_18610 901 1986 gene locus_tag LOCUS_18620 gene HemH 901 1986 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYK5 protein_id gnl|my_center|LOCUS_18620 >Feature sequence0584 <2176 1034 gene locus_tag LOCUS_18630 <2176 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061602.1:CoA transferase >Feature sequence0585 229 696 gene locus_tag LOCUS_18640 gene nifU 229 696 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_18640 736 2142 gene locus_tag LOCUS_18650 736 2142 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence0586 160 717 gene locus_tag LOCUS_18660 160 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 990 790 gene locus_tag LOCUS_18670 990 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1833 1042 gene locus_tag LOCUS_18680 1833 1042 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086215.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence0587 <1 559 gene locus_tag LOCUS_18690 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727685.1:aldehyde dehydrogenase 560 1309 gene locus_tag LOCUS_18700 560 1309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815420.1 protein_id gnl|my_center|LOCUS_18700 1980 1327 gene locus_tag LOCUS_18710 1980 1327 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814914.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence0588 321 1109 gene locus_tag LOCUS_18720 321 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1228 2046 gene locus_tag LOCUS_18730 1228 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence0589 >Feature sequence0590 1704 1060 gene locus_tag LOCUS_18740 1704 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence0591 90 545 gene locus_tag LOCUS_18750 90 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence0592 110 769 gene locus_tag LOCUS_18760 110 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 864 1298 gene locus_tag LOCUS_18770 gene gloA1 864 1298 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY85 protein_id gnl|my_center|LOCUS_18770 2035 1838 gene locus_tag LOCUS_18780 2035 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence0593 664 437 gene locus_tag LOCUS_18790 664 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18790 989 675 gene locus_tag LOCUS_18800 989 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383954.1 protein_id gnl|my_center|LOCUS_18800 1406 993 gene locus_tag LOCUS_18810 1406 993 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383953.1 protein_id gnl|my_center|LOCUS_18810 1842 1432 gene locus_tag LOCUS_18820 1842 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337514.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence0594 >Feature sequence0595 <2134 913 gene locus_tag LOCUS_18830 <2134 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63UC8:urocanate hydratase >Feature sequence0596 768 1172 gene locus_tag LOCUS_18840 768 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2036 1245 gene locus_tag LOCUS_18850 gene trmJ 2036 1245 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXX1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0597 149 697 gene locus_tag LOCUS_18860 149 697 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562223.1 protein_id gnl|my_center|LOCUS_18860 1429 836 gene locus_tag LOCUS_18870 1429 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0598 781 20 gene locus_tag LOCUS_18880 gene pdxJ 781 20 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W4 protein_id gnl|my_center|LOCUS_18880 1537 881 gene locus_tag LOCUS_18890 1537 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336935.1 protein_id gnl|my_center|LOCUS_18890 <2127 1562 gene locus_tag LOCUS_18900 <2127 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009561565.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence0599 1009 320 gene locus_tag LOCUS_18910 1009 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1410 1279 gene locus_tag LOCUS_18920 1410 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2094 1597 gene locus_tag LOCUS_18930 2094 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0600 2034 478 gene locus_tag LOCUS_18940 2034 478 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384909.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0601 <1 1250 gene locus_tag LOCUS_18950 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918232.1:methyl-accepting chemotaxis protein >Feature sequence0602 383 138 gene locus_tag LOCUS_18960 383 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 887 468 gene locus_tag LOCUS_18970 887 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1890 1093 gene locus_tag LOCUS_18980 1890 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence0603 >Feature sequence0604 914 2059 gene locus_tag LOCUS_18990 914 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence0605 >Feature sequence0606 904 1149 gene locus_tag LOCUS_19000 904 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0607 3 1142 gene locus_tag LOCUS_19010 3 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1121 2020 gene locus_tag LOCUS_19020 gene nosX 1121 2020 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ4 protein_id gnl|my_center|LOCUS_19020 >Feature sequence0608 1580 879 gene locus_tag LOCUS_19030 1580 879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707299.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence0609 494 1519 gene locus_tag LOCUS_19040 494 1519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969953.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence0610 >Feature sequence0611 1527 850 gene locus_tag LOCUS_19050 1527 850 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY67 protein_id gnl|my_center|LOCUS_19050 <2101 1539 gene locus_tag LOCUS_19060 <2101 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385131.1:flagellar hook-length control protein >Feature sequence0612 >Feature sequence0613 452 1411 gene locus_tag LOCUS_19070 gene mcl1 452 1411 CDS product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L6 protein_id gnl|my_center|LOCUS_19070 1953 1489 gene locus_tag LOCUS_19080 1953 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence0614 2 1153 gene locus_tag LOCUS_19090 2 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1458 1240 gene locus_tag LOCUS_19100 1458 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530530.1 protein_id gnl|my_center|LOCUS_19100 <2092 1573 gene locus_tag LOCUS_19110 <2092 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709397.1:alpha-D-glucose phosphate-specific phosphoglucomutase >Feature sequence0615 2089 1250 gene locus_tag LOCUS_19120 2089 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence0616 <1 548 gene locus_tag LOCUS_19130 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970038.1:oxidoreductase 643 1311 gene locus_tag LOCUS_19140 643 1311 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269242.1 protein_id gnl|my_center|LOCUS_19140 1338 1901 gene locus_tag LOCUS_19150 1338 1901 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 protein_id gnl|my_center|LOCUS_19150 2088 1927 gene locus_tag LOCUS_19160 2088 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence0617 <1 584 gene locus_tag LOCUS_19170 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707312.1:diacylglycerol kinase 683 2035 gene locus_tag LOCUS_19180 683 2035 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974998.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence0618 >Feature sequence0619 552 1313 gene locus_tag LOCUS_19190 552 1313 CDS product ornithine-acyl-ACP acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337612.1 protein_id gnl|my_center|LOCUS_19190 1463 1987 gene locus_tag LOCUS_19200 1463 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence0620 746 558 gene locus_tag LOCUS_19210 746 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 954 1175 gene locus_tag LOCUS_19220 954 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1249 1524 gene locus_tag LOCUS_19230 1249 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1625 1780 gene locus_tag LOCUS_19240 1625 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0621 1222 710 gene locus_tag LOCUS_19250 1222 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1420 1710 gene locus_tag LOCUS_19260 1420 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722131.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence0622 254 712 gene locus_tag LOCUS_19270 gene cycP 254 712 CDS product cytochrome c' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00148 protein_id gnl|my_center|LOCUS_19270 735 1328 gene locus_tag LOCUS_19280 735 1328 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338252.1 protein_id gnl|my_center|LOCUS_19280 1803 1336 gene locus_tag LOCUS_19290 1803 1336 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337040.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence0623 966 196 gene locus_tag LOCUS_19300 966 196 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537939.1 protein_id gnl|my_center|LOCUS_19300 1449 1225 gene locus_tag LOCUS_19310 1449 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence0624 3 644 gene locus_tag LOCUS_19320 3 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 683 1222 gene locus_tag LOCUS_19330 683 1222 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389882.1 protein_id gnl|my_center|LOCUS_19330 1870 1346 gene locus_tag LOCUS_19340 1870 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0625 1310 237 gene locus_tag LOCUS_19350 gene queA 1310 237 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J252 protein_id gnl|my_center|LOCUS_19350 >Feature sequence0626 1906 620 gene locus_tag LOCUS_19360 1906 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence0627 481 1878 gene locus_tag LOCUS_19370 481 1878 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence0628 122 1054 gene locus_tag LOCUS_19380 122 1054 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_19380 1192 1989 gene locus_tag LOCUS_19390 1192 1989 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086441.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence0629 1208 282 gene locus_tag LOCUS_19400 1208 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1805 1344 gene locus_tag LOCUS_19410 1805 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708037.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence0630 <1 1171 gene locus_tag LOCUS_19420 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337818.1:hybrid sensor histidine kinase/response regulator 1967 1188 gene locus_tag LOCUS_19430 1967 1188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975093.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence0631 1220 660 gene locus_tag LOCUS_19440 1220 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338151.1 protein_id gnl|my_center|LOCUS_19440 1905 1456 gene locus_tag LOCUS_19450 gene ccmH 1905 1456 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 protein_id gnl|my_center|LOCUS_19450 2060 1902 gene locus_tag LOCUS_19460 2060 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence0632 >Feature sequence0633 354 920 gene locus_tag LOCUS_19470 354 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337609.1 protein_id gnl|my_center|LOCUS_19470 1264 1470 gene locus_tag LOCUS_19480 gene rpmF 1264 1470 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J363 protein_id gnl|my_center|LOCUS_19480 >Feature sequence0634 1060 74 gene locus_tag LOCUS_19490 1060 74 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338241.1 protein_id gnl|my_center|LOCUS_19490 <2060 1193 gene locus_tag LOCUS_19500 <2060 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3HKL8:molybdenum import ATP-binding protein ModC >Feature sequence0635 64 1047 gene locus_tag LOCUS_19510 64 1047 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720324.1 protein_id gnl|my_center|LOCUS_19510 1992 1099 gene locus_tag LOCUS_19520 1992 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence0636 1625 126 gene locus_tag LOCUS_19530 1625 126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969959.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence0637 447 193 gene locus_tag LOCUS_19540 447 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 988 440 gene locus_tag LOCUS_19550 988 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227331.1 protein_id gnl|my_center|LOCUS_19550 1896 997 gene locus_tag LOCUS_19560 1896 997 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0638 >Feature sequence0639 919 707 gene locus_tag LOCUS_19570 919 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 <2049 1017 gene locus_tag LOCUS_19580 <2049 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337307.1:acyl-CoA dehydrogenase >Feature sequence0640 743 453 gene locus_tag LOCUS_19590 743 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 1380 1162 gene locus_tag LOCUS_19600 1380 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 <2048 1377 gene locus_tag LOCUS_19610 <2048 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919173.1:inositol 2-dehydrogenase >Feature sequence0641 957 364 gene locus_tag LOCUS_19620 957 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 <2042 1108 gene locus_tag LOCUS_19630 <2042 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200942.1:alcohol dehydrogenase >Feature sequence0642 319 693 gene locus_tag LOCUS_19640 319 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1150 671 gene locus_tag LOCUS_19650 1150 671 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338561.1 protein_id gnl|my_center|LOCUS_19650 <2042 1147 gene locus_tag LOCUS_19660 <2042 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708348.1:cobaltochelatase subunit CobN >Feature sequence0643 >Feature sequence0644 684 448 gene locus_tag LOCUS_19670 684 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 972 1595 gene locus_tag LOCUS_19680 972 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1686 1970 gene locus_tag LOCUS_19690 1686 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence0645 1525 998 gene locus_tag LOCUS_19700 1525 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 <2034 1529 gene locus_tag LOCUS_19710 <2034 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870197.1:C4-dicarboxylate ABC transporter substrate-binding protein >Feature sequence0646 1708 671 gene locus_tag LOCUS_19720 1708 671 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0647 <1 579 gene locus_tag LOCUS_19730 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196222.1:LysR family transcriptional regulator 1801 635 gene locus_tag LOCUS_19740 1801 635 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088437.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence0648 952 287 gene locus_tag LOCUS_19750 952 287 CDS product protein NnrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390538.1 protein_id gnl|my_center|LOCUS_19750 <2022 966 gene locus_tag LOCUS_19760 <2022 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089820.1:short-chain dehydrogenase >Feature sequence0649 <1 1400 gene locus_tag LOCUS_19770 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y9Z2:urease subunit alpha 1763 1434 gene locus_tag LOCUS_19780 1763 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0650 <1 1251 gene locus_tag LOCUS_19790 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338040.1:sodium:solute symporter >Feature sequence0651 363 1445 gene locus_tag LOCUS_19800 363 1445 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence0652 <2002 121 gene locus_tag LOCUS_19810 <2002 121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI5:DNA mismatch repair protein MutS >Feature sequence0653 <2001 1044 gene locus_tag LOCUS_19820 <2001 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAL8:DNA-directed DNA polymerase >Feature sequence0654 209 949 gene locus_tag LOCUS_19830 209 949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338132.1 protein_id gnl|my_center|LOCUS_19830 963 1661 gene locus_tag LOCUS_19840 963 1661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338131.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence0655 >Feature sequence0656 499 44 gene locus_tag LOCUS_19850 499 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1379 576 gene locus_tag LOCUS_19860 1379 576 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_19860 <1999 1376 gene locus_tag LOCUS_19870 <1999 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103268.1:2OG-Fe(II) oxygenase >Feature sequence0657 133 849 gene locus_tag LOCUS_19880 133 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 976 1791 gene locus_tag LOCUS_19890 976 1791 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969279.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence0658 <1 609 gene locus_tag LOCUS_19900 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ78:mesaconyl-CoA hydratase 926 1315 gene locus_tag LOCUS_19910 gene sdhC 926 1315 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382963.1 protein_id gnl|my_center|LOCUS_19910 1326 1697 gene locus_tag LOCUS_19920 1326 1697 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721269.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence0659 633 1811 gene locus_tag LOCUS_19930 gene patB 633 1811 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence0660 >Feature sequence0661 1507 584 gene locus_tag LOCUS_19940 gene potB 1507 584 CDS product spermidine/putrescine transport system permease protein PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45170 protein_id gnl|my_center|LOCUS_19940 >Feature sequence0662 708 163 gene locus_tag LOCUS_19950 708 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19950 <1984 721 gene locus_tag LOCUS_19960 <1984 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721575.1:glutamate synthase note possible pseudo, internal stop codon >Feature sequence0663 1415 510 gene locus_tag LOCUS_19970 1415 510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721410.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence0664 949 50 gene locus_tag LOCUS_19980 949 50 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527974.1 protein_id gnl|my_center|LOCUS_19980 <1981 946 gene locus_tag LOCUS_19990 <1981 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527973.1:ABC transporter permease >Feature sequence0665 874 404 gene locus_tag LOCUS_20000 gene ccmH 874 404 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45405 protein_id gnl|my_center|LOCUS_20000 1436 876 gene locus_tag LOCUS_20010 1436 876 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_20010 1922 1440 gene locus_tag LOCUS_20020 1922 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0666 <1 1216 gene locus_tag LOCUS_20030 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808822.1:aldehyde dehydrogenase <1973 1213 gene locus_tag LOCUS_20040 <1973 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975808.1:transcriptional regulator >Feature sequence0667 <1 725 gene locus_tag LOCUS_20050 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338701.1:formate dehydrogenase subunit alpha 722 1495 gene locus_tag LOCUS_20060 gene fdsC 722 1495 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYW9 protein_id gnl|my_center|LOCUS_20060 1492 1695 gene locus_tag LOCUS_20070 gene fdsD 1492 1695 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970348.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0668 137 700 gene locus_tag LOCUS_20080 137 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_20080 700 1458 gene locus_tag LOCUS_20090 700 1458 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7E6 protein_id gnl|my_center|LOCUS_20090 <1970 1465 gene locus_tag LOCUS_20100 <1970 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122027.1:cation efflux system protein >Feature sequence0669 54 407 gene locus_tag LOCUS_20110 54 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1668 793 gene locus_tag LOCUS_20120 1668 793 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence0670 <1966 490 gene locus_tag LOCUS_20130 <1966 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J317:glycerol kinase >Feature sequence0671 587 721 gene locus_tag LOCUS_20140 587 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 746 904 gene locus_tag LOCUS_20150 746 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1118 1714 gene locus_tag LOCUS_20160 1118 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence0672 <1 610 gene locus_tag LOCUS_20170 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338750.1:3-beta-hydroxy-Delta(5)-steroid dehydrogenase 1467 661 gene locus_tag LOCUS_20180 gene uppP 1467 661 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ4 protein_id gnl|my_center|LOCUS_20180 >Feature sequence0673 1002 1313 gene locus_tag LOCUS_20190 1002 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529087.1 protein_id gnl|my_center|LOCUS_20190 1776 1318 gene locus_tag LOCUS_20200 1776 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence0674 861 193 gene locus_tag LOCUS_20210 861 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272839.1 protein_id gnl|my_center|LOCUS_20210 932 1717 gene locus_tag LOCUS_20220 932 1717 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529834.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence0675 <1 1052 gene locus_tag LOCUS_20230 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538073.1:ammonia monooxygenase >Feature sequence0676 682 176 gene locus_tag LOCUS_20240 682 176 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384580.1 protein_id gnl|my_center|LOCUS_20240 1669 683 gene locus_tag LOCUS_20250 1669 683 CDS product periplasmic substrate-binding transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence0677 312 1112 gene locus_tag LOCUS_20260 312 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence0678 174 653 gene locus_tag LOCUS_20270 174 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 811 1368 gene locus_tag LOCUS_20280 811 1368 CDS product twin-arginine translocation pathway signal sequence domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537588.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence0679 882 1850 gene locus_tag LOCUS_20290 882 1850 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence0680 908 75 gene locus_tag LOCUS_20300 908 75 CDS product phenazine antibiotic biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709313.1 protein_id gnl|my_center|LOCUS_20300 1945 905 gene locus_tag LOCUS_20310 gene nhaP 1945 905 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_20310 >Feature sequence0681 954 601 gene locus_tag LOCUS_20320 gene rpoZ 954 601 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W7 protein_id gnl|my_center|LOCUS_20320 1615 1037 gene locus_tag LOCUS_20330 gene FolK 1615 1037 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336934.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence0682 <1 1809 gene locus_tag LOCUS_20340 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYN1:protein translocase subunit SecA >Feature sequence0683 61 426 gene locus_tag LOCUS_20350 61 426 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967915.1 protein_id gnl|my_center|LOCUS_20350 413 712 gene locus_tag LOCUS_20360 413 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence0684 >Feature sequence0685 548 835 gene locus_tag LOCUS_20370 548 835 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140014.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence0686 1277 540 gene locus_tag LOCUS_20380 1277 540 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338103.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence0687 1949 891 gene locus_tag LOCUS_20390 1949 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence0688 855 37 gene locus_tag LOCUS_20400 855 37 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338406.1 protein_id gnl|my_center|LOCUS_20400 <1949 897 gene locus_tag LOCUS_20410 <1949 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338405.1:DNA polymerase III subunit delta' >Feature sequence0689 >Feature sequence0690 <1 1159 gene locus_tag LOCUS_20420 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000150113.1:salicylate hydroxylase 1192 1890 gene locus_tag LOCUS_20430 1192 1890 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531256.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence0691 <1 777 gene locus_tag LOCUS_20440 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975704.1:CoA transferase 799 1920 gene locus_tag LOCUS_20450 799 1920 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence0692 <1938 962 gene locus_tag LOCUS_20460 <1938 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031698.1:bicyclomycin resistance protein >Feature sequence0693 1432 89 gene locus_tag LOCUS_20470 1432 89 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720539.1 protein_id gnl|my_center|LOCUS_20470 <1935 1429 gene locus_tag LOCUS_20480 <1935 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720538.1:amino acid ABC transporter permease >Feature sequence0694 358 1083 gene locus_tag LOCUS_20490 gene exoI 358 1083 CDS product succinoglycan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037197.1 protein_id gnl|my_center|LOCUS_20490 1157 1232 gene locus_tag LOCUS_t00170 1157 1232 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1339 1611 gene locus_tag LOCUS_20500 1339 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1791 1867 gene locus_tag LOCUS_t00180 1791 1867 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0695 1015 191 gene locus_tag LOCUS_20510 1015 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722722.1 protein_id gnl|my_center|LOCUS_20510 1503 1012 gene locus_tag LOCUS_20520 1503 1012 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563763.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence0696 69 458 gene locus_tag LOCUS_20530 69 458 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384895.1 protein_id gnl|my_center|LOCUS_20530 638 1333 gene locus_tag LOCUS_20540 gene TolQ 638 1333 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720852.1 protein_id gnl|my_center|LOCUS_20540 1335 1802 gene locus_tag LOCUS_20550 1335 1802 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence0697 186 1184 gene locus_tag LOCUS_20560 186 1184 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339542.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence0698 <1 921 gene locus_tag LOCUS_20570 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563827.1:pilus assembly protein TadB 941 1924 gene locus_tag LOCUS_20580 941 1924 CDS product pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337064.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence0699 >Feature sequence0700 544 828 gene locus_tag LOCUS_20590 544 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1150 1809 gene locus_tag LOCUS_20600 1150 1809 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338579.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence0701 <1 895 gene locus_tag LOCUS_20610 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337061.1:ATPase 1019 1822 gene locus_tag LOCUS_20620 gene garR 1019 1822 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765818.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0702 1193 1807 gene locus_tag LOCUS_20630 1193 1807 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708997.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence0703 <1 621 gene locus_tag LOCUS_20640 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393449.1:ABC transporter permease 623 1558 gene locus_tag LOCUS_20650 623 1558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence0704 69 1778 gene locus_tag LOCUS_20660 69 1778 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338456.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence0705 >Feature sequence0706 <1922 758 gene locus_tag LOCUS_20670 <1922 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190520.1:NADPH-dependent 2,4-dienoyl-CoA reductase >Feature sequence0707 <1 1185 gene locus_tag LOCUS_20680 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5D8:phosphoribosylamine--glycine ligase >Feature sequence0708 115 411 gene locus_tag LOCUS_20690 115 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 573 842 gene locus_tag LOCUS_20700 gene rpsO 573 842 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Q0 protein_id gnl|my_center|LOCUS_20700 1733 996 gene locus_tag LOCUS_20710 1733 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence0709 <1 1728 gene locus_tag LOCUS_20720 <1 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5C7:glycine--tRNA ligase beta subunit >Feature sequence0710 1619 852 gene locus_tag LOCUS_20730 1619 852 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269161.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence0711 462 635 gene locus_tag LOCUS_20740 462 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence0712 <1909 1133 gene locus_tag LOCUS_20750 <1909 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I1V2:4-alpha-glucanotransferase >Feature sequence0713 <1 1375 gene locus_tag LOCUS_20760 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730671.1:AMP-dependent synthetase >Feature sequence0714 1210 602 gene locus_tag LOCUS_20770 1210 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722170.1 protein_id gnl|my_center|LOCUS_20770 1570 1268 gene locus_tag LOCUS_20780 1570 1268 CDS product septum formation initiator precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719640.1 protein_id gnl|my_center|LOCUS_20780 1903 1781 gene locus_tag LOCUS_20790 1903 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0715 1354 485 gene locus_tag LOCUS_20800 1354 485 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence0716 <1 628 gene locus_tag LOCUS_20810 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337103.1:cytochrome P450 681 1487 gene locus_tag LOCUS_20820 gene trpC 681 1487 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_20820 >Feature sequence0717 <1 1078 gene locus_tag LOCUS_20830 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459065.1:C4-dicarboxylate ABC transporter substrate-binding protein <1891 1119 gene locus_tag LOCUS_20840 <1891 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339635.1:adenosylmethionine-8-amino-7-oxononanoate aminotransferase >Feature sequence0718 330 13 gene locus_tag LOCUS_20850 330 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1888 1232 gene locus_tag LOCUS_20860 1888 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence0719 1145 303 gene locus_tag LOCUS_20870 gene surA 1145 303 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN2 protein_id gnl|my_center|LOCUS_20870 >Feature sequence0720 <1883 567 gene locus_tag LOCUS_20880 <1883 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039896.1:sensor histidine kinase >Feature sequence0721 >Feature sequence0722 614 276 gene locus_tag LOCUS_20890 gene glnB-1 614 276 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence0723 <1882 659 gene locus_tag LOCUS_20900 <1882 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2C2:LPS-assembly protein LptD >Feature sequence0724 1029 385 gene locus_tag LOCUS_20910 1029 385 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 protein_id gnl|my_center|LOCUS_20910 1211 1864 gene locus_tag LOCUS_20920 1211 1864 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337043.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence0725 <1879 577 gene locus_tag LOCUS_20930 <1879 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003341224.1:tryptophan synthase subunit alpha >Feature sequence0726 1071 148 gene locus_tag LOCUS_20940 gene mepA 1071 148 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385579.1 protein_id gnl|my_center|LOCUS_20940 <1878 1068 gene locus_tag LOCUS_20950 <1878 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338909.1:MFS transporter >Feature sequence0727 <1 692 gene locus_tag LOCUS_20960 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565322.1:spermidine/putrescine ABC transporter permease 692 1492 gene locus_tag LOCUS_20970 692 1492 CDS product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence0728 1443 550 gene locus_tag LOCUS_20980 gene tatC 1443 550 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9L8 protein_id gnl|my_center|LOCUS_20980 >Feature sequence0729 1622 411 gene locus_tag LOCUS_20990 1622 411 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337737.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence0730 898 149 gene locus_tag LOCUS_21000 gene maiA 898 149 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFK2 protein_id gnl|my_center|LOCUS_21000 1681 1010 gene locus_tag LOCUS_21010 1681 1010 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_21010 1873 1733 gene locus_tag LOCUS_21020 1873 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0731 637 1647 gene locus_tag LOCUS_21030 637 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565051.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence0732 <1 1639 gene locus_tag LOCUS_21040 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384871.1:hemolysin 1830 1746 gene locus_tag LOCUS_t00190 1830 1746 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0733 >Feature sequence0734 870 595 gene locus_tag LOCUS_21050 870 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1537 1007 gene locus_tag LOCUS_21060 1537 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337886.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence0735 82 792 gene locus_tag LOCUS_21070 82 792 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383010.1 protein_id gnl|my_center|LOCUS_21070 <1865 800 gene locus_tag LOCUS_21080 <1865 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020477356.1:spermidine/putrescine ABC transporter ATPase >Feature sequence0736 212 1123 gene locus_tag LOCUS_21090 212 1123 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813028.1 protein_id gnl|my_center|LOCUS_21090 <1865 1216 gene locus_tag LOCUS_21100 <1865 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533083.1:Zn-dependent alcohol dehydrogenase >Feature sequence0737 <1864 402 gene locus_tag LOCUS_21110 <1864 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y3V3:arginine--tRNA ligase >Feature sequence0738 <1 628 gene locus_tag LOCUS_21120 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389118.1:sugar ABC transporter ATP-binding protein 621 1601 gene locus_tag LOCUS_21130 621 1601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389117.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence0739 >Feature sequence0740 <1 980 gene locus_tag LOCUS_21140 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5P2:pseudouridine synthase 977 1648 gene locus_tag LOCUS_21150 977 1648 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence0741 1526 888 gene locus_tag LOCUS_21160 gene cobH 1526 888 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence0742 <1 1195 gene locus_tag LOCUS_21170 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530820.1:sugar ABC transporter substrate-binding protein >Feature sequence0743 >Feature sequence0744 768 373 gene locus_tag LOCUS_21180 768 373 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence0745 1734 355 gene locus_tag LOCUS_21190 1734 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence0746 3 251 gene locus_tag LOCUS_21200 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0747 1189 860 gene locus_tag LOCUS_21210 1189 860 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383189.1 protein_id gnl|my_center|LOCUS_21210 1539 1195 gene locus_tag LOCUS_21220 1539 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence0748 <1 716 gene locus_tag LOCUS_21230 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975661.1:aldehyde dehydrogenase >Feature sequence0749 <1 1130 gene locus_tag LOCUS_21240 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384880.1:tellurium resistance protein >Feature sequence0750 >Feature sequence0751 <1836 207 gene locus_tag LOCUS_21250 <1836 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336807.1:double-strand break repair protein AddB >Feature sequence0752 3 1325 gene locus_tag LOCUS_21260 gene tctE 3 1325 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence0753 >Feature sequence0754 <1 1126 gene locus_tag LOCUS_21270 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009561978.1:D-alanyl-D-alanine carboxypeptidase 1152 1784 gene locus_tag LOCUS_21280 gene tmk 1152 1784 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S6 protein_id gnl|my_center|LOCUS_21280 >Feature sequence0755 742 1716 gene locus_tag LOCUS_21290 742 1716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence0756 1395 925 gene locus_tag LOCUS_21300 1395 925 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence0757 1198 1596 gene locus_tag LOCUS_21310 gene lguL 1198 1596 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence0758 1719 355 gene locus_tag LOCUS_21320 gene murD 1719 355 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M6 protein_id gnl|my_center|LOCUS_21320 >Feature sequence0759 274 1305 gene locus_tag LOCUS_21330 gene rbsC 274 1305 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815639.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence0760 1453 950 gene locus_tag LOCUS_21340 gene dut 1453 950 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0B2 protein_id gnl|my_center|LOCUS_21340 >Feature sequence0761 1807 827 gene locus_tag LOCUS_21350 1807 827 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence0762 406 1335 gene locus_tag LOCUS_21360 406 1335 CDS product conjugation transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339442.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence0763 1295 255 gene locus_tag LOCUS_21370 1295 255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 protein_id gnl|my_center|LOCUS_21370 <1807 1292 gene locus_tag LOCUS_21380 <1807 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098477.1:ABC transporter substrate-binding protein >Feature sequence0764 <1807 679 gene locus_tag LOCUS_21390 <1807 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809839.1:ABC transporter substrate-binding protein >Feature sequence0765 1665 580 gene locus_tag LOCUS_21400 1665 580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337645.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence0766 339 755 gene locus_tag LOCUS_21410 gene soxY 339 755 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_21410 783 1112 gene locus_tag LOCUS_21420 gene soxZ 783 1112 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence0767 <1802 26 gene locus_tag LOCUS_21430 <1802 26 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y8A8:phenylalanine--tRNA ligase beta subunit >Feature sequence0768 469 1056 gene locus_tag LOCUS_21440 469 1056 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529260.1 protein_id gnl|my_center|LOCUS_21440 1390 1103 gene locus_tag LOCUS_21450 1390 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720613.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence0769 <1 983 gene locus_tag LOCUS_21460 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337509.1:portal protein 985 1560 gene locus_tag LOCUS_21470 985 1560 CDS product peptidase U35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337510.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence0770 84 806 gene locus_tag LOCUS_21480 gene pyrF 84 806 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY00 protein_id gnl|my_center|LOCUS_21480 1280 876 gene locus_tag LOCUS_21490 1280 876 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836383.1 protein_id gnl|my_center|LOCUS_21490 1590 1303 gene locus_tag LOCUS_21500 1590 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563435.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence0771 <1 927 gene locus_tag LOCUS_21510 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337852.1:branched-chain amino acid ABC transporter permease 935 1549 gene locus_tag LOCUS_21520 935 1549 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337853.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence0772 113 424 gene locus_tag LOCUS_21530 113 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706751.1 protein_id gnl|my_center|LOCUS_21530 1035 1199 gene locus_tag LOCUS_21540 1035 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 <1789 1223 gene locus_tag LOCUS_21550 <1789 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339467.1:Crp/Fnr family transcriptional regulator >Feature sequence0773 439 1302 gene locus_tag LOCUS_21560 439 1302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383375.1 protein_id gnl|my_center|LOCUS_21560 1501 1334 gene locus_tag LOCUS_21570 1501 1334 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561774.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0774 1312 1752 gene locus_tag LOCUS_21580 1312 1752 CDS product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720750.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence0775 <1776 1088 gene locus_tag LOCUS_21590 <1776 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336877.1:D-mannonate oxidoreductase >Feature sequence0776 37 501 gene locus_tag LOCUS_21600 37 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence0777 265 1575 gene locus_tag LOCUS_21610 265 1575 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385195.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence0778 <1 1500 gene locus_tag LOCUS_21620 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368539.1:transporter >Feature sequence0779 <1 1580 gene locus_tag LOCUS_21630 <1 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389287.1:chloride channel protein >Feature sequence0780 372 938 gene locus_tag LOCUS_21640 372 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence0781 1192 662 gene locus_tag LOCUS_21650 1192 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 <1772 1200 gene locus_tag LOCUS_21660 <1772 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064421.1:nitrilase >Feature sequence0782 381 1172 gene locus_tag LOCUS_21670 381 1172 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140304.1 protein_id gnl|my_center|LOCUS_21670 <1771 1161 gene locus_tag LOCUS_21680 <1771 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002723403.1:thiamine phosphate synthase >Feature sequence0783 1312 41 gene locus_tag LOCUS_21690 1312 41 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339365.1 protein_id gnl|my_center|LOCUS_21690 1766 1335 gene locus_tag LOCUS_21700 1766 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0784 <1765 1045 gene locus_tag LOCUS_21710 <1765 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537790.1:capsule biosynthesis protein CapA >Feature sequence0785 >Feature sequence0786 377 36 gene locus_tag LOCUS_21720 377 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 <1763 707 gene locus_tag LOCUS_21730 <1763 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706388.1:alcohol dehydrogenase >Feature sequence0787 2 733 gene locus_tag LOCUS_21740 2 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 878 1606 gene locus_tag LOCUS_21750 878 1606 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence0788 >Feature sequence0789 <1 596 gene locus_tag LOCUS_21760 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887360.1:ABC transporter ATP-binding protein 589 1287 gene locus_tag LOCUS_21770 589 1287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence0790 >Feature sequence0791 752 1291 gene locus_tag LOCUS_21780 752 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1288 1668 gene locus_tag LOCUS_21790 1288 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0792 <1753 808 gene locus_tag LOCUS_21800 <1753 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976013.1:dihydroxy-acid dehydratase >Feature sequence0793 1349 729 gene locus_tag LOCUS_21810 gene rpsD 1349 729 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J446 protein_id gnl|my_center|LOCUS_21810 >Feature sequence0794 <1 830 gene locus_tag LOCUS_21820 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339543.1:ABC transporter ATP-binding protein >Feature sequence0795 650 45 gene locus_tag LOCUS_21830 gene pcaG 650 45 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538213.1 protein_id gnl|my_center|LOCUS_21830 1380 652 gene locus_tag LOCUS_21840 gene pcaH 1380 652 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385629.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0796 410 1291 gene locus_tag LOCUS_21850 410 1291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719816.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence0797 >Feature sequence0798 >Feature sequence0799 <1744 575 gene locus_tag LOCUS_21860 <1744 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384303.1:ABC transporter >Feature sequence0800 <1 1118 gene locus_tag LOCUS_21870 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538199.1:phosphogluconate dehydratase <1743 1210 gene locus_tag LOCUS_21880 <1743 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919990.1:12-oxophytodienoate reductase >Feature sequence0801 >Feature sequence0802 300 1202 gene locus_tag LOCUS_21890 300 1202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528010.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence0803 >Feature sequence0804 1201 38 gene locus_tag LOCUS_21900 gene lctB 1201 38 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338523.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence0805 >Feature sequence0806 >Feature sequence0807 9 341 gene locus_tag LOCUS_21910 9 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1311 370 gene locus_tag LOCUS_21920 1311 370 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0808 1289 720 gene locus_tag LOCUS_21930 1289 720 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338348.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0809 <1 634 gene locus_tag LOCUS_21940 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IW85:apolipoprotein N-acyltransferase >Feature sequence0810 732 454 gene locus_tag LOCUS_21950 732 454 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776288.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence0811 <1 917 gene locus_tag LOCUS_21960 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338134.1:branched-chain amino acid ABC transporter permease >Feature sequence0812 >Feature sequence0813 1541 147 gene locus_tag LOCUS_21970 1541 147 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 protein_id gnl|my_center|LOCUS_21970 1717 1547 gene locus_tag LOCUS_21980 1717 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence0814 411 620 gene locus_tag LOCUS_21990 411 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence0815 1057 758 gene locus_tag LOCUS_22000 1057 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1622 1080 gene locus_tag LOCUS_22010 1622 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence0816 >Feature sequence0817 170 454 gene locus_tag LOCUS_22020 170 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22020 1489 479 gene locus_tag LOCUS_22030 1489 479 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086008.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence0818 394 1662 gene locus_tag LOCUS_22040 394 1662 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y871 protein_id gnl|my_center|LOCUS_22040 >Feature sequence0819 413 186 gene locus_tag LOCUS_22050 413 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 <1716 618 gene locus_tag LOCUS_22060 <1716 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337352.1:acyl-CoA synthetase >Feature sequence0820 <1 1084 gene locus_tag LOCUS_22070 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY57:DNA gyrase subunit B >Feature sequence0821 368 1696 gene locus_tag LOCUS_22080 gene phnE 368 1696 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970701.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence0822 1629 748 gene locus_tag LOCUS_22090 gene rpoH2 1629 748 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720768.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence0823 <1 999 gene locus_tag LOCUS_22100 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729462.1:sugar ABC transporter permease >Feature sequence0824 1280 630 gene locus_tag LOCUS_22110 gene dapF 1280 630 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZB6 protein_id gnl|my_center|LOCUS_22110 1577 1652 gene locus_tag LOCUS_t00200 1577 1652 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0825 >Feature sequence0826 <1700 495 gene locus_tag LOCUS_22120 <1700 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113043.1:aldehyde dehydrogenase >Feature sequence0827 <1 811 gene locus_tag LOCUS_22130 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140207.1:oxidoreductase 883 1587 gene locus_tag LOCUS_22140 gene rlmE 883 1587 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 protein_id gnl|my_center|LOCUS_22140 >Feature sequence0828 900 181 gene locus_tag LOCUS_22150 900 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 <1697 960 gene locus_tag LOCUS_22160 <1697 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337548.1:NADH-quinone oxidoreductase subunit E >Feature sequence0829 <1 713 gene locus_tag LOCUS_22170 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931227.1:ABC transporter ATP-binding protein 706 1512 gene locus_tag LOCUS_22180 706 1512 CDS product ABC transporter inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064938.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence0830 >Feature sequence0831 1693 548 gene locus_tag LOCUS_22190 1693 548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence0832 1186 851 gene locus_tag LOCUS_22200 gene qacE 1186 851 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384254.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence0833 1214 36 gene locus_tag LOCUS_22210 gene dinB 1214 36 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y709 protein_id gnl|my_center|LOCUS_22210 >Feature sequence0834 >Feature sequence0835 440 829 gene locus_tag LOCUS_22220 440 829 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722435.1 protein_id gnl|my_center|LOCUS_22220 860 1135 gene locus_tag LOCUS_22230 gene ptsH 860 1135 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383054.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence0836 1520 1098 gene locus_tag LOCUS_22240 1520 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193213.1 protein_id gnl|my_center|LOCUS_22240 1687 1517 gene locus_tag LOCUS_22250 1687 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence0837 >Feature sequence0838 1489 587 gene locus_tag LOCUS_22260 1489 587 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337022.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence0839 963 664 gene locus_tag LOCUS_22270 963 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22270 1219 995 gene locus_tag LOCUS_22280 1219 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22280 >Feature sequence0840 1069 131 gene locus_tag LOCUS_22290 1069 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383631.1 protein_id gnl|my_center|LOCUS_22290 1243 1668 gene locus_tag LOCUS_22300 1243 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence0841 1419 664 gene locus_tag LOCUS_22310 1419 664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533094.1 protein_id gnl|my_center|LOCUS_22310 1685 1416 gene locus_tag LOCUS_22320 1685 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence0842 835 323 gene locus_tag LOCUS_22330 gene fxsA 835 323 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_22330 943 1608 gene locus_tag LOCUS_22340 943 1608 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338812.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence0843 >Feature sequence0844 >Feature sequence0845 >Feature sequence0846 >Feature sequence0847 <1680 701 gene locus_tag LOCUS_22350 <1680 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4L6:cell division protein FtsA >Feature sequence0848 1462 779 gene locus_tag LOCUS_22360 gene cbbE 1462 779 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N7 protein_id gnl|my_center|LOCUS_22360 >Feature sequence0849 >Feature sequence0850 <1 1065 gene locus_tag LOCUS_22370 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970699.1:phosphonate metabolism protein PhnM >Feature sequence0851 1078 620 gene locus_tag LOCUS_22380 1078 620 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence0852 795 884 gene locus_tag LOCUS_t00210 795 884 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0853 312 446 gene locus_tag LOCUS_22390 312 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 617 1642 gene locus_tag LOCUS_22400 617 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence0854 <1 683 gene locus_tag LOCUS_22410 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206889.1:aryl-alcohol dehydrogenase 1038 1352 gene locus_tag LOCUS_22420 1038 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22420 >Feature sequence0855 16 972 gene locus_tag LOCUS_22430 16 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence0856 237 485 gene locus_tag LOCUS_22440 237 485 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 protein_id gnl|my_center|LOCUS_22440 804 1304 gene locus_tag LOCUS_22450 804 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339244.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence0857 420 67 gene locus_tag LOCUS_22460 420 67 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 protein_id gnl|my_center|LOCUS_22460 <1665 534 gene locus_tag LOCUS_22470 <1665 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O33568:protein translocase subunit SecF >Feature sequence0858 243 542 gene locus_tag LOCUS_22480 243 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0859 >Feature sequence0860 <1 1062 gene locus_tag LOCUS_22490 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2L8:GTPase HflX 1064 1390 gene locus_tag LOCUS_22500 1064 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence0861 <1 727 gene locus_tag LOCUS_22510 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083709.1:ABC transporter substrate-binding protein 804 1568 gene locus_tag LOCUS_22520 804 1568 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence0862 583 1044 gene locus_tag LOCUS_22530 583 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1146 1009 gene locus_tag LOCUS_22540 1146 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1232 1474 gene locus_tag LOCUS_22550 1232 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence0863 609 151 gene locus_tag LOCUS_22560 609 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1624 614 gene locus_tag LOCUS_22570 1624 614 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268505.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence0864 <1 1077 gene locus_tag LOCUS_22580 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385011.1:MBL fold hydrolase 1659 1195 gene locus_tag LOCUS_22590 1659 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence0865 <1 549 gene locus_tag LOCUS_22600 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P95646:anthranilate synthase component 1 1077 616 gene locus_tag LOCUS_22610 1077 616 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722912.1 protein_id gnl|my_center|LOCUS_22610 1251 1562 gene locus_tag LOCUS_22620 1251 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337101.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence0866 >Feature sequence0867 <1653 976 gene locus_tag LOCUS_22630 <1653 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein >Feature sequence0868 <1652 217 gene locus_tag LOCUS_22640 <1652 217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4Z5:valine--tRNA ligase >Feature sequence0869 <1 1288 gene locus_tag LOCUS_22650 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336880.1:sigma-54-dependent Fis family transcriptional regulator 1297 1575 gene locus_tag LOCUS_22660 1297 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence0870 1647 1120 gene locus_tag LOCUS_22670 1647 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence0871 1644 445 gene locus_tag LOCUS_22680 1644 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence0872 >Feature sequence0873 109 35 gene locus_tag LOCUS_t00220 109 35 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1643 225 gene locus_tag LOCUS_22690 1643 225 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565538.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0874 >Feature sequence0875 >Feature sequence0876 <1 617 gene locus_tag LOCUS_22700 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521491.1:DUF2063 domain-containing protein 610 1149 gene locus_tag LOCUS_22710 610 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1442 1128 gene locus_tag LOCUS_22720 1442 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence0877 >Feature sequence0878 1012 503 gene locus_tag LOCUS_22730 1012 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence0879 1604 360 gene locus_tag LOCUS_22740 gene mifR 1604 360 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence0880 <1 522 gene locus_tag LOCUS_22750 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529018.1:hemolysin expression modulating protein >Feature sequence0881 1631 828 gene locus_tag LOCUS_22760 1631 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0882 >Feature sequence0883 <1 671 gene locus_tag LOCUS_22770 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531687.1:integrase >Feature sequence0884 1225 1301 gene locus_tag LOCUS_t00230 1225 1301 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0885 >Feature sequence0886 193 585 gene locus_tag LOCUS_22780 193 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1298 633 gene locus_tag LOCUS_22790 gene msrA1 1298 633 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9I6 protein_id gnl|my_center|LOCUS_22790 >Feature sequence0887 1082 330 gene locus_tag LOCUS_22800 1082 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence0888 <1 820 gene locus_tag LOCUS_22810 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974909.1:cytochrome P450 881 1195 gene locus_tag LOCUS_22820 881 1195 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975686.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence0889 1437 496 gene locus_tag LOCUS_22830 1437 496 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764455.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence0890 <1 1113 gene locus_tag LOCUS_22840 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z3R7:alpha-glucoside transport system permease protein AglG >Feature sequence0891 847 392 gene locus_tag LOCUS_22850 847 392 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383650.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence0892 1292 726 gene locus_tag LOCUS_22860 1292 726 CDS product protein hupE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066513.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence0893 >Feature sequence0894 847 110 gene locus_tag LOCUS_22870 gene ugpQ 847 110 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973645.1 protein_id gnl|my_center|LOCUS_22870 <1599 969 gene locus_tag LOCUS_22880 <1599 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZM8:50S ribosomal protein L25 >Feature sequence0895 <1 651 gene locus_tag LOCUS_22890 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4A7:adenylosuccinate lyase 727 891 gene locus_tag LOCUS_22900 727 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence0896 85 804 gene locus_tag LOCUS_22910 85 804 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence0897 1200 226 gene locus_tag LOCUS_22920 1200 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence0898 1314 79 gene locus_tag LOCUS_22930 gene pepA 1314 79 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C5 protein_id gnl|my_center|LOCUS_22930 >Feature sequence0899 >Feature sequence0900 934 470 gene locus_tag LOCUS_22940 gene rplM 934 470 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z4 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0901 1401 586 gene locus_tag LOCUS_22950 1401 586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543285.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0902 <1576 665 gene locus_tag LOCUS_22960 <1576 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012710141.1:sn-glycerol 3-phosphate ABC transporter substrate-binding protein >Feature sequence0903 17 727 gene locus_tag LOCUS_22970 17 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence0904 <1 704 gene locus_tag LOCUS_22980 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J645:thymidine phosphorylase >Feature sequence0905 <1569 790 gene locus_tag LOCUS_22990 <1569 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028209.1:iron-sulfur protein >Feature sequence0906 1169 240 gene locus_tag LOCUS_23000 gene fabD 1169 240 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y446 protein_id gnl|my_center|LOCUS_23000 >Feature sequence0907 606 238 gene locus_tag LOCUS_23010 606 238 CDS product monooxygenase component MmoB/DmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720016.1 protein_id gnl|my_center|LOCUS_23010 <1568 628 gene locus_tag LOCUS_23020 <1568 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720017.1:toluene hydroxylase >Feature sequence0908 71 490 gene locus_tag LOCUS_23030 71 490 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 protein_id gnl|my_center|LOCUS_23030 518 799 gene locus_tag LOCUS_23040 518 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383068.1 protein_id gnl|my_center|LOCUS_23040 1539 844 gene locus_tag LOCUS_23050 1539 844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence0909 1235 531 gene locus_tag LOCUS_23060 1235 531 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387930.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence0910 <1 729 gene locus_tag LOCUS_23070 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338229.1:aminotransferase >Feature sequence0911 509 988 gene locus_tag LOCUS_23080 509 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence0912 1053 523 gene locus_tag LOCUS_23090 1053 523 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973810.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence0913 117 686 gene locus_tag LOCUS_23100 117 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1297 683 gene locus_tag LOCUS_23110 1297 683 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338642.1 protein_id gnl|my_center|LOCUS_23110 1557 1297 gene locus_tag LOCUS_23120 1557 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence0914 <1 1200 gene locus_tag LOCUS_23130 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971690.1:beta-mannosidase >Feature sequence0915 2 424 gene locus_tag LOCUS_23140 2 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 583 672 gene locus_tag LOCUS_t00240 583 672 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0916 1364 483 gene locus_tag LOCUS_23150 1364 483 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338180.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence0917 >Feature sequence0918 1370 24 gene locus_tag LOCUS_23160 1370 24 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence0919 81 1292 gene locus_tag LOCUS_23170 81 1292 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337305.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence0920 <1550 836 gene locus_tag LOCUS_23180 <1550 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638382.2:alpha,alpha-trehalose-phosphate synthase note possible pseudo, frameshifted >Feature sequence0921 >Feature sequence0922 >Feature sequence0923 <1545 625 gene locus_tag LOCUS_23190 <1545 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140209.1:PAS domain-containing sensor histidine kinase >Feature sequence0924 894 556 gene locus_tag LOCUS_23200 894 556 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722422.1 protein_id gnl|my_center|LOCUS_23200 1421 894 gene locus_tag LOCUS_23210 1421 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence0925 >Feature sequence0926 238 1524 gene locus_tag LOCUS_23220 238 1524 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence0927 <1541 662 gene locus_tag LOCUS_23230 <1541 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706196.1:sugar ABC transporter ATP-binding protein >Feature sequence0928 >Feature sequence0929 1475 435 gene locus_tag LOCUS_23240 1475 435 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384418.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence0930 >Feature sequence0931 170 943 gene locus_tag LOCUS_23250 170 943 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969950.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence0932 >Feature sequence0933 >Feature sequence0934 <1535 627 gene locus_tag LOCUS_23260 <1535 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083705.1:branched-chain amino acid ABC transporter permease >Feature sequence0935 116 526 gene locus_tag LOCUS_23270 116 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence0936 <1531 762 gene locus_tag LOCUS_23280 <1531 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390949.1:ABC transporter >Feature sequence0937 1047 55 gene locus_tag LOCUS_23290 1047 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence0938 280 849 gene locus_tag LOCUS_23300 280 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 861 1190 gene locus_tag LOCUS_23310 861 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence0939 3 530 gene locus_tag LOCUS_23320 3 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence0940 <1 525 gene locus_tag LOCUS_23330 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533166.1:molybdopterin dehydrogenase 522 1007 gene locus_tag LOCUS_23340 522 1007 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533165.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence0941 338 204 gene locus_tag LOCUS_23350 338 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence0942 >Feature sequence0943 <1525 718 gene locus_tag LOCUS_23360 <1525 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336824.1:peptidase >Feature sequence0944 >Feature sequence0945 380 952 gene locus_tag LOCUS_23370 380 952 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 protein_id gnl|my_center|LOCUS_23370 >Feature sequence0946 >Feature sequence0947 19 1005 gene locus_tag LOCUS_23380 19 1005 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337394.1 protein_id gnl|my_center|LOCUS_23380 1514 1056 gene locus_tag LOCUS_23390 1514 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0948 1091 783 gene locus_tag LOCUS_23400 1091 783 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561857.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence0949 670 1128 gene locus_tag LOCUS_23410 670 1128 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence0950 <1512 722 gene locus_tag LOCUS_23420 <1512 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533093.1:branched-chain amino acid ABC transporter permease >Feature sequence0951 923 465 gene locus_tag LOCUS_23430 923 465 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384952.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence0952 607 1383 gene locus_tag LOCUS_23440 gene bacC 607 1383 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence0953 >Feature sequence0954 147 296 gene locus_tag LOCUS_23450 147 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence0955 150 1268 gene locus_tag LOCUS_23460 150 1268 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence0956 <1503 757 gene locus_tag LOCUS_23470 <1503 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531243.1:heme ABC transporter permease >Feature sequence0957 1306 365 gene locus_tag LOCUS_23480 1306 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384496.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence0958 <1501 952 gene locus_tag LOCUS_23490 <1501 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337037.1:diguanylate cyclase >Feature sequence0959 <1498 235 gene locus_tag LOCUS_23500 <1498 235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538186.1:2-methylcitrate dehydratase >Feature sequence0960 >Feature sequence0961 527 1333 gene locus_tag LOCUS_23510 527 1333 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence0962 <1 524 gene locus_tag LOCUS_23520 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAL1:Holliday junction ATP-dependent DNA helicase RuvA >Feature sequence0963 170 1075 gene locus_tag LOCUS_23530 170 1075 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086449.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence0964 451 912 gene locus_tag LOCUS_23540 451 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence0965 <1 708 gene locus_tag LOCUS_23550 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563182.1:DNA-binding response regulator 788 1030 gene locus_tag LOCUS_23560 gene xseB 788 1030 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR4 protein_id gnl|my_center|LOCUS_23560 1030 1386 gene locus_tag LOCUS_23570 1030 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23570 >Feature sequence0966 1310 609 gene locus_tag LOCUS_23580 1310 609 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383047.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence0967 <1 864 gene locus_tag LOCUS_23590 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722432.1:sensor histidine kinase 990 1358 gene locus_tag LOCUS_23600 990 1358 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence0968 <1493 519 gene locus_tag LOCUS_23610 <1493 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971654.1:transporter >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 1268 582 gene locus_tag LOCUS_23620 1268 582 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724571.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence0972 121 969 gene locus_tag LOCUS_23630 121 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence0973 1166 54 gene locus_tag LOCUS_23640 1166 54 CDS product acetylpolyamine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113816.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence0974 <1 1106 gene locus_tag LOCUS_23650 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393450.1:ABC transporter >Feature sequence0975 <1 656 gene locus_tag LOCUS_23660 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728413.1:carboxylesterase 685 834 gene locus_tag LOCUS_23670 685 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence0976 316 1179 gene locus_tag LOCUS_23680 gene hmuT 316 1179 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969934.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence0977 <1472 459 gene locus_tag LOCUS_23690 <1472 459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337522.1:pyruvate dehydrogenase complex E1 component subunit beta >Feature sequence0978 >Feature sequence0979 <1472 306 gene locus_tag LOCUS_23700 <1472 306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563407.1:MFS transporter >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 1226 390 gene locus_tag LOCUS_23710 1226 390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339220.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence0983 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 >Feature sequence0987 630 58 gene locus_tag LOCUS_23720 630 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence0988 >Feature sequence0989 279 881 gene locus_tag LOCUS_23730 gene coaE 279 881 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG8 protein_id gnl|my_center|LOCUS_23730 >Feature sequence0990 <1458 383 gene locus_tag LOCUS_23740 <1458 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324929.1:nitrate ABC transporter ATP-binding protein >Feature sequence0991 >Feature sequence0992 258 1346 gene locus_tag LOCUS_23750 258 1346 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975869.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence0993 <1452 385 gene locus_tag LOCUS_23760 <1452 385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205079.1:fimbriae assembly protein >Feature sequence0994 69 446 gene locus_tag LOCUS_23770 69 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317528.1 protein_id gnl|my_center|LOCUS_23770 528 1034 gene locus_tag LOCUS_23780 gene prtI 528 1034 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971658.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence0995 >Feature sequence0996 1076 72 gene locus_tag LOCUS_23790 gene dctP 1076 72 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR9 protein_id gnl|my_center|LOCUS_23790 >Feature sequence0997 <1 516 gene locus_tag LOCUS_23800 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338674.1:adenosine kinase <1447 596 gene locus_tag LOCUS_23810 <1447 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338672.1:DNA polymerase I >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 >Feature sequence1001 6 962 gene locus_tag LOCUS_23820 6 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence1002 1014 97 gene locus_tag LOCUS_23830 1014 97 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337069.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence1003 <1 802 gene locus_tag LOCUS_23840 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720964.1:AI-2E family transporter >Feature sequence1004 30 572 gene locus_tag LOCUS_23850 gene phnN 30 572 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU71 protein_id gnl|my_center|LOCUS_23850 1297 554 gene locus_tag LOCUS_23860 1297 554 CDS product phosphonate metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337861.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 >Feature sequence1008 1088 78 gene locus_tag LOCUS_23870 gene amiF 1088 78 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H51 protein_id gnl|my_center|LOCUS_23870 >Feature sequence1009 626 1405 gene locus_tag LOCUS_23880 626 1405 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NV1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence1010 987 379 gene locus_tag LOCUS_23890 987 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence1011 <1 761 gene locus_tag LOCUS_23900 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4L2:DNA repair protein RecN 1428 823 gene locus_tag LOCUS_23910 1428 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence1012 1 732 gene locus_tag LOCUS_23920 1 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence1013 51 938 gene locus_tag LOCUS_23930 51 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_23930 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 303 947 gene locus_tag LOCUS_23940 gene nth 303 947 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7I5 protein_id gnl|my_center|LOCUS_23940 >Feature sequence1017 >Feature sequence1018 903 526 gene locus_tag LOCUS_23950 903 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 1198 854 gene locus_tag LOCUS_23960 1198 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence1019 363 1370 gene locus_tag LOCUS_23970 363 1370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527972.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence1020 >Feature sequence1021 277 888 gene locus_tag LOCUS_23980 gene cmk 277 888 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E0 protein_id gnl|my_center|LOCUS_23980 >Feature sequence1022 1089 313 gene locus_tag LOCUS_23990 1089 313 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537570.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence1023 1182 559 gene locus_tag LOCUS_24000 gene ompW 1182 559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence1024 <1 1366 gene locus_tag LOCUS_24010 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972713.1:peptide ABC transporter substrate-binding protein >Feature sequence1025 9 623 gene locus_tag LOCUS_24020 9 623 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 protein_id gnl|my_center|LOCUS_24020 <1411 654 gene locus_tag LOCUS_24030 <1411 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887425.1:phosphonate metabolism protein PhnM >Feature sequence1026 2 907 gene locus_tag LOCUS_24040 2 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence1027 212 475 gene locus_tag LOCUS_24050 212 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24050 602 1369 gene locus_tag LOCUS_24060 602 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24060 >Feature sequence1028 >Feature sequence1029 456 1229 gene locus_tag LOCUS_24070 gene fad 456 1229 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence1030 16 963 gene locus_tag LOCUS_24080 16 963 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267509.1 protein_id gnl|my_center|LOCUS_24080 978 1373 gene locus_tag LOCUS_24090 978 1373 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence1031 1162 191 gene locus_tag LOCUS_24100 1162 191 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence1032 <1395 278 gene locus_tag LOCUS_24110 <1395 278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064424.1:FMN-dependent dehydrogenase >Feature sequence1033 >Feature sequence1034 >Feature sequence1035 1281 562 gene locus_tag LOCUS_24120 1281 562 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338510.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence1036 802 149 gene locus_tag LOCUS_24130 gene kpsT 802 149 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538104.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence1037 <1 812 gene locus_tag LOCUS_24140 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730493.1:nitrilase >Feature sequence1038 564 106 gene locus_tag LOCUS_24150 564 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 803 549 gene locus_tag LOCUS_24160 803 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence1039 <1 637 gene locus_tag LOCUS_24170 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383162.1:type I secretion protein TolC >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 979 824 gene locus_tag LOCUS_24180 979 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1378 1043 gene locus_tag LOCUS_24190 1378 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence1043 >Feature sequence1044 >Feature sequence1045 <1 555 gene locus_tag LOCUS_24200 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J364:phosphate acyltransferase >Feature sequence1046 >Feature sequence1047 <1 648 gene locus_tag LOCUS_24210 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339408.1:xanthine dehydrogenase small subunit >Feature sequence1048 574 272 gene locus_tag LOCUS_24220 574 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 <1373 615 gene locus_tag LOCUS_24230 <1373 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538090.1:cobalamin synthesis protein CobW >Feature sequence1049 732 61 gene locus_tag LOCUS_24240 gene tctD 732 61 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence1050 >Feature sequence1051 <1 525 gene locus_tag LOCUS_24250 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5H6:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence1052 1254 226 gene locus_tag LOCUS_24260 1254 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence1053 <1 1107 gene locus_tag LOCUS_24270 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085805.1:amidohydrolase >Feature sequence1054 1254 289 gene locus_tag LOCUS_24280 1254 289 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence1055 >Feature sequence1056 >Feature sequence1057 3 176 gene locus_tag LOCUS_24290 3 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 181 603 gene locus_tag LOCUS_24300 181 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1297 671 gene locus_tag LOCUS_24310 gene mobC 1297 671 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338449.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence1058 <1 1156 gene locus_tag LOCUS_24320 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390196.1:toxin HipA >Feature sequence1059 426 989 gene locus_tag LOCUS_24330 gene frr 426 989 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6E2 protein_id gnl|my_center|LOCUS_24330 >Feature sequence1060 <1 749 gene locus_tag LOCUS_24340 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533077.1:glycerol-3-phosphate dehydrogenase >Feature sequence1061 >Feature sequence1062 >Feature sequence1063 >Feature sequence1064 540 1262 gene locus_tag LOCUS_24350 540 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence1065 748 134 gene locus_tag LOCUS_24360 gene ureG 748 134 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J158 protein_id gnl|my_center|LOCUS_24360 <1350 792 gene locus_tag LOCUS_24370 <1350 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J157:urease accessory protein UreF >Feature sequence1066 1210 227 gene locus_tag LOCUS_24380 1210 227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528023.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence1067 1348 554 gene locus_tag LOCUS_24390 gene fbp1 1348 554 CDS product fructose-1,6-bisphosphatase class 1 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYB9 protein_id gnl|my_center|LOCUS_24390 >Feature sequence1068 460 5 gene locus_tag LOCUS_24400 460 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 927 460 gene locus_tag LOCUS_24410 927 460 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097615.1 protein_id gnl|my_center|LOCUS_24410 1273 905 gene locus_tag LOCUS_24420 1273 905 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088047.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence1069 <1347 828 gene locus_tag LOCUS_24430 <1347 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338695.1:phosphoglycerate mutase >Feature sequence1070 147 467 gene locus_tag LOCUS_24440 147 467 CDS product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338792.1 protein_id gnl|my_center|LOCUS_24440 <1347 478 gene locus_tag LOCUS_24450 <1347 478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y677:L-threonine dehydratase >Feature sequence1071 <1346 654 gene locus_tag LOCUS_24460 <1346 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y3D5:methionine--tRNA ligase >Feature sequence1072 <1 781 gene locus_tag LOCUS_24470 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339405.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence1073 <1 503 gene locus_tag LOCUS_24480 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383138.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 516 1142 gene locus_tag LOCUS_24490 516 1142 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence1074 >Feature sequence1075 1323 781 gene locus_tag LOCUS_24500 1323 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence1076 89 808 gene locus_tag LOCUS_24510 89 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence1077 1027 449 gene locus_tag LOCUS_24520 1027 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence1078 629 339 gene locus_tag LOCUS_24530 629 339 CDS product sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719575.1 protein_id gnl|my_center|LOCUS_24530 725 1303 gene locus_tag LOCUS_24540 725 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence1079 184 630 gene locus_tag LOCUS_24550 184 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719475.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence1080 <1336 416 gene locus_tag LOCUS_24560 <1336 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462118.1:sodium:proton antiporter >Feature sequence1081 1334 762 gene locus_tag LOCUS_24570 1334 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence1082 >Feature sequence1083 >Feature sequence1084 230 973 gene locus_tag LOCUS_24580 230 973 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268506.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence1085 <1333 482 gene locus_tag LOCUS_24590 <1333 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4L4:UDP-3-O-acyl-N-acetylglucosamine deacetylase >Feature sequence1086 >Feature sequence1087 1182 739 gene locus_tag LOCUS_24600 1182 739 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564474.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence1088 254 472 gene locus_tag LOCUS_24610 254 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383748.1 protein_id gnl|my_center|LOCUS_24610 684 1169 gene locus_tag LOCUS_24620 gene purE 684 1169 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J671 protein_id gnl|my_center|LOCUS_24620 >Feature sequence1089 >Feature sequence1090 521 829 gene locus_tag LOCUS_24630 521 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence1091 >Feature sequence1092 <1 568 gene locus_tag LOCUS_24640 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8X5J8:4-hydroxy-2-oxovalerate aldolase >Feature sequence1093 >Feature sequence1094 1185 973 gene locus_tag LOCUS_24650 1185 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1322 1182 gene locus_tag LOCUS_24660 1322 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence1095 >Feature sequence1096 >Feature sequence1097 <1 604 gene locus_tag LOCUS_24670 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN28:FMN-dependent NADH-azoreductase >Feature sequence1098 2 244 gene locus_tag LOCUS_24680 2 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence1099 >Feature sequence1100 1128 112 gene locus_tag LOCUS_24690 gene prsA 1128 112 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J429 protein_id gnl|my_center|LOCUS_24690 >Feature sequence1101 1119 748 gene locus_tag LOCUS_24700 gene gcvH 1119 748 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4D5 protein_id gnl|my_center|LOCUS_24700 1313 1143 gene locus_tag LOCUS_24710 1313 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence1102 716 360 gene locus_tag LOCUS_24720 gene rbcS 716 360 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_24720 <1315 748 gene locus_tag LOCUS_24730 <1315 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VD33:ribulose bisphosphate carboxylase large chain >Feature sequence1103 >Feature sequence1104 755 465 gene locus_tag LOCUS_24740 755 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 803 1084 gene locus_tag LOCUS_24750 803 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence1105 479 685 gene locus_tag LOCUS_24760 479 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence1106 643 846 gene locus_tag LOCUS_24770 643 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence1107 >Feature sequence1108 3 1055 gene locus_tag LOCUS_24780 3 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence1109 775 488 gene locus_tag LOCUS_24790 775 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1020 784 gene locus_tag LOCUS_24800 1020 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence1110 1038 157 gene locus_tag LOCUS_24810 gene hbdA 1038 157 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence1111 480 232 gene locus_tag LOCUS_24820 480 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence1112 922 632 gene locus_tag LOCUS_24830 922 632 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331458.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence1113 <1 503 gene locus_tag LOCUS_24840 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P38103:4-hydroxy-tetrahydrodipicolinate reductase >Feature sequence1114 778 374 gene locus_tag LOCUS_24850 gene infC 778 374 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5H7 protein_id gnl|my_center|LOCUS_24850 >Feature sequence1115 969 196 gene locus_tag LOCUS_24860 gene rpsB 969 196 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N4 protein_id gnl|my_center|LOCUS_24860 >Feature sequence1116 101 913 gene locus_tag LOCUS_24870 gene murI 101 913 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J276 protein_id gnl|my_center|LOCUS_24870 >Feature sequence1117 >Feature sequence1118 <1 1205 gene locus_tag LOCUS_24880 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384633.1:isocitrate dehydrogenase >Feature sequence1119 <1 759 gene locus_tag LOCUS_24890 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895522.1:transcriptional regulator >Feature sequence1120 >Feature sequence1121 <1 851 gene locus_tag LOCUS_24900 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249985.1:restriction endonuclease >Feature sequence1122 958 140 gene locus_tag LOCUS_24910 958 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336894.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence1123 <1 826 gene locus_tag LOCUS_24920 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384336.1:lipid-A-disaccharide synthase 886 1149 gene locus_tag LOCUS_24930 886 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence1124 >Feature sequence1125 1139 417 gene locus_tag LOCUS_24940 1139 417 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence1126 1270 845 gene locus_tag LOCUS_24950 1270 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence1127 >Feature sequence1128 >Feature sequence1129 >Feature sequence1130 >Feature sequence1131 712 116 gene locus_tag LOCUS_24960 712 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337512.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence1132 >Feature sequence1133 >Feature sequence1134 >Feature sequence1135 <1 628 gene locus_tag LOCUS_24970 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403169.1:dipeptidase >Feature sequence1136 1020 751 gene locus_tag LOCUS_24980 1020 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence1137 903 4 gene locus_tag LOCUS_24990 903 4 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337879.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence1138 >Feature sequence1139 856 110 gene locus_tag LOCUS_25000 gene cbbJ 856 110 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J536 protein_id gnl|my_center|LOCUS_25000 >Feature sequence1140 433 633 gene locus_tag LOCUS_25010 433 633 CDS product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720048.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence1141 <1 1149 gene locus_tag LOCUS_25020 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UAA0:hydrogenobyrinate a,c-diamide synthase >Feature sequence1142 869 582 gene locus_tag LOCUS_25030 869 582 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence1143 >Feature sequence1144 446 1246 gene locus_tag LOCUS_25040 446 1246 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence1145 1192 86 gene locus_tag LOCUS_25050 gene gpsA 1192 86 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_25050 >Feature sequence1146 >Feature sequence1147 85 510 gene locus_tag LOCUS_25060 85 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence1148 >Feature sequence1149 <1246 203 gene locus_tag LOCUS_25070 <1246 203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390060.1:twin-arginine translocation pathway signal >Feature sequence1150 >Feature sequence1151 >Feature sequence1152 >Feature sequence1153 1241 141 gene locus_tag LOCUS_25080 gene murG 1241 141 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M2 protein_id gnl|my_center|LOCUS_25080 >Feature sequence1154 111 536 gene locus_tag LOCUS_25090 111 536 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_25090 <1240 610 gene locus_tag LOCUS_25100 <1240 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338651.1:glutamate--cysteine ligase >Feature sequence1155 180 938 gene locus_tag LOCUS_25110 180 938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888750.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence1156 1047 298 gene locus_tag LOCUS_25120 1047 298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence1157 823 353 gene locus_tag LOCUS_25130 823 353 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336873.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence1158 984 148 gene locus_tag LOCUS_25140 984 148 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533089.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence1159 <1 939 gene locus_tag LOCUS_25150 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338664.1:FAD-binding protein >Feature sequence1160 >Feature sequence1161 <1232 704 gene locus_tag LOCUS_25160 <1232 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974129.1:oxidoreductase >Feature sequence1162 178 801 gene locus_tag LOCUS_25170 178 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence1163 <1229 655 gene locus_tag LOCUS_25180 <1229 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083707.1:ABC transporter ATP-binding protein >Feature sequence1164 >Feature sequence1165 57 632 gene locus_tag LOCUS_25190 57 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338215.1 protein_id gnl|my_center|LOCUS_25190 1224 700 gene locus_tag LOCUS_25200 1224 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence1166 1033 281 gene locus_tag LOCUS_25210 1033 281 CDS product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence1167 546 743 gene locus_tag LOCUS_25220 546 743 CDS product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061934.1 protein_id gnl|my_center|LOCUS_25220 1152 832 gene locus_tag LOCUS_25230 1152 832 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDQ8 protein_id gnl|my_center|LOCUS_25230 >Feature sequence1168 <1221 570 gene locus_tag LOCUS_25240 <1221 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338041.1:XRE family transcriptional regulator >Feature sequence1169 <1 1127 gene locus_tag LOCUS_25250 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O87388:sarcosine oxidase subunit beta >Feature sequence1170 75 1019 gene locus_tag LOCUS_25260 75 1019 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974534.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence1171 <1217 347 gene locus_tag LOCUS_25270 <1217 347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003536990.1:ABC transporter permease >Feature sequence1172 >Feature sequence1173 >Feature sequence1174 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 >Feature sequence1178 >Feature sequence1179 71 988 gene locus_tag LOCUS_25280 71 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 985 1143 gene locus_tag LOCUS_25290 gene rdxS 985 1143 CDS product cytochrome oxidase maturation protein, cbb3-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720871.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence1180 >Feature sequence1181 >Feature sequence1182 292 837 gene locus_tag LOCUS_25300 292 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence1183 >Feature sequence1184 <1209 411 gene locus_tag LOCUS_25310 <1209 411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337802.1:amidohydrolase >Feature sequence1185 48 482 gene locus_tag LOCUS_25320 48 482 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 protein_id gnl|my_center|LOCUS_25320 600 1094 gene locus_tag LOCUS_25330 gene coaD 600 1094 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J263 protein_id gnl|my_center|LOCUS_25330 >Feature sequence1186 1056 238 gene locus_tag LOCUS_25340 1056 238 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337681.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence1187 >Feature sequence1188 550 26 gene locus_tag LOCUS_25350 550 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531852.1 protein_id gnl|my_center|LOCUS_25350 967 572 gene locus_tag LOCUS_25360 gene lguL 967 572 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence1189 1204 908 gene locus_tag LOCUS_25370 1204 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence1190 >Feature sequence1191 >Feature sequence1192 923 495 gene locus_tag LOCUS_25380 923 495 CDS product endoribonuclease L-PSP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence1193 <1202 586 gene locus_tag LOCUS_25390 <1202 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390180.1:membrane protein >Feature sequence1194 490 35 gene locus_tag LOCUS_25400 490 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1199 510 gene locus_tag LOCUS_25410 1199 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence1195 >Feature sequence1196 20 235 gene locus_tag LOCUS_25420 20 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence1197 3 965 gene locus_tag LOCUS_25430 3 965 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338044.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence1198 <1 522 gene locus_tag LOCUS_25440 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337264.1:cyclopropane-fatty-acyl-phospholipid synthase 557 997 gene locus_tag LOCUS_25450 gene trgA 557 997 CDS product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337265.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence1199 <1190 509 gene locus_tag LOCUS_25460 <1190 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FA52:glucans biosynthesis glucosyltransferase H >Feature sequence1200 51 437 gene locus_tag LOCUS_25470 51 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 512 586 gene locus_tag LOCUS_t00250 512 586 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 618 845 gene locus_tag LOCUS_25480 618 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence1201 195 1148 gene locus_tag LOCUS_25490 195 1148 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338598.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence1202 <1189 648 gene locus_tag LOCUS_25500 <1189 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140274.1:alpha/beta hydrolase >Feature sequence1203 >Feature sequence1204 >Feature sequence1205 <1185 245 gene locus_tag LOCUS_25510 <1185 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IXX8:glutamate 5-kinase >Feature sequence1206 64 579 gene locus_tag LOCUS_25520 64 579 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412093.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence1207 >Feature sequence1208 >Feature sequence1209 <1 910 gene locus_tag LOCUS_25530 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338455.1:MBL fold hydrolase 1029 1163 gene locus_tag LOCUS_25540 1029 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence1210 <1 660 gene locus_tag LOCUS_25550 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533096.1:ABC transporter substrate-binding protein 1176 754 gene locus_tag LOCUS_25560 1176 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence1211 826 1050 gene locus_tag LOCUS_25570 826 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence1212 824 465 gene locus_tag LOCUS_25580 824 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence1213 <1170 344 gene locus_tag LOCUS_25590 <1170 344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192697.1:sugar ABC transporter >Feature sequence1214 3 602 gene locus_tag LOCUS_25600 3 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence1215 >Feature sequence1216 <1 571 gene locus_tag LOCUS_25610 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719378.1:flagellar motor switch protein FliG >Feature sequence1217 <1163 393 gene locus_tag LOCUS_25620 <1163 393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118174.1:glycosyl transferase >Feature sequence1218 >Feature sequence1219 <1161 537 gene locus_tag LOCUS_25630 <1161 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002119889.1:benzoate 1,2-dioxygenase large subunit >Feature sequence1220 335 1156 gene locus_tag LOCUS_25640 335 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence1221 781 20 gene locus_tag LOCUS_25650 781 20 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence1222 >Feature sequence1223 >Feature sequence1224 866 294 gene locus_tag LOCUS_25660 866 294 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886846.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence1225 1 252 gene locus_tag LOCUS_25670 1 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1149 259 gene locus_tag LOCUS_25680 gene purK 1149 259 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 protein_id gnl|my_center|LOCUS_25680 >Feature sequence1226 397 98 gene locus_tag LOCUS_25690 gene atpE 397 98 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_25690 1101 394 gene locus_tag LOCUS_25700 1101 394 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence1227 >Feature sequence1228 63 136 gene locus_tag LOCUS_t00260 63 136 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 250 543 gene locus_tag LOCUS_25710 250 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 <1146 623 gene locus_tag LOCUS_25720 <1146 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2U4:glucose-6-phosphate isomerase >Feature sequence1229 97 399 gene locus_tag LOCUS_25730 97 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1052 405 gene locus_tag LOCUS_25740 1052 405 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY27 protein_id gnl|my_center|LOCUS_25740 >Feature sequence1230 >Feature sequence1231 >Feature sequence1232 198 989 gene locus_tag LOCUS_25750 198 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence1233 >Feature sequence1234 137 346 gene locus_tag LOCUS_25760 137 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 437 607 gene locus_tag LOCUS_25770 437 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence1235 >Feature sequence1236 167 967 gene locus_tag LOCUS_25780 167 967 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338649.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence1237 171 599 gene locus_tag LOCUS_25790 171 599 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973696.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence1238 1032 322 gene locus_tag LOCUS_25800 1032 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence1239 <1138 272 gene locus_tag LOCUS_25810 <1138 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MIE5:NAD/NADP-dependent betaine aldehyde dehydrogenase >Feature sequence1240 631 428 gene locus_tag LOCUS_25820 631 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382962.1 protein_id gnl|my_center|LOCUS_25820 <1138 628 gene locus_tag LOCUS_25830 <1138 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721261.1:membrane protein >Feature sequence1241 <1136 601 gene locus_tag LOCUS_25840 <1136 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58264:thiazole synthase >Feature sequence1242 <1134 376 gene locus_tag LOCUS_25850 <1134 376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J426:riboflavin biosynthesis protein >Feature sequence1243 <1 585 gene locus_tag LOCUS_25860 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to U5NMV0:ADP-dependent (S)-NAD(P)H-hydrate dehydratase 1047 727 gene locus_tag LOCUS_25870 1047 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence1244 >Feature sequence1245 973 260 gene locus_tag LOCUS_25880 973 260 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970595.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence1246 >Feature sequence1247 727 164 gene locus_tag LOCUS_25890 727 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338707.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence1248 1132 521 gene locus_tag LOCUS_25900 1132 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence1249 1021 830 gene locus_tag LOCUS_25910 1021 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence1250 >Feature sequence1251 >Feature sequence1252 <1 518 gene locus_tag LOCUS_25920 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538033.1:3'-5' exonuclease >Feature sequence1253 <1 796 gene locus_tag LOCUS_25930 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337055.1:NADPH:quinone oxidoreductase 1122 811 gene locus_tag LOCUS_25940 1122 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence1254 >Feature sequence1255 <1123 319 gene locus_tag LOCUS_25950 <1123 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4G3:phosphate transporter >Feature sequence1256 <1122 246 gene locus_tag LOCUS_25960 <1122 246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533092.1:branched-chain amino acid ABC transporter permease >Feature sequence1257 858 307 gene locus_tag LOCUS_25970 858 307 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337021.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence1258 386 174 gene locus_tag LOCUS_25980 386 174 CDS product slyX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384904.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence1259 >Feature sequence1260 >Feature sequence1261 >Feature sequence1262 325 969 gene locus_tag LOCUS_25990 325 969 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090671.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence1263 1118 861 gene locus_tag LOCUS_26000 1118 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence1264 836 108 gene locus_tag LOCUS_26010 836 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26010 >Feature sequence1265 310 630 gene locus_tag LOCUS_26020 310 630 CDS product transcriptional activator HlyU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence1266 >Feature sequence1267 66 632 gene locus_tag LOCUS_26030 66 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence1268 <1 1039 gene locus_tag LOCUS_26040 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P32920:uroporphyrinogen decarboxylase >Feature sequence1269 <1 763 gene locus_tag LOCUS_26050 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J428:L-threonine aldolase >Feature sequence1270 193 504 gene locus_tag LOCUS_26060 193 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 <1106 542 gene locus_tag LOCUS_26070 <1106 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088209.1:3-keto-5-aminohexanoate cleavage protein >Feature sequence1271 >Feature sequence1272 38 271 gene locus_tag LOCUS_26080 38 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 405 851 gene locus_tag LOCUS_26090 405 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence1273 748 374 gene locus_tag LOCUS_26100 748 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1102 752 gene locus_tag LOCUS_26110 1102 752 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence1274 372 286 gene locus_tag LOCUS_t00270 372 286 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <1098 450 gene locus_tag LOCUS_26120 <1098 450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537739.1:membrane protein >Feature sequence1275 >Feature sequence1276 >Feature sequence1277 <1 888 gene locus_tag LOCUS_26130 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y4A6:peptide chain release factor 2 >Feature sequence1278 >Feature sequence1279 <1093 429 gene locus_tag LOCUS_26140 <1093 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385625.1:pca operon transcription factor PcaQ >Feature sequence1280 77 1054 gene locus_tag LOCUS_26150 77 1054 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969962.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence1281 <1092 381 gene locus_tag LOCUS_26160 <1092 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3I2:anhydro-N-acetylmuramic acid kinase >Feature sequence1282 <1091 25 gene locus_tag LOCUS_26170 <1091 25 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4M8:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence1283 >Feature sequence1284 <1089 312 gene locus_tag LOCUS_26180 <1089 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2C1:chaperone SurA >Feature sequence1285 1078 5 gene locus_tag LOCUS_26190 1078 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707169.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence1286 100 357 gene locus_tag LOCUS_26200 100 357 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence1287 >Feature sequence1288 448 1029 gene locus_tag LOCUS_26210 448 1029 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ52 protein_id gnl|my_center|LOCUS_26210 >Feature sequence1289 <1085 322 gene locus_tag LOCUS_26220 <1085 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAL6:histidine--tRNA ligase >Feature sequence1290 >Feature sequence1291 >Feature sequence1292 >Feature sequence1293 <1 892 gene locus_tag LOCUS_26230 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YA51:carboxynorspermidine/carboxyspermidine decarboxylase >Feature sequence1294 >Feature sequence1295 >Feature sequence1296 1049 639 gene locus_tag LOCUS_26240 gene fur 1049 639 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719651.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence1297 <1076 102 gene locus_tag LOCUS_26250 <1076 102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383184.1:oxidoreductase >Feature sequence1298 >Feature sequence1299 >Feature sequence1300 2 514 gene locus_tag LOCUS_26260 2 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence1301 <1 703 gene locus_tag LOCUS_26270 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003817846.1:CDP-6-deoxy-delta-3,4-glucoseen reductase >Feature sequence1302 >Feature sequence1303 <1069 3 gene locus_tag LOCUS_26280 <1069 3 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709446.1:xylulokinase >Feature sequence1304 >Feature sequence1305 999 541 gene locus_tag LOCUS_26290 999 541 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337626.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence1306 783 310 gene locus_tag LOCUS_26300 783 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence1307 <1066 427 gene locus_tag LOCUS_26310 <1066 427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003614.1:murein L,D-transpeptidase >Feature sequence1308 563 249 gene locus_tag LOCUS_26320 gene sugE2 563 249 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383935.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence1309 <1062 305 gene locus_tag LOCUS_26330 <1062 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383187.1:D-amino acid aminotransferase >Feature sequence1310 371 691 gene locus_tag LOCUS_26340 371 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence1311 19 291 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttgatccccgcgtgggcggggaacgc 660 376 gene locus_tag LOCUS_26350 gene ygbF 660 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_404470.2 protein_id gnl|my_center|LOCUS_26350 >Feature sequence1312 <1 810 gene locus_tag LOCUS_26360 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969596.1:cobalamin biosynthesis protein CobW 1006 839 gene locus_tag LOCUS_26370 1006 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence1313 <1 576 gene locus_tag LOCUS_26380 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887706.1:integrase 1059 832 gene locus_tag LOCUS_26390 1059 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence1314 >Feature sequence1315 >Feature sequence1316 951 526 gene locus_tag LOCUS_26400 951 526 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532827.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence1317 <1 1007 gene locus_tag LOCUS_26410 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338443.1:ATPase >Feature sequence1318 >Feature sequence1319 >Feature sequence1320 >Feature sequence1321 <1050 207 gene locus_tag LOCUS_26420 <1050 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384199.1:kinase >Feature sequence1322 >Feature sequence1323 >Feature sequence1324 2 625 gene locus_tag LOCUS_26430 2 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence1325 >Feature sequence1326 >Feature sequence1327 >Feature sequence1328 >Feature sequence1329 445 110 gene locus_tag LOCUS_26440 gene dksA 445 110 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338037.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence1330 >Feature sequence1331 <1 562 gene locus_tag LOCUS_26450 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y6E1:isoprenyl transferase >Feature sequence1332 >Feature sequence1333 >Feature sequence1334 733 816 gene locus_tag LOCUS_t00280 733 816 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 440 66 gene locus_tag LOCUS_26460 440 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence1338 >Feature sequence1339 >Feature sequence1340 >Feature sequence1341 450 680 gene locus_tag LOCUS_26470 gene purS 450 680 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S4 protein_id gnl|my_center|LOCUS_26470 >Feature sequence1342 3 668 gene locus_tag LOCUS_26480 3 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence1343 >Feature sequence1344 >Feature sequence1345 >Feature sequence1346 <1 580 gene locus_tag LOCUS_26490 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388134.1:MFS transporter >Feature sequence1347 <1 722 gene locus_tag LOCUS_26500 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2H6:Lon protease >Feature sequence1348 <1014 162 gene locus_tag LOCUS_26510 <1014 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719301.1:cysteine synthase A >Feature sequence1349 <1 978 gene locus_tag LOCUS_26520 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918510.1:transposase >Feature sequence1350 <1 746 gene locus_tag LOCUS_26530 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391131.1:precorrin-4 C(11)-methyltransferase >Feature sequence1351 45 647 gene locus_tag LOCUS_26540 45 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence1352 >Feature sequence1353 234 64 gene locus_tag LOCUS_26550 234 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 <1012 490 gene locus_tag LOCUS_26560 <1012 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3Z9:2-isopropylmalate synthase >Feature sequence1354 >Feature sequence1355 >Feature sequence1356 811 332 gene locus_tag LOCUS_26570 811 332 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815416.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence1357 >Feature sequence1358 >Feature sequence1359 <1 879 gene locus_tag LOCUS_26580 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:C4-dicarboxylate ABC transporter permease >Feature sequence1360 517 200 gene locus_tag LOCUS_26590 517 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337161.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence1361 <1 744 gene locus_tag LOCUS_26600 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120208.1:NAD(P)-dependent oxidoreductase >Feature sequence1362