>Feature sequence0001 436 14 gene locus_tag LOCUS_00010 436 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 686 1663 gene locus_tag LOCUS_00020 686 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2516 1707 gene locus_tag LOCUS_00030 2516 1707 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_00030 3682 2516 gene locus_tag LOCUS_00040 3682 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729605.1 protein_id gnl|my_center|LOCUS_00040 3802 5334 gene locus_tag LOCUS_00050 3802 5334 CDS product acetate CoA-transferase YdiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQM6 protein_id gnl|my_center|LOCUS_00050 5348 6517 gene locus_tag LOCUS_00060 5348 6517 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 protein_id gnl|my_center|LOCUS_00060 6514 7260 gene locus_tag LOCUS_00070 6514 7260 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027914.1 protein_id gnl|my_center|LOCUS_00070 7257 8093 gene locus_tag LOCUS_00080 7257 8093 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_00080 8185 9306 gene locus_tag LOCUS_00090 gene glxK 8185 9306 CDS product glycerate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_00090 9384 10409 gene locus_tag LOCUS_00100 9384 10409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967751.1 protein_id gnl|my_center|LOCUS_00100 10422 11453 gene locus_tag LOCUS_00110 10422 11453 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706500.1 protein_id gnl|my_center|LOCUS_00110 11450 12964 gene locus_tag LOCUS_00120 11450 12964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_00120 12961 13980 gene locus_tag LOCUS_00130 12961 13980 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706498.1 protein_id gnl|my_center|LOCUS_00130 14011 15132 gene locus_tag LOCUS_00140 14011 15132 CDS product putative zinc-type alcohol dehydrogenase AdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702819.1 protein_id gnl|my_center|LOCUS_00140 15177 16688 gene locus_tag LOCUS_00150 15177 16688 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529702.1 protein_id gnl|my_center|LOCUS_00150 16685 17122 gene locus_tag LOCUS_00160 16685 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729616.1 protein_id gnl|my_center|LOCUS_00160 17501 17743 gene locus_tag LOCUS_00170 17501 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17916 18089 gene locus_tag LOCUS_00180 17916 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18514 19128 gene locus_tag LOCUS_00190 18514 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19280 19876 gene locus_tag LOCUS_00200 19280 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00200 19880 20392 gene locus_tag LOCUS_00210 19880 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00210 20406 21443 gene locus_tag LOCUS_00220 20406 21443 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_00220 21440 22957 gene locus_tag LOCUS_00230 21440 22957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729613.1 protein_id gnl|my_center|LOCUS_00230 22954 23676 gene locus_tag LOCUS_00240 22954 23676 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729612.1 protein_id gnl|my_center|LOCUS_00240 23673 25265 gene locus_tag LOCUS_00250 23673 25265 CDS product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729611.1 protein_id gnl|my_center|LOCUS_00250 25267 26400 gene locus_tag LOCUS_00260 25267 26400 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_00260 26397 27572 gene locus_tag LOCUS_00270 26397 27572 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729609.1 protein_id gnl|my_center|LOCUS_00270 27569 28963 gene locus_tag LOCUS_00280 27569 28963 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729608.1 protein_id gnl|my_center|LOCUS_00280 29143 29712 gene locus_tag LOCUS_00290 29143 29712 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729607.1 protein_id gnl|my_center|LOCUS_00290 29709 30431 gene locus_tag LOCUS_00300 29709 30431 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729606.1 protein_id gnl|my_center|LOCUS_00300 32773 31169 gene locus_tag LOCUS_00310 32773 31169 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967746.1 protein_id gnl|my_center|LOCUS_00310 35166 33217 gene locus_tag LOCUS_00320 35166 33217 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_00320 37058 35226 gene locus_tag LOCUS_00330 37058 35226 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_00330 38246 37068 gene locus_tag LOCUS_00340 gene lldD1 38246 37068 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898557.1 protein_id gnl|my_center|LOCUS_00340 39490 38249 gene locus_tag LOCUS_00350 39490 38249 CDS product putative coenzyme PQQ synthesis protein E PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704563.1 protein_id gnl|my_center|LOCUS_00350 39869 39585 gene locus_tag LOCUS_00360 39869 39585 CDS product mycofactocin system protein MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892808.1 protein_id gnl|my_center|LOCUS_00360 40062 40697 gene locus_tag LOCUS_00370 gene mftR 40062 40697 CDS product putative mycofactocin biosynthesis transcriptional regulator MftR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMB7 protein_id gnl|my_center|LOCUS_00370 40724 41569 gene locus_tag LOCUS_00380 40724 41569 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731146.1 protein_id gnl|my_center|LOCUS_00380 41899 42873 gene locus_tag LOCUS_00390 41899 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45061 43316 gene locus_tag LOCUS_00400 45061 43316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45568 45356 gene locus_tag LOCUS_00410 45568 45356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45740 47170 gene locus_tag LOCUS_00420 45740 47170 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027365.1 protein_id gnl|my_center|LOCUS_00420 47212 48246 gene locus_tag LOCUS_00430 47212 48246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419657.1 protein_id gnl|my_center|LOCUS_00430 48917 48420 gene locus_tag LOCUS_00440 48917 48420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence0002 852 148 gene locus_tag LOCUS_00450 852 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 946 4326 gene locus_tag LOCUS_00460 946 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063831.1 protein_id gnl|my_center|LOCUS_00460 4442 5317 gene locus_tag LOCUS_00470 4442 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5956 5576 gene locus_tag LOCUS_00480 5956 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5873 6328 gene locus_tag LOCUS_00490 5873 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 7561 6467 gene locus_tag LOCUS_00500 7561 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00500 9966 7606 gene locus_tag LOCUS_00510 9966 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 10235 9939 gene locus_tag LOCUS_00520 10235 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 11197 10538 gene locus_tag LOCUS_00530 11197 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 13227 11194 gene locus_tag LOCUS_00540 13227 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 13694 13224 gene locus_tag LOCUS_00550 13694 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 13859 14383 gene locus_tag LOCUS_00560 13859 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 14373 17744 gene locus_tag LOCUS_00570 14373 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 17741 19741 gene locus_tag LOCUS_00580 17741 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 19821 21818 gene locus_tag LOCUS_00590 19821 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 21815 22795 gene locus_tag LOCUS_00600 21815 22795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 22792 23583 gene locus_tag LOCUS_00610 22792 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 23580 27623 gene locus_tag LOCUS_00620 23580 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 27620 28201 gene locus_tag LOCUS_00630 27620 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 28198 31623 gene locus_tag LOCUS_00640 28198 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 31643 33469 gene locus_tag LOCUS_00650 31643 33469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_00650 33466 36315 gene locus_tag LOCUS_00660 33466 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence0003 1338 2165 gene locus_tag LOCUS_00670 1338 2165 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896837.1 protein_id gnl|my_center|LOCUS_00670 2337 3395 gene locus_tag LOCUS_00680 gene rpfB 2337 3395 CDS product resuscitation-promoting factor RpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3E0 protein_id gnl|my_center|LOCUS_00680 3424 4299 gene locus_tag LOCUS_00690 gene rsmA 3424 4299 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRY1 protein_id gnl|my_center|LOCUS_00690 5125 4310 gene locus_tag LOCUS_00700 5125 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 6127 5138 gene locus_tag LOCUS_00710 6127 5138 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_00710 6268 7245 gene locus_tag LOCUS_00720 gene ispE 6268 7245 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKD5 protein_id gnl|my_center|LOCUS_00720 7245 9041 gene locus_tag LOCUS_00730 7245 9041 CDS product putative ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702017.1 protein_id gnl|my_center|LOCUS_00730 9091 9804 gene locus_tag LOCUS_00740 gene yndH 9091 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31812 protein_id gnl|my_center|LOCUS_00740 9850 10848 gene locus_tag LOCUS_00750 9850 10848 CDS product 3-hydroxyisobutyryl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 protein_id gnl|my_center|LOCUS_00750 11483 10860 gene locus_tag LOCUS_00760 11483 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 12272 11619 gene locus_tag LOCUS_00770 12272 11619 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013360.1 protein_id gnl|my_center|LOCUS_00770 13838 12282 gene locus_tag LOCUS_00780 gene prfC 13838 12282 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRW2 protein_id gnl|my_center|LOCUS_00780 14094 15728 gene locus_tag LOCUS_00790 14094 15728 CDS product putative ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3D6 protein_id gnl|my_center|LOCUS_00790 16322 15729 gene locus_tag LOCUS_00800 gene pth 16322 15729 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKD8 protein_id gnl|my_center|LOCUS_00800 17066 16404 gene locus_tag LOCUS_00810 gene rplY 17066 16404 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3D2 protein_id gnl|my_center|LOCUS_00810 17860 17252 gene locus_tag LOCUS_00820 17860 17252 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030297.1 protein_id gnl|my_center|LOCUS_00820 18438 17941 gene locus_tag LOCUS_00830 18438 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 19524 18811 gene locus_tag LOCUS_00840 19524 18811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence0004 <1 1500 gene locus_tag LOCUS_00850 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R628:galactofuranosyl transferase GlfT2 1478 2014 gene locus_tag LOCUS_00860 1478 2014 CDS product putative phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700926.1 protein_id gnl|my_center|LOCUS_00860 2011 2916 gene locus_tag LOCUS_00870 2011 2916 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R626 protein_id gnl|my_center|LOCUS_00870 2894 4759 gene locus_tag LOCUS_00880 2894 4759 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731263.1 protein_id gnl|my_center|LOCUS_00880 4973 5983 gene locus_tag LOCUS_00890 4973 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897808.1 protein_id gnl|my_center|LOCUS_00890 6315 7328 gene locus_tag LOCUS_00900 6315 7328 CDS product antigen 85-C precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700929.1 protein_id gnl|my_center|LOCUS_00900 7548 9449 gene locus_tag LOCUS_00910 gene csp1 7548 9449 CDS product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C1D6 protein_id gnl|my_center|LOCUS_00910 9714 9460 gene locus_tag LOCUS_00920 9714 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 9596 10084 gene locus_tag LOCUS_00930 9596 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 10094 11047 gene locus_tag LOCUS_00940 10094 11047 CDS product cutinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731258.1 protein_id gnl|my_center|LOCUS_00940 11336 12334 gene locus_tag LOCUS_00950 11336 12334 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414686.1 protein_id gnl|my_center|LOCUS_00950 12514 14412 gene locus_tag LOCUS_00960 12514 14412 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700933.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence0005 861 1325 gene locus_tag LOCUS_00970 861 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 1571 2185 gene locus_tag LOCUS_00980 1571 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 2470 8370 gene locus_tag LOCUS_00990 2470 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 8994 8443 gene locus_tag LOCUS_01000 8994 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 9630 9064 gene locus_tag LOCUS_01010 9630 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 10250 9630 gene locus_tag LOCUS_01020 10250 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 11624 10584 gene locus_tag LOCUS_01030 11624 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039448.1 protein_id gnl|my_center|LOCUS_01030 11758 12123 gene locus_tag LOCUS_01040 11758 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 12168 12338 gene locus_tag LOCUS_01050 12168 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 <18442 12708 gene locus_tag LOCUS_01060 <18442 12708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700713.2:TraA/ATP-dependent exoDNAse/relaxase >Feature sequence0006 1050 493 gene locus_tag LOCUS_01070 1050 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 1564 1271 gene locus_tag LOCUS_01080 1564 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1864 2118 gene locus_tag LOCUS_01090 1864 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2171 2950 gene locus_tag LOCUS_01100 2171 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731121.1 protein_id gnl|my_center|LOCUS_01100 3790 3014 gene locus_tag LOCUS_01110 3790 3014 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225354.1 protein_id gnl|my_center|LOCUS_01110 5294 3876 gene locus_tag LOCUS_01120 5294 3876 CDS product putative dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705456.1 protein_id gnl|my_center|LOCUS_01120 7138 5291 gene locus_tag LOCUS_01130 7138 5291 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950497.1 protein_id gnl|my_center|LOCUS_01130 8619 7336 gene locus_tag LOCUS_01140 8619 7336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226953.1 protein_id gnl|my_center|LOCUS_01140 8714 10204 gene locus_tag LOCUS_01150 gene lcfB 8714 10204 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07610 protein_id gnl|my_center|LOCUS_01150 10525 10250 gene locus_tag LOCUS_01160 10525 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 11198 10740 gene locus_tag LOCUS_01170 11198 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 11312 12187 gene locus_tag LOCUS_01180 gene folD 11312 12187 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J6 protein_id gnl|my_center|LOCUS_01180 12960 12157 gene locus_tag LOCUS_01190 12960 12157 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_01190 13722 13030 gene locus_tag LOCUS_01200 13722 13030 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_01200 14916 13765 gene locus_tag LOCUS_01210 14916 13765 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_01210 16175 15012 gene locus_tag LOCUS_01220 gene hcaD 16175 15012 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_01220 16534 16172 gene locus_tag LOCUS_01230 gene hcaC 16534 16172 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_01230 <17971 16905 gene locus_tag LOCUS_01240 <17971 16905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729747.1:S-(hydroxymethyl)mycothiol dehydrogenase >Feature sequence0007 1210 254 gene locus_tag LOCUS_01250 1210 254 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_01250 2640 1210 gene locus_tag LOCUS_01260 2640 1210 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977606.1 protein_id gnl|my_center|LOCUS_01260 3948 2752 gene locus_tag LOCUS_01270 3948 2752 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_01270 5291 3945 gene locus_tag LOCUS_01280 5291 3945 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893854.1 protein_id gnl|my_center|LOCUS_01280 6584 5295 gene locus_tag LOCUS_01290 6584 5295 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728381.1 protein_id gnl|my_center|LOCUS_01290 7408 6695 gene locus_tag LOCUS_01300 7408 6695 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_01300 8898 7423 gene locus_tag LOCUS_01310 8898 7423 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 protein_id gnl|my_center|LOCUS_01310 11807 8895 gene locus_tag LOCUS_01320 11807 8895 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_01320 13069 11804 gene locus_tag LOCUS_01330 gene gabT 13069 11804 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_01330 13175 14062 gene locus_tag LOCUS_01340 gene rbsK 13175 14062 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R116 protein_id gnl|my_center|LOCUS_01340 14059 14529 gene locus_tag LOCUS_01350 14059 14529 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_01350 14539 14943 gene locus_tag LOCUS_01360 14539 14943 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_01360 15337 14963 gene locus_tag LOCUS_01370 gene crcB 15337 14963 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBA0 protein_id gnl|my_center|LOCUS_01370 15747 15334 gene locus_tag LOCUS_01380 gene crcB 15747 15334 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB99 protein_id gnl|my_center|LOCUS_01380 >Feature sequence0008 990 2270 gene locus_tag LOCUS_01390 gene proA 990 2270 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R115 protein_id gnl|my_center|LOCUS_01390 2322 3203 gene locus_tag LOCUS_01400 2322 3203 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895962.1 protein_id gnl|my_center|LOCUS_01400 3205 4620 gene locus_tag LOCUS_01410 3205 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412513.1 protein_id gnl|my_center|LOCUS_01410 4665 5441 gene locus_tag LOCUS_01420 gene nadD 4665 5441 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMZ4 protein_id gnl|my_center|LOCUS_01420 5438 5827 gene locus_tag LOCUS_01430 gene rsfS 5438 5827 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBS8 protein_id gnl|my_center|LOCUS_01430 5824 6477 gene locus_tag LOCUS_01440 5824 6477 CDS product putative phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702362.1 protein_id gnl|my_center|LOCUS_01440 6464 7216 gene locus_tag LOCUS_01450 gene octT 6464 7216 CDS product diglucosylglycerate octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R109 protein_id gnl|my_center|LOCUS_01450 7285 8061 gene locus_tag LOCUS_01460 7285 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702364.1 protein_id gnl|my_center|LOCUS_01460 8169 9125 gene locus_tag LOCUS_01470 8169 9125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412373.1 protein_id gnl|my_center|LOCUS_01470 9122 10708 gene locus_tag LOCUS_01480 9122 10708 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729933.1 protein_id gnl|my_center|LOCUS_01480 10726 11736 gene locus_tag LOCUS_01490 10726 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729932.1 protein_id gnl|my_center|LOCUS_01490 12072 11812 gene locus_tag LOCUS_01500 gene rpsT 12072 11812 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R102 protein_id gnl|my_center|LOCUS_01500 12377 13981 gene locus_tag LOCUS_01510 12377 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702374.1 protein_id gnl|my_center|LOCUS_01510 13982 14956 gene locus_tag LOCUS_01520 13982 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702375.1 protein_id gnl|my_center|LOCUS_01520 14953 15795 gene locus_tag LOCUS_01530 14953 15795 CDS product transglutaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702376.1 protein_id gnl|my_center|LOCUS_01530 16413 15844 gene locus_tag LOCUS_01540 16413 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702378.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence0009 1523 921 gene locus_tag LOCUS_01550 1523 921 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726881.1 protein_id gnl|my_center|LOCUS_01550 2761 1586 gene locus_tag LOCUS_01560 2761 1586 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908964.1 protein_id gnl|my_center|LOCUS_01560 2916 3383 gene locus_tag LOCUS_01570 2916 3383 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 protein_id gnl|my_center|LOCUS_01570 3433 3657 gene locus_tag LOCUS_01580 3433 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 3680 7927 gene locus_tag LOCUS_01590 gene aftD 3680 7927 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96419 protein_id gnl|my_center|LOCUS_01590 9050 7905 gene locus_tag LOCUS_01600 9050 7905 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705196.1 protein_id gnl|my_center|LOCUS_01600 9218 10342 gene locus_tag LOCUS_01610 9218 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908969.1 protein_id gnl|my_center|LOCUS_01610 12162 10444 gene locus_tag LOCUS_01620 12162 10444 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974754.1 protein_id gnl|my_center|LOCUS_01620 13601 12159 gene locus_tag LOCUS_01630 13601 12159 CDS product cytosine/purines uracil thiamine allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459893.1 protein_id gnl|my_center|LOCUS_01630 14208 13771 gene locus_tag LOCUS_01640 14208 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 14312 15388 gene locus_tag LOCUS_01650 14312 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730477.1 protein_id gnl|my_center|LOCUS_01650 16409 15369 gene locus_tag LOCUS_01660 16409 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence0010 3319 2354 gene locus_tag LOCUS_01670 gene dapA 3319 2354 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG94 protein_id gnl|my_center|LOCUS_01670 3318 4292 gene locus_tag LOCUS_01680 3318 4292 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229187.1 protein_id gnl|my_center|LOCUS_01680 6221 4248 gene locus_tag LOCUS_01690 6221 4248 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUE0 protein_id gnl|my_center|LOCUS_01690 6852 6571 gene locus_tag LOCUS_01700 6852 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 7394 6987 gene locus_tag LOCUS_01710 7394 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 9807 7612 gene locus_tag LOCUS_01720 9807 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 10116 11123 gene locus_tag LOCUS_01730 10116 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_01730 11484 12368 gene locus_tag LOCUS_01740 11484 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_01740 12694 13911 gene locus_tag LOCUS_01750 12694 13911 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969873.1 protein_id gnl|my_center|LOCUS_01750 14025 14369 gene locus_tag LOCUS_01760 14025 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729060.1 protein_id gnl|my_center|LOCUS_01760 14366 15205 gene locus_tag LOCUS_01770 14366 15205 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227569.1 protein_id gnl|my_center|LOCUS_01770 15347 15793 gene locus_tag LOCUS_01780 15347 15793 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967754.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence0011 897 1286 gene locus_tag LOCUS_01790 897 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1541 1290 gene locus_tag LOCUS_01800 1541 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2211 1546 gene locus_tag LOCUS_01810 2211 1546 CDS product putative two-component system response regulator, LuxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705242.1 protein_id gnl|my_center|LOCUS_01810 3359 2208 gene locus_tag LOCUS_01820 3359 2208 CDS product putative two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705243.1 protein_id gnl|my_center|LOCUS_01820 4542 3364 gene locus_tag LOCUS_01830 4542 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705244.1 protein_id gnl|my_center|LOCUS_01830 4628 6160 gene locus_tag LOCUS_01840 4628 6160 CDS product putative adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705246.1 protein_id gnl|my_center|LOCUS_01840 6170 7303 gene locus_tag LOCUS_01850 6170 7303 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 protein_id gnl|my_center|LOCUS_01850 7416 7967 gene locus_tag LOCUS_01860 7416 7967 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_01860 8151 8543 gene locus_tag LOCUS_01870 8151 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705249.1 protein_id gnl|my_center|LOCUS_01870 8600 9994 gene locus_tag LOCUS_01880 gene nhaA 8600 9994 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCU8 protein_id gnl|my_center|LOCUS_01880 10074 11327 gene locus_tag LOCUS_01890 10074 11327 CDS product conserved hypothetical transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703333.1 protein_id gnl|my_center|LOCUS_01890 11428 11724 gene locus_tag LOCUS_01900 11428 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 11721 12809 gene locus_tag LOCUS_01910 11721 12809 CDS product putative arsenic-transport integral membrane protein ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705585.1 protein_id gnl|my_center|LOCUS_01910 12809 13231 gene locus_tag LOCUS_01920 12809 13231 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_01920 13228 13644 gene locus_tag LOCUS_01930 13228 13644 CDS product putative arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705586.1 protein_id gnl|my_center|LOCUS_01930 13650 14705 gene locus_tag LOCUS_01940 13650 14705 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence0012 1600 821 gene locus_tag LOCUS_01950 gene paaG 1600 821 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_01950 2440 1625 gene locus_tag LOCUS_01960 2440 1625 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_01960 3246 2488 gene locus_tag LOCUS_01970 3246 2488 CDS product putative ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704114.1 protein_id gnl|my_center|LOCUS_01970 3130 3375 gene locus_tag LOCUS_01980 3130 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3422 5527 gene locus_tag LOCUS_01990 gene glgX 3422 5527 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D191 protein_id gnl|my_center|LOCUS_01990 5738 6058 gene locus_tag LOCUS_02000 5738 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 7002 6193 gene locus_tag LOCUS_02010 7002 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_02010 8159 6999 gene locus_tag LOCUS_02020 gene serB 8159 6999 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229475.1 protein_id gnl|my_center|LOCUS_02020 10165 8375 gene locus_tag LOCUS_02030 10165 8375 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDZ6 protein_id gnl|my_center|LOCUS_02030 10539 11552 gene locus_tag LOCUS_02040 10539 11552 CDS product Fe3+-citrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727368.1 protein_id gnl|my_center|LOCUS_02040 11557 12030 gene locus_tag LOCUS_02050 11557 12030 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_02050 12129 13046 gene locus_tag LOCUS_02060 12129 13046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_02060 13050 13247 gene locus_tag LOCUS_02070 13050 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 14282 13272 gene locus_tag LOCUS_02080 gene nrdF 14282 13272 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CBQ2 protein_id gnl|my_center|LOCUS_02080 >Feature sequence0013 838 1437 gene locus_tag LOCUS_02090 838 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 2195 1434 gene locus_tag LOCUS_02100 2195 1434 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_02100 2672 2223 gene locus_tag LOCUS_02110 2672 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704786.1 protein_id gnl|my_center|LOCUS_02110 3680 2727 gene locus_tag LOCUS_02120 3680 2727 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_02120 3710 4216 gene locus_tag LOCUS_02130 3710 4216 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442621.1 protein_id gnl|my_center|LOCUS_02130 4248 4787 gene locus_tag LOCUS_02140 4248 4787 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_02140 6149 4779 gene locus_tag LOCUS_02150 6149 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6358 6170 gene locus_tag LOCUS_02160 6358 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7122 6358 gene locus_tag LOCUS_02170 7122 6358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_02170 7194 7997 gene locus_tag LOCUS_02180 7194 7997 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702047.1 protein_id gnl|my_center|LOCUS_02180 8015 8485 gene locus_tag LOCUS_02190 8015 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 8506 9594 gene locus_tag LOCUS_02200 8506 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02200 10364 9591 gene locus_tag LOCUS_02210 10364 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705284.1 protein_id gnl|my_center|LOCUS_02210 10890 10399 gene locus_tag LOCUS_02220 10890 10399 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230347.1 protein_id gnl|my_center|LOCUS_02220 10976 11428 gene locus_tag LOCUS_02230 10976 11428 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897002.1 protein_id gnl|my_center|LOCUS_02230 11425 12147 gene locus_tag LOCUS_02240 11425 12147 CDS product putative pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702303.1 protein_id gnl|my_center|LOCUS_02240 12178 12987 gene locus_tag LOCUS_02250 12178 12987 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100893.1 protein_id gnl|my_center|LOCUS_02250 13424 12990 gene locus_tag LOCUS_02260 13424 12990 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971444.1 protein_id gnl|my_center|LOCUS_02260 13487 13858 gene locus_tag LOCUS_02270 13487 13858 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223051.1 protein_id gnl|my_center|LOCUS_02270 13877 14551 gene locus_tag LOCUS_02280 13877 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence0014 564 1247 gene locus_tag LOCUS_02290 564 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1251 1856 gene locus_tag LOCUS_02300 1251 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02300 1853 2866 gene locus_tag LOCUS_02310 1853 2866 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027138.1 protein_id gnl|my_center|LOCUS_02310 2976 3521 gene locus_tag LOCUS_02320 2976 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4342 3467 gene locus_tag LOCUS_02330 4342 3467 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_02330 5647 4424 gene locus_tag LOCUS_02340 5647 4424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_02340 8174 5730 gene locus_tag LOCUS_02350 8174 5730 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_02350 8280 9224 gene locus_tag LOCUS_02360 8280 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_02360 9275 10219 gene locus_tag LOCUS_02370 9275 10219 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_02370 10319 11551 gene locus_tag LOCUS_02380 10319 11551 CDS product putative multidrug resistance transporter, Bcr/CflA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702135.1 protein_id gnl|my_center|LOCUS_02380 11606 12130 gene locus_tag LOCUS_02390 11606 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229804.1 protein_id gnl|my_center|LOCUS_02390 12172 12873 gene locus_tag LOCUS_02400 12172 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 13650 12886 gene locus_tag LOCUS_02410 gene nfo 13650 12886 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230998.1 protein_id gnl|my_center|LOCUS_02410 13726 14460 gene locus_tag LOCUS_02420 13726 14460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence0015 988 185 gene locus_tag LOCUS_02430 gene thiM 988 185 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQH0 protein_id gnl|my_center|LOCUS_02430 1861 1178 gene locus_tag LOCUS_02440 1861 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701445.1 protein_id gnl|my_center|LOCUS_02440 2444 1935 gene locus_tag LOCUS_02450 2444 1935 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHW8 protein_id gnl|my_center|LOCUS_02450 3976 2576 gene locus_tag LOCUS_02460 3976 2576 CDS product aerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896702.1 protein_id gnl|my_center|LOCUS_02460 4150 5703 gene locus_tag LOCUS_02470 4150 5703 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730457.1 protein_id gnl|my_center|LOCUS_02470 5700 6374 gene locus_tag LOCUS_02480 5700 6374 CDS product transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R313 protein_id gnl|my_center|LOCUS_02480 8585 6453 gene locus_tag LOCUS_02490 gene ptrB 8585 6453 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_02490 9499 8582 gene locus_tag LOCUS_02500 gene purC 9499 8582 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4I0 protein_id gnl|my_center|LOCUS_02500 9530 10933 gene locus_tag LOCUS_02510 9530 10933 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_02510 12046 10991 gene locus_tag LOCUS_02520 12046 10991 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_02520 13611 12043 gene locus_tag LOCUS_02530 13611 12043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_02530 <14363 13615 gene locus_tag LOCUS_02540 <14363 13615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729221.1:iron ABC transporter substrate-binding protein >Feature sequence0016 664 125 gene locus_tag LOCUS_02550 664 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1416 661 gene locus_tag LOCUS_02560 1416 661 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65349 protein_id gnl|my_center|LOCUS_02560 1908 1426 gene locus_tag LOCUS_02570 1908 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2264 1923 gene locus_tag LOCUS_02580 2264 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2814 2296 gene locus_tag LOCUS_02590 2814 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_02590 3127 2807 gene locus_tag LOCUS_02600 3127 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3520 3149 gene locus_tag LOCUS_02610 3520 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702649.1 protein_id gnl|my_center|LOCUS_02610 4779 3847 gene locus_tag LOCUS_02620 4779 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4883 5476 gene locus_tag LOCUS_02630 4883 5476 CDS product TIGR03086 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224486.1 protein_id gnl|my_center|LOCUS_02630 6023 5562 gene locus_tag LOCUS_02640 6023 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6652 6029 gene locus_tag LOCUS_02650 6652 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 6785 7108 gene locus_tag LOCUS_02660 6785 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 8468 7101 gene locus_tag LOCUS_02670 8468 7101 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726938.1 protein_id gnl|my_center|LOCUS_02670 8554 9435 gene locus_tag LOCUS_02680 8554 9435 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726937.1 protein_id gnl|my_center|LOCUS_02680 9432 10652 gene locus_tag LOCUS_02690 9432 10652 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_02690 10749 11474 gene locus_tag LOCUS_02700 10749 11474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728695.1 protein_id gnl|my_center|LOCUS_02700 11471 12679 gene locus_tag LOCUS_02710 11471 12679 CDS product putative ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701968.1 protein_id gnl|my_center|LOCUS_02710 12676 13413 gene locus_tag LOCUS_02720 12676 13413 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence0017 267 1616 gene locus_tag LOCUS_02730 267 1616 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950468.1 protein_id gnl|my_center|LOCUS_02730 1795 2724 gene locus_tag LOCUS_02740 1795 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2685 3887 gene locus_tag LOCUS_02750 2685 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 4079 3906 gene locus_tag LOCUS_02760 4079 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 4143 4397 gene locus_tag LOCUS_02770 4143 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4402 4926 gene locus_tag LOCUS_02780 4402 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5544 4903 gene locus_tag LOCUS_02790 5544 4903 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_02790 5629 6060 gene locus_tag LOCUS_02800 5629 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144205.1 protein_id gnl|my_center|LOCUS_02800 6057 7466 gene locus_tag LOCUS_02810 6057 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7456 8061 gene locus_tag LOCUS_02820 7456 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 8248 8045 gene locus_tag LOCUS_02830 8248 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8473 8306 gene locus_tag LOCUS_02840 8473 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 8729 9277 gene locus_tag LOCUS_02850 8729 9277 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932115.1 protein_id gnl|my_center|LOCUS_02850 10545 9505 gene locus_tag LOCUS_02860 10545 9505 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_02860 10630 11100 gene locus_tag LOCUS_02870 10630 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 11164 11931 gene locus_tag LOCUS_02880 11164 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12213 12028 gene locus_tag LOCUS_02890 12213 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13027 12263 gene locus_tag LOCUS_02900 13027 12263 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence0018 <1 1256 gene locus_tag LOCUS_02910 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532746.1:flavin-binding monooxygenase 1253 2086 gene locus_tag LOCUS_02920 1253 2086 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411086.1 protein_id gnl|my_center|LOCUS_02920 2747 2103 gene locus_tag LOCUS_02930 2747 2103 CDS product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703312.1 protein_id gnl|my_center|LOCUS_02930 2872 4005 gene locus_tag LOCUS_02940 2872 4005 CDS product 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_02940 4002 4937 gene locus_tag LOCUS_02950 4002 4937 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227174.1 protein_id gnl|my_center|LOCUS_02950 4934 6541 gene locus_tag LOCUS_02960 gene mhpA 4934 6541 CDS product 3-(3-hydroxyphenyl)propionate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227171.1 protein_id gnl|my_center|LOCUS_02960 6538 7353 gene locus_tag LOCUS_02970 6538 7353 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702047.1 protein_id gnl|my_center|LOCUS_02970 8507 7350 gene locus_tag LOCUS_02980 8507 7350 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_02980 9634 8504 gene locus_tag LOCUS_02990 gene nixA 9634 8504 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIK3 protein_id gnl|my_center|LOCUS_02990 10354 9752 gene locus_tag LOCUS_03000 10354 9752 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705264.1 protein_id gnl|my_center|LOCUS_03000 10471 12048 gene locus_tag LOCUS_03010 10471 12048 CDS product acetyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence0019 398 841 gene locus_tag LOCUS_03020 398 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 1427 957 gene locus_tag LOCUS_03030 1427 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2069 1569 gene locus_tag LOCUS_03040 2069 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03040 2437 2090 gene locus_tag LOCUS_03050 2437 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 3375 2527 gene locus_tag LOCUS_03060 3375 2527 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727583.1 protein_id gnl|my_center|LOCUS_03060 3526 4194 gene locus_tag LOCUS_03070 3526 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 4181 4600 gene locus_tag LOCUS_03080 4181 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03080 5084 4623 gene locus_tag LOCUS_03090 5084 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 5197 5922 gene locus_tag LOCUS_03100 5197 5922 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967980.1 protein_id gnl|my_center|LOCUS_03100 5954 6151 gene locus_tag LOCUS_03110 5954 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 6607 6176 gene locus_tag LOCUS_03120 6607 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6843 7373 gene locus_tag LOCUS_03130 6843 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 7592 7380 gene locus_tag LOCUS_03140 7592 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 8679 7609 gene locus_tag LOCUS_03150 gene mraY 8679 7609 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R019 protein_id gnl|my_center|LOCUS_03150 9724 8795 gene locus_tag LOCUS_03160 9724 8795 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896431.1 protein_id gnl|my_center|LOCUS_03160 9687 10064 gene locus_tag LOCUS_03170 9687 10064 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029806.1 protein_id gnl|my_center|LOCUS_03170 10066 10470 gene locus_tag LOCUS_03180 10066 10470 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_03180 10867 10475 gene locus_tag LOCUS_03190 10867 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_03190 11385 10864 gene locus_tag LOCUS_03200 11385 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030665.1 protein_id gnl|my_center|LOCUS_03200 12125 11508 gene locus_tag LOCUS_03210 12125 11508 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence0020 501 1010 gene locus_tag LOCUS_03220 501 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 1172 1552 gene locus_tag LOCUS_03230 1172 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2240 1524 gene locus_tag LOCUS_03240 2240 1524 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_03240 3445 2237 gene locus_tag LOCUS_03250 3445 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4652 3681 gene locus_tag LOCUS_03260 4652 3681 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_03260 4672 5460 gene locus_tag LOCUS_03270 4672 5460 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122123.1 protein_id gnl|my_center|LOCUS_03270 7469 5469 gene locus_tag LOCUS_03280 7469 5469 CDS product putative multi-functional enzyme with acyl-CoA-reductase activity AcrA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704438.1 protein_id gnl|my_center|LOCUS_03280 9633 7504 gene locus_tag LOCUS_03290 9633 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence0021 <1 1898 gene locus_tag LOCUS_03300 <1 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R0B0:pyruvate dehydrogenase E1 component 1986 3410 gene locus_tag LOCUS_03310 1986 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702617.1 protein_id gnl|my_center|LOCUS_03310 3539 4447 gene locus_tag LOCUS_03320 3539 4447 CDS product putative malonyl CoA-ACP transacylase FabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702616.1 protein_id gnl|my_center|LOCUS_03320 4512 4880 gene locus_tag LOCUS_03330 gene acpM 4512 4880 CDS product meromycolate extension acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69475 protein_id gnl|my_center|LOCUS_03330 4889 6139 gene locus_tag LOCUS_03340 4889 6139 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729736.1 protein_id gnl|my_center|LOCUS_03340 6272 7705 gene locus_tag LOCUS_03350 6272 7705 CDS product putative propionyl-CoA carboxylase beta chain 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702613.1 protein_id gnl|my_center|LOCUS_03350 8354 7905 gene locus_tag LOCUS_03360 8354 7905 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_03360 8955 8443 gene locus_tag LOCUS_03370 8955 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908531.1 protein_id gnl|my_center|LOCUS_03370 9903 9100 gene locus_tag LOCUS_03380 9903 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411619.1 protein_id gnl|my_center|LOCUS_03380 9989 12124 gene locus_tag LOCUS_03390 9989 12124 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence0022 484 1587 gene locus_tag LOCUS_03400 484 1587 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027159.1 protein_id gnl|my_center|LOCUS_03400 1584 2453 gene locus_tag LOCUS_03410 1584 2453 CDS product iron-enterobactin transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_03410 5090 2463 gene locus_tag LOCUS_03420 5090 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35867 protein_id gnl|my_center|LOCUS_03420 6388 5087 gene locus_tag LOCUS_03430 6388 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35866 protein_id gnl|my_center|LOCUS_03430 6616 6999 gene locus_tag LOCUS_03440 6616 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703150.1 protein_id gnl|my_center|LOCUS_03440 7023 7979 gene locus_tag LOCUS_03450 7023 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703149.1 protein_id gnl|my_center|LOCUS_03450 8260 9933 gene locus_tag LOCUS_03460 8260 9933 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_03460 10098 11549 gene locus_tag LOCUS_03470 10098 11549 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB73 protein_id gnl|my_center|LOCUS_03470 >Feature sequence0023 448 882 gene locus_tag LOCUS_03480 448 882 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 protein_id gnl|my_center|LOCUS_03480 873 1757 gene locus_tag LOCUS_03490 873 1757 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_03490 1914 1741 gene locus_tag LOCUS_03500 1914 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2732 1911 gene locus_tag LOCUS_03510 2732 1911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 protein_id gnl|my_center|LOCUS_03510 3775 2729 gene locus_tag LOCUS_03520 3775 2729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_03520 5070 3790 gene locus_tag LOCUS_03530 5070 3790 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_03530 5238 6077 gene locus_tag LOCUS_03540 5238 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705273.1 protein_id gnl|my_center|LOCUS_03540 6893 6081 gene locus_tag LOCUS_03550 6893 6081 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 protein_id gnl|my_center|LOCUS_03550 8447 7182 gene locus_tag LOCUS_03560 8447 7182 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031072.1 protein_id gnl|my_center|LOCUS_03560 10195 8444 gene locus_tag LOCUS_03570 10195 8444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 protein_id gnl|my_center|LOCUS_03570 11683 10199 gene locus_tag LOCUS_03580 11683 10199 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886853.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence0024 2975 810 gene locus_tag LOCUS_03590 gene nrdE2 2975 810 CDS product ribonucleoside-diphosphate reductase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CH00 protein_id gnl|my_center|LOCUS_03590 3471 3010 gene locus_tag LOCUS_03600 gene nrdI 3471 3010 CDS product protein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIZ3 protein_id gnl|my_center|LOCUS_03600 3795 3496 gene locus_tag LOCUS_03610 3795 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4864 4298 gene locus_tag LOCUS_03620 4864 4298 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_03620 4981 5568 gene locus_tag LOCUS_03630 4981 5568 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415984.1 protein_id gnl|my_center|LOCUS_03630 6373 5579 gene locus_tag LOCUS_03640 6373 5579 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_03640 6428 7273 gene locus_tag LOCUS_03650 gene nadE 6428 7273 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYV5 protein_id gnl|my_center|LOCUS_03650 7588 7304 gene locus_tag LOCUS_03660 gene moaD2 7588 7304 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404559.1 protein_id gnl|my_center|LOCUS_03660 8078 7581 gene locus_tag LOCUS_03670 8078 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03670 8811 10001 gene locus_tag LOCUS_03680 8811 10001 CDS product putative molybdopterin biosynthesis protein MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701392.1 protein_id gnl|my_center|LOCUS_03680 9998 11005 gene locus_tag LOCUS_03690 gene moaCB 9998 11005 CDS product molybdenum cofactor biosynthesis bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59014 protein_id gnl|my_center|LOCUS_03690 >Feature sequence0025 1584 766 gene locus_tag LOCUS_03700 1584 766 CDS product putative cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704703.1 protein_id gnl|my_center|LOCUS_03700 2171 1581 gene locus_tag LOCUS_03710 2171 1581 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 protein_id gnl|my_center|LOCUS_03710 2826 2164 gene locus_tag LOCUS_03720 2826 2164 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_03720 4181 2862 gene locus_tag LOCUS_03730 gene hemL 4181 2862 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWA8 protein_id gnl|my_center|LOCUS_03730 4299 4805 gene locus_tag LOCUS_03740 4299 4805 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_03740 5365 4802 gene locus_tag LOCUS_03750 5365 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6108 5419 gene locus_tag LOCUS_03760 gene bioD 6108 5419 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCC1 protein_id gnl|my_center|LOCUS_03760 7250 6105 gene locus_tag LOCUS_03770 gene bioF 7250 6105 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX65 protein_id gnl|my_center|LOCUS_03770 8480 7278 gene locus_tag LOCUS_03780 gene bioA 8480 7278 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX64 protein_id gnl|my_center|LOCUS_03780 8682 9995 gene locus_tag LOCUS_03790 8682 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731029.1 protein_id gnl|my_center|LOCUS_03790 10036 10248 gene locus_tag LOCUS_03800 10036 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence0026 <1 4094 gene locus_tag LOCUS_03810 <1 4094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226015.1:fused acetyl/propionyl-CoA carboxylase subuit alpha/methylmalonyl-CoA decarboxylase subunit alpha 4413 4204 gene locus_tag LOCUS_03820 4413 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5291 4509 gene locus_tag LOCUS_03830 5291 4509 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 6229 5387 gene locus_tag LOCUS_03840 6229 5387 CDS product UPF0176 protein Cgl2992/cg3319 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLF0 protein_id gnl|my_center|LOCUS_03840 7837 6248 gene locus_tag LOCUS_03850 7837 6248 CDS product phosphodiesterase/alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601465.1 protein_id gnl|my_center|LOCUS_03850 8028 9500 gene locus_tag LOCUS_03860 8028 9500 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026908.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence0027 1701 205 gene locus_tag LOCUS_03870 1701 205 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_03870 1789 2328 gene locus_tag LOCUS_03880 1789 2328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225185.1 protein_id gnl|my_center|LOCUS_03880 2797 2333 gene locus_tag LOCUS_03890 2797 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2969 5272 gene locus_tag LOCUS_03900 gene uvrA 2969 5272 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_03900 5286 6275 gene locus_tag LOCUS_03910 5286 6275 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_03910 6786 6277 gene locus_tag LOCUS_03920 6786 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 7751 6804 gene locus_tag LOCUS_03930 7751 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8731 7748 gene locus_tag LOCUS_03940 8731 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9027 8728 gene locus_tag LOCUS_03950 9027 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 9995 9120 gene locus_tag LOCUS_03960 9995 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence0028 1235 426 gene locus_tag LOCUS_03970 1235 426 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_03970 1406 2305 gene locus_tag LOCUS_03980 gene cpdA 1406 2305 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP65 protein_id gnl|my_center|LOCUS_03980 3801 2302 gene locus_tag LOCUS_03990 gene cpsY 3801 2302 CDS product exopolysaccharide phosphotransferase CpsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50025 protein_id gnl|my_center|LOCUS_03990 4317 3955 gene locus_tag LOCUS_04000 4317 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5035 4328 gene locus_tag LOCUS_04010 5035 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703909.1 protein_id gnl|my_center|LOCUS_04010 5081 5554 gene locus_tag LOCUS_04020 5081 5554 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 protein_id gnl|my_center|LOCUS_04020 6572 5556 gene locus_tag LOCUS_04030 gene qor 6572 5556 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_04030 6688 7197 gene locus_tag LOCUS_04040 6688 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_04040 7695 7201 gene locus_tag LOCUS_04050 7695 7201 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230912.1 protein_id gnl|my_center|LOCUS_04050 8516 7692 gene locus_tag LOCUS_04060 8516 7692 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702276.1 protein_id gnl|my_center|LOCUS_04060 8618 9679 gene locus_tag LOCUS_04070 8618 9679 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 protein_id gnl|my_center|LOCUS_04070 <10690 9840 gene locus_tag LOCUS_04080 <10690 9840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229411.1:HNH endonuclease >Feature sequence0029 1736 1993 gene locus_tag LOCUS_04090 1736 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2095 2622 gene locus_tag LOCUS_04100 2095 2622 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_04100 4171 2606 gene locus_tag LOCUS_04110 4171 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5397 4168 gene locus_tag LOCUS_04120 5397 4168 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_04120 5775 6893 gene locus_tag LOCUS_04130 5775 6893 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 protein_id gnl|my_center|LOCUS_04130 7501 7001 gene locus_tag LOCUS_04140 7501 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7568 8740 gene locus_tag LOCUS_04150 7568 8740 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730370.1 protein_id gnl|my_center|LOCUS_04150 8740 9450 gene locus_tag LOCUS_04160 8740 9450 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 protein_id gnl|my_center|LOCUS_04160 9514 9951 gene locus_tag LOCUS_04170 9514 9951 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704375.1 protein_id gnl|my_center|LOCUS_04170 <10641 9923 gene locus_tag LOCUS_04180 <10641 9923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727571.1:oxidoreductase >Feature sequence0030 1416 436 gene locus_tag LOCUS_04190 gene aes 1416 436 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_04190 1672 1599 gene locus_tag LOCUS_t00010 1672 1599 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3485 1692 gene locus_tag LOCUS_04200 3485 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM13 protein_id gnl|my_center|LOCUS_04200 5743 3629 gene locus_tag LOCUS_04210 5743 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728218.1 protein_id gnl|my_center|LOCUS_04210 6468 5740 gene locus_tag LOCUS_04220 6468 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM09 protein_id gnl|my_center|LOCUS_04220 6606 7187 gene locus_tag LOCUS_04230 gene dcd 6606 7187 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ98 protein_id gnl|my_center|LOCUS_04230 7293 8825 gene locus_tag LOCUS_04240 7293 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9007 10350 gene locus_tag LOCUS_04250 9007 10350 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227038.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence0031 922 458 gene locus_tag LOCUS_04260 922 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1751 924 gene locus_tag LOCUS_04270 gene echA21 1751 924 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420587.1 protein_id gnl|my_center|LOCUS_04270 1871 2368 gene locus_tag LOCUS_04280 1871 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701269.1 protein_id gnl|my_center|LOCUS_04280 3209 2631 gene locus_tag LOCUS_04290 3209 2631 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228754.1 protein_id gnl|my_center|LOCUS_04290 3348 4343 gene locus_tag LOCUS_04300 3348 4343 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_04300 4355 5317 gene locus_tag LOCUS_04310 gene alc 4355 5317 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R472 protein_id gnl|my_center|LOCUS_04310 5345 5818 gene locus_tag LOCUS_04320 5345 5818 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_04320 6333 5830 gene locus_tag LOCUS_04330 6333 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731066.1 protein_id gnl|my_center|LOCUS_04330 7750 6488 gene locus_tag LOCUS_04340 7750 6488 CDS product putative aminotransferase/cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701265.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence0032 651 1286 gene locus_tag LOCUS_04350 gene rsmG 651 1286 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NL53 protein_id gnl|my_center|LOCUS_04350 1363 2364 gene locus_tag LOCUS_04360 1363 2364 CDS product putative chromosome partitioning protein/ cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705672.1 protein_id gnl|my_center|LOCUS_04360 2368 3444 gene locus_tag LOCUS_04370 2368 3444 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731641.1 protein_id gnl|my_center|LOCUS_04370 3680 4360 gene locus_tag LOCUS_04380 3680 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705670.1 protein_id gnl|my_center|LOCUS_04380 5504 4398 gene locus_tag LOCUS_04390 5504 4398 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_04390 5406 5678 gene locus_tag LOCUS_04400 5406 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6062 5730 gene locus_tag LOCUS_04410 gene trxA 6062 5730 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DLF0 protein_id gnl|my_center|LOCUS_04410 7153 6110 gene locus_tag LOCUS_04420 gene trxB 7153 6110 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_04420 7983 7225 gene locus_tag LOCUS_04430 7983 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 protein_id gnl|my_center|LOCUS_04430 8624 8043 gene locus_tag LOCUS_04440 8624 8043 CDS product putative alternative RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705660.1 protein_id gnl|my_center|LOCUS_04440 <9973 8724 gene locus_tag LOCUS_04450 <9973 8724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400134.1:murein biosynthesis integral membrane protein MurJ >Feature sequence0033 354 22 gene locus_tag LOCUS_04460 354 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 470 874 gene locus_tag LOCUS_04470 470 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 1068 2285 gene locus_tag LOCUS_04480 1068 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729765.1 protein_id gnl|my_center|LOCUS_04480 2871 2248 gene locus_tag LOCUS_04490 2871 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3854 2868 gene locus_tag LOCUS_04500 3854 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4040 4195 gene locus_tag LOCUS_04510 4040 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4285 5643 gene locus_tag LOCUS_04520 4285 5643 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730485.1 protein_id gnl|my_center|LOCUS_04520 6336 5719 gene locus_tag LOCUS_04530 6336 5719 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727467.1 protein_id gnl|my_center|LOCUS_04530 6422 7774 gene locus_tag LOCUS_04540 6422 7774 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_04540 8641 7778 gene locus_tag LOCUS_04550 8641 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_04550 <9707 8778 gene locus_tag LOCUS_04560 <9707 8778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32507:succinate-semialdehyde dehydrogenase [NADP(+)] >Feature sequence0034 <1 849 gene locus_tag LOCUS_04570 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978280.1:MFS transporter 1460 900 gene locus_tag LOCUS_04580 1460 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2869 1496 gene locus_tag LOCUS_04590 2869 1496 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028665.1 protein_id gnl|my_center|LOCUS_04590 2941 4095 gene locus_tag LOCUS_04600 2941 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4218 4679 gene locus_tag LOCUS_04610 4218 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5707 4748 gene locus_tag LOCUS_04620 5707 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5779 7692 gene locus_tag LOCUS_04630 5779 7692 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_04630 7789 8718 gene locus_tag LOCUS_04640 7789 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 8773 9132 gene locus_tag LOCUS_04650 8773 9132 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence0035 3138 2080 gene locus_tag LOCUS_04660 3138 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3255 4103 gene locus_tag LOCUS_04670 3255 4103 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013910.1 protein_id gnl|my_center|LOCUS_04670 4372 5826 gene locus_tag LOCUS_04680 4372 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701623.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04680 5823 6335 gene locus_tag LOCUS_04690 5823 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701622.1 protein_id gnl|my_center|LOCUS_04690 6755 6339 gene locus_tag LOCUS_04700 gene cspB 6755 6339 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908736.1 protein_id gnl|my_center|LOCUS_04700 6946 7164 gene locus_tag LOCUS_04710 6946 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 7168 7542 gene locus_tag LOCUS_04720 7168 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_04720 8029 8640 gene locus_tag LOCUS_04730 gene rpf1 8029 8640 CDS product resuscitation-promoting factor Rpf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6M6W5 protein_id gnl|my_center|LOCUS_04730 8906 8718 gene locus_tag LOCUS_04740 8906 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_215378.2 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0036 <1 518 gene locus_tag LOCUS_04750 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224114.1:type VII secretion protein EccC 545 2011 gene locus_tag LOCUS_04760 545 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2199 2537 gene locus_tag LOCUS_04770 2199 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2602 2883 gene locus_tag LOCUS_04780 2602 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2996 3337 gene locus_tag LOCUS_04790 2996 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112819.1 protein_id gnl|my_center|LOCUS_04790 3521 3964 gene locus_tag LOCUS_04800 gene rplM 3521 3964 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG81 protein_id gnl|my_center|LOCUS_04800 3961 4485 gene locus_tag LOCUS_04810 gene rpsI 3961 4485 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSP9 protein_id gnl|my_center|LOCUS_04810 4592 5938 gene locus_tag LOCUS_04820 gene glmM 4592 5938 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TWH9 protein_id gnl|my_center|LOCUS_04820 6982 5942 gene locus_tag LOCUS_04830 6982 5942 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_04830 7133 7438 gene locus_tag LOCUS_04840 7133 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7534 9345 gene locus_tag LOCUS_04850 7534 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence0037 5242 2840 gene locus_tag LOCUS_04860 5242 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731633.1 protein_id gnl|my_center|LOCUS_04860 5829 5245 gene locus_tag LOCUS_04870 5829 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04870 5922 7388 gene locus_tag LOCUS_04880 5922 7388 CDS product poly(A) polymerase PcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705656.1 protein_id gnl|my_center|LOCUS_04880 8935 7439 gene locus_tag LOCUS_04890 8935 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 <9506 8995 gene locus_tag LOCUS_04900 <9506 8995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WJY1:putative MFS-type transporter >Feature sequence0038 394 1044 gene locus_tag LOCUS_04910 394 1044 CDS product Trk system potassium uptake protein CeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703726.1 protein_id gnl|my_center|LOCUS_04910 1094 1753 gene locus_tag LOCUS_04920 gene ceoC 1094 1753 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_04920 2449 1727 gene locus_tag LOCUS_04930 2449 1727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_04930 2876 2499 gene locus_tag LOCUS_04940 2876 2499 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224481.1 protein_id gnl|my_center|LOCUS_04940 3029 3754 gene locus_tag LOCUS_04950 3029 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703730.1 protein_id gnl|my_center|LOCUS_04950 4594 3761 gene locus_tag LOCUS_04960 4594 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728567.1 protein_id gnl|my_center|LOCUS_04960 5305 4673 gene locus_tag LOCUS_04970 5305 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5337 5831 gene locus_tag LOCUS_04980 5337 5831 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728565.1 protein_id gnl|my_center|LOCUS_04980 6237 5935 gene locus_tag LOCUS_04990 6237 5935 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 protein_id gnl|my_center|LOCUS_04990 6783 7463 gene locus_tag LOCUS_05000 6783 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 8279 7512 gene locus_tag LOCUS_05010 8279 7512 CDS product putative inositol-1-monophosphatase SuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703739.1 protein_id gnl|my_center|LOCUS_05010 8301 9434 gene locus_tag LOCUS_05020 8301 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence0039 <1 685 gene locus_tag LOCUS_05030 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728831.1:Fe-S cluster assembly protein SufD 725 1501 gene locus_tag LOCUS_05040 725 1501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703480.1 protein_id gnl|my_center|LOCUS_05040 1504 2796 gene locus_tag LOCUS_05050 1504 2796 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC54 protein_id gnl|my_center|LOCUS_05050 2796 3293 gene locus_tag LOCUS_05060 2796 3293 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_05060 3290 3670 gene locus_tag LOCUS_05070 3290 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703477.1 protein_id gnl|my_center|LOCUS_05070 4648 3692 gene locus_tag LOCUS_05080 gene ku 4648 3692 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3S7 protein_id gnl|my_center|LOCUS_05080 5842 4700 gene locus_tag LOCUS_05090 gene lcyB 5842 4700 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125288.1 protein_id gnl|my_center|LOCUS_05090 6627 5839 gene locus_tag LOCUS_05100 gene fabG 6627 5839 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_05100 6784 8415 gene locus_tag LOCUS_05110 6784 8415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894527.1 protein_id gnl|my_center|LOCUS_05110 8984 8403 gene locus_tag LOCUS_05120 8984 8403 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728842.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence0040 120 1073 gene locus_tag LOCUS_05130 gene fruK 120 1073 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229560.1 protein_id gnl|my_center|LOCUS_05130 1070 1819 gene locus_tag LOCUS_05140 gene surE 1070 1819 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731558.1 protein_id gnl|my_center|LOCUS_05140 1910 2983 gene locus_tag LOCUS_05150 1910 2983 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_05150 2993 3274 gene locus_tag LOCUS_05160 2993 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3948 3289 gene locus_tag LOCUS_05170 3948 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_05170 5476 3986 gene locus_tag LOCUS_05180 5476 3986 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_05180 6368 5502 gene locus_tag LOCUS_05190 6368 5502 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729627.1 protein_id gnl|my_center|LOCUS_05190 6441 7085 gene locus_tag LOCUS_05200 6441 7085 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_05200 8067 7093 gene locus_tag LOCUS_05210 8067 7093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_05210 8134 8667 gene locus_tag LOCUS_05220 8134 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_05220 8786 9046 gene locus_tag LOCUS_05230 8786 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence0041 331 1386 gene locus_tag LOCUS_05240 331 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 1299 2798 gene locus_tag LOCUS_05250 1299 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05250 2795 3274 gene locus_tag LOCUS_05260 2795 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228336.1 protein_id gnl|my_center|LOCUS_05260 3331 3498 gene locus_tag LOCUS_05270 3331 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3591 3923 gene locus_tag LOCUS_05280 3591 3923 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_05280 4413 4862 gene locus_tag LOCUS_05290 4413 4862 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858809.1 protein_id gnl|my_center|LOCUS_05290 5931 5248 gene locus_tag LOCUS_05300 5931 5248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_05300 7010 5928 gene locus_tag LOCUS_05310 7010 5928 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_05310 7195 8376 gene locus_tag LOCUS_05320 7195 8376 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_05320 8373 9011 gene locus_tag LOCUS_05330 8373 9011 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0042 348 974 gene locus_tag LOCUS_05340 gene mtcA2 348 974 CDS product carbonic anhydrase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPJ9 protein_id gnl|my_center|LOCUS_05340 1086 1832 gene locus_tag LOCUS_05350 1086 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1848 2717 gene locus_tag LOCUS_05360 1848 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029935.1 protein_id gnl|my_center|LOCUS_05360 3850 2765 gene locus_tag LOCUS_05370 gene disA 3850 2765 CDS product DNA integrity scanning protein DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGX6 protein_id gnl|my_center|LOCUS_05370 5376 3979 gene locus_tag LOCUS_05380 gene radA 5376 3979 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGX8 protein_id gnl|my_center|LOCUS_05380 5852 5430 gene locus_tag LOCUS_05390 5852 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6327 6815 gene locus_tag LOCUS_05400 gene carD 6327 6815 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R561 protein_id gnl|my_center|LOCUS_05400 6851 7516 gene locus_tag LOCUS_05410 gene ispD 6851 7516 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGY3 protein_id gnl|my_center|LOCUS_05410 7513 7977 gene locus_tag LOCUS_05420 gene ispF 7513 7977 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGY4 protein_id gnl|my_center|LOCUS_05420 >Feature sequence0043 437 51 gene locus_tag LOCUS_05430 437 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 940 434 gene locus_tag LOCUS_05440 940 434 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727022.1 protein_id gnl|my_center|LOCUS_05440 1097 2083 gene locus_tag LOCUS_05450 1097 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3484 2108 gene locus_tag LOCUS_05460 3484 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704376.1 protein_id gnl|my_center|LOCUS_05460 3678 5162 gene locus_tag LOCUS_05470 3678 5162 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_05470 5203 6732 gene locus_tag LOCUS_05480 5203 6732 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_05480 7668 6979 gene locus_tag LOCUS_05490 7668 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05490 8977 7670 gene locus_tag LOCUS_05500 8977 7670 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJ49 protein_id gnl|my_center|LOCUS_05500 9124 8996 gene locus_tag LOCUS_05510 9124 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence0044 <1 1832 gene locus_tag LOCUS_05520 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731547.1:excinuclease ABC subunit A 1854 2180 gene locus_tag LOCUS_05530 1854 2180 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727853.1 protein_id gnl|my_center|LOCUS_05530 2177 3115 gene locus_tag LOCUS_05540 2177 3115 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727854.1 protein_id gnl|my_center|LOCUS_05540 3079 3501 gene locus_tag LOCUS_05550 3079 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4353 3529 gene locus_tag LOCUS_05560 4353 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4387 4581 gene locus_tag LOCUS_05570 4387 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6649 5069 gene locus_tag LOCUS_05580 6649 5069 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_05580 7530 6646 gene locus_tag LOCUS_05590 7530 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704932.1 protein_id gnl|my_center|LOCUS_05590 <9123 7642 gene locus_tag LOCUS_05600 <9123 7642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701568.1:putative NAD-glutamate dehydrogenase >Feature sequence0045 362 1393 gene locus_tag LOCUS_05610 362 1393 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_05610 1449 1961 gene locus_tag LOCUS_05620 gene msrA 1449 1961 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDF5 protein_id gnl|my_center|LOCUS_05620 2136 3407 gene locus_tag LOCUS_05630 2136 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 protein_id gnl|my_center|LOCUS_05630 3427 4170 gene locus_tag LOCUS_05640 3427 4170 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729204.1 protein_id gnl|my_center|LOCUS_05640 4149 4769 gene locus_tag LOCUS_05650 4149 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_05650 5133 5621 gene locus_tag LOCUS_05660 5133 5621 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893397.1 protein_id gnl|my_center|LOCUS_05660 5683 6516 gene locus_tag LOCUS_05670 5683 6516 CDS product F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728073.1 protein_id gnl|my_center|LOCUS_05670 7202 6600 gene locus_tag LOCUS_05680 7202 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7312 8013 gene locus_tag LOCUS_05690 gene prrA 7312 8013 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225438.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence0046 1441 218 gene locus_tag LOCUS_05700 1441 218 CDS product putative peptidase/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704386.1 protein_id gnl|my_center|LOCUS_05700 2670 1468 gene locus_tag LOCUS_05710 2670 1468 CDS product putative peptidase/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704387.1 protein_id gnl|my_center|LOCUS_05710 3452 2748 gene locus_tag LOCUS_05720 3452 2748 CDS product putative enoyl-coa hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703200.1 protein_id gnl|my_center|LOCUS_05720 3451 4365 gene locus_tag LOCUS_05730 3451 4365 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFY9 protein_id gnl|my_center|LOCUS_05730 4362 5963 gene locus_tag LOCUS_05740 4362 5963 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222818.1 protein_id gnl|my_center|LOCUS_05740 6855 5965 gene locus_tag LOCUS_05750 6855 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7511 6888 gene locus_tag LOCUS_05760 gene upp 7511 6888 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFF3 protein_id gnl|my_center|LOCUS_05760 7688 8020 gene locus_tag LOCUS_05770 7688 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence0047 20 1498 gene locus_tag LOCUS_05780 20 1498 CDS product putative two component sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704270.1 protein_id gnl|my_center|LOCUS_05780 1904 1650 gene locus_tag LOCUS_05790 gene whiB1 1904 1650 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTP7 protein_id gnl|my_center|LOCUS_05790 3124 2171 gene locus_tag LOCUS_05800 3124 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704268.1 protein_id gnl|my_center|LOCUS_05800 3250 3681 gene locus_tag LOCUS_05810 3250 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704267.1 protein_id gnl|my_center|LOCUS_05810 4154 3678 gene locus_tag LOCUS_05820 4154 3678 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704266.1 protein_id gnl|my_center|LOCUS_05820 4822 4151 gene locus_tag LOCUS_05830 4822 4151 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728016.1 protein_id gnl|my_center|LOCUS_05830 5104 4895 gene locus_tag LOCUS_05840 5104 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5007 6473 gene locus_tag LOCUS_05850 gene emrB 5007 6473 CDS product multidrug resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WG89 protein_id gnl|my_center|LOCUS_05850 6530 7324 gene locus_tag LOCUS_05860 6530 7324 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 protein_id gnl|my_center|LOCUS_05860 8601 7348 gene locus_tag LOCUS_05870 8601 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704262.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence0048 3316 392 gene locus_tag LOCUS_05880 3316 392 CDS product putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_277100.1 protein_id gnl|my_center|LOCUS_05880 3568 4257 gene locus_tag LOCUS_05890 3568 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5905 4307 gene locus_tag LOCUS_05900 5905 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943012.1 protein_id gnl|my_center|LOCUS_05900 6475 6197 gene locus_tag LOCUS_05910 6475 6197 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_05910 6614 6796 gene locus_tag LOCUS_05920 6614 6796 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PH3 protein_id gnl|my_center|LOCUS_05920 6806 7516 gene locus_tag LOCUS_05930 6806 7516 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_05930 8775 7549 gene locus_tag LOCUS_05940 8775 7549 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence0049 493 933 gene locus_tag LOCUS_05950 493 933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405744.1 protein_id gnl|my_center|LOCUS_05950 1157 1651 gene locus_tag LOCUS_05960 gene greA 1157 1651 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKJ7 protein_id gnl|my_center|LOCUS_05960 2514 1720 gene locus_tag LOCUS_05970 2514 1720 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0Z5 protein_id gnl|my_center|LOCUS_05970 3479 2511 gene locus_tag LOCUS_05980 3479 2511 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_05980 6672 3535 gene locus_tag LOCUS_05990 6672 3535 CDS product arabinosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 protein_id gnl|my_center|LOCUS_05990 7958 6747 gene locus_tag LOCUS_06000 7958 6747 CDS product putative threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701941.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence0050 705 1952 gene locus_tag LOCUS_06010 705 1952 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704657.1 protein_id gnl|my_center|LOCUS_06010 2606 1965 gene locus_tag LOCUS_06020 gene menG 2606 1965 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHC3 protein_id gnl|my_center|LOCUS_06020 3814 2675 gene locus_tag LOCUS_06030 3814 2675 CDS product putative glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704659.1 protein_id gnl|my_center|LOCUS_06030 4303 3878 gene locus_tag LOCUS_06040 4303 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4841 4296 gene locus_tag LOCUS_06050 4841 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4840 5343 gene locus_tag LOCUS_06060 4840 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704794.1 protein_id gnl|my_center|LOCUS_06060 6950 5340 gene locus_tag LOCUS_06070 gene menD 6950 5340 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK11 protein_id gnl|my_center|LOCUS_06070 7013 7600 gene locus_tag LOCUS_06080 7013 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_06080 7597 8661 gene locus_tag LOCUS_06090 7597 8661 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence0051 <1 716 gene locus_tag LOCUS_06100 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O33230:GTPase HflX 722 1816 gene locus_tag LOCUS_06110 722 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2070 1813 gene locus_tag LOCUS_06120 2070 1813 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_06120 4168 2114 gene locus_tag LOCUS_06130 4168 2114 CDS product PTS lactose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_06130 5187 4177 gene locus_tag LOCUS_06140 5187 4177 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_06140 5951 5184 gene locus_tag LOCUS_06150 5951 5184 CDS product D-beta-D-heptose 1-phosphate adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_06150 6122 7861 gene locus_tag LOCUS_06160 gene ptsI 6122 7861 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNL6 protein_id gnl|my_center|LOCUS_06160 >Feature sequence0052 <1 3368 gene locus_tag LOCUS_06170 <1 3368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700845.1:putative ferredoxin-dependent glutamate synthase 3361 4812 gene locus_tag LOCUS_06180 gene gltD 3361 4812 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_06180 5105 6007 gene locus_tag LOCUS_06190 5105 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7534 6008 gene locus_tag LOCUS_06200 7534 6008 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_06200 7634 7930 gene locus_tag LOCUS_06210 7634 7930 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence0053 <1 801 gene locus_tag LOCUS_06220 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389558.1:diguanylate cyclase note possible pseudo, frameshifted 686 982 gene locus_tag LOCUS_06230 686 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 2233 986 gene locus_tag LOCUS_06240 2233 986 CDS product putative multi-drug efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702041.1 protein_id gnl|my_center|LOCUS_06240 2346 3230 gene locus_tag LOCUS_06250 2346 3230 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225528.1 protein_id gnl|my_center|LOCUS_06250 3281 4372 gene locus_tag LOCUS_06260 3281 4372 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110374.1 protein_id gnl|my_center|LOCUS_06260 4745 4377 gene locus_tag LOCUS_06270 4745 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4855 5235 gene locus_tag LOCUS_06280 4855 5235 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223391.1 protein_id gnl|my_center|LOCUS_06280 5311 5868 gene locus_tag LOCUS_06290 5311 5868 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225836.1 protein_id gnl|my_center|LOCUS_06290 5908 7140 gene locus_tag LOCUS_06300 5908 7140 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227011.1 protein_id gnl|my_center|LOCUS_06300 7189 8544 gene locus_tag LOCUS_06310 7189 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence0054 1793 558 gene locus_tag LOCUS_06320 1793 558 CDS product putative mannose-6-phosphate isomerase ManA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704330.1 protein_id gnl|my_center|LOCUS_06320 2926 1793 gene locus_tag LOCUS_06330 2926 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417056.1 protein_id gnl|my_center|LOCUS_06330 4389 3007 gene locus_tag LOCUS_06340 gene manB 4389 3007 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_06340 4897 4595 gene locus_tag LOCUS_06350 4897 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704333.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 5078 5563 gene locus_tag LOCUS_06360 5078 5563 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893223.1 protein_id gnl|my_center|LOCUS_06360 6185 5607 gene locus_tag LOCUS_06370 6185 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6478 7608 gene locus_tag LOCUS_06380 gene cofD 6478 7608 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTG2 protein_id gnl|my_center|LOCUS_06380 >Feature sequence0055 3055 929 gene locus_tag LOCUS_06390 3055 929 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728879.1 protein_id gnl|my_center|LOCUS_06390 3892 3293 gene locus_tag LOCUS_06400 3892 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4407 3889 gene locus_tag LOCUS_06410 4407 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4507 5415 gene locus_tag LOCUS_06420 4507 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6018 5422 gene locus_tag LOCUS_06430 6018 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700916.1 protein_id gnl|my_center|LOCUS_06430 6066 6854 gene locus_tag LOCUS_06440 gene cobB 6066 6854 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MER1 protein_id gnl|my_center|LOCUS_06440 6912 7196 gene locus_tag LOCUS_06450 6912 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8280 7213 gene locus_tag LOCUS_06460 8280 7213 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229214.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0056 1855 416 gene locus_tag LOCUS_06470 1855 416 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729431.1 protein_id gnl|my_center|LOCUS_06470 1930 2844 gene locus_tag LOCUS_06480 1930 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2862 3362 gene locus_tag LOCUS_06490 2862 3362 CDS product putative transcriptional regulator, MarR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703382.1 protein_id gnl|my_center|LOCUS_06490 3359 3772 gene locus_tag LOCUS_06500 3359 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704956.1 protein_id gnl|my_center|LOCUS_06500 3828 4043 gene locus_tag LOCUS_06510 3828 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704688.1 protein_id gnl|my_center|LOCUS_06510 4050 4553 gene locus_tag LOCUS_06520 4050 4553 CDS product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895204.1 protein_id gnl|my_center|LOCUS_06520 4578 4967 gene locus_tag LOCUS_06530 4578 4967 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013480.1 protein_id gnl|my_center|LOCUS_06530 5833 4964 gene locus_tag LOCUS_06540 gene menA 5833 4964 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR52 protein_id gnl|my_center|LOCUS_06540 7131 5881 gene locus_tag LOCUS_06550 7131 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8066 7287 gene locus_tag LOCUS_06560 8066 7287 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence0057 1715 1035 gene locus_tag LOCUS_06570 gene lppM 1715 1035 CDS product protein LppM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O53505 protein_id gnl|my_center|LOCUS_06570 2625 1801 gene locus_tag LOCUS_06580 2625 1801 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_06580 4217 2622 gene locus_tag LOCUS_06590 4217 2622 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_06590 4851 4234 gene locus_tag LOCUS_06600 4851 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702731.1 protein_id gnl|my_center|LOCUS_06600 5048 5503 gene locus_tag LOCUS_06610 5048 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5742 6176 gene locus_tag LOCUS_06620 5742 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411231.1 protein_id gnl|my_center|LOCUS_06620 6718 7149 gene locus_tag LOCUS_06630 gene mraZ 6718 7149 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNM6 protein_id gnl|my_center|LOCUS_06630 7369 8409 gene locus_tag LOCUS_06640 gene rsmH 7369 8409 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP29 protein_id gnl|my_center|LOCUS_06640 >Feature sequence0058 122 1450 gene locus_tag LOCUS_06650 122 1450 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 protein_id gnl|my_center|LOCUS_06650 1447 2346 gene locus_tag LOCUS_06660 1447 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_06660 2358 3794 gene locus_tag LOCUS_06670 2358 3794 CDS product putative IMP dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703147.1 protein_id gnl|my_center|LOCUS_06670 4126 5505 gene locus_tag LOCUS_06680 4126 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703146.1 protein_id gnl|my_center|LOCUS_06680 5498 6619 gene locus_tag LOCUS_06690 5498 6619 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895093.1 protein_id gnl|my_center|LOCUS_06690 6620 7534 gene locus_tag LOCUS_06700 6620 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729223.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence0059 1475 1293 gene locus_tag LOCUS_06710 1475 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3403 2000 gene locus_tag LOCUS_06720 3403 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3960 3400 gene locus_tag LOCUS_06730 3960 3400 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 protein_id gnl|my_center|LOCUS_06730 4050 4574 gene locus_tag LOCUS_06740 4050 4574 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406057.1 protein_id gnl|my_center|LOCUS_06740 4571 5821 gene locus_tag LOCUS_06750 4571 5821 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223081.1 protein_id gnl|my_center|LOCUS_06750 6953 5841 gene locus_tag LOCUS_06760 6953 5841 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_06760 7687 6950 gene locus_tag LOCUS_06770 7687 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_06770 <8592 7794 gene locus_tag LOCUS_06780 <8592 7794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R096:GTP cyclohydrolase 1 type 2 >Feature sequence0060 1509 472 gene locus_tag LOCUS_06790 gene tsaD 1509 472 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSS1 protein_id gnl|my_center|LOCUS_06790 1994 1506 gene locus_tag LOCUS_06800 1994 1506 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG64 protein_id gnl|my_center|LOCUS_06800 2743 1991 gene locus_tag LOCUS_06810 2743 1991 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 protein_id gnl|my_center|LOCUS_06810 3317 2790 gene locus_tag LOCUS_06820 3317 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704465.1 protein_id gnl|my_center|LOCUS_06820 4323 3310 gene locus_tag LOCUS_06830 4323 3310 CDS product putative hydrolase alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704466.1 protein_id gnl|my_center|LOCUS_06830 5511 4327 gene locus_tag LOCUS_06840 gene alr 5511 4327 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSR6 protein_id gnl|my_center|LOCUS_06840 7039 5606 gene locus_tag LOCUS_06850 7039 5606 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG70 protein_id gnl|my_center|LOCUS_06850 <8542 7091 gene locus_tag LOCUS_06860 <8542 7091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MG72:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence0061 1805 423 gene locus_tag LOCUS_06870 1805 423 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_06870 2038 2349 gene locus_tag LOCUS_06880 2038 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3017 2373 gene locus_tag LOCUS_06890 3017 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3463 3014 gene locus_tag LOCUS_06900 3463 3014 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730267.1 protein_id gnl|my_center|LOCUS_06900 3709 4827 gene locus_tag LOCUS_06910 3709 4827 CDS product putative NAD(P) transhydrogenase, alpha1 subunit PntAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705302.1 protein_id gnl|my_center|LOCUS_06910 4827 5150 gene locus_tag LOCUS_06920 gene pntAB 4827 5150 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909006.1 protein_id gnl|my_center|LOCUS_06920 5150 6571 gene locus_tag LOCUS_06930 gene pntB 5150 6571 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P244 protein_id gnl|my_center|LOCUS_06930 7148 6609 gene locus_tag LOCUS_06940 7148 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7072 7362 gene locus_tag LOCUS_06950 7072 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 7910 8224 gene locus_tag LOCUS_06960 7910 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence0062 185 2143 gene locus_tag LOCUS_06970 gene aftA 185 2143 CDS product arabinofuranosyltransferase AftA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R611 protein_id gnl|my_center|LOCUS_06970 2641 2189 gene locus_tag LOCUS_06980 2641 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_06980 2715 3419 gene locus_tag LOCUS_06990 2715 3419 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_06990 3516 5285 gene locus_tag LOCUS_07000 3516 5285 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228371.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence0063 632 1063 gene locus_tag LOCUS_07010 632 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705624.1 protein_id gnl|my_center|LOCUS_07010 1505 1116 gene locus_tag LOCUS_07020 1505 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1758 1534 gene locus_tag LOCUS_07030 1758 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1721 3802 gene locus_tag LOCUS_07040 gene ponA1 1721 3802 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7G2 protein_id gnl|my_center|LOCUS_07040 3812 5362 gene locus_tag LOCUS_07050 3812 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400514.1 protein_id gnl|my_center|LOCUS_07050 6605 5337 gene locus_tag LOCUS_07060 6605 5337 CDS product transport-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_07060 6881 6654 gene locus_tag LOCUS_07070 6881 6654 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295139.1 protein_id gnl|my_center|LOCUS_07070 7480 6881 gene locus_tag LOCUS_07080 7480 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 8299 7565 gene locus_tag LOCUS_07090 8299 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence0064 3392 1392 gene locus_tag LOCUS_07100 3392 1392 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 protein_id gnl|my_center|LOCUS_07100 4227 3442 gene locus_tag LOCUS_07110 gene sigB 4227 3442 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_07110 4658 4227 gene locus_tag LOCUS_07120 4658 4227 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227036.1 protein_id gnl|my_center|LOCUS_07120 4786 7002 gene locus_tag LOCUS_07130 4786 7002 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC57 protein_id gnl|my_center|LOCUS_07130 7153 7902 gene locus_tag LOCUS_07140 gene fdhD 7153 7902 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMW5 protein_id gnl|my_center|LOCUS_07140 >Feature sequence0065 46 558 gene locus_tag LOCUS_07150 46 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 555 920 gene locus_tag LOCUS_07160 555 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1506 931 gene locus_tag LOCUS_07170 1506 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701759.1 protein_id gnl|my_center|LOCUS_07170 1763 1557 gene locus_tag LOCUS_07180 1763 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705444.1 protein_id gnl|my_center|LOCUS_07180 2574 1843 gene locus_tag LOCUS_07190 2574 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_07190 4210 2687 gene locus_tag LOCUS_07200 4210 2687 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705199.1 protein_id gnl|my_center|LOCUS_07200 5127 4207 gene locus_tag LOCUS_07210 5127 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704779.1 protein_id gnl|my_center|LOCUS_07210 5893 5129 gene locus_tag LOCUS_07220 5893 5129 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704781.1 protein_id gnl|my_center|LOCUS_07220 7011 6004 gene locus_tag LOCUS_07230 7011 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7118 8212 gene locus_tag LOCUS_07240 gene kshB 7118 8212 CDS product 3-ketosteroid-9-alpha-monooxygenase, ferredoxin reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R525 protein_id gnl|my_center|LOCUS_07240 >Feature sequence0066 <1 920 gene locus_tag LOCUS_07250 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CZ43:lipoyl synthase 982 1737 gene locus_tag LOCUS_07260 982 1737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895683.1 protein_id gnl|my_center|LOCUS_07260 2230 1775 gene locus_tag LOCUS_07270 2230 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702671.1 protein_id gnl|my_center|LOCUS_07270 2407 3843 gene locus_tag LOCUS_07280 2407 3843 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNW5 protein_id gnl|my_center|LOCUS_07280 3932 4681 gene locus_tag LOCUS_07290 3932 4681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222047.1 protein_id gnl|my_center|LOCUS_07290 4674 5870 gene locus_tag LOCUS_07300 4674 5870 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222048.1 protein_id gnl|my_center|LOCUS_07300 5867 6652 gene locus_tag LOCUS_07310 5867 6652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222049.1 protein_id gnl|my_center|LOCUS_07310 6652 7635 gene locus_tag LOCUS_07320 6652 7635 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_07320 <8220 7632 gene locus_tag LOCUS_07330 <8220 7632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R082:glutamate-ammonia-ligase adenylyltransferase >Feature sequence0067 <1 782 gene locus_tag LOCUS_07340 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MHQ0:D-inositol 3-phosphate glycosyltransferase 779 1285 gene locus_tag LOCUS_07350 779 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 protein_id gnl|my_center|LOCUS_07350 1343 2773 gene locus_tag LOCUS_07360 1343 2773 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 protein_id gnl|my_center|LOCUS_07360 2851 3942 gene locus_tag LOCUS_07370 2851 3942 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_07370 3961 5463 gene locus_tag LOCUS_07380 3961 5463 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_07380 5456 6676 gene locus_tag LOCUS_07390 5456 6676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776142.1 protein_id gnl|my_center|LOCUS_07390 6673 7941 gene locus_tag LOCUS_07400 6673 7941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence0068 1782 928 gene locus_tag LOCUS_07410 1782 928 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908849.1 protein_id gnl|my_center|LOCUS_07410 2533 1793 gene locus_tag LOCUS_07420 gene drrB 2533 1793 CDS product doxorubicin resistance ABC transporter permease protein DrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WG23 protein_id gnl|my_center|LOCUS_07420 3618 2647 gene locus_tag LOCUS_07430 3618 2647 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908851.1 protein_id gnl|my_center|LOCUS_07430 4736 3747 gene locus_tag LOCUS_07440 4736 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5647 4733 gene locus_tag LOCUS_07450 5647 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6154 5660 gene locus_tag LOCUS_07460 6154 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6523 6948 gene locus_tag LOCUS_07470 6523 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6963 7628 gene locus_tag LOCUS_07480 gene rplC 6963 7628 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence0069 <1 798 gene locus_tag LOCUS_07490 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96264:putative lipoprotein aminopeptidase LpqL 835 1656 gene locus_tag LOCUS_07500 835 1656 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916840.1 protein_id gnl|my_center|LOCUS_07500 2472 1618 gene locus_tag LOCUS_07510 gene thiD 2472 1618 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727221.1 protein_id gnl|my_center|LOCUS_07510 2774 3100 gene locus_tag LOCUS_07520 2774 3100 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640927.1 protein_id gnl|my_center|LOCUS_07520 3243 3599 gene locus_tag LOCUS_07530 3243 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4416 3616 gene locus_tag LOCUS_07540 4416 3616 CDS product putative exodeoxyribonuclease III protein XthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704916.1 protein_id gnl|my_center|LOCUS_07540 5399 4428 gene locus_tag LOCUS_07550 5399 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704915.1 protein_id gnl|my_center|LOCUS_07550 6010 5408 gene locus_tag LOCUS_07560 gene def 6010 5408 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQP8 protein_id gnl|my_center|LOCUS_07560 6306 6641 gene locus_tag LOCUS_07570 6306 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 protein_id gnl|my_center|LOCUS_07570 6745 7281 gene locus_tag LOCUS_07580 6745 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7378 8100 gene locus_tag LOCUS_07590 gene sodC 7378 8100 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQQ1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence0070 1618 53 gene locus_tag LOCUS_07600 1618 53 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYI2 protein_id gnl|my_center|LOCUS_07600 1807 2370 gene locus_tag LOCUS_07610 1807 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895048.1 protein_id gnl|my_center|LOCUS_07610 2487 3884 gene locus_tag LOCUS_07620 2487 3884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775787.1 protein_id gnl|my_center|LOCUS_07620 4040 4762 gene locus_tag LOCUS_07630 4040 4762 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_07630 4774 5772 gene locus_tag LOCUS_07640 4774 5772 CDS product myristoyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 protein_id gnl|my_center|LOCUS_07640 5777 6586 gene locus_tag LOCUS_07650 5777 6586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530796.1 protein_id gnl|my_center|LOCUS_07650 6579 7337 gene locus_tag LOCUS_07660 6579 7337 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530797.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence0071 46 237 gene locus_tag LOCUS_07670 46 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 242 1180 gene locus_tag LOCUS_07680 242 1180 CDS product transposition protein TniB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 protein_id gnl|my_center|LOCUS_07680 1177 2412 gene locus_tag LOCUS_07690 1177 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087245.1 protein_id gnl|my_center|LOCUS_07690 2618 3790 gene locus_tag LOCUS_07700 2618 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3892 4881 gene locus_tag LOCUS_07710 3892 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5162 6127 gene locus_tag LOCUS_07720 5162 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6128 6679 gene locus_tag LOCUS_07730 gene rpoE 6128 6679 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2T1 protein_id gnl|my_center|LOCUS_07730 6955 7353 gene locus_tag LOCUS_07740 6955 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence0072 31 444 gene locus_tag LOCUS_07750 31 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 673 1836 gene locus_tag LOCUS_07760 673 1836 CDS product putative low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705298.1 protein_id gnl|my_center|LOCUS_07760 1849 2604 gene locus_tag LOCUS_07770 gene gpmA 1849 2604 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHP2 protein_id gnl|my_center|LOCUS_07770 2742 3914 gene locus_tag LOCUS_07780 2742 3914 CDS product sensor-like histidine kinase senX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704776.1 protein_id gnl|my_center|LOCUS_07780 3911 4600 gene locus_tag LOCUS_07790 gene regX3 3911 4600 CDS product sensory transduction protein regX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F868 protein_id gnl|my_center|LOCUS_07790 5422 4670 gene locus_tag LOCUS_07800 5422 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704742.1 protein_id gnl|my_center|LOCUS_07800 5513 6454 gene locus_tag LOCUS_07810 5513 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65787 protein_id gnl|my_center|LOCUS_07810 6451 7665 gene locus_tag LOCUS_07820 6451 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence0073 2177 807 gene locus_tag LOCUS_07830 2177 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728198.1 protein_id gnl|my_center|LOCUS_07830 2370 3068 gene locus_tag LOCUS_07840 2370 3068 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893548.1 protein_id gnl|my_center|LOCUS_07840 3174 4328 gene locus_tag LOCUS_07850 gene acd 3174 4328 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_07850 4353 6527 gene locus_tag LOCUS_07860 4353 6527 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_07860 6565 7185 gene locus_tag LOCUS_07870 6565 7185 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228711.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence0074 1943 471 gene locus_tag LOCUS_07880 gene gatA 1943 471 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDU8 protein_id gnl|my_center|LOCUS_07880 2533 1940 gene locus_tag LOCUS_07890 2533 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2532 3182 gene locus_tag LOCUS_07900 2532 3182 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893731.1 protein_id gnl|my_center|LOCUS_07900 5387 3207 gene locus_tag LOCUS_07910 gene ligA 5387 3207 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDV2 protein_id gnl|my_center|LOCUS_07910 5594 5412 gene locus_tag LOCUS_07920 5594 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6807 5620 gene locus_tag LOCUS_07930 6807 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704668.1 protein_id gnl|my_center|LOCUS_07930 7982 6963 gene locus_tag LOCUS_07940 7982 6963 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728293.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence0075 1534 635 gene locus_tag LOCUS_07950 1534 635 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 protein_id gnl|my_center|LOCUS_07950 1646 2164 gene locus_tag LOCUS_07960 1646 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2767 2300 gene locus_tag LOCUS_07970 2767 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704154.1 protein_id gnl|my_center|LOCUS_07970 2997 4199 gene locus_tag LOCUS_07980 2997 4199 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_07980 5391 4210 gene locus_tag LOCUS_07990 5391 4210 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_07990 5559 6425 gene locus_tag LOCUS_08000 5559 6425 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNZ7 protein_id gnl|my_center|LOCUS_08000 6456 7304 gene locus_tag LOCUS_08010 6456 7304 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222197.1 protein_id gnl|my_center|LOCUS_08010 <8008 7321 gene locus_tag LOCUS_08020 <8008 7321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029384.1:amidohydrolase >Feature sequence0076 2948 2292 gene locus_tag LOCUS_08030 gene kdpC 2948 2292 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDK9 protein_id gnl|my_center|LOCUS_08030 4963 2951 gene locus_tag LOCUS_08040 gene kdpB 4963 2951 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDL0 protein_id gnl|my_center|LOCUS_08040 6624 4960 gene locus_tag LOCUS_08050 gene kdpA 6624 4960 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDL1 protein_id gnl|my_center|LOCUS_08050 7291 6833 gene locus_tag LOCUS_08060 7291 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 7833 7276 gene locus_tag LOCUS_08070 7833 7276 CDS product putative RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701990.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence0077 2312 588 gene locus_tag LOCUS_08080 2312 588 CDS product NAD+ synthase (glutamine-hydrolysing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_08080 2423 3961 gene locus_tag LOCUS_08090 2423 3961 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_08090 4045 5403 gene locus_tag LOCUS_08100 4045 5403 CDS product putative glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702657.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence0078 3 296 gene locus_tag LOCUS_08110 3 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2379 403 gene locus_tag LOCUS_08120 2379 403 CDS product putative copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701202.1 protein_id gnl|my_center|LOCUS_08120 2410 2598 gene locus_tag LOCUS_08130 2410 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2917 2687 gene locus_tag LOCUS_08140 2917 2687 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_08140 5859 3235 gene locus_tag LOCUS_08150 5859 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35867 protein_id gnl|my_center|LOCUS_08150 7297 5999 gene locus_tag LOCUS_08160 7297 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35866 protein_id gnl|my_center|LOCUS_08160 >Feature sequence0079 1408 503 gene locus_tag LOCUS_08170 gene ftsX 1408 503 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32882 protein_id gnl|my_center|LOCUS_08170 2164 1475 gene locus_tag LOCUS_08180 gene ftsE 2164 1475 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_08180 2583 2251 gene locus_tag LOCUS_08190 2583 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3596 2697 gene locus_tag LOCUS_08200 3596 2697 CDS product MscS Mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704207.1 protein_id gnl|my_center|LOCUS_08200 4733 3600 gene locus_tag LOCUS_08210 gene prfB 4733 3600 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU58 protein_id gnl|my_center|LOCUS_08210 4915 5406 gene locus_tag LOCUS_08220 4915 5406 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R248 protein_id gnl|my_center|LOCUS_08220 5466 6257 gene locus_tag LOCUS_08230 5466 6257 CDS product putative monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704215.1 protein_id gnl|my_center|LOCUS_08230 6737 6303 gene locus_tag LOCUS_08240 6737 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0080 248 1186 gene locus_tag LOCUS_08250 gene mshD 248 1186 CDS product mycothiol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI19 protein_id gnl|my_center|LOCUS_08250 1386 2486 gene locus_tag LOCUS_08260 gene pstS 1386 2486 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4C3 protein_id gnl|my_center|LOCUS_08260 2565 3611 gene locus_tag LOCUS_08270 gene pstC 2565 3611 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4C2 protein_id gnl|my_center|LOCUS_08270 3615 4523 gene locus_tag LOCUS_08280 3615 4523 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI22 protein_id gnl|my_center|LOCUS_08280 4560 5336 gene locus_tag LOCUS_08290 gene pstB 4560 5336 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4C0 protein_id gnl|my_center|LOCUS_08290 6138 5464 gene locus_tag LOCUS_08300 6138 5464 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI25 protein_id gnl|my_center|LOCUS_08300 7677 6205 gene locus_tag LOCUS_08310 7677 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 >Feature sequence0081 517 20 gene locus_tag LOCUS_08320 gene garA 517 20 CDS product glycogen accumulation regulator GarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYG2 protein_id gnl|my_center|LOCUS_08320 1169 747 gene locus_tag LOCUS_08330 gene gcvH 1169 747 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB62 protein_id gnl|my_center|LOCUS_08330 1923 1192 gene locus_tag LOCUS_08340 1923 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703136.1 protein_id gnl|my_center|LOCUS_08340 2367 1927 gene locus_tag LOCUS_08350 2367 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3218 2364 gene locus_tag LOCUS_08360 3218 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729231.1 protein_id gnl|my_center|LOCUS_08360 3826 3221 gene locus_tag LOCUS_08370 gene pgsA 3826 3221 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_08370 4520 3894 gene locus_tag LOCUS_08380 4520 3894 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_08380 5153 4545 gene locus_tag LOCUS_08390 gene idi 5153 4545 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKK5 protein_id gnl|my_center|LOCUS_08390 5198 5359 gene locus_tag LOCUS_08400 5198 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5464 5646 gene locus_tag LOCUS_08410 5464 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5643 6905 gene locus_tag LOCUS_08420 5643 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7682 6921 gene locus_tag LOCUS_08430 gene gno 7682 6921 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence0082 751 1584 gene locus_tag LOCUS_08440 751 1584 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_08440 1754 1572 gene locus_tag LOCUS_08450 1754 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1949 3223 gene locus_tag LOCUS_08460 1949 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3214 3870 gene locus_tag LOCUS_08470 3214 3870 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_08470 3867 4646 gene locus_tag LOCUS_08480 3867 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5860 4640 gene locus_tag LOCUS_08490 5860 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5814 6182 gene locus_tag LOCUS_08500 5814 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6331 7584 gene locus_tag LOCUS_08510 6331 7584 CDS product putative acetamidase/formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701339.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0083 1175 1717 gene locus_tag LOCUS_08520 1175 1717 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893209.1 protein_id gnl|my_center|LOCUS_08520 1704 2237 gene locus_tag LOCUS_08530 1704 2237 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730252.1 protein_id gnl|my_center|LOCUS_08530 2498 2244 gene locus_tag LOCUS_08540 2498 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3894 2509 gene locus_tag LOCUS_08550 3894 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5204 3909 gene locus_tag LOCUS_08560 5204 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6679 5342 gene locus_tag LOCUS_08570 6679 5342 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence0084 <1 1026 gene locus_tag LOCUS_08580 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707083.1:acetyl-CoA acetyltransferase 1023 1703 gene locus_tag LOCUS_08590 1023 1703 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601166.1 protein_id gnl|my_center|LOCUS_08590 1700 2332 gene locus_tag LOCUS_08600 1700 2332 CDS product cobalt ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_08600 2322 3770 gene locus_tag LOCUS_08610 gene yhfT 2322 3770 CDS product putative acyl--CoA ligase YhfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07619 protein_id gnl|my_center|LOCUS_08610 4492 3674 gene locus_tag LOCUS_08620 4492 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLN5 protein_id gnl|my_center|LOCUS_08620 6008 4503 gene locus_tag LOCUS_08630 6008 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6712 6128 gene locus_tag LOCUS_08640 6712 6128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_08640 7446 6733 gene locus_tag LOCUS_08650 7446 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415010.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence0085 <1 1191 gene locus_tag LOCUS_08660 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QX60:L-threonine dehydratase 1717 1193 gene locus_tag LOCUS_08670 1717 1193 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_08670 1832 3388 gene locus_tag LOCUS_08680 1832 3388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_08680 5136 3361 gene locus_tag LOCUS_08690 gene treZ 5136 3361 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX61 protein_id gnl|my_center|LOCUS_08690 7508 5133 gene locus_tag LOCUS_08700 gene treY 7508 5133 CDS product putative maltooligosyl trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ21 protein_id gnl|my_center|LOCUS_08700 >Feature sequence0086 <1 1171 gene locus_tag LOCUS_08710 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MFN6:2-isopropylmalate synthase 1380 1757 gene locus_tag LOCUS_08720 1380 1757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897694.1 protein_id gnl|my_center|LOCUS_08720 2637 1726 gene locus_tag LOCUS_08730 2637 1726 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230607.1 protein_id gnl|my_center|LOCUS_08730 1893 1967 gene locus_tag LOCUS_t00020 1893 1967 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2710 3606 gene locus_tag LOCUS_08740 2710 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701428.1 protein_id gnl|my_center|LOCUS_08740 3656 4954 gene locus_tag LOCUS_08750 3656 4954 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900738.1 protein_id gnl|my_center|LOCUS_08750 4947 5657 gene locus_tag LOCUS_08760 4947 5657 CDS product putative cobyric acid synthase CobQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701076.1 protein_id gnl|my_center|LOCUS_08760 6625 5690 gene locus_tag LOCUS_08770 6625 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence0087 <1 540 gene locus_tag LOCUS_08780 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QZ54:proteasome-associated ATPase 622 2121 gene locus_tag LOCUS_08790 622 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702905.1 protein_id gnl|my_center|LOCUS_08790 2317 2511 gene locus_tag LOCUS_08800 gene pup 2317 2511 CDS product prokaryotic ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TZ12 protein_id gnl|my_center|LOCUS_08800 2508 3449 gene locus_tag LOCUS_08810 gene prcB 2508 3449 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAI2 protein_id gnl|my_center|LOCUS_08810 3446 4219 gene locus_tag LOCUS_08820 gene prcA 3446 4219 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ46 protein_id gnl|my_center|LOCUS_08820 5615 4257 gene locus_tag LOCUS_08830 5615 4257 CDS product glycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226721.1 protein_id gnl|my_center|LOCUS_08830 5818 7161 gene locus_tag LOCUS_08840 gene pafA 5818 7161 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAJ3 protein_id gnl|my_center|LOCUS_08840 >Feature sequence0088 <1 581 gene locus_tag LOCUS_08850 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893096.1:membrane protein 1999 587 gene locus_tag LOCUS_08860 1999 587 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730855.1 protein_id gnl|my_center|LOCUS_08860 2703 1996 gene locus_tag LOCUS_08870 gene phoP 2703 1996 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 protein_id gnl|my_center|LOCUS_08870 2855 3805 gene locus_tag LOCUS_08880 2855 3805 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228387.1 protein_id gnl|my_center|LOCUS_08880 3802 4536 gene locus_tag LOCUS_08890 3802 4536 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731009.1 protein_id gnl|my_center|LOCUS_08890 4659 4973 gene locus_tag LOCUS_08900 4659 4973 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727806.1 protein_id gnl|my_center|LOCUS_08900 5172 4993 gene locus_tag LOCUS_08910 5172 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5111 5809 gene locus_tag LOCUS_08920 5111 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6008 7144 gene locus_tag LOCUS_08930 gene xylF 6008 7144 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0089 1871 588 gene locus_tag LOCUS_08940 1871 588 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJ33 protein_id gnl|my_center|LOCUS_08940 2872 1868 gene locus_tag LOCUS_08950 2872 1868 CDS product putative pyruvate dehydrogenase E1 component, beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701644.1 protein_id gnl|my_center|LOCUS_08950 3984 2869 gene locus_tag LOCUS_08960 3984 2869 CDS product putative pyruvate dehydrogenase E1 component, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701645.1 protein_id gnl|my_center|LOCUS_08960 4143 4628 gene locus_tag LOCUS_08970 4143 4628 CDS product putative transcriptional regulator, AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701646.1 protein_id gnl|my_center|LOCUS_08970 5862 4657 gene locus_tag LOCUS_08980 5862 4657 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701641.1 protein_id gnl|my_center|LOCUS_08980 6025 6537 gene locus_tag LOCUS_08990 6025 6537 CDS product putative transcriptional regulator, AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701640.1 protein_id gnl|my_center|LOCUS_08990 <7475 6544 gene locus_tag LOCUS_09000 <7475 6544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701636.1:putative fumarylacetoacetase >Feature sequence0090 376 2367 gene locus_tag LOCUS_09010 376 2367 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601379.1 protein_id gnl|my_center|LOCUS_09010 3804 2419 gene locus_tag LOCUS_09020 gene aroG 3804 2419 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R033 protein_id gnl|my_center|LOCUS_09020 4341 3850 gene locus_tag LOCUS_09030 4341 3850 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R034 protein_id gnl|my_center|LOCUS_09030 4551 5714 gene locus_tag LOCUS_09040 4551 5714 CDS product polyprenol-phosphate-mannose-dependent alpha-(1-2)-phosphatidylinositol mannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R036 protein_id gnl|my_center|LOCUS_09040 6452 5724 gene locus_tag LOCUS_09050 6452 5724 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895641.1 protein_id gnl|my_center|LOCUS_09050 <7465 6630 gene locus_tag LOCUS_09060 <7465 6630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224324.1:glucokinase >Feature sequence0091 2210 1389 gene locus_tag LOCUS_09070 2210 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2912 2334 gene locus_tag LOCUS_09080 2912 2334 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_09080 3052 3888 gene locus_tag LOCUS_09090 3052 3888 CDS product putative peptidoglycan hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6XEI5 protein_id gnl|my_center|LOCUS_09090 4839 3994 gene locus_tag LOCUS_09100 4839 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5156 6376 gene locus_tag LOCUS_09110 gene pimE 5156 6376 CDS product polyprenol-phosphate-mannose-dependent alpha-(1-2)-phosphatidylinositol pentamannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2K8 protein_id gnl|my_center|LOCUS_09110 6602 6318 gene locus_tag LOCUS_09120 gene phhB 6602 6318 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGD3 protein_id gnl|my_center|LOCUS_09120 6617 7042 gene locus_tag LOCUS_09130 6617 7042 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 protein_id gnl|my_center|LOCUS_09130 7184 7008 gene locus_tag LOCUS_09140 7184 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence0092 244 1137 gene locus_tag LOCUS_09150 244 1137 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_09150 1975 1217 gene locus_tag LOCUS_09160 1975 1217 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_09160 2781 2044 gene locus_tag LOCUS_09170 2781 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3231 2839 gene locus_tag LOCUS_09180 3231 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4173 3418 gene locus_tag LOCUS_09190 4173 3418 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4C9 protein_id gnl|my_center|LOCUS_09190 5153 4170 gene locus_tag LOCUS_09200 5153 4170 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_09200 6222 5200 gene locus_tag LOCUS_09210 6222 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0093 646 344 gene locus_tag LOCUS_09220 646 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 749 1312 gene locus_tag LOCUS_09230 749 1312 CDS product deaminase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225287.1 protein_id gnl|my_center|LOCUS_09230 1650 1354 gene locus_tag LOCUS_09240 1650 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_09240 5268 1723 gene locus_tag LOCUS_09250 5268 1723 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728718.1 protein_id gnl|my_center|LOCUS_09250 5601 7397 gene locus_tag LOCUS_09260 5601 7397 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence0094 749 1909 gene locus_tag LOCUS_09270 749 1909 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230965.1 protein_id gnl|my_center|LOCUS_09270 1920 2582 gene locus_tag LOCUS_09280 1920 2582 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_09280 2664 3200 gene locus_tag LOCUS_09290 2664 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702939.1 protein_id gnl|my_center|LOCUS_09290 3218 4813 gene locus_tag LOCUS_09300 3218 4813 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729377.1 protein_id gnl|my_center|LOCUS_09300 4788 6380 gene locus_tag LOCUS_09310 gene lnt 4788 6380 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ13 protein_id gnl|my_center|LOCUS_09310 >Feature sequence0095 2613 1777 gene locus_tag LOCUS_09320 2613 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3483 2731 gene locus_tag LOCUS_09330 3483 2731 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_09330 4084 3485 gene locus_tag LOCUS_09340 4084 3485 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_09340 4252 4740 gene locus_tag LOCUS_09350 4252 4740 CDS product putative cytidine/deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704189.1 protein_id gnl|my_center|LOCUS_09350 4801 6126 gene locus_tag LOCUS_09360 4801 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7033 6158 gene locus_tag LOCUS_09370 7033 6158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226941.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence0096 1619 2113 gene locus_tag LOCUS_09380 gene soxR 1619 2113 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896846.1 protein_id gnl|my_center|LOCUS_09380 2931 2029 gene locus_tag LOCUS_09390 2931 2029 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 protein_id gnl|my_center|LOCUS_09390 3149 3006 gene locus_tag LOCUS_09400 3149 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3893 3219 gene locus_tag LOCUS_09410 3893 3219 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893568.1 protein_id gnl|my_center|LOCUS_09410 4518 4084 gene locus_tag LOCUS_09420 4518 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4970 4518 gene locus_tag LOCUS_09430 4970 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6018 5134 gene locus_tag LOCUS_09440 6018 5134 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_09440 7052 6240 gene locus_tag LOCUS_09450 7052 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence0097 1350 331 gene locus_tag LOCUS_09460 1350 331 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_09460 2510 1347 gene locus_tag LOCUS_09470 2510 1347 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701595.1 protein_id gnl|my_center|LOCUS_09470 2582 3568 gene locus_tag LOCUS_09480 2582 3568 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_09480 4274 3549 gene locus_tag LOCUS_09490 4274 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5970 4315 gene locus_tag LOCUS_09500 5970 4315 CDS product putative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701608.1 protein_id gnl|my_center|LOCUS_09500 <7326 6060 gene locus_tag LOCUS_09510 <7326 6060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730725.1:DNA-binding protein >Feature sequence0098 83 1012 gene locus_tag LOCUS_09520 83 1012 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 protein_id gnl|my_center|LOCUS_09520 1127 2173 gene locus_tag LOCUS_09530 1127 2173 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 protein_id gnl|my_center|LOCUS_09530 2233 3222 gene locus_tag LOCUS_09540 2233 3222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729923.1 protein_id gnl|my_center|LOCUS_09540 3219 3998 gene locus_tag LOCUS_09550 3219 3998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_09550 4231 5583 gene locus_tag LOCUS_09560 4231 5583 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729877.1 protein_id gnl|my_center|LOCUS_09560 6785 5505 gene locus_tag LOCUS_09570 6785 5505 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229184.1 protein_id gnl|my_center|LOCUS_09570 7237 6803 gene locus_tag LOCUS_09580 7237 6803 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229347.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence0099 1427 831 gene locus_tag LOCUS_09590 1427 831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 protein_id gnl|my_center|LOCUS_09590 1541 3229 gene locus_tag LOCUS_09600 1541 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3278 3766 gene locus_tag LOCUS_09610 3278 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4038 3769 gene locus_tag LOCUS_09620 4038 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_09620 4155 4862 gene locus_tag LOCUS_09630 gene paaG 4155 4862 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_09630 5908 4880 gene locus_tag LOCUS_09640 5908 4880 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708897.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence0100 439 2043 gene locus_tag LOCUS_09650 gene trpE 439 2043 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67002 protein_id gnl|my_center|LOCUS_09650 2040 2705 gene locus_tag LOCUS_09660 2040 2705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728903.1 protein_id gnl|my_center|LOCUS_09660 2755 3594 gene locus_tag LOCUS_09670 gene trpC 2755 3594 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBV4 protein_id gnl|my_center|LOCUS_09670 3649 4986 gene locus_tag LOCUS_09680 gene trpB 3649 4986 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX96 protein_id gnl|my_center|LOCUS_09680 4983 5786 gene locus_tag LOCUS_09690 gene trpA 4983 5786 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66981 protein_id gnl|my_center|LOCUS_09690 5783 6769 gene locus_tag LOCUS_09700 5783 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09700 >Feature sequence0101 <1 1105 gene locus_tag LOCUS_09710 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728060.1:acyl-CoA synthetase 2710 1115 gene locus_tag LOCUS_09720 2710 1115 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_09720 3527 2901 gene locus_tag LOCUS_09730 3527 2901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_09730 3893 5266 gene locus_tag LOCUS_09740 3893 5266 CDS product Na+/H+-dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601751.1 protein_id gnl|my_center|LOCUS_09740 5722 5327 gene locus_tag LOCUS_09750 5722 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 6301 5735 gene locus_tag LOCUS_09760 6301 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7055 6366 gene locus_tag LOCUS_09770 7055 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225214.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence0102 1713 745 gene locus_tag LOCUS_09780 1713 745 CDS product putative oligopeptide ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701471.1 protein_id gnl|my_center|LOCUS_09780 2801 1713 gene locus_tag LOCUS_09790 2801 1713 CDS product putative oligopeptide ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701470.1 protein_id gnl|my_center|LOCUS_09790 4475 2805 gene locus_tag LOCUS_09800 4475 2805 CDS product putative oligopeptide ABC transporter, solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701469.1 protein_id gnl|my_center|LOCUS_09800 6156 4588 gene locus_tag LOCUS_09810 gene purF 6156 4588 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4E0 protein_id gnl|my_center|LOCUS_09810 6661 6275 gene locus_tag LOCUS_09820 6661 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863125.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0103 115 531 gene locus_tag LOCUS_09830 115 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 528 1214 gene locus_tag LOCUS_09840 gene dehII 528 1214 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553610.1 protein_id gnl|my_center|LOCUS_09840 1794 1225 gene locus_tag LOCUS_09850 1794 1225 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_09850 2637 1810 gene locus_tag LOCUS_09860 2637 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978134.1 protein_id gnl|my_center|LOCUS_09860 3341 2724 gene locus_tag LOCUS_09870 3341 2724 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225283.1 protein_id gnl|my_center|LOCUS_09870 3591 4094 gene locus_tag LOCUS_09880 3591 4094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258312.1 protein_id gnl|my_center|LOCUS_09880 4628 4095 gene locus_tag LOCUS_09890 4628 4095 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727921.1 protein_id gnl|my_center|LOCUS_09890 4806 6710 gene locus_tag LOCUS_09900 4806 6710 CDS product uracil-xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727573.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0104 1051 2310 gene locus_tag LOCUS_09910 1051 2310 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_09910 2524 2294 gene locus_tag LOCUS_09920 2524 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2562 3236 gene locus_tag LOCUS_09930 2562 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898734.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09930 3900 3226 gene locus_tag LOCUS_09940 3900 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5G8 protein_id gnl|my_center|LOCUS_09940 4536 3997 gene locus_tag LOCUS_09950 gene ahpD 4536 3997 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50441 protein_id gnl|my_center|LOCUS_09950 5125 4538 gene locus_tag LOCUS_09960 5125 4538 CDS product putative alkylhydroperoxidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705132.1 protein_id gnl|my_center|LOCUS_09960 <7182 5580 gene locus_tag LOCUS_09970 <7182 5580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027613.1:helicase >Feature sequence0105 322 1374 gene locus_tag LOCUS_09980 322 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2981 1407 gene locus_tag LOCUS_09990 2981 1407 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731449.1 protein_id gnl|my_center|LOCUS_09990 4178 3003 gene locus_tag LOCUS_10000 gene pobA 4178 3003 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229335.1 protein_id gnl|my_center|LOCUS_10000 4961 4245 gene locus_tag LOCUS_10010 4961 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893955.1 protein_id gnl|my_center|LOCUS_10010 6592 5090 gene locus_tag LOCUS_10020 gene accD 6592 5090 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_10020 <7144 6589 gene locus_tag LOCUS_10030 <7144 6589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728197.1:CoA transferase >Feature sequence0106 778 3351 gene locus_tag LOCUS_10040 778 3351 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728362.1 protein_id gnl|my_center|LOCUS_10040 3348 4376 gene locus_tag LOCUS_10050 3348 4376 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 protein_id gnl|my_center|LOCUS_10050 4448 5962 gene locus_tag LOCUS_10060 4448 5962 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097699.1 protein_id gnl|my_center|LOCUS_10060 5959 7005 gene locus_tag LOCUS_10070 gene fbpC 5959 7005 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAH7 protein_id gnl|my_center|LOCUS_10070 >Feature sequence0107 154 3366 gene locus_tag LOCUS_10080 154 3366 CDS product putative arabinosyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700939.1 protein_id gnl|my_center|LOCUS_10080 3996 4643 gene locus_tag LOCUS_10090 3996 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228586.1 protein_id gnl|my_center|LOCUS_10090 6351 4807 gene locus_tag LOCUS_10100 gene accD4 6351 4807 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 protein_id gnl|my_center|LOCUS_10100 <7120 6355 gene locus_tag LOCUS_10110 <7120 6355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003902557.1:polyketide synthase >Feature sequence0108 648 1346 gene locus_tag LOCUS_10120 648 1346 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726671.1 protein_id gnl|my_center|LOCUS_10120 1498 1842 gene locus_tag LOCUS_10130 1498 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2972 1875 gene locus_tag LOCUS_10140 2972 1875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 protein_id gnl|my_center|LOCUS_10140 3673 3098 gene locus_tag LOCUS_10150 3673 3098 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_10150 3819 4973 gene locus_tag LOCUS_10160 3819 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_10160 5000 6151 gene locus_tag LOCUS_10170 5000 6151 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence0109 82 1728 gene locus_tag LOCUS_10180 82 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599382.1 protein_id gnl|my_center|LOCUS_10180 2467 1739 gene locus_tag LOCUS_10190 2467 1739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731624.1 protein_id gnl|my_center|LOCUS_10190 3234 2473 gene locus_tag LOCUS_10200 3234 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10200 4185 3250 gene locus_tag LOCUS_10210 4185 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10210 5078 4314 gene locus_tag LOCUS_10220 5078 4314 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400486.1 protein_id gnl|my_center|LOCUS_10220 5627 5151 gene locus_tag LOCUS_10230 5627 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705272.1 protein_id gnl|my_center|LOCUS_10230 5767 6492 gene locus_tag LOCUS_10240 5767 6492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222021.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence0110 1181 405 gene locus_tag LOCUS_10250 1181 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1326 1859 gene locus_tag LOCUS_10260 1326 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1856 2572 gene locus_tag LOCUS_10270 1856 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4773 2554 gene locus_tag LOCUS_10280 4773 2554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_10280 5274 4774 gene locus_tag LOCUS_10290 5274 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6660 5920 gene locus_tag LOCUS_10300 6660 5920 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391993.1 protein_id gnl|my_center|LOCUS_10300 6857 6660 gene locus_tag LOCUS_10310 6857 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence0111 1195 2184 gene locus_tag LOCUS_10320 1195 2184 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_10320 2288 2584 gene locus_tag LOCUS_10330 2288 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3228 2638 gene locus_tag LOCUS_10340 3228 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3754 4866 gene locus_tag LOCUS_10350 3754 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10350 4850 5311 gene locus_tag LOCUS_10360 4850 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10360 5308 6129 gene locus_tag LOCUS_10370 5308 6129 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027678.1 protein_id gnl|my_center|LOCUS_10370 6249 6803 gene locus_tag LOCUS_10380 6249 6803 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402330.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence0112 802 1554 gene locus_tag LOCUS_10390 gene tauD 802 1554 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817330.1 protein_id gnl|my_center|LOCUS_10390 1605 2330 gene locus_tag LOCUS_10400 1605 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703940.1 protein_id gnl|my_center|LOCUS_10400 2960 2346 gene locus_tag LOCUS_10410 2960 2346 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223182.1 protein_id gnl|my_center|LOCUS_10410 3071 3973 gene locus_tag LOCUS_10420 3071 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408760.1 protein_id gnl|my_center|LOCUS_10420 4567 3992 gene locus_tag LOCUS_10430 4567 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4949 4608 gene locus_tag LOCUS_10440 4949 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704670.1 protein_id gnl|my_center|LOCUS_10440 6302 5004 gene locus_tag LOCUS_10450 6302 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence0113 632 1057 gene locus_tag LOCUS_10460 632 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896741.1 protein_id gnl|my_center|LOCUS_10460 2200 1082 gene locus_tag LOCUS_10470 2200 1082 CDS product 16S RNA G1207 methylase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776338.1 protein_id gnl|my_center|LOCUS_10470 2256 2414 gene locus_tag LOCUS_10480 2256 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2942 2418 gene locus_tag LOCUS_10490 2942 2418 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971790.1 protein_id gnl|my_center|LOCUS_10490 3561 2989 gene locus_tag LOCUS_10500 3561 2989 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 protein_id gnl|my_center|LOCUS_10500 3728 4225 gene locus_tag LOCUS_10510 3728 4225 CDS product putative transcriptional regulator, AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701646.1 protein_id gnl|my_center|LOCUS_10510 4222 5364 gene locus_tag LOCUS_10520 gene dauA 4222 5364 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_10520 6037 5432 gene locus_tag LOCUS_10530 6037 5432 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029478.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0114 1963 1391 gene locus_tag LOCUS_10540 1963 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2106 1960 gene locus_tag LOCUS_10550 2106 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2578 2180 gene locus_tag LOCUS_10560 2578 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4249 2615 gene locus_tag LOCUS_10570 4249 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4584 4246 gene locus_tag LOCUS_10580 4584 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6428 4584 gene locus_tag LOCUS_10590 6428 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0115 861 16 gene locus_tag LOCUS_10600 861 16 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728291.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 1760 942 gene locus_tag LOCUS_10610 1760 942 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728290.1 protein_id gnl|my_center|LOCUS_10610 2870 1914 gene locus_tag LOCUS_10620 2870 1914 CDS product electron transfer flavoprotein alpha-subunit FixB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704092.1 protein_id gnl|my_center|LOCUS_10620 3714 2914 gene locus_tag LOCUS_10630 3714 2914 CDS product electron transfer flavoprotein beta-subunit FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704093.1 protein_id gnl|my_center|LOCUS_10630 3888 4727 gene locus_tag LOCUS_10640 3888 4727 CDS product putative S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUV5 protein_id gnl|my_center|LOCUS_10640 4724 6265 gene locus_tag LOCUS_10650 4724 6265 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728284.1 protein_id gnl|my_center|LOCUS_10650 6262 6747 gene locus_tag LOCUS_10660 6262 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 >Feature sequence0116 <1 1585 gene locus_tag LOCUS_10670 <1 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728908.1:glutamate synthase 1578 3083 gene locus_tag LOCUS_10680 1578 3083 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 protein_id gnl|my_center|LOCUS_10680 3290 4624 gene locus_tag LOCUS_10690 gene pyk 3290 4624 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXA3 protein_id gnl|my_center|LOCUS_10690 4625 5593 gene locus_tag LOCUS_10700 4625 5593 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894617.1 protein_id gnl|my_center|LOCUS_10700 6041 5520 gene locus_tag LOCUS_10710 6041 5520 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_10710 6098 6301 gene locus_tag LOCUS_10720 6098 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6768 6277 gene locus_tag LOCUS_10730 6768 6277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529116.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence0117 <1 1120 gene locus_tag LOCUS_10740 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228710.1:tryptophan synthase subunit alpha 1827 1117 gene locus_tag LOCUS_10750 1827 1117 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021303.1 protein_id gnl|my_center|LOCUS_10750 3361 1856 gene locus_tag LOCUS_10760 3361 1856 CDS product putative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704929.1 protein_id gnl|my_center|LOCUS_10760 3482 4846 gene locus_tag LOCUS_10770 3482 4846 CDS product 4-aminobutyrate aminotransferase GabT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704934.1 protein_id gnl|my_center|LOCUS_10770 4848 6299 gene locus_tag LOCUS_10780 4848 6299 CDS product putative succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704935.1 protein_id gnl|my_center|LOCUS_10780 <6942 6408 gene locus_tag LOCUS_10790 <6942 6408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228727.1:valine dehydrogenase >Feature sequence0118 2001 2705 gene locus_tag LOCUS_10800 2001 2705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_10800 3541 3068 gene locus_tag LOCUS_10810 3541 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4216 4013 gene locus_tag LOCUS_10820 4216 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10820 4470 4228 gene locus_tag LOCUS_10830 4470 4228 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706289.1 protein_id gnl|my_center|LOCUS_10830 5360 4722 gene locus_tag LOCUS_10840 5360 4722 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_10840 6481 5357 gene locus_tag LOCUS_10850 6481 5357 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence0119 638 1678 gene locus_tag LOCUS_10860 gene trpS 638 1678 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX76 protein_id gnl|my_center|LOCUS_10860 1765 2784 gene locus_tag LOCUS_10870 1765 2784 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 protein_id gnl|my_center|LOCUS_10870 4117 2828 gene locus_tag LOCUS_10880 4117 2828 CDS product putative penicillin-binding protein DacB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704409.1 protein_id gnl|my_center|LOCUS_10880 4318 5355 gene locus_tag LOCUS_10890 4318 5355 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 protein_id gnl|my_center|LOCUS_10890 5383 6441 gene locus_tag LOCUS_10900 5383 6441 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896031.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence0120 754 681 gene locus_tag LOCUS_t00030 754 681 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 899 810 gene locus_tag LOCUS_t00040 899 810 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1670 1023 gene locus_tag LOCUS_10910 1670 1023 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222223.1 protein_id gnl|my_center|LOCUS_10910 1875 2939 gene locus_tag LOCUS_10920 gene pat 1875 2939 CDS product putative phenylalanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5X8 protein_id gnl|my_center|LOCUS_10920 3974 2928 gene locus_tag LOCUS_10930 3974 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4470 4267 gene locus_tag LOCUS_10940 4470 4267 CDS product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 protein_id gnl|my_center|LOCUS_10940 4631 4990 gene locus_tag LOCUS_10950 4631 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5069 5983 gene locus_tag LOCUS_10960 5069 5983 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_10960 6820 6008 gene locus_tag LOCUS_10970 6820 6008 CDS product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence0121 263 787 gene locus_tag LOCUS_10980 263 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 986 2812 gene locus_tag LOCUS_10990 986 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2851 3249 gene locus_tag LOCUS_11000 gene ectC 2851 3249 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ51 protein_id gnl|my_center|LOCUS_11000 3326 4222 gene locus_tag LOCUS_11010 gene cobB 3326 4222 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R145 protein_id gnl|my_center|LOCUS_11010 5331 4195 gene locus_tag LOCUS_11020 gene proB 5331 4195 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59958 protein_id gnl|my_center|LOCUS_11020 6788 5337 gene locus_tag LOCUS_11030 gene obg 6788 5337 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMY5 protein_id gnl|my_center|LOCUS_11030 >Feature sequence0122 521 1048 gene locus_tag LOCUS_11040 521 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897837.1 protein_id gnl|my_center|LOCUS_11040 1255 1962 gene locus_tag LOCUS_11050 1255 1962 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_11050 1993 3177 gene locus_tag LOCUS_11060 1993 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3174 4190 gene locus_tag LOCUS_11070 3174 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4814 5581 gene locus_tag LOCUS_11080 4814 5581 CDS product 3-hydroxy-2-methylbutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_11080 <6837 5622 gene locus_tag LOCUS_11090 <6837 5622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222052.1:recombinase RecB >Feature sequence0123 1693 1337 gene locus_tag LOCUS_11100 1693 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1758 2591 gene locus_tag LOCUS_11110 1758 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037882.1 protein_id gnl|my_center|LOCUS_11110 3440 2640 gene locus_tag LOCUS_11120 gene kipR 3440 2640 CDS product HTH-type transcriptional regulator KipR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42968 protein_id gnl|my_center|LOCUS_11120 3584 4450 gene locus_tag LOCUS_11130 3584 4450 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_11130 4447 5712 gene locus_tag LOCUS_11140 gene leuC 4447 5712 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F6 protein_id gnl|my_center|LOCUS_11140 5709 6260 gene locus_tag LOCUS_11150 5709 6260 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816726.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence0124 2066 1437 gene locus_tag LOCUS_11160 2066 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2185 3165 gene locus_tag LOCUS_11170 2185 3165 CDS product nucleotide-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228034.1 protein_id gnl|my_center|LOCUS_11170 3162 3947 gene locus_tag LOCUS_11180 3162 3947 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 protein_id gnl|my_center|LOCUS_11180 4147 3944 gene locus_tag LOCUS_11190 4147 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4056 4730 gene locus_tag LOCUS_11200 4056 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5358 4699 gene locus_tag LOCUS_11210 5358 4699 CDS product putative enoyl-coa hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703200.1 protein_id gnl|my_center|LOCUS_11210 6010 5387 gene locus_tag LOCUS_11220 6010 5387 CDS product putative transcriptional regulator, TetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703201.1 protein_id gnl|my_center|LOCUS_11220 6165 6800 gene locus_tag LOCUS_11230 6165 6800 CDS product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence0125 1496 2533 gene locus_tag LOCUS_11240 1496 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702863.1 protein_id gnl|my_center|LOCUS_11240 2635 2982 gene locus_tag LOCUS_11250 2635 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2982 5471 gene locus_tag LOCUS_11260 gene nasD 2982 5471 CDS product nitrite reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42435 protein_id gnl|my_center|LOCUS_11260 5468 5767 gene locus_tag LOCUS_11270 5468 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence0126 660 935 gene locus_tag LOCUS_11280 660 935 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_11280 1415 1050 gene locus_tag LOCUS_11290 1415 1050 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 protein_id gnl|my_center|LOCUS_11290 1650 2012 gene locus_tag LOCUS_11300 1650 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2025 2477 gene locus_tag LOCUS_11310 2025 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3008 2592 gene locus_tag LOCUS_11320 3008 2592 CDS product cytochrome c oxidase polypeptide 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNZ3 protein_id gnl|my_center|LOCUS_11320 4100 3027 gene locus_tag LOCUS_11330 4100 3027 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895662.1 protein_id gnl|my_center|LOCUS_11330 4329 6257 gene locus_tag LOCUS_11340 gene asnB 4329 6257 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729689.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0127 156 929 gene locus_tag LOCUS_11350 156 929 CDS product putative glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700877.1 protein_id gnl|my_center|LOCUS_11350 940 1851 gene locus_tag LOCUS_11360 940 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_11360 2562 2008 gene locus_tag LOCUS_11370 gene bfrB 2562 2008 CDS product ferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R647 protein_id gnl|my_center|LOCUS_11370 3229 2675 gene locus_tag LOCUS_11380 3229 2675 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEG3 protein_id gnl|my_center|LOCUS_11380 4775 3252 gene locus_tag LOCUS_11390 4775 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11390 5601 4792 gene locus_tag LOCUS_11400 5601 4792 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731271.1 protein_id gnl|my_center|LOCUS_11400 6407 5637 gene locus_tag LOCUS_11410 6407 5637 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897828.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence0128 3923 783 gene locus_tag LOCUS_11420 3923 783 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_11420 4573 3920 gene locus_tag LOCUS_11430 4573 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729189.1 protein_id gnl|my_center|LOCUS_11430 5607 4570 gene locus_tag LOCUS_11440 5607 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5842 6210 gene locus_tag LOCUS_11450 gene rplN 5842 6210 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHD9 protein_id gnl|my_center|LOCUS_11450 6211 6528 gene locus_tag LOCUS_11460 gene rplX 6211 6528 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32994 protein_id gnl|my_center|LOCUS_11460 >Feature sequence0129 <1 1006 gene locus_tag LOCUS_11470 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894330.1:MFS transporter 1059 1412 gene locus_tag LOCUS_11480 1059 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1443 2267 gene locus_tag LOCUS_11490 1443 2267 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_11490 2674 2309 gene locus_tag LOCUS_11500 2674 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_11500 2834 3733 gene locus_tag LOCUS_11510 2834 3733 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889403.1 protein_id gnl|my_center|LOCUS_11510 5049 3847 gene locus_tag LOCUS_11520 5049 3847 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223659.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence0130 2082 586 gene locus_tag LOCUS_11530 2082 586 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 protein_id gnl|my_center|LOCUS_11530 2206 2880 gene locus_tag LOCUS_11540 2206 2880 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726687.1 protein_id gnl|my_center|LOCUS_11540 5253 2887 gene locus_tag LOCUS_11550 5253 2887 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_11550 5564 5304 gene locus_tag LOCUS_11560 5564 5304 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_11560 6162 5593 gene locus_tag LOCUS_11570 6162 5593 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence0131 1343 54 gene locus_tag LOCUS_11580 gene purA 1343 54 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIV1 protein_id gnl|my_center|LOCUS_11580 1547 2212 gene locus_tag LOCUS_11590 1547 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704977.1 protein_id gnl|my_center|LOCUS_11590 2229 3002 gene locus_tag LOCUS_11600 gene rip2 2229 3002 CDS product putative zinc metalloprotease Rip2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQH5 protein_id gnl|my_center|LOCUS_11600 3021 3587 gene locus_tag LOCUS_11610 3021 3587 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029863.1 protein_id gnl|my_center|LOCUS_11610 4506 3577 gene locus_tag LOCUS_11620 4506 3577 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727169.1 protein_id gnl|my_center|LOCUS_11620 5652 4585 gene locus_tag LOCUS_11630 5652 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99340 protein_id gnl|my_center|LOCUS_11630 6142 5717 gene locus_tag LOCUS_11640 6142 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898414.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence0132 1300 344 gene locus_tag LOCUS_11650 gene dppB 1300 344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_11650 3058 1379 gene locus_tag LOCUS_11660 3058 1379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384235.1 protein_id gnl|my_center|LOCUS_11660 4224 3163 gene locus_tag LOCUS_11670 4224 3163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_11670 5424 4228 gene locus_tag LOCUS_11680 5424 4228 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223745.1 protein_id gnl|my_center|LOCUS_11680 6615 5818 gene locus_tag LOCUS_11690 6615 5818 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence0133 <1 507 gene locus_tag LOCUS_11700 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702844.1:putative phosphoglycerate/bisphosphoglycerate mutase 643 1233 gene locus_tag LOCUS_11710 643 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908254.1 protein_id gnl|my_center|LOCUS_11710 1230 2042 gene locus_tag LOCUS_11720 1230 2042 CDS product putative phosphatidylinositol 3-and 4-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702846.1 protein_id gnl|my_center|LOCUS_11720 2067 3308 gene locus_tag LOCUS_11730 gene mshC 2067 3308 CDS product L-cysteine:1D-myo-inositol 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZY0 protein_id gnl|my_center|LOCUS_11730 4543 3305 gene locus_tag LOCUS_11740 4543 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 <6669 4533 gene locus_tag LOCUS_11750 <6669 4533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459216.1:TIGR02680 family protein >Feature sequence0134 <1 2357 gene locus_tag LOCUS_11760 <1 2357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MH61:DNA-directed RNA polymerase subunit beta' 2542 2931 gene locus_tag LOCUS_11770 2542 2931 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031798.1 protein_id gnl|my_center|LOCUS_11770 4400 2949 gene locus_tag LOCUS_11780 4400 2949 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729346.1 protein_id gnl|my_center|LOCUS_11780 4399 4839 gene locus_tag LOCUS_11790 4399 4839 CDS product putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703044.1 protein_id gnl|my_center|LOCUS_11790 5240 4878 gene locus_tag LOCUS_11800 5240 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5350 5811 gene locus_tag LOCUS_11810 5350 5811 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228449.1 protein_id gnl|my_center|LOCUS_11810 6265 5843 gene locus_tag LOCUS_11820 6265 5843 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence0135 333 629 gene locus_tag LOCUS_11830 333 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2080 1124 gene locus_tag LOCUS_11840 2080 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705581.1 protein_id gnl|my_center|LOCUS_11840 2454 2077 gene locus_tag LOCUS_11850 2454 2077 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705580.1 protein_id gnl|my_center|LOCUS_11850 2883 3242 gene locus_tag LOCUS_11860 2883 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3540 3920 gene locus_tag LOCUS_11870 3540 3920 CDS product putative transcriptional regulator, ArsR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705576.1 protein_id gnl|my_center|LOCUS_11870 3917 4750 gene locus_tag LOCUS_11880 3917 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 4879 5835 gene locus_tag LOCUS_11890 4879 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 5832 6377 gene locus_tag LOCUS_11900 5832 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence0136 <1 1263 gene locus_tag LOCUS_11910 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095878.1:DNA-binding transcriptional regulator 2424 1348 gene locus_tag LOCUS_11920 2424 1348 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730368.1 protein_id gnl|my_center|LOCUS_11920 2696 2481 gene locus_tag LOCUS_11930 2696 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2646 3716 gene locus_tag LOCUS_11940 gene purT 2646 3716 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY4 protein_id gnl|my_center|LOCUS_11940 4455 3727 gene locus_tag LOCUS_11950 4455 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4456 4947 gene locus_tag LOCUS_11960 4456 4947 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 protein_id gnl|my_center|LOCUS_11960 5690 4944 gene locus_tag LOCUS_11970 5690 4944 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104707.1 protein_id gnl|my_center|LOCUS_11970 5737 6615 gene locus_tag LOCUS_11980 5737 6615 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence0137 <1 946 gene locus_tag LOCUS_11990 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MEY1:DNA helicase 1090 1401 gene locus_tag LOCUS_12000 1090 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1447 1875 gene locus_tag LOCUS_12010 1447 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3139 1910 gene locus_tag LOCUS_12020 3139 1910 CDS product putative ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704234.1 protein_id gnl|my_center|LOCUS_12020 4212 3316 gene locus_tag LOCUS_12030 4212 3316 CDS product cyclodehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728040.1 protein_id gnl|my_center|LOCUS_12030 5730 4327 gene locus_tag LOCUS_12040 5730 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704231.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence0138 127 1134 gene locus_tag LOCUS_12050 gene metN 127 1134 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4E7 protein_id gnl|my_center|LOCUS_12050 1131 1865 gene locus_tag LOCUS_12060 1131 1865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730808.1 protein_id gnl|my_center|LOCUS_12060 1862 2749 gene locus_tag LOCUS_12070 1862 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2842 3513 gene locus_tag LOCUS_12080 2842 3513 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_12080 4509 3526 gene locus_tag LOCUS_12090 4509 3526 CDS product NAD/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036475.1 protein_id gnl|my_center|LOCUS_12090 4653 5990 gene locus_tag LOCUS_12100 4653 5990 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549937.1 protein_id gnl|my_center|LOCUS_12100 <6622 5987 gene locus_tag LOCUS_12110 <6622 5987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727646.1:alcohol dehydrogenase >Feature sequence0139 763 2013 gene locus_tag LOCUS_12120 763 2013 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892107.1 protein_id gnl|my_center|LOCUS_12120 2348 3604 gene locus_tag LOCUS_12130 2348 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727121.1 protein_id gnl|my_center|LOCUS_12130 4762 3680 gene locus_tag LOCUS_12140 gene ald 4762 3680 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ8 protein_id gnl|my_center|LOCUS_12140 4842 5399 gene locus_tag LOCUS_12150 4842 5399 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899476.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0140 1400 1654 gene locus_tag LOCUS_12160 1400 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1782 2705 gene locus_tag LOCUS_12170 1782 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3292 2699 gene locus_tag LOCUS_12180 3292 2699 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_12180 3374 3853 gene locus_tag LOCUS_12190 3374 3853 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_12190 5427 3865 gene locus_tag LOCUS_12200 gene nuoN 5427 3865 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU23 protein_id gnl|my_center|LOCUS_12200 <6562 5424 gene locus_tag LOCUS_12210 <6562 5424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728119.1:NADH-quinone oxidoreductase subunit M >Feature sequence0141 202 864 gene locus_tag LOCUS_12220 202 864 CDS product putative osmoprotectant (glycine betaine/ carnitine/choline/l-proline) ABC transporter ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701017.1 protein_id gnl|my_center|LOCUS_12220 861 1553 gene locus_tag LOCUS_12230 861 1553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731209.1 protein_id gnl|my_center|LOCUS_12230 2830 1631 gene locus_tag LOCUS_12240 2830 1631 CDS product putative malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702124.1 protein_id gnl|my_center|LOCUS_12240 3369 3076 gene locus_tag LOCUS_12250 3369 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3980 3366 gene locus_tag LOCUS_12260 3980 3366 CDS product UPF0056 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLP2 protein_id gnl|my_center|LOCUS_12260 4813 3977 gene locus_tag LOCUS_12270 4813 3977 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 protein_id gnl|my_center|LOCUS_12270 5013 5981 gene locus_tag LOCUS_12280 gene corA 5013 5981 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW96 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0142 404 1186 gene locus_tag LOCUS_12290 404 1186 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027678.1 protein_id gnl|my_center|LOCUS_12290 2555 1239 gene locus_tag LOCUS_12300 2555 1239 CDS product putative cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701063.1 protein_id gnl|my_center|LOCUS_12300 3913 2552 gene locus_tag LOCUS_12310 3913 2552 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731176.1 protein_id gnl|my_center|LOCUS_12310 4256 4690 gene locus_tag LOCUS_12320 4256 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701070.1 protein_id gnl|my_center|LOCUS_12320 5337 4687 gene locus_tag LOCUS_12330 5337 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5539 5808 gene locus_tag LOCUS_12340 5539 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12340 5818 6426 gene locus_tag LOCUS_12350 gene recR 5818 6426 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFL9 protein_id gnl|my_center|LOCUS_12350 >Feature sequence0143 <1 5242 gene locus_tag LOCUS_12360 <1 5242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45745:dimodular nonribosomal peptide synthase 6305 5313 gene locus_tag LOCUS_12370 6305 5313 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0144 1916 1212 gene locus_tag LOCUS_12380 gene lolD 1916 1212 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0B3 protein_id gnl|my_center|LOCUS_12380 3223 1991 gene locus_tag LOCUS_12390 3223 1991 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228715.1 protein_id gnl|my_center|LOCUS_12390 3557 4462 gene locus_tag LOCUS_12400 3557 4462 CDS product putative acyl-[acyl-carrier protein] desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705127.1 protein_id gnl|my_center|LOCUS_12400 4566 5426 gene locus_tag LOCUS_12410 4566 5426 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_12410 5745 5419 gene locus_tag LOCUS_12420 5745 5419 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_12420 6309 5800 gene locus_tag LOCUS_12430 6309 5800 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD46 protein_id gnl|my_center|LOCUS_12430 >Feature sequence0145 1259 2125 gene locus_tag LOCUS_12440 1259 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2170 3516 gene locus_tag LOCUS_12450 2170 3516 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFC7 protein_id gnl|my_center|LOCUS_12450 5032 3530 gene locus_tag LOCUS_12460 5032 3530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 protein_id gnl|my_center|LOCUS_12460 6275 5040 gene locus_tag LOCUS_12470 gene cysG 6275 5040 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414535.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence0146 680 54 gene locus_tag LOCUS_12480 680 54 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726963.1 protein_id gnl|my_center|LOCUS_12480 809 2251 gene locus_tag LOCUS_12490 809 2251 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085720.1 protein_id gnl|my_center|LOCUS_12490 2235 3044 gene locus_tag LOCUS_12500 2235 3044 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_12500 3360 3142 gene locus_tag LOCUS_12510 3360 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3727 4515 gene locus_tag LOCUS_12520 3727 4515 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ7 protein_id gnl|my_center|LOCUS_12520 4970 4518 gene locus_tag LOCUS_12530 4970 4518 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_12530 5848 5039 gene locus_tag LOCUS_12540 5848 5039 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730031.1 protein_id gnl|my_center|LOCUS_12540 6330 5845 gene locus_tag LOCUS_12550 6330 5845 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730032.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence0147 <1 650 gene locus_tag LOCUS_12560 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PDA8:tryptophan 2,3-dioxygenase 647 1858 gene locus_tag LOCUS_12570 647 1858 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DES2 protein_id gnl|my_center|LOCUS_12570 1839 2675 gene locus_tag LOCUS_12580 1839 2675 CDS product PaaX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_12580 3415 2672 gene locus_tag LOCUS_12590 3415 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599486.1 protein_id gnl|my_center|LOCUS_12590 4371 3493 gene locus_tag LOCUS_12600 4371 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5336 4476 gene locus_tag LOCUS_12610 gene gltX 5336 4476 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5T6 protein_id gnl|my_center|LOCUS_12610 5616 6461 gene locus_tag LOCUS_12620 5616 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0148 1624 203 gene locus_tag LOCUS_12630 1624 203 CDS product putative amidase AmiA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702413.1 protein_id gnl|my_center|LOCUS_12630 1697 2530 gene locus_tag LOCUS_12640 gene recO 1697 2530 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0S5 protein_id gnl|my_center|LOCUS_12640 2628 3305 gene locus_tag LOCUS_12650 2628 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 3298 3702 gene locus_tag LOCUS_12660 3298 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702416.1 protein_id gnl|my_center|LOCUS_12660 3887 3732 gene locus_tag LOCUS_12670 3887 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3880 4743 gene locus_tag LOCUS_12680 3880 4743 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 protein_id gnl|my_center|LOCUS_12680 5191 4751 gene locus_tag LOCUS_12690 gene fur 5191 4751 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_12690 5598 5188 gene locus_tag LOCUS_12700 5598 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0149 73 516 gene locus_tag LOCUS_12710 73 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH1 protein_id gnl|my_center|LOCUS_12710 1200 532 gene locus_tag LOCUS_12720 1200 532 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK27 protein_id gnl|my_center|LOCUS_12720 1505 1212 gene locus_tag LOCUS_12730 1505 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3142 1502 gene locus_tag LOCUS_12740 3142 1502 CDS product putative propionyl-CoA carboxylase beta chain 5 AccD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704359.1 protein_id gnl|my_center|LOCUS_12740 3226 4074 gene locus_tag LOCUS_12750 3226 4074 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_12750 4122 4721 gene locus_tag LOCUS_12760 4122 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704353.1 protein_id gnl|my_center|LOCUS_12760 4761 5441 gene locus_tag LOCUS_12770 gene vicR 4761 5441 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence0150 <1 1003 gene locus_tag LOCUS_12780 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228715.1:transcriptional regulator 1000 1734 gene locus_tag LOCUS_12790 1000 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1994 1797 gene locus_tag LOCUS_12800 1994 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2104 2574 gene locus_tag LOCUS_12810 2104 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728301.1 protein_id gnl|my_center|LOCUS_12810 3215 2649 gene locus_tag LOCUS_12820 3215 2649 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027232.1 protein_id gnl|my_center|LOCUS_12820 4341 3277 gene locus_tag LOCUS_12830 gene terC 4341 3277 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_12830 5868 4654 gene locus_tag LOCUS_12840 5868 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence0151 1347 2918 gene locus_tag LOCUS_12850 1347 2918 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_12850 3083 4009 gene locus_tag LOCUS_12860 3083 4009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857497.1 protein_id gnl|my_center|LOCUS_12860 4002 4973 gene locus_tag LOCUS_12870 4002 4973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601198.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence0152 574 95 gene locus_tag LOCUS_12880 574 95 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DII6 protein_id gnl|my_center|LOCUS_12880 1332 670 gene locus_tag LOCUS_12890 1332 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701827.1 protein_id gnl|my_center|LOCUS_12890 1826 1422 gene locus_tag LOCUS_12900 1826 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2506 1910 gene locus_tag LOCUS_12910 2506 1910 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05575 protein_id gnl|my_center|LOCUS_12910 2613 3566 gene locus_tag LOCUS_12920 2613 3566 CDS product putative UTP-glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701830.1 protein_id gnl|my_center|LOCUS_12920 3600 4859 gene locus_tag LOCUS_12930 3600 4859 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730556.1 protein_id gnl|my_center|LOCUS_12930 4948 5544 gene locus_tag LOCUS_12940 gene rimJ 4948 5544 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405148.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence0153 280 621 gene locus_tag LOCUS_12950 280 621 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703800.1 protein_id gnl|my_center|LOCUS_12950 766 1575 gene locus_tag LOCUS_12960 766 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703799.1 protein_id gnl|my_center|LOCUS_12960 1621 2490 gene locus_tag LOCUS_12970 1621 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703798.1 protein_id gnl|my_center|LOCUS_12970 2589 2762 gene locus_tag LOCUS_12980 2589 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3671 2775 gene locus_tag LOCUS_12990 3671 2775 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_12990 3895 4521 gene locus_tag LOCUS_13000 3895 4521 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704611.1 protein_id gnl|my_center|LOCUS_13000 4599 5759 gene locus_tag LOCUS_13010 4599 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703794.1 protein_id gnl|my_center|LOCUS_13010 5770 5961 gene locus_tag LOCUS_13020 5770 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence0154 298 26 gene locus_tag LOCUS_13030 298 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 354 506 gene locus_tag LOCUS_13040 354 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 986 618 gene locus_tag LOCUS_13050 986 618 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901716.1 protein_id gnl|my_center|LOCUS_13050 1078 3084 gene locus_tag LOCUS_13060 1078 3084 CDS product metal-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 protein_id gnl|my_center|LOCUS_13060 3652 3278 gene locus_tag LOCUS_13070 3652 3278 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027712.1 protein_id gnl|my_center|LOCUS_13070 4890 3667 gene locus_tag LOCUS_13080 4890 3667 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_13080 5237 4983 gene locus_tag LOCUS_13090 5237 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5160 5480 gene locus_tag LOCUS_13100 5160 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6128 5664 gene locus_tag LOCUS_13110 6128 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0155 76 1323 gene locus_tag LOCUS_13120 gene nagE 76 1323 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224594.1 protein_id gnl|my_center|LOCUS_13120 1320 2504 gene locus_tag LOCUS_13130 1320 2504 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDR9 protein_id gnl|my_center|LOCUS_13130 2505 3299 gene locus_tag LOCUS_13140 gene nagB 2505 3299 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC83 protein_id gnl|my_center|LOCUS_13140 4128 3301 gene locus_tag LOCUS_13150 4128 3301 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896853.1 protein_id gnl|my_center|LOCUS_13150 4881 4165 gene locus_tag LOCUS_13160 4881 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265710.1 protein_id gnl|my_center|LOCUS_13160 5876 4977 gene locus_tag LOCUS_13170 5876 4977 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015533.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence0156 578 2329 gene locus_tag LOCUS_13180 gene poxB 578 2329 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226369.1 protein_id gnl|my_center|LOCUS_13180 3855 2377 gene locus_tag LOCUS_13190 3855 2377 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z545 protein_id gnl|my_center|LOCUS_13190 3996 4688 gene locus_tag LOCUS_13200 3996 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 5781 4690 gene locus_tag LOCUS_13210 gene dinB 5781 4690 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8Q0 protein_id gnl|my_center|LOCUS_13210 5780 6244 gene locus_tag LOCUS_13220 5780 6244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0157 1283 669 gene locus_tag LOCUS_13230 1283 669 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_13230 2199 1288 gene locus_tag LOCUS_13240 2199 1288 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_13240 2282 3514 gene locus_tag LOCUS_13250 2282 3514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726670.1 protein_id gnl|my_center|LOCUS_13250 3985 3500 gene locus_tag LOCUS_13260 3985 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4437 4036 gene locus_tag LOCUS_13270 4437 4036 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027434.1 protein_id gnl|my_center|LOCUS_13270 5621 4656 gene locus_tag LOCUS_13280 gene fabH 5621 4656 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKD7 protein_id gnl|my_center|LOCUS_13280 >Feature sequence0158 1217 4606 gene locus_tag LOCUS_13290 1217 4606 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728760.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence0159 661 209 gene locus_tag LOCUS_13300 661 209 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728514.1 protein_id gnl|my_center|LOCUS_13300 1125 667 gene locus_tag LOCUS_13310 1125 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 protein_id gnl|my_center|LOCUS_13310 1895 1137 gene locus_tag LOCUS_13320 gene dapB 1895 1137 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD52 protein_id gnl|my_center|LOCUS_13320 1989 2777 gene locus_tag LOCUS_13330 1989 2777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775985.1 protein_id gnl|my_center|LOCUS_13330 3887 2781 gene locus_tag LOCUS_13340 3887 2781 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726685.1 protein_id gnl|my_center|LOCUS_13340 <6226 3971 gene locus_tag LOCUS_13350 <6226 3971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence0160 3109 3711 gene locus_tag LOCUS_13360 3109 3711 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_13360 3726 4397 gene locus_tag LOCUS_13370 3726 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0161 76 387 gene locus_tag LOCUS_13380 76 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1476 394 gene locus_tag LOCUS_13390 1476 394 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 protein_id gnl|my_center|LOCUS_13390 1826 1473 gene locus_tag LOCUS_13400 1826 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2026 2241 gene locus_tag LOCUS_13410 2026 2241 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_13410 2377 2574 gene locus_tag LOCUS_13420 2377 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3525 2584 gene locus_tag LOCUS_13430 3525 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5355 4372 gene locus_tag LOCUS_13440 gene ccsB 5355 4372 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727325.1 protein_id gnl|my_center|LOCUS_13440 <6192 5359 gene locus_tag LOCUS_13450 <6192 5359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727324.1:cytochrome c biogenesis protein >Feature sequence0162 2869 2168 gene locus_tag LOCUS_13460 2869 2168 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_13460 3758 2997 gene locus_tag LOCUS_13470 3758 2997 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_13470 3840 4223 gene locus_tag LOCUS_13480 3840 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4234 5076 gene locus_tag LOCUS_13490 4234 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence0163 2093 945 gene locus_tag LOCUS_13500 gene fadE13 2093 945 CDS product acyl-CoA dehydrogenase FadE13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898670.1 protein_id gnl|my_center|LOCUS_13500 3784 2090 gene locus_tag LOCUS_13510 3784 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 protein_id gnl|my_center|LOCUS_13510 4593 3781 gene locus_tag LOCUS_13520 4593 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM91 protein_id gnl|my_center|LOCUS_13520 4706 5761 gene locus_tag LOCUS_13530 4706 5761 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence0164 831 625 gene locus_tag LOCUS_13540 831 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1860 865 gene locus_tag LOCUS_13550 1860 865 CDS product 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013494.1 protein_id gnl|my_center|LOCUS_13550 2031 3053 gene locus_tag LOCUS_13560 2031 3053 CDS product periplasmic binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814105.1 protein_id gnl|my_center|LOCUS_13560 4028 3126 gene locus_tag LOCUS_13570 4028 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4350 5276 gene locus_tag LOCUS_13580 4350 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6081 5287 gene locus_tag LOCUS_13590 6081 5287 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727057.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence0165 3873 5015 gene locus_tag LOCUS_13600 gene lppS 3873 5015 CDS product transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412938.1 protein_id gnl|my_center|LOCUS_13600 5778 5026 gene locus_tag LOCUS_13610 5778 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence0166 1586 279 gene locus_tag LOCUS_13620 1586 279 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532883.1 protein_id gnl|my_center|LOCUS_13620 3028 1607 gene locus_tag LOCUS_13630 3028 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229997.1 protein_id gnl|my_center|LOCUS_13630 3207 4100 gene locus_tag LOCUS_13640 3207 4100 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408081.1 protein_id gnl|my_center|LOCUS_13640 4158 4535 gene locus_tag LOCUS_13650 4158 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030855.1 protein_id gnl|my_center|LOCUS_13650 4532 5413 gene locus_tag LOCUS_13660 4532 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 <6117 5420 gene locus_tag LOCUS_13670 <6117 5420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893323.1:membrane protein >Feature sequence0167 <6100 2426 gene locus_tag LOCUS_13680 <6100 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028843.1:non-ribosomal peptide synthetase >Feature sequence0168 879 175 gene locus_tag LOCUS_13690 879 175 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313424.1 protein_id gnl|my_center|LOCUS_13690 982 2421 gene locus_tag LOCUS_13700 gene aspA 982 2421 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D018 protein_id gnl|my_center|LOCUS_13700 2426 3859 gene locus_tag LOCUS_13710 gene ansP 2426 3859 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_13710 3852 4772 gene locus_tag LOCUS_13720 gene ansA 3852 4772 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973324.1 protein_id gnl|my_center|LOCUS_13720 4831 5151 gene locus_tag LOCUS_13730 4831 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 <6066 5116 gene locus_tag LOCUS_13740 <6066 5116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029509.1:molybdenum cofactor sulfurase >Feature sequence0169 1284 475 gene locus_tag LOCUS_13750 1284 475 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223260.1 protein_id gnl|my_center|LOCUS_13750 1555 1337 gene locus_tag LOCUS_13760 1555 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1753 1680 gene locus_tag LOCUS_t00050 1753 1680 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2515 1820 gene locus_tag LOCUS_13770 2515 1820 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728668.1 protein_id gnl|my_center|LOCUS_13770 2543 3121 gene locus_tag LOCUS_13780 2543 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225405.1 protein_id gnl|my_center|LOCUS_13780 4305 3118 gene locus_tag LOCUS_13790 4305 3118 CDS product putative DNA polymerase III, delta' subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701244.1 protein_id gnl|my_center|LOCUS_13790 <6029 4424 gene locus_tag LOCUS_13800 <6029 4424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MGQ4:DNA topoisomerase 1 >Feature sequence0170 287 1318 gene locus_tag LOCUS_13810 287 1318 CDS product putative adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705493.1 protein_id gnl|my_center|LOCUS_13810 2361 1300 gene locus_tag LOCUS_13820 2361 1300 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727036.1 protein_id gnl|my_center|LOCUS_13820 3209 2358 gene locus_tag LOCUS_13830 3209 2358 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_13830 4545 3217 gene locus_tag LOCUS_13840 4545 3217 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_13840 4832 4542 gene locus_tag LOCUS_13850 4832 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_13850 5706 4825 gene locus_tag LOCUS_13860 5706 4825 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727038.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence0171 561 890 gene locus_tag LOCUS_13870 561 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1993 917 gene locus_tag LOCUS_13880 1993 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3156 1990 gene locus_tag LOCUS_13890 3156 1990 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226521.1 protein_id gnl|my_center|LOCUS_13890 3666 4109 gene locus_tag LOCUS_13900 3666 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13900 4012 4401 gene locus_tag LOCUS_13910 4012 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13910 4661 5206 gene locus_tag LOCUS_13920 4661 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13920 5203 5934 gene locus_tag LOCUS_13930 5203 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKL7 protein_id gnl|my_center|LOCUS_13930 >Feature sequence0172 <1 669 gene locus_tag LOCUS_13940 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729239.1:TetR family transcriptional regulator 688 1341 gene locus_tag LOCUS_13950 688 1341 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7H8 protein_id gnl|my_center|LOCUS_13950 2775 1414 gene locus_tag LOCUS_13960 gene gadB 2775 1414 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P8X8 protein_id gnl|my_center|LOCUS_13960 3803 2808 gene locus_tag LOCUS_13970 3803 2808 CDS product putative Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705451.1 protein_id gnl|my_center|LOCUS_13970 4792 3812 gene locus_tag LOCUS_13980 4792 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5252 4797 gene locus_tag LOCUS_13990 5252 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence0173 1338 145 gene locus_tag LOCUS_14000 1338 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5708 2052 gene locus_tag LOCUS_14010 5708 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence0174 1630 1998 gene locus_tag LOCUS_14020 1630 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3070 2021 gene locus_tag LOCUS_14030 3070 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702894.1 protein_id gnl|my_center|LOCUS_14030 3338 4102 gene locus_tag LOCUS_14040 3338 4102 CDS product exonuclease RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_14040 4099 4911 gene locus_tag LOCUS_14050 4099 4911 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728435.1 protein_id gnl|my_center|LOCUS_14050 5796 4945 gene locus_tag LOCUS_14060 gene hisG 5796 4945 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60760 protein_id gnl|my_center|LOCUS_14060 >Feature sequence0175 <1 1490 gene locus_tag LOCUS_14070 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227654.1:HNH endonuclease 2405 1518 gene locus_tag LOCUS_14080 2405 1518 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_14080 2896 3501 gene locus_tag LOCUS_14090 2896 3501 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_14090 3498 5006 gene locus_tag LOCUS_14100 3498 5006 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729844.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence0176 797 45 gene locus_tag LOCUS_14110 797 45 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223956.1 protein_id gnl|my_center|LOCUS_14110 859 2610 gene locus_tag LOCUS_14120 gene proS 859 2610 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD96 protein_id gnl|my_center|LOCUS_14120 2702 4423 gene locus_tag LOCUS_14130 gene acd 2702 4423 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223446.1 protein_id gnl|my_center|LOCUS_14130 5041 4427 gene locus_tag LOCUS_14140 5041 4427 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence0177 <1 1417 gene locus_tag LOCUS_14150 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727333.1:MFS transporter 1434 2381 gene locus_tag LOCUS_14160 1434 2381 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226775.1 protein_id gnl|my_center|LOCUS_14160 3884 2400 gene locus_tag LOCUS_14170 gene araA 3884 2400 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MA46 protein_id gnl|my_center|LOCUS_14170 4598 3921 gene locus_tag LOCUS_14180 4598 3921 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_14180 <5920 4595 gene locus_tag LOCUS_14190 <5920 4595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D7X3:ribulokinase >Feature sequence0178 1000 41 gene locus_tag LOCUS_14200 gene thiL 1000 41 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDP1 protein_id gnl|my_center|LOCUS_14200 1234 1482 gene locus_tag LOCUS_14210 1234 1482 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_14210 1486 2112 gene locus_tag LOCUS_14220 1486 2112 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893762.1 protein_id gnl|my_center|LOCUS_14220 3226 2120 gene locus_tag LOCUS_14230 gene ddl 3226 2120 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDP3 protein_id gnl|my_center|LOCUS_14230 4298 3300 gene locus_tag LOCUS_14240 gene gpsA 4298 3300 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUZ5 protein_id gnl|my_center|LOCUS_14240 4394 5197 gene locus_tag LOCUS_14250 gene cofC 4394 5197 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUZ4 protein_id gnl|my_center|LOCUS_14250 >Feature sequence0179 1949 558 gene locus_tag LOCUS_14260 gene pknA 1949 558 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726617.1 protein_id gnl|my_center|LOCUS_14260 3440 1956 gene locus_tag LOCUS_14270 gene pbpA 3440 1956 CDS product penicillin-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNG3 protein_id gnl|my_center|LOCUS_14270 4894 3437 gene locus_tag LOCUS_14280 4894 3437 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_14280 <5869 4891 gene locus_tag LOCUS_14290 <5869 4891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700793.1:putative serine/threonine phosphatase Ppp >Feature sequence0180 373 50 gene locus_tag LOCUS_14300 373 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1722 370 gene locus_tag LOCUS_14310 gene hisD 1722 370 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBX9 protein_id gnl|my_center|LOCUS_14310 2330 1812 gene locus_tag LOCUS_14320 2330 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703465.1 protein_id gnl|my_center|LOCUS_14320 2847 2380 gene locus_tag LOCUS_14330 2847 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705064.1 protein_id gnl|my_center|LOCUS_14330 2931 3557 gene locus_tag LOCUS_14340 2931 3557 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 protein_id gnl|my_center|LOCUS_14340 3554 3718 gene locus_tag LOCUS_14350 3554 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3715 4098 gene locus_tag LOCUS_14360 3715 4098 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DB15 protein_id gnl|my_center|LOCUS_14360 4511 4095 gene locus_tag LOCUS_14370 4511 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228177.1 protein_id gnl|my_center|LOCUS_14370 4590 5573 gene locus_tag LOCUS_14380 4590 5573 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence0181 2852 1719 gene locus_tag LOCUS_14390 2852 1719 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704748.1 protein_id gnl|my_center|LOCUS_14390 3766 2849 gene locus_tag LOCUS_14400 3766 2849 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 protein_id gnl|my_center|LOCUS_14400 4494 3934 gene locus_tag LOCUS_14410 4494 3934 CDS product UPF0232 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ME44 protein_id gnl|my_center|LOCUS_14410 5723 4491 gene locus_tag LOCUS_14420 gene recF 5723 4491 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ME43 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0182 506 1804 gene locus_tag LOCUS_14430 gene ydiO 506 1804 CDS product putative BsuMI modification methylase subunit YdiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34939 protein_id gnl|my_center|LOCUS_14430 2633 1836 gene locus_tag LOCUS_14440 2633 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3745 2639 gene locus_tag LOCUS_14450 3745 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5691 3742 gene locus_tag LOCUS_14460 5691 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0183 135 1172 gene locus_tag LOCUS_14470 135 1172 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731150.1 protein_id gnl|my_center|LOCUS_14470 1169 2686 gene locus_tag LOCUS_14480 1169 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731149.1 protein_id gnl|my_center|LOCUS_14480 2837 4060 gene locus_tag LOCUS_14490 2837 4060 CDS product 1,3-propanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731148.1 protein_id gnl|my_center|LOCUS_14490 4057 5409 gene locus_tag LOCUS_14500 4057 5409 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731147.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0184 1450 203 gene locus_tag LOCUS_14510 1450 203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223668.1 protein_id gnl|my_center|LOCUS_14510 2679 1447 gene locus_tag LOCUS_14520 2679 1447 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 protein_id gnl|my_center|LOCUS_14520 4028 2745 gene locus_tag LOCUS_14530 4028 2745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224304.1 protein_id gnl|my_center|LOCUS_14530 5026 4028 gene locus_tag LOCUS_14540 5026 4028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222536.1 protein_id gnl|my_center|LOCUS_14540 <5769 5023 gene locus_tag LOCUS_14550 <5769 5023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222535.1:ABC transporter substrate-binding protein >Feature sequence0185 1028 129 gene locus_tag LOCUS_14560 1028 129 CDS product putative heme/hemin ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701302.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14560 2715 1309 gene locus_tag LOCUS_14570 2715 1309 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_14570 2936 2712 gene locus_tag LOCUS_14580 2936 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3435 2974 gene locus_tag LOCUS_14590 3435 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3797 3432 gene locus_tag LOCUS_14600 3797 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 4111 3797 gene locus_tag LOCUS_14610 4111 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4740 4108 gene locus_tag LOCUS_14620 gene nthA 4740 4108 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087269.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence0186 1935 1324 gene locus_tag LOCUS_14630 1935 1324 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701649.1 protein_id gnl|my_center|LOCUS_14630 2046 3245 gene locus_tag LOCUS_14640 2046 3245 CDS product putative beta-ketoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701650.1 protein_id gnl|my_center|LOCUS_14640 3242 3964 gene locus_tag LOCUS_14650 3242 3964 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701651.1 protein_id gnl|my_center|LOCUS_14650 3961 4812 gene locus_tag LOCUS_14660 gene paaH 3961 4812 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 protein_id gnl|my_center|LOCUS_14660 4905 5579 gene locus_tag LOCUS_14670 4905 5579 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701653.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence0187 798 10 gene locus_tag LOCUS_14680 798 10 CDS product ABC transporter membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_14680 1634 795 gene locus_tag LOCUS_14690 1634 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2866 1631 gene locus_tag LOCUS_14700 2866 1631 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028997.1 protein_id gnl|my_center|LOCUS_14700 3012 3680 gene locus_tag LOCUS_14710 3012 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3677 4288 gene locus_tag LOCUS_14720 3677 4288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028998.1 protein_id gnl|my_center|LOCUS_14720 <5712 4260 gene locus_tag LOCUS_14730 <5712 4260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029001.1:oxidoreductase >Feature sequence0188 955 1557 gene locus_tag LOCUS_14740 955 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1554 3008 gene locus_tag LOCUS_14750 1554 3008 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_14750 3891 3013 gene locus_tag LOCUS_14760 3891 3013 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730749.1 protein_id gnl|my_center|LOCUS_14760 4317 3988 gene locus_tag LOCUS_14770 4317 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4766 4401 gene locus_tag LOCUS_14780 4766 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5246 4779 gene locus_tag LOCUS_14790 5246 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0189 1001 582 gene locus_tag LOCUS_14800 1001 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 996 1418 gene locus_tag LOCUS_14810 996 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3539 1515 gene locus_tag LOCUS_14820 gene priA 3539 1515 CDS product putative primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWT9 protein_id gnl|my_center|LOCUS_14820 4853 3639 gene locus_tag LOCUS_14830 gene metK 4853 3639 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCC8 protein_id gnl|my_center|LOCUS_14830 <5700 5034 gene locus_tag LOCUS_14840 <5700 5034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728784.1:phosphopantothenate synthase >Feature sequence0190 1331 576 gene locus_tag LOCUS_14850 1331 576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_14850 2072 1413 gene locus_tag LOCUS_14860 2072 1413 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_14860 3268 2069 gene locus_tag LOCUS_14870 3268 2069 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776061.1 protein_id gnl|my_center|LOCUS_14870 3928 3287 gene locus_tag LOCUS_14880 3928 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5060 4077 gene locus_tag LOCUS_14890 gene prs 5060 4077 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKE3 protein_id gnl|my_center|LOCUS_14890 5632 5057 gene locus_tag LOCUS_14900 5632 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence0191 699 115 gene locus_tag LOCUS_14910 699 115 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088533.1 protein_id gnl|my_center|LOCUS_14910 734 1522 gene locus_tag LOCUS_14920 734 1522 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_14920 2011 1526 gene locus_tag LOCUS_14930 2011 1526 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_14930 3306 2008 gene locus_tag LOCUS_14940 3306 2008 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726769.1 protein_id gnl|my_center|LOCUS_14940 3823 3311 gene locus_tag LOCUS_14950 3823 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700968.1 protein_id gnl|my_center|LOCUS_14950 4673 4014 gene locus_tag LOCUS_14960 4673 4014 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895059.1 protein_id gnl|my_center|LOCUS_14960 <5676 4721 gene locus_tag LOCUS_14970 <5676 4721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730326.1:acyl-CoA synthetase >Feature sequence0192 2727 2074 gene locus_tag LOCUS_14980 2727 2074 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226512.1 protein_id gnl|my_center|LOCUS_14980 3269 2811 gene locus_tag LOCUS_14990 3269 2811 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WME3 protein_id gnl|my_center|LOCUS_14990 3712 3299 gene locus_tag LOCUS_15000 3712 3299 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888035.1 protein_id gnl|my_center|LOCUS_15000 3826 4731 gene locus_tag LOCUS_15010 3826 4731 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_15010 5362 4712 gene locus_tag LOCUS_15020 5362 4712 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0193 3039 4010 gene locus_tag LOCUS_15030 3039 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228586.1 protein_id gnl|my_center|LOCUS_15030 4546 3992 gene locus_tag LOCUS_15040 4546 3992 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705560.1 protein_id gnl|my_center|LOCUS_15040 5182 4763 gene locus_tag LOCUS_15050 5182 4763 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897940.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence0194 473 1480 gene locus_tag LOCUS_15060 473 1480 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_15060 2191 1553 gene locus_tag LOCUS_15070 2191 1553 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_15070 2949 2188 gene locus_tag LOCUS_15080 gene scoA 2949 2188 CDS product putative succinyl-CoA:3-ketoacid coenzyme A transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPW5 protein_id gnl|my_center|LOCUS_15080 3058 3873 gene locus_tag LOCUS_15090 3058 3873 CDS product putative IclR-family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705105.1 protein_id gnl|my_center|LOCUS_15090 4124 3870 gene locus_tag LOCUS_15100 4124 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5099 4134 gene locus_tag LOCUS_15110 5099 4134 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0195 684 2327 gene locus_tag LOCUS_15120 684 2327 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_15120 2504 4969 gene locus_tag LOCUS_15130 2504 4969 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence0196 2265 55 gene locus_tag LOCUS_15140 2265 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3103 2504 gene locus_tag LOCUS_15150 gene wrbA 3103 2504 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_15150 3255 4433 gene locus_tag LOCUS_15160 3255 4433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_15160 5068 4463 gene locus_tag LOCUS_15170 5068 4463 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082512.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence0197 1149 676 gene locus_tag LOCUS_15180 1149 676 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728797.1 protein_id gnl|my_center|LOCUS_15180 1643 1146 gene locus_tag LOCUS_15190 gene ribH 1643 1146 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCA3 protein_id gnl|my_center|LOCUS_15190 2965 1640 gene locus_tag LOCUS_15200 gene ribBA 2965 1640 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCA4 protein_id gnl|my_center|LOCUS_15200 3649 3038 gene locus_tag LOCUS_15210 gene ribE 3649 3038 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK35 protein_id gnl|my_center|LOCUS_15210 4684 3650 gene locus_tag LOCUS_15220 4684 3650 CDS product putative bifunctional riboflavin biosynthesis protein RibG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703541.1 protein_id gnl|my_center|LOCUS_15220 5343 4681 gene locus_tag LOCUS_15230 gene rpe 5343 4681 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWU4 protein_id gnl|my_center|LOCUS_15230 >Feature sequence0198 2578 188 gene locus_tag LOCUS_15240 2578 188 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S87 protein_id gnl|my_center|LOCUS_15240 3501 2575 gene locus_tag LOCUS_15250 3501 2575 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_15250 3655 3999 gene locus_tag LOCUS_15260 3655 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4082 4699 gene locus_tag LOCUS_15270 4082 4699 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730262.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence0199 1049 261 gene locus_tag LOCUS_15280 1049 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701637.1 protein_id gnl|my_center|LOCUS_15280 2239 1046 gene locus_tag LOCUS_15290 2239 1046 CDS product putative homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701638.1 protein_id gnl|my_center|LOCUS_15290 2838 2311 gene locus_tag LOCUS_15300 2838 2311 CDS product putative HTH-type transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701639.1 protein_id gnl|my_center|LOCUS_15300 2932 3141 gene locus_tag LOCUS_15310 2932 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3511 3113 gene locus_tag LOCUS_15320 3511 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3595 4047 gene locus_tag LOCUS_15330 3595 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4244 5125 gene locus_tag LOCUS_15340 4244 5125 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223360.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence0200 1885 569 gene locus_tag LOCUS_15350 1885 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223807.1 protein_id gnl|my_center|LOCUS_15350 2785 1976 gene locus_tag LOCUS_15360 2785 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4558 2960 gene locus_tag LOCUS_15370 4558 2960 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730708.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0201 1355 330 gene locus_tag LOCUS_15380 1355 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703626.1 protein_id gnl|my_center|LOCUS_15380 2479 1355 gene locus_tag LOCUS_15390 gene pimA 2479 1355 CDS product phosphatidyl-myo-inositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWG6 protein_id gnl|my_center|LOCUS_15390 3381 2476 gene locus_tag LOCUS_15400 3381 2476 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMB5 protein_id gnl|my_center|LOCUS_15400 4061 3378 gene locus_tag LOCUS_15410 4061 3378 CDS product putative phosphatidylinositol synthase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703629.1 protein_id gnl|my_center|LOCUS_15410 4641 4087 gene locus_tag LOCUS_15420 4641 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703630.1 protein_id gnl|my_center|LOCUS_15420 <5524 4643 gene locus_tag LOCUS_15430 <5524 4643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QWG2:threonine--tRNA ligase >Feature sequence0202 327 1298 gene locus_tag LOCUS_15440 gene truB 327 1298 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD72 protein_id gnl|my_center|LOCUS_15440 2112 1342 gene locus_tag LOCUS_15450 2112 1342 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_15450 2968 2096 gene locus_tag LOCUS_15460 2968 2096 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_15460 3769 2972 gene locus_tag LOCUS_15470 3769 2972 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 protein_id gnl|my_center|LOCUS_15470 4595 3795 gene locus_tag LOCUS_15480 4595 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0203 <1 819 gene locus_tag LOCUS_15490 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404801.1:bifunctional 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase/cyclase/dehydrase 1619 846 gene locus_tag LOCUS_15500 1619 846 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973953.1 protein_id gnl|my_center|LOCUS_15500 3112 1637 gene locus_tag LOCUS_15510 3112 1637 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704845.1 protein_id gnl|my_center|LOCUS_15510 3198 3599 gene locus_tag LOCUS_15520 3198 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4527 3796 gene locus_tag LOCUS_15530 4527 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence0204 1540 734 gene locus_tag LOCUS_15540 gene tsnR 1540 734 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_15540 1968 1579 gene locus_tag LOCUS_15550 gene rplT 1968 1579 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAY3 protein_id gnl|my_center|LOCUS_15550 2249 2055 gene locus_tag LOCUS_15560 gene rpmI 2249 2055 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAY2 protein_id gnl|my_center|LOCUS_15560 3109 2366 gene locus_tag LOCUS_15570 gene infC 3109 2366 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYU8 protein_id gnl|my_center|LOCUS_15570 3486 3866 gene locus_tag LOCUS_15580 3486 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 protein_id gnl|my_center|LOCUS_15580 <5470 3948 gene locus_tag LOCUS_15590 <5470 3948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MAX5:UvrABC system protein A >Feature sequence0205 153 1034 gene locus_tag LOCUS_15600 153 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1031 2020 gene locus_tag LOCUS_15610 1031 2020 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729306.1 protein_id gnl|my_center|LOCUS_15610 2175 2327 gene locus_tag LOCUS_15620 2175 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2329 3156 gene locus_tag LOCUS_15630 2329 3156 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729305.1 protein_id gnl|my_center|LOCUS_15630 3153 4118 gene locus_tag LOCUS_15640 gene nadK 3153 4118 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB20 protein_id gnl|my_center|LOCUS_15640 >Feature sequence0206 <1 618 gene locus_tag LOCUS_15650 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727438.1:geranylgeranyl pyrophosphate synthase 706 1575 gene locus_tag LOCUS_15660 gene htpX 706 1575 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHC0 protein_id gnl|my_center|LOCUS_15660 2142 1642 gene locus_tag LOCUS_15670 2142 1642 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRM0 protein_id gnl|my_center|LOCUS_15670 2318 2401 gene locus_tag LOCUS_t00060 2318 2401 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2584 2657 gene locus_tag LOCUS_t00070 2584 2657 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2720 2793 gene locus_tag LOCUS_t00080 2720 2793 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2874 3041 gene locus_tag LOCUS_15680 gene rpmG2 2874 3041 CDS product 50S ribosomal protein L33 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH95 protein_id gnl|my_center|LOCUS_15680 3179 3691 gene locus_tag LOCUS_15690 3179 3691 CDS product UPF0336 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QS40 protein_id gnl|my_center|LOCUS_15690 3678 4103 gene locus_tag LOCUS_15700 3678 4103 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892730.1 protein_id gnl|my_center|LOCUS_15700 4293 4367 gene locus_tag LOCUS_t00090 4293 4367 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4597 4866 gene locus_tag LOCUS_15710 4597 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0207 <1 632 gene locus_tag LOCUS_15720 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730070.1:MFS transporter 725 2437 gene locus_tag LOCUS_15730 725 2437 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_15730 2442 3167 gene locus_tag LOCUS_15740 2442 3167 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089879.1 protein_id gnl|my_center|LOCUS_15740 5113 3284 gene locus_tag LOCUS_15750 5113 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence0208 2062 2391 gene locus_tag LOCUS_15760 2062 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2396 3487 gene locus_tag LOCUS_15770 2396 3487 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731644.1 protein_id gnl|my_center|LOCUS_15770 3513 4202 gene locus_tag LOCUS_15780 3513 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0209 671 252 gene locus_tag LOCUS_15790 671 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729674.1 protein_id gnl|my_center|LOCUS_15790 1854 715 gene locus_tag LOCUS_15800 1854 715 CDS product putative arsenite-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702718.1 protein_id gnl|my_center|LOCUS_15800 2405 1971 gene locus_tag LOCUS_15810 2405 1971 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_15810 2931 2539 gene locus_tag LOCUS_15820 2931 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702715.1 protein_id gnl|my_center|LOCUS_15820 3065 4870 gene locus_tag LOCUS_15830 3065 4870 CDS product putative long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702714.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence0210 >Feature sequence0211 274 20 gene locus_tag LOCUS_15840 274 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1809 271 gene locus_tag LOCUS_15850 1809 271 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_15850 1840 2523 gene locus_tag LOCUS_15860 gene aroH 1840 2523 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AN1 protein_id gnl|my_center|LOCUS_15860 2769 4394 gene locus_tag LOCUS_15870 gene rnj 2769 4394 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MA07 protein_id gnl|my_center|LOCUS_15870 4809 4405 gene locus_tag LOCUS_15880 4809 4405 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892834.1 protein_id gnl|my_center|LOCUS_15880 <5357 4844 gene locus_tag LOCUS_15890 <5357 4844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727675.1:sodium-independent anion transporter >Feature sequence0212 1748 2116 gene locus_tag LOCUS_15900 1748 2116 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901716.1 protein_id gnl|my_center|LOCUS_15900 2873 2232 gene locus_tag LOCUS_15910 2873 2232 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_15910 4220 2970 gene locus_tag LOCUS_15920 4220 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701903.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence0213 <1 912 gene locus_tag LOCUS_15930 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407926.1:lipase 1343 918 gene locus_tag LOCUS_15940 1343 918 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897128.1 protein_id gnl|my_center|LOCUS_15940 1435 2160 gene locus_tag LOCUS_15950 1435 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2231 2734 gene locus_tag LOCUS_15960 2231 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3994 2756 gene locus_tag LOCUS_15970 3994 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4335 4568 gene locus_tag LOCUS_15980 4335 4568 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727581.1 protein_id gnl|my_center|LOCUS_15980 <5332 4786 gene locus_tag LOCUS_15990 <5332 4786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230982.1:short chain dehydrogenase >Feature sequence0214 971 612 gene locus_tag LOCUS_16000 gene rsfB 971 612 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5B0 protein_id gnl|my_center|LOCUS_16000 2370 1039 gene locus_tag LOCUS_16010 2370 1039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_16010 2965 2510 gene locus_tag LOCUS_16020 2965 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229817.1 protein_id gnl|my_center|LOCUS_16020 3994 3032 gene locus_tag LOCUS_16030 3994 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 <5331 4420 gene locus_tag LOCUS_16040 <5331 4420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888568.1:transcriptional regulator >Feature sequence0215 736 1203 gene locus_tag LOCUS_16050 736 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1196 1990 gene locus_tag LOCUS_16060 1196 1990 CDS product heparin-binding hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704810.1 protein_id gnl|my_center|LOCUS_16060 2058 2348 gene locus_tag LOCUS_16070 2058 2348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727289.1 protein_id gnl|my_center|LOCUS_16070 2429 3454 gene locus_tag LOCUS_16080 2429 3454 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_16080 4349 3465 gene locus_tag LOCUS_16090 gene purU 4349 3465 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUI8 protein_id gnl|my_center|LOCUS_16090 5205 4363 gene locus_tag LOCUS_16100 5205 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence0216 119 1111 gene locus_tag LOCUS_16110 gene bioB 119 1111 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBZ3 protein_id gnl|my_center|LOCUS_16110 1359 1961 gene locus_tag LOCUS_16120 1359 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2685 1975 gene locus_tag LOCUS_16130 2685 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703409.1 protein_id gnl|my_center|LOCUS_16130 2753 3811 gene locus_tag LOCUS_16140 gene nadA 2753 3811 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBY3 protein_id gnl|my_center|LOCUS_16140 >Feature sequence0217 1180 515 gene locus_tag LOCUS_16150 gene tmk 1180 515 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF63 protein_id gnl|my_center|LOCUS_16150 2682 1198 gene locus_tag LOCUS_16160 gene ahcY 2682 1198 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF64 protein_id gnl|my_center|LOCUS_16160 4032 2803 gene locus_tag LOCUS_16170 4032 2803 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_16170 <5319 4206 gene locus_tag LOCUS_16180 <5319 4206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229745.1:amino acid permease >Feature sequence0218 275 2779 gene locus_tag LOCUS_16190 275 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2932 4740 gene locus_tag LOCUS_16200 2932 4740 CDS product isoniazid-inducible protein iniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727126.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence0219 762 145 gene locus_tag LOCUS_16210 762 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1508 807 gene locus_tag LOCUS_16220 1508 807 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729715.1 protein_id gnl|my_center|LOCUS_16220 1696 3243 gene locus_tag LOCUS_16230 1696 3243 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728208.1 protein_id gnl|my_center|LOCUS_16230 3250 4032 gene locus_tag LOCUS_16240 3250 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704818.1 protein_id gnl|my_center|LOCUS_16240 4029 4655 gene locus_tag LOCUS_16250 4029 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704819.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence0220 389 721 gene locus_tag LOCUS_16260 389 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702950.1 protein_id gnl|my_center|LOCUS_16260 863 1318 gene locus_tag LOCUS_16270 863 1318 CDS product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_16270 1522 3159 gene locus_tag LOCUS_16280 1522 3159 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_16280 4809 3211 gene locus_tag LOCUS_16290 4809 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0221 3037 3822 gene locus_tag LOCUS_16300 3037 3822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728027.1 protein_id gnl|my_center|LOCUS_16300 3823 4164 gene locus_tag LOCUS_16310 3823 4164 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416847.1 protein_id gnl|my_center|LOCUS_16310 4161 4607 gene locus_tag LOCUS_16320 4161 4607 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895083.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence0222 <1 1255 gene locus_tag LOCUS_16330 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_600753.1:cell wall-associated hydrolase 1426 2841 gene locus_tag LOCUS_16340 1426 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2838 3824 gene locus_tag LOCUS_16350 2838 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64854 protein_id gnl|my_center|LOCUS_16350 3821 4819 gene locus_tag LOCUS_16360 3821 4819 CDS product UPF0353 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX26 protein_id gnl|my_center|LOCUS_16360 >Feature sequence0223 1743 2093 gene locus_tag LOCUS_16370 1743 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2258 2956 gene locus_tag LOCUS_16380 2258 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3462 2953 gene locus_tag LOCUS_16390 3462 2953 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_16390 4385 3459 gene locus_tag LOCUS_16400 4385 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4448 5122 gene locus_tag LOCUS_16410 4448 5122 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727552.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence0224 2049 556 gene locus_tag LOCUS_16420 gene mmsA 2049 556 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_16420 2161 3063 gene locus_tag LOCUS_16430 2161 3063 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892779.1 protein_id gnl|my_center|LOCUS_16430 3437 4405 gene locus_tag LOCUS_16440 gene cobD 3437 4405 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0A0 protein_id gnl|my_center|LOCUS_16440 <5223 4346 gene locus_tag LOCUS_16450 <5223 4346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R099:SURF1-like protein >Feature sequence0225 2289 1357 gene locus_tag LOCUS_16460 gene thrB 2289 1357 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLU6 protein_id gnl|my_center|LOCUS_16460 3376 2309 gene locus_tag LOCUS_16470 3376 2309 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLU5 protein_id gnl|my_center|LOCUS_16470 4674 3373 gene locus_tag LOCUS_16480 4674 3373 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R221 protein_id gnl|my_center|LOCUS_16480 <5220 4671 gene locus_tag LOCUS_16490 <5220 4671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MLU3:diaminopimelate decarboxylase >Feature sequence0226 <1 1154 gene locus_tag LOCUS_16500 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCD8:dihydroorotase 1159 1665 gene locus_tag LOCUS_16510 1159 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703562.1 protein_id gnl|my_center|LOCUS_16510 1662 2792 gene locus_tag LOCUS_16520 gene carA 1662 2792 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCD6 protein_id gnl|my_center|LOCUS_16520 >Feature sequence0227 572 357 gene locus_tag LOCUS_16530 572 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 858 601 gene locus_tag LOCUS_16540 858 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1117 947 gene locus_tag LOCUS_16550 1117 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2038 1232 gene locus_tag LOCUS_16560 2038 1232 CDS product putative transglutaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705032.1 protein_id gnl|my_center|LOCUS_16560 3142 2123 gene locus_tag LOCUS_16570 3142 2123 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 protein_id gnl|my_center|LOCUS_16570 3793 3224 gene locus_tag LOCUS_16580 3793 3224 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227158.1 protein_id gnl|my_center|LOCUS_16580 3899 5041 gene locus_tag LOCUS_16590 3899 5041 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0228 <1 793 gene locus_tag LOCUS_16600 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701974.1:putative cholesterol oxidase ChoD 793 1428 gene locus_tag LOCUS_16610 793 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1603 3135 gene locus_tag LOCUS_16620 1603 3135 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFQ0 protein_id gnl|my_center|LOCUS_16620 3229 3747 gene locus_tag LOCUS_16630 gene dps 3229 3747 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230585.1 protein_id gnl|my_center|LOCUS_16630 3861 4520 gene locus_tag LOCUS_16640 3861 4520 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0229 <1 1248 gene locus_tag LOCUS_16650 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893059.1:bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase 1245 2390 gene locus_tag LOCUS_16660 gene metX 1245 2390 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSZ0 protein_id gnl|my_center|LOCUS_16660 2656 2411 gene locus_tag LOCUS_16670 2656 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3596 2739 gene locus_tag LOCUS_16680 gene folD 3596 2739 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG21 protein_id gnl|my_center|LOCUS_16680 4252 3653 gene locus_tag LOCUS_16690 gene mfpA 4252 3653 CDS product pentapeptide repeat protein MfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSY0 protein_id gnl|my_center|LOCUS_16690 4307 4759 gene locus_tag LOCUS_16700 4307 4759 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSX5 protein_id gnl|my_center|LOCUS_16700 >Feature sequence0230 1081 710 gene locus_tag LOCUS_16710 1081 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1005 1925 gene locus_tag LOCUS_16720 1005 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1936 3021 gene locus_tag LOCUS_16730 gene dapE 1936 3021 CDS product putative succinyl-diaminopimelate desuccinylase DapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHS9 protein_id gnl|my_center|LOCUS_16730 3032 3802 gene locus_tag LOCUS_16740 3032 3802 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CY58 protein_id gnl|my_center|LOCUS_16740 3799 4362 gene locus_tag LOCUS_16750 3799 4362 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2E9 protein_id gnl|my_center|LOCUS_16750 >Feature sequence0231 1861 251 gene locus_tag LOCUS_16760 1861 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701284.1 protein_id gnl|my_center|LOCUS_16760 3641 2010 gene locus_tag LOCUS_16770 3641 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701284.1 protein_id gnl|my_center|LOCUS_16770 4092 3688 gene locus_tag LOCUS_16780 4092 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701712.1 protein_id gnl|my_center|LOCUS_16780 <5150 4177 gene locus_tag LOCUS_16790 <5150 4177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730355.1:cation acetate symporter >Feature sequence0232 2166 415 gene locus_tag LOCUS_16800 2166 415 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_16800 2957 2715 gene locus_tag LOCUS_16810 2957 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3311 3126 gene locus_tag LOCUS_16820 3311 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3387 3851 gene locus_tag LOCUS_16830 3387 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4309 3905 gene locus_tag LOCUS_16840 4309 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence0233 1544 636 gene locus_tag LOCUS_16850 1544 636 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973952.1 protein_id gnl|my_center|LOCUS_16850 3130 1886 gene locus_tag LOCUS_16860 3130 1886 CDS product hemin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727613.1 protein_id gnl|my_center|LOCUS_16860 3612 3172 gene locus_tag LOCUS_16870 3612 3172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727612.1 protein_id gnl|my_center|LOCUS_16870 3885 4229 gene locus_tag LOCUS_16880 3885 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4468 4202 gene locus_tag LOCUS_16890 4468 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLS3 protein_id gnl|my_center|LOCUS_16890 <5114 4524 gene locus_tag LOCUS_16900 <5114 4524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227298.1:universal stress protein >Feature sequence0234 841 2361 gene locus_tag LOCUS_16910 gene mqo 841 2361 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVL2 protein_id gnl|my_center|LOCUS_16910 2358 2849 gene locus_tag LOCUS_16920 2358 2849 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728473.1 protein_id gnl|my_center|LOCUS_16920 3082 5019 gene locus_tag LOCUS_16930 3082 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence0235 1045 287 gene locus_tag LOCUS_16940 gene trmB 1045 287 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QP29 protein_id gnl|my_center|LOCUS_16940 1293 2375 gene locus_tag LOCUS_16950 1293 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2342 3922 gene locus_tag LOCUS_16960 2342 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3981 4283 gene locus_tag LOCUS_16970 3981 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence0236 1527 352 gene locus_tag LOCUS_16980 1527 352 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971922.1 protein_id gnl|my_center|LOCUS_16980 2281 1619 gene locus_tag LOCUS_16990 2281 1619 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224249.1 protein_id gnl|my_center|LOCUS_16990 2646 2458 gene locus_tag LOCUS_17000 2646 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3171 2809 gene locus_tag LOCUS_17010 3171 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4385 3171 gene locus_tag LOCUS_17020 4385 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence0237 1067 994 gene locus_tag LOCUS_t00100 1067 994 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1211 1495 gene locus_tag LOCUS_17030 1211 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702448.1 protein_id gnl|my_center|LOCUS_17030 3408 1492 gene locus_tag LOCUS_17040 gene dnaG 3408 1492 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN81 protein_id gnl|my_center|LOCUS_17040 4725 3451 gene locus_tag LOCUS_17050 4725 3451 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN80 protein_id gnl|my_center|LOCUS_17050 >Feature sequence0238 1315 350 gene locus_tag LOCUS_17060 1315 350 CDS product putative histidine kinase sensor of two-component system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702460.1 protein_id gnl|my_center|LOCUS_17060 1995 1321 gene locus_tag LOCUS_17070 1995 1321 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_17070 2164 3186 gene locus_tag LOCUS_17080 2164 3186 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401373.1 protein_id gnl|my_center|LOCUS_17080 4440 3190 gene locus_tag LOCUS_17090 4440 3190 CDS product putative permease of the major facilitator superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702169.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence0239 464 2950 gene locus_tag LOCUS_17100 gene pheT 464 2950 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYT3 protein_id gnl|my_center|LOCUS_17100 3020 3574 gene locus_tag LOCUS_17110 3020 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3627 4682 gene locus_tag LOCUS_17120 gene argC 3627 4682 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYT2 protein_id gnl|my_center|LOCUS_17120 >Feature sequence0240 1969 935 gene locus_tag LOCUS_17130 1969 935 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_17130 2086 3111 gene locus_tag LOCUS_17140 2086 3111 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896980.1 protein_id gnl|my_center|LOCUS_17140 3108 4460 gene locus_tag LOCUS_17150 3108 4460 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896979.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence0241 <1 1304 gene locus_tag LOCUS_17160 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705165.1:putative oxidoreductase 2247 1306 gene locus_tag LOCUS_17170 2247 1306 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Y4 protein_id gnl|my_center|LOCUS_17170 3058 2258 gene locus_tag LOCUS_17180 gene paaG 3058 2258 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226875.1 protein_id gnl|my_center|LOCUS_17180 3136 4281 gene locus_tag LOCUS_17190 3136 4281 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700819.1 protein_id gnl|my_center|LOCUS_17190 <5049 4334 gene locus_tag LOCUS_17200 <5049 4334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730278.1:MFS transporter >Feature sequence0242 2 634 gene locus_tag LOCUS_17210 2 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1440 631 gene locus_tag LOCUS_17220 1440 631 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 protein_id gnl|my_center|LOCUS_17220 2183 1407 gene locus_tag LOCUS_17230 2183 1407 CDS product putative hydrolase, alpha/beta fold family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701307.1 protein_id gnl|my_center|LOCUS_17230 2220 2531 gene locus_tag LOCUS_17240 2220 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701306.1 protein_id gnl|my_center|LOCUS_17240 4842 2548 gene locus_tag LOCUS_17250 4842 2548 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063994.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0243 221 685 gene locus_tag LOCUS_17260 221 685 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_17260 773 1042 gene locus_tag LOCUS_17270 773 1042 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 protein_id gnl|my_center|LOCUS_17270 1182 1898 gene locus_tag LOCUS_17280 gene psd 1182 1898 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH53 protein_id gnl|my_center|LOCUS_17280 1906 2760 gene locus_tag LOCUS_17290 1906 2760 CDS product putative CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701390.1 protein_id gnl|my_center|LOCUS_17290 2782 4965 gene locus_tag LOCUS_17300 2782 4965 CDS product putative conserved ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701389.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence0244 2029 989 gene locus_tag LOCUS_17310 2029 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A573 protein_id gnl|my_center|LOCUS_17310 3199 2255 gene locus_tag LOCUS_17320 3199 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703765.1 protein_id gnl|my_center|LOCUS_17320 4784 3381 gene locus_tag LOCUS_17330 4784 3381 CDS product putative soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703764.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence0245 <1 1041 gene locus_tag LOCUS_17340 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723717.1:MFS transporter 1775 1053 gene locus_tag LOCUS_17350 1775 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228008.1 protein_id gnl|my_center|LOCUS_17350 1886 2353 gene locus_tag LOCUS_17360 1886 2353 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_17360 2457 4253 gene locus_tag LOCUS_17370 2457 4253 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_17370 4250 4600 gene locus_tag LOCUS_17380 4250 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0246 <1 1385 gene locus_tag LOCUS_17390 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MIX5:chaperone protein DnaK 1382 2041 gene locus_tag LOCUS_17400 gene grpE 1382 2041 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQC9 protein_id gnl|my_center|LOCUS_17400 2073 3248 gene locus_tag LOCUS_17410 gene dnaJ 2073 3248 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIX3 protein_id gnl|my_center|LOCUS_17410 3248 3664 gene locus_tag LOCUS_17420 3248 3664 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230871.1 protein_id gnl|my_center|LOCUS_17420 3897 4586 gene locus_tag LOCUS_17430 3897 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0247 2000 540 gene locus_tag LOCUS_17440 gene murD 2000 540 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R018 protein_id gnl|my_center|LOCUS_17440 3089 2004 gene locus_tag LOCUS_17450 gene mraY 3089 2004 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP34 protein_id gnl|my_center|LOCUS_17450 4636 3086 gene locus_tag LOCUS_17460 gene murF 4636 3086 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP33 protein_id gnl|my_center|LOCUS_17460 >Feature sequence0248 >Feature sequence0249 3043 611 gene locus_tag LOCUS_17470 3043 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_17470 3627 3052 gene locus_tag LOCUS_17480 3627 3052 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 protein_id gnl|my_center|LOCUS_17480 4468 3665 gene locus_tag LOCUS_17490 4468 3665 CDS product putative transglutaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705032.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence0250 698 66 gene locus_tag LOCUS_17500 698 66 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 protein_id gnl|my_center|LOCUS_17500 821 1771 gene locus_tag LOCUS_17510 821 1771 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063674.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence0251 857 1750 gene locus_tag LOCUS_17520 857 1750 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 protein_id gnl|my_center|LOCUS_17520 2796 1762 gene locus_tag LOCUS_17530 2796 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703601.1 protein_id gnl|my_center|LOCUS_17530 2919 3389 gene locus_tag LOCUS_17540 2919 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4041 3403 gene locus_tag LOCUS_17550 4041 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 <4949 4031 gene locus_tag LOCUS_17560 <4949 4031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P67484:histidine--tRNA ligase >Feature sequence0252 489 1550 gene locus_tag LOCUS_17570 gene fepG 489 1550 CDS product iron-enterobactin transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_17570 1547 2356 gene locus_tag LOCUS_17580 gene fepC 1547 2356 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817187.1 protein_id gnl|my_center|LOCUS_17580 2436 3329 gene locus_tag LOCUS_17590 2436 3329 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974569.1 protein_id gnl|my_center|LOCUS_17590 4519 3326 gene locus_tag LOCUS_17600 4519 3326 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266181.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence0253 152 499 gene locus_tag LOCUS_17610 152 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 657 1877 gene locus_tag LOCUS_17620 657 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2508 1984 gene locus_tag LOCUS_17630 2508 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17630 2768 3589 gene locus_tag LOCUS_17640 2768 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3586 4266 gene locus_tag LOCUS_17650 3586 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence0254 370 969 gene locus_tag LOCUS_17660 gene yoaZ 370 969 CDS product putative protease YoaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34947 protein_id gnl|my_center|LOCUS_17660 966 1430 gene locus_tag LOCUS_17670 966 1430 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709522.1 protein_id gnl|my_center|LOCUS_17670 1438 2691 gene locus_tag LOCUS_17680 1438 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2715 3719 gene locus_tag LOCUS_17690 2715 3719 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence0255 915 223 gene locus_tag LOCUS_17700 915 223 CDS product putative transcriptional regulator, GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703007.1 protein_id gnl|my_center|LOCUS_17700 1014 2255 gene locus_tag LOCUS_17710 1014 2255 CDS product putative MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703008.1 protein_id gnl|my_center|LOCUS_17710 2396 3883 gene locus_tag LOCUS_17720 2396 3883 CDS product putative integral membrane nitrite extrusion protein NarK3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704253.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence0256 <1 536 gene locus_tag LOCUS_17730 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223643.1:gamma carbonic anhydrase family protein 533 1225 gene locus_tag LOCUS_17740 gene ung 533 1225 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV01 protein_id gnl|my_center|LOCUS_17740 2025 1231 gene locus_tag LOCUS_17750 2025 1231 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704011.1 protein_id gnl|my_center|LOCUS_17750 2362 2171 gene locus_tag LOCUS_17760 gene rpmB 2362 2171 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CY37 protein_id gnl|my_center|LOCUS_17760 2399 2569 gene locus_tag LOCUS_17770 2399 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2646 4313 gene locus_tag LOCUS_17780 2646 4313 CDS product putative phosphatase/kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704009.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence0257 277 1239 gene locus_tag LOCUS_17790 277 1239 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_17790 3685 1268 gene locus_tag LOCUS_17800 3685 1268 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972413.1 protein_id gnl|my_center|LOCUS_17800 4686 3682 gene locus_tag LOCUS_17810 4686 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence0258 499 1107 gene locus_tag LOCUS_17820 499 1107 CDS product DUF1211 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225289.1 protein_id gnl|my_center|LOCUS_17820 1104 1877 gene locus_tag LOCUS_17830 1104 1877 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728097.1 protein_id gnl|my_center|LOCUS_17830 2854 1865 gene locus_tag LOCUS_17840 2854 1865 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_17840 3774 2851 gene locus_tag LOCUS_17850 3774 2851 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728096.1 protein_id gnl|my_center|LOCUS_17850 <4893 3775 gene locus_tag LOCUS_17860 <4893 3775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728095.1:CoA transferase >Feature sequence0259 328 401 gene locus_tag LOCUS_t00110 328 401 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 520 1650 gene locus_tag LOCUS_17870 520 1650 CDS product putative prophage phiRv2 integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMB3 protein_id gnl|my_center|LOCUS_17870 2020 1655 gene locus_tag LOCUS_17880 2020 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2220 2537 gene locus_tag LOCUS_17890 2220 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3060 2572 gene locus_tag LOCUS_17900 3060 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3195 4619 gene locus_tag LOCUS_17910 3195 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence0260 >Feature sequence0261 79 930 gene locus_tag LOCUS_17920 79 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 protein_id gnl|my_center|LOCUS_17920 987 1418 gene locus_tag LOCUS_17930 987 1418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_17930 1424 2608 gene locus_tag LOCUS_17940 1424 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703451.1 protein_id gnl|my_center|LOCUS_17940 3118 2609 gene locus_tag LOCUS_17950 3118 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3714 3115 gene locus_tag LOCUS_17960 3714 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 protein_id gnl|my_center|LOCUS_17960 4471 3746 gene locus_tag LOCUS_17970 4471 3746 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728856.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence0262 3371 2694 gene locus_tag LOCUS_17980 3371 2694 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729228.1 protein_id gnl|my_center|LOCUS_17980 4120 3647 gene locus_tag LOCUS_17990 4120 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895101.1 protein_id gnl|my_center|LOCUS_17990 <4873 4218 gene locus_tag LOCUS_18000 <4873 4218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226818.1:MerR family transcriptional regulator >Feature sequence0263 <1 1196 gene locus_tag LOCUS_18010 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CXW1:glycerol kinase 1193 2899 gene locus_tag LOCUS_18020 1193 2899 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R730 protein_id gnl|my_center|LOCUS_18020 3058 4581 gene locus_tag LOCUS_18030 3058 4581 CDS product putative phosphodiesterase/alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704477.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence0264 <1 661 gene locus_tag LOCUS_18040 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MF88:N5-carboxyaminoimidazole ribonucleotide synthase 654 1166 gene locus_tag LOCUS_18050 gene purE 654 1166 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTF3 protein_id gnl|my_center|LOCUS_18050 1163 1552 gene locus_tag LOCUS_18060 1163 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2272 1562 gene locus_tag LOCUS_18070 2272 1562 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 protein_id gnl|my_center|LOCUS_18070 3731 2328 gene locus_tag LOCUS_18080 3731 2328 CDS product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727933.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence0265 416 3817 gene locus_tag LOCUS_18090 416 3817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726778.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence0266 1552 971 gene locus_tag LOCUS_18100 1552 971 CDS product RNA polymerase sigma factor ShbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727765.1 protein_id gnl|my_center|LOCUS_18100 1749 2696 gene locus_tag LOCUS_18110 1749 2696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727748.1 protein_id gnl|my_center|LOCUS_18110 3438 2764 gene locus_tag LOCUS_18120 3438 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 <4813 3631 gene locus_tag LOCUS_18130 <4813 3631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MFQ4:ammonium transporter >Feature sequence0267 3 548 gene locus_tag LOCUS_18140 3 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 939 598 gene locus_tag LOCUS_18150 939 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 protein_id gnl|my_center|LOCUS_18150 1318 3096 gene locus_tag LOCUS_18160 1318 3096 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNX6 protein_id gnl|my_center|LOCUS_18160 3246 4136 gene locus_tag LOCUS_18170 3246 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702680.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence0268 311 383 gene locus_tag LOCUS_t00120 311 383 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 482 555 gene locus_tag LOCUS_t00130 482 555 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 813 646 gene locus_tag LOCUS_18180 813 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A089QKZ7 protein_id gnl|my_center|LOCUS_18180 1663 935 gene locus_tag LOCUS_18190 1663 935 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 protein_id gnl|my_center|LOCUS_18190 1809 3263 gene locus_tag LOCUS_18200 gene leuC 1809 3263 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_18200 3311 3928 gene locus_tag LOCUS_18210 gene leuD 3311 3928 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUZ0 protein_id gnl|my_center|LOCUS_18210 4606 4741 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccaagaaggctccggccaaga >Feature sequence0269 2464 1232 gene locus_tag LOCUS_18220 2464 1232 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 protein_id gnl|my_center|LOCUS_18220 2677 2919 gene locus_tag LOCUS_18230 2677 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 <4767 2922 gene locus_tag LOCUS_18240 <4767 2922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701062.1:DNA polymerase III, subunit gamma/tau >Feature sequence0270 1827 412 gene locus_tag LOCUS_18250 1827 412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730982.1 protein_id gnl|my_center|LOCUS_18250 1934 2875 gene locus_tag LOCUS_18260 1934 2875 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730983.1 protein_id gnl|my_center|LOCUS_18260 2889 3635 gene locus_tag LOCUS_18270 2889 3635 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976167.1 protein_id gnl|my_center|LOCUS_18270 4266 3649 gene locus_tag LOCUS_18280 4266 3649 CDS product deaminase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031810.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence0271 <1 1223 gene locus_tag LOCUS_18290 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MDJ5:bifunctional uridylyltransferase/uridylyl-removing enzyme note possible pseudo, frameshifted 1256 1975 gene locus_tag LOCUS_18300 1256 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18300 2178 3137 gene locus_tag LOCUS_18310 2178 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence0272 807 619 gene locus_tag LOCUS_18320 807 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 881 1420 gene locus_tag LOCUS_18330 881 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2673 1393 gene locus_tag LOCUS_18340 gene rpoE 2673 1393 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 protein_id gnl|my_center|LOCUS_18340 3034 2690 gene locus_tag LOCUS_18350 3034 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223907.1 protein_id gnl|my_center|LOCUS_18350 4447 3227 gene locus_tag LOCUS_18360 4447 3227 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728136.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence0273 254 1987 gene locus_tag LOCUS_18370 254 1987 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_18370 1984 3924 gene locus_tag LOCUS_18380 1984 3924 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence0274 739 969 gene locus_tag LOCUS_18390 739 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1406 2428 gene locus_tag LOCUS_18400 1406 2428 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_18400 2429 3322 gene locus_tag LOCUS_18410 2429 3322 CDS product putative sulfate ABC transporter, permease protein CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702392.1 protein_id gnl|my_center|LOCUS_18410 3319 4119 gene locus_tag LOCUS_18420 3319 4119 CDS product putative sulfate ABC transporter, permease protein CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702393.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence0275 1557 535 gene locus_tag LOCUS_18430 gene asd 1557 535 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5N7 protein_id gnl|my_center|LOCUS_18430 2825 1560 gene locus_tag LOCUS_18440 2825 1560 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFP2 protein_id gnl|my_center|LOCUS_18440 3010 4650 gene locus_tag LOCUS_18450 3010 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703003.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence0276 1424 384 gene locus_tag LOCUS_18460 gene glpX 1424 384 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2U7 protein_id gnl|my_center|LOCUS_18460 1560 2129 gene locus_tag LOCUS_18470 1560 2129 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730406.1 protein_id gnl|my_center|LOCUS_18470 2350 2126 gene locus_tag LOCUS_18480 gene xseB 2350 2126 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2T5 protein_id gnl|my_center|LOCUS_18480 3642 2380 gene locus_tag LOCUS_18490 gene xseA 3642 2380 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKQ1 protein_id gnl|my_center|LOCUS_18490 4256 3639 gene locus_tag LOCUS_18500 4256 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730397.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence0277 1673 30 gene locus_tag LOCUS_18510 1673 30 CDS product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_18510 2475 1699 gene locus_tag LOCUS_18520 gene eutC 2475 1699 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSP7 protein_id gnl|my_center|LOCUS_18520 3884 2472 gene locus_tag LOCUS_18530 gene eutB 3884 2472 CDS product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892941.1 protein_id gnl|my_center|LOCUS_18530 <4714 3881 gene locus_tag LOCUS_18540 <4714 3881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727732.1:ethanolamine permease >Feature sequence0278 607 389 gene locus_tag LOCUS_18550 607 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 783 2060 gene locus_tag LOCUS_18560 783 2060 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_18560 2133 3017 gene locus_tag LOCUS_18570 2133 3017 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_18570 3014 4105 gene locus_tag LOCUS_18580 3014 4105 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence0279 2618 297 gene locus_tag LOCUS_18590 2618 297 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728553.1 protein_id gnl|my_center|LOCUS_18590 3319 2615 gene locus_tag LOCUS_18600 3319 2615 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230405.1 protein_id gnl|my_center|LOCUS_18600 4011 3316 gene locus_tag LOCUS_18610 4011 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WL45 protein_id gnl|my_center|LOCUS_18610 4703 4017 gene locus_tag LOCUS_18620 4703 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence0280 13 498 gene locus_tag LOCUS_18630 13 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 808 521 gene locus_tag LOCUS_18640 808 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1097 939 gene locus_tag LOCUS_18650 1097 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1159 1386 gene locus_tag LOCUS_18660 1159 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2084 1512 gene locus_tag LOCUS_18670 gene upp 2084 1512 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFZ1 protein_id gnl|my_center|LOCUS_18670 2339 3511 gene locus_tag LOCUS_18680 2339 3511 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728197.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence0281 <1 1578 gene locus_tag LOCUS_18690 <1 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226548.1:acyl-CoA dehydrogenase 2612 1644 gene locus_tag LOCUS_18700 2612 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4416 2767 gene locus_tag LOCUS_18710 gene pgi 4416 2767 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3N9 protein_id gnl|my_center|LOCUS_18710 >Feature sequence0282 284 493 gene locus_tag LOCUS_18720 284 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1260 1185 gene locus_tag LOCUS_t00140 1260 1185 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2741 1305 gene locus_tag LOCUS_18730 2741 1305 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407630.1 protein_id gnl|my_center|LOCUS_18730 3802 2858 gene locus_tag LOCUS_18740 3802 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701910.1 protein_id gnl|my_center|LOCUS_18740 4329 3799 gene locus_tag LOCUS_18750 4329 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18750 >Feature sequence0283 1834 824 gene locus_tag LOCUS_18760 gene rbsR 1834 824 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898179.1 protein_id gnl|my_center|LOCUS_18760 2503 1871 gene locus_tag LOCUS_18770 gene frcK 2503 1871 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_18770 3437 2511 gene locus_tag LOCUS_18780 3437 2511 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_18780 4197 3415 gene locus_tag LOCUS_18790 4197 3415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731543.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence0284 1056 2126 gene locus_tag LOCUS_18800 1056 2126 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730997.1 protein_id gnl|my_center|LOCUS_18800 <4667 2219 gene locus_tag LOCUS_18810 <4667 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701330.1:putative trehalose phosphatase >Feature sequence0285 986 648 gene locus_tag LOCUS_18820 986 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1746 1267 gene locus_tag LOCUS_18830 gene ycgE 1746 1267 CDS product putative HTH-type transcriptional regulator YcgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31472 protein_id gnl|my_center|LOCUS_18830 1840 3948 gene locus_tag LOCUS_18840 1840 3948 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727176.1 protein_id gnl|my_center|LOCUS_18840 3945 4574 gene locus_tag LOCUS_18850 3945 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence0286 162 935 gene locus_tag LOCUS_18860 162 935 CDS product putative iron compound ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701301.1 protein_id gnl|my_center|LOCUS_18860 932 1951 gene locus_tag LOCUS_18870 932 1951 CDS product putative iron compound ABC transporter, substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701300.1 protein_id gnl|my_center|LOCUS_18870 2492 2022 gene locus_tag LOCUS_18880 2492 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3109 2651 gene locus_tag LOCUS_18890 3109 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3130 3480 gene locus_tag LOCUS_18900 3130 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3768 3694 gene locus_tag LOCUS_t00150 3768 3694 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4082 3861 gene locus_tag LOCUS_18910 4082 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4161 4634 gene locus_tag LOCUS_18920 4161 4634 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence0287 <1 2407 gene locus_tag LOCUS_18930 <1 2407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702252.1:putative fatty acid synthase Fas 2407 2799 gene locus_tag LOCUS_18940 gene acpS 2407 2799 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQD3 protein_id gnl|my_center|LOCUS_18940 3593 2877 gene locus_tag LOCUS_18950 3593 2877 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015165.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence0288 216 1118 gene locus_tag LOCUS_18960 216 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1115 2122 gene locus_tag LOCUS_18970 1115 2122 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533312.1 protein_id gnl|my_center|LOCUS_18970 2765 2148 gene locus_tag LOCUS_18980 2765 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3696 3421 gene locus_tag LOCUS_18990 3696 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence0289 1431 2588 gene locus_tag LOCUS_19000 gene fabF 1431 2588 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_19000 4174 2957 gene locus_tag LOCUS_19010 gene fdh 4174 2957 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence0290 <4625 2020 gene locus_tag LOCUS_19020 <4625 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229685.1:ABC transporter >Feature sequence0291 1493 687 gene locus_tag LOCUS_19030 gene tipA 1493 687 CDS product HTH-type transcriptional activator TipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4T8 protein_id gnl|my_center|LOCUS_19030 2755 1550 gene locus_tag LOCUS_19040 2755 1550 CDS product putative lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704012.1 protein_id gnl|my_center|LOCUS_19040 2912 4465 gene locus_tag LOCUS_19050 gene gabD2 2912 4465 CDS product putative succinate-semialdehyde dehydrogenase [NADP(+)] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNX7 protein_id gnl|my_center|LOCUS_19050 >Feature sequence0292 >Feature sequence0293 185 931 gene locus_tag LOCUS_19060 185 931 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_19060 2407 914 gene locus_tag LOCUS_19070 2407 914 CDS product putative cobalamin biosynthesis protein CobI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702933.1 protein_id gnl|my_center|LOCUS_19070 3030 2404 gene locus_tag LOCUS_19080 gene cobH 3030 2404 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_19080 4194 3085 gene locus_tag LOCUS_19090 gene cobG 4194 3085 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence0294 341 1132 gene locus_tag LOCUS_19100 341 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703988.1 protein_id gnl|my_center|LOCUS_19100 1224 1832 gene locus_tag LOCUS_19110 1224 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703987.1 protein_id gnl|my_center|LOCUS_19110 1833 2015 gene locus_tag LOCUS_19120 gene rpmF 1833 2015 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D273 protein_id gnl|my_center|LOCUS_19120 2042 2824 gene locus_tag LOCUS_19130 gene rnc 2042 2824 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDL3 protein_id gnl|my_center|LOCUS_19130 2824 3690 gene locus_tag LOCUS_19140 gene fpg 2824 3690 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV21 protein_id gnl|my_center|LOCUS_19140 3740 4168 gene locus_tag LOCUS_19150 3740 4168 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893786.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence0295 425 2233 gene locus_tag LOCUS_19160 425 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2230 3804 gene locus_tag LOCUS_19170 2230 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence0296 392 1153 gene locus_tag LOCUS_19180 392 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1768 1169 gene locus_tag LOCUS_19190 1768 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2188 1913 gene locus_tag LOCUS_19200 2188 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3310 2300 gene locus_tag LOCUS_19210 3310 2300 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_19210 3566 4018 gene locus_tag LOCUS_19220 3566 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4493 3993 gene locus_tag LOCUS_19230 gene hemG 4493 3993 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence0297 377 646 gene locus_tag LOCUS_19240 377 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 902 1576 gene locus_tag LOCUS_19250 902 1576 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_19250 2395 1604 gene locus_tag LOCUS_19260 2395 1604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 protein_id gnl|my_center|LOCUS_19260 2467 3327 gene locus_tag LOCUS_19270 2467 3327 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230738.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence0298 <1 1183 gene locus_tag LOCUS_19280 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DI18:nuclease SbcCD subunit C 2422 1190 gene locus_tag LOCUS_19290 2422 1190 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601993.1 protein_id gnl|my_center|LOCUS_19290 2987 2493 gene locus_tag LOCUS_19300 2987 2493 CDS product putative methylated-DNA:protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703067.1 protein_id gnl|my_center|LOCUS_19300 4453 2987 gene locus_tag LOCUS_19310 4453 2987 CDS product putative 3-methyladenine DNA glycosylase AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703068.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence0299 <1 3096 gene locus_tag LOCUS_19320 <1 3096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228749.1:ATP-dependent helicase 3573 3109 gene locus_tag LOCUS_19330 gene nrdR 3573 3109 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCZ3 protein_id gnl|my_center|LOCUS_19330 4062 3673 gene locus_tag LOCUS_19340 4062 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0300 836 369 gene locus_tag LOCUS_19350 836 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1170 847 gene locus_tag LOCUS_19360 1170 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WL03 protein_id gnl|my_center|LOCUS_19360 1971 1228 gene locus_tag LOCUS_19370 1971 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_19370 2658 1981 gene locus_tag LOCUS_19380 2658 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973590.1 protein_id gnl|my_center|LOCUS_19380 3268 2660 gene locus_tag LOCUS_19390 3268 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030225.1 protein_id gnl|my_center|LOCUS_19390 4320 3334 gene locus_tag LOCUS_19400 4320 3334 CDS product putative luciferase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703166.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence0301 225 31 gene locus_tag LOCUS_19410 225 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 311 553 gene locus_tag LOCUS_19420 311 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703758.1 protein_id gnl|my_center|LOCUS_19420 1656 592 gene locus_tag LOCUS_19430 1656 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224451.1 protein_id gnl|my_center|LOCUS_19430 1848 3587 gene locus_tag LOCUS_19440 1848 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224452.1 protein_id gnl|my_center|LOCUS_19440 3606 3818 gene locus_tag LOCUS_19450 3606 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence0302 2184 988 gene locus_tag LOCUS_19460 2184 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2381 4381 gene locus_tag LOCUS_19470 2381 4381 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265468.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence0303 479 117 gene locus_tag LOCUS_19480 479 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702204.1 protein_id gnl|my_center|LOCUS_19480 1744 554 gene locus_tag LOCUS_19490 1744 554 CDS product putative acetyl-CoA acetyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702203.1 protein_id gnl|my_center|LOCUS_19490 1857 2333 gene locus_tag LOCUS_19500 gene mce 1857 2333 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730193.1 protein_id gnl|my_center|LOCUS_19500 2393 3355 gene locus_tag LOCUS_19510 2393 3355 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223472.1 protein_id gnl|my_center|LOCUS_19510 4387 3743 gene locus_tag LOCUS_19520 gene nucS 4387 3743 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59979 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0304 1649 423 gene locus_tag LOCUS_19530 1649 423 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729861.1 protein_id gnl|my_center|LOCUS_19530 2107 1646 gene locus_tag LOCUS_19540 2107 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2854 2201 gene locus_tag LOCUS_19550 2854 2201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727434.1 protein_id gnl|my_center|LOCUS_19550 2990 3637 gene locus_tag LOCUS_19560 2990 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013553.1 protein_id gnl|my_center|LOCUS_19560 4013 3564 gene locus_tag LOCUS_19570 4013 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0305 <1 1018 gene locus_tag LOCUS_19580 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896426.1:alcohol dehydrogenase 1015 1782 gene locus_tag LOCUS_19590 1015 1782 CDS product diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896425.1 protein_id gnl|my_center|LOCUS_19590 1818 3155 gene locus_tag LOCUS_19600 1818 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896424.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence0306 >Feature sequence0307 398 1621 gene locus_tag LOCUS_19610 398 1621 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551301.1 protein_id gnl|my_center|LOCUS_19610 1729 2853 gene locus_tag LOCUS_19620 1729 2853 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730592.1 protein_id gnl|my_center|LOCUS_19620 2947 4164 gene locus_tag LOCUS_19630 2947 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence0308 384 37 gene locus_tag LOCUS_19640 384 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1482 757 gene locus_tag LOCUS_19650 1482 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703940.1 protein_id gnl|my_center|LOCUS_19650 2646 2335 gene locus_tag LOCUS_19660 2646 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2805 3518 gene locus_tag LOCUS_19670 2805 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 protein_id gnl|my_center|LOCUS_19670 3515 4273 gene locus_tag LOCUS_19680 3515 4273 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0309 1526 606 gene locus_tag LOCUS_19690 1526 606 CDS product putative OxpP cycle protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703495.1 protein_id gnl|my_center|LOCUS_19690 3067 1511 gene locus_tag LOCUS_19700 gene zwf 3067 1511 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWX8 protein_id gnl|my_center|LOCUS_19700 4195 3071 gene locus_tag LOCUS_19710 gene tal 4195 3071 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWX9 protein_id gnl|my_center|LOCUS_19710 >Feature sequence0310 <1 931 gene locus_tag LOCUS_19720 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222377.1:NADP-dependent oxidoreductase 1024 1938 gene locus_tag LOCUS_19730 1024 1938 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225290.1 protein_id gnl|my_center|LOCUS_19730 2992 1868 gene locus_tag LOCUS_19740 2992 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 protein_id gnl|my_center|LOCUS_19740 3104 3688 gene locus_tag LOCUS_19750 3104 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_19750 3777 4076 gene locus_tag LOCUS_19760 3777 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4385 4089 gene locus_tag LOCUS_19770 4385 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence0311 <1 4489 gene locus_tag LOCUS_19780 <1 4489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45745:dimodular nonribosomal peptide synthase >Feature sequence0312 419 150 gene locus_tag LOCUS_19790 419 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 687 1868 gene locus_tag LOCUS_19800 687 1868 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777090.1 protein_id gnl|my_center|LOCUS_19800 1927 3153 gene locus_tag LOCUS_19810 1927 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 <4493 3070 gene locus_tag LOCUS_19820 <4493 3070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729328.1:gluconate:proton symporter >Feature sequence0313 1294 491 gene locus_tag LOCUS_19830 1294 491 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702276.1 protein_id gnl|my_center|LOCUS_19830 3363 1318 gene locus_tag LOCUS_19840 3363 1318 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730332.1 protein_id gnl|my_center|LOCUS_19840 3923 3360 gene locus_tag LOCUS_19850 3923 3360 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence0314 1202 2617 gene locus_tag LOCUS_19860 1202 2617 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIH9 protein_id gnl|my_center|LOCUS_19860 3653 2688 gene locus_tag LOCUS_19870 3653 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703687.1 protein_id gnl|my_center|LOCUS_19870 <4484 3855 gene locus_tag LOCUS_19880 <4484 3855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704746.1:similarity with UbiE/COQ5 methyltransferase >Feature sequence0315 1729 461 gene locus_tag LOCUS_19890 1729 461 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_19890 2655 1729 gene locus_tag LOCUS_19900 2655 1729 CDS product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5B6 protein_id gnl|my_center|LOCUS_19900 4285 2687 gene locus_tag LOCUS_19910 4285 2687 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence0316 795 133 gene locus_tag LOCUS_19920 795 133 CDS product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703312.1 protein_id gnl|my_center|LOCUS_19920 953 2155 gene locus_tag LOCUS_19930 953 2155 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 protein_id gnl|my_center|LOCUS_19930 2152 2349 gene locus_tag LOCUS_19940 2152 2349 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 protein_id gnl|my_center|LOCUS_19940 2346 3488 gene locus_tag LOCUS_19950 2346 3488 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_19950 3497 3889 gene locus_tag LOCUS_19960 3497 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence0317 951 376 gene locus_tag LOCUS_19970 951 376 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_19970 1060 2079 gene locus_tag LOCUS_19980 1060 2079 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_19980 2081 2938 gene locus_tag LOCUS_19990 2081 2938 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229199.1 protein_id gnl|my_center|LOCUS_19990 3898 2963 gene locus_tag LOCUS_20000 3898 2963 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702226.1 protein_id gnl|my_center|LOCUS_20000 <4460 3936 gene locus_tag LOCUS_20010 <4460 3936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704960.1:putative monooxygenase >Feature sequence0318 454 155 gene locus_tag LOCUS_20020 454 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 1297 623 gene locus_tag LOCUS_20030 gene rutR 1297 623 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_20030 1407 2297 gene locus_tag LOCUS_20040 gene aroE 1407 2297 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WD96 protein_id gnl|my_center|LOCUS_20040 2294 4186 gene locus_tag LOCUS_20050 2294 4186 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738807.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence0319 977 282 gene locus_tag LOCUS_20060 977 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1081 1851 gene locus_tag LOCUS_20070 gene map 1081 1851 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3DAC1 protein_id gnl|my_center|LOCUS_20070 2384 1869 gene locus_tag LOCUS_20080 2384 1869 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_20080 2562 3041 gene locus_tag LOCUS_20090 2562 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3580 3056 gene locus_tag LOCUS_20100 3580 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 <4440 3659 gene locus_tag LOCUS_20110 <4440 3659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704959.1:putative oxygenase >Feature sequence0320 870 1271 gene locus_tag LOCUS_20120 870 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1372 1713 gene locus_tag LOCUS_20130 1372 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1747 2562 gene locus_tag LOCUS_20140 gene nagD 1747 2562 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH38 protein_id gnl|my_center|LOCUS_20140 2562 3635 gene locus_tag LOCUS_20150 gene entC 2562 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_20150 <4432 3641 gene locus_tag LOCUS_20160 <4432 3641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QQI7:O-succinylhomoserine sulfhydrylase >Feature sequence0321 1487 1143 gene locus_tag LOCUS_20170 1487 1143 CDS product putative transcriptional regulatory protein ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703297.1 protein_id gnl|my_center|LOCUS_20170 1603 2250 gene locus_tag LOCUS_20180 1603 2250 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_20180 2399 3556 gene locus_tag LOCUS_20190 2399 3556 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893212.1 protein_id gnl|my_center|LOCUS_20190 3553 4410 gene locus_tag LOCUS_20200 gene paaH 3553 4410 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence0322 3103 1913 gene locus_tag LOCUS_20210 3103 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728928.1 protein_id gnl|my_center|LOCUS_20210 4017 3244 gene locus_tag LOCUS_20220 4017 3244 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703049.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence0323 1651 560 gene locus_tag LOCUS_20230 1651 560 CDS product X-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 protein_id gnl|my_center|LOCUS_20230 1767 2417 gene locus_tag LOCUS_20240 1767 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3632 2520 gene locus_tag LOCUS_20250 gene aroB 3632 2520 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1K8 protein_id gnl|my_center|LOCUS_20250 4197 3643 gene locus_tag LOCUS_20260 gene aroK 4197 3643 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPY3 protein_id gnl|my_center|LOCUS_20260 4403 4194 gene locus_tag LOCUS_20270 4403 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence0324 <1 711 gene locus_tag LOCUS_20280 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368510.1:iron ABC transporter permease 713 1633 gene locus_tag LOCUS_20290 713 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2336 1713 gene locus_tag LOCUS_20300 2336 1713 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEF4 protein_id gnl|my_center|LOCUS_20300 2596 3735 gene locus_tag LOCUS_20310 2596 3735 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114111.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence0325 84 737 gene locus_tag LOCUS_20320 84 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401827.1 protein_id gnl|my_center|LOCUS_20320 734 1705 gene locus_tag LOCUS_20330 gene menC 734 1705 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65426 protein_id gnl|my_center|LOCUS_20330 1758 2201 gene locus_tag LOCUS_20340 1758 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_20340 3650 2253 gene locus_tag LOCUS_20350 3650 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224551.1 protein_id gnl|my_center|LOCUS_20350 <4393 3673 gene locus_tag LOCUS_20360 <4393 3673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027131.1:siderophore-interacting protein >Feature sequence0326 1142 2305 gene locus_tag LOCUS_20370 gene ydiP 1142 2305 CDS product putative BsuMI modification methylase subunit YdiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34680 protein_id gnl|my_center|LOCUS_20370 2302 2733 gene locus_tag LOCUS_20380 gene vsr 2302 2733 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970457.1 protein_id gnl|my_center|LOCUS_20380 2865 3848 gene locus_tag LOCUS_20390 2865 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence0327 148 708 gene locus_tag LOCUS_20400 148 708 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_20400 808 1608 gene locus_tag LOCUS_20410 808 1608 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_20410 1720 3123 gene locus_tag LOCUS_20420 gene ndh 1720 3123 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_20420 3873 3214 gene locus_tag LOCUS_20430 3873 3214 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729210.1 protein_id gnl|my_center|LOCUS_20430 <4380 3877 gene locus_tag LOCUS_20440 <4380 3877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MB87:urease accessory protein UreG >Feature sequence0328 <1 708 gene locus_tag LOCUS_20450 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704560.1:putative glycosyltransferase 712 2259 gene locus_tag LOCUS_20460 712 2259 CDS product glucose-methanol-choline oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727663.1 protein_id gnl|my_center|LOCUS_20460 2272 2454 gene locus_tag LOCUS_20470 2272 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2564 3859 gene locus_tag LOCUS_20480 2564 3859 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892930.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence0329 2990 1272 gene locus_tag LOCUS_20490 2990 1272 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_20490 <4369 3033 gene locus_tag LOCUS_20500 <4369 3033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115242.1:amidase >Feature sequence0330 975 319 gene locus_tag LOCUS_20510 gene azoR 975 319 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXP9 protein_id gnl|my_center|LOCUS_20510 1041 1403 gene locus_tag LOCUS_20520 1041 1403 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_20520 1741 1421 gene locus_tag LOCUS_20530 1741 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2739 1972 gene locus_tag LOCUS_20540 2739 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2923 3207 gene locus_tag LOCUS_20550 2923 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3448 3212 gene locus_tag LOCUS_20560 3448 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence0331 122 1285 gene locus_tag LOCUS_20570 gene ispG 122 1285 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVH9 protein_id gnl|my_center|LOCUS_20570 1402 2238 gene locus_tag LOCUS_20580 1402 2238 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728449.1 protein_id gnl|my_center|LOCUS_20580 2343 4133 gene locus_tag LOCUS_20590 2343 4133 CDS product penicillin-binding protein, putative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703898.1 protein_id gnl|my_center|LOCUS_20590 4347 4156 gene locus_tag LOCUS_20600 4347 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence0332 884 1456 gene locus_tag LOCUS_20610 884 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2456 1449 gene locus_tag LOCUS_20620 2456 1449 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892757.1 protein_id gnl|my_center|LOCUS_20620 3212 2487 gene locus_tag LOCUS_20630 3212 2487 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191609.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence0333 725 138 gene locus_tag LOCUS_20640 725 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704314.1 protein_id gnl|my_center|LOCUS_20640 2644 863 gene locus_tag LOCUS_20650 gene lpqB 2644 863 CDS product lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TWW9 protein_id gnl|my_center|LOCUS_20650 <4345 2641 gene locus_tag LOCUS_20660 <4345 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QTK3:sensor histidine kinase MtrB >Feature sequence0334 2340 2957 gene locus_tag LOCUS_20670 2340 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 <4334 3048 gene locus_tag LOCUS_20680 <4334 3048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702714.1:putative long-chain-fatty-acid--CoA ligase FadD >Feature sequence0335 451 819 gene locus_tag LOCUS_20690 451 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 942 2024 gene locus_tag LOCUS_20700 942 2024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_20700 2021 2578 gene locus_tag LOCUS_20710 2021 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3161 3550 gene locus_tag LOCUS_20720 3161 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4016 3840 gene locus_tag LOCUS_20730 4016 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence0336 101 811 gene locus_tag LOCUS_20740 gene cysH 101 811 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN34 protein_id gnl|my_center|LOCUS_20740 790 1752 gene locus_tag LOCUS_20750 790 1752 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN33 protein_id gnl|my_center|LOCUS_20750 1752 3092 gene locus_tag LOCUS_20760 1752 3092 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN32 protein_id gnl|my_center|LOCUS_20760 3089 3829 gene locus_tag LOCUS_20770 3089 3829 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895895.1 protein_id gnl|my_center|LOCUS_20770 4308 3853 gene locus_tag LOCUS_20780 4308 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence0337 432 2723 gene locus_tag LOCUS_20790 gene purL 432 2723 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHY1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence0338 698 51 gene locus_tag LOCUS_20800 698 51 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704325.1 protein_id gnl|my_center|LOCUS_20800 1896 682 gene locus_tag LOCUS_20810 1896 682 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_20810 2066 1893 gene locus_tag LOCUS_20820 gene rubB 2066 1893 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P5S1 protein_id gnl|my_center|LOCUS_20820 2227 2063 gene locus_tag LOCUS_20830 2227 2063 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTH2 protein_id gnl|my_center|LOCUS_20830 3450 2227 gene locus_tag LOCUS_20840 3450 2227 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_20840 3626 3796 gene locus_tag LOCUS_20850 3626 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence0339 265 1020 gene locus_tag LOCUS_20860 265 1020 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYR9 protein_id gnl|my_center|LOCUS_20860 1237 1031 gene locus_tag LOCUS_20870 1237 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_20870 <4296 1342 gene locus_tag LOCUS_20880 <4296 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703083.1:putative long-chain acyl-CoA synthase >Feature sequence0340 1536 2693 gene locus_tag LOCUS_20890 1536 2693 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QW28 protein_id gnl|my_center|LOCUS_20890 2721 3149 gene locus_tag LOCUS_20900 2721 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703711.1 protein_id gnl|my_center|LOCUS_20900 3275 4087 gene locus_tag LOCUS_20910 3275 4087 CDS product exoV-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence0341 446 1264 gene locus_tag LOCUS_20920 gene mutM 446 1264 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228777.1 protein_id gnl|my_center|LOCUS_20920 1418 3271 gene locus_tag LOCUS_20930 1418 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3271 3843 gene locus_tag LOCUS_20940 3271 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence0342 1551 136 gene locus_tag LOCUS_20950 1551 136 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_20950 1572 1940 gene locus_tag LOCUS_20960 1572 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2991 1942 gene locus_tag LOCUS_20970 gene rsgA 2991 1942 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBT9 protein_id gnl|my_center|LOCUS_20970 <4288 3133 gene locus_tag LOCUS_20980 <4288 3133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R4M9:trehalose-phosphate synthase >Feature sequence0343 1838 756 gene locus_tag LOCUS_20990 gene cobT 1838 756 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R064 protein_id gnl|my_center|LOCUS_20990 2404 1835 gene locus_tag LOCUS_21000 2404 1835 CDS product putative cobinamide kinase/cobinamide phosphate guanylyltransferase CobU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702690.1 protein_id gnl|my_center|LOCUS_21000 3000 2410 gene locus_tag LOCUS_21010 3000 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702691.1 protein_id gnl|my_center|LOCUS_21010 3134 4249 gene locus_tag LOCUS_21020 3134 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64289 protein_id gnl|my_center|LOCUS_21020 >Feature sequence0344 2817 1279 gene locus_tag LOCUS_21030 2817 1279 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229745.1 protein_id gnl|my_center|LOCUS_21030 4050 2962 gene locus_tag LOCUS_21040 4050 2962 CDS product valine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence0345 1762 695 gene locus_tag LOCUS_21050 1762 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1893 2876 gene locus_tag LOCUS_21060 1893 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence0346 1020 100 gene locus_tag LOCUS_21070 1020 100 CDS product copper resistance protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731280.1 protein_id gnl|my_center|LOCUS_21070 1624 1061 gene locus_tag LOCUS_21080 1624 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2283 1621 gene locus_tag LOCUS_21090 2283 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 protein_id gnl|my_center|LOCUS_21090 2867 2334 gene locus_tag LOCUS_21100 2867 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3534 2884 gene locus_tag LOCUS_21110 3534 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897846.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence0347 392 12 gene locus_tag LOCUS_21120 392 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21120 554 393 gene locus_tag LOCUS_21130 554 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21130 1651 608 gene locus_tag LOCUS_21140 1651 608 CDS product PhoH-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIA3 protein_id gnl|my_center|LOCUS_21140 2520 1765 gene locus_tag LOCUS_21150 2520 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_21150 3290 2517 gene locus_tag LOCUS_21160 3290 2517 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0T7 protein_id gnl|my_center|LOCUS_21160 <4232 3294 gene locus_tag LOCUS_21170 <4232 3294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R0T8:chaperone protein DnaJ >Feature sequence0348 1681 35 gene locus_tag LOCUS_21180 1681 35 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222206.1 protein_id gnl|my_center|LOCUS_21180 1869 3254 gene locus_tag LOCUS_21190 1869 3254 CDS product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027933.1 protein_id gnl|my_center|LOCUS_21190 3290 3700 gene locus_tag LOCUS_21200 3290 3700 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777009.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence0349 1542 2453 gene locus_tag LOCUS_21210 1542 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701935.1 protein_id gnl|my_center|LOCUS_21210 2526 3746 gene locus_tag LOCUS_21220 2526 3746 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence0350 755 147 gene locus_tag LOCUS_21230 755 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1162 752 gene locus_tag LOCUS_21240 1162 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1596 3671 gene locus_tag LOCUS_21250 1596 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0351 482 2755 gene locus_tag LOCUS_21260 482 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2752 3390 gene locus_tag LOCUS_21270 2752 3390 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704081.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence0352 437 1054 gene locus_tag LOCUS_21280 437 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence0353 1297 359 gene locus_tag LOCUS_21290 1297 359 CDS product putative prephenate dehydrogenase TyrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701020.1 protein_id gnl|my_center|LOCUS_21290 1322 1933 gene locus_tag LOCUS_21300 1322 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701021.1 protein_id gnl|my_center|LOCUS_21300 1937 2392 gene locus_tag LOCUS_21310 gene tadA 1937 2392 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFG8 protein_id gnl|my_center|LOCUS_21310 2408 2683 gene locus_tag LOCUS_21320 2408 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2742 2831 gene locus_tag LOCUS_t00160 2742 2831 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3793 3317 gene locus_tag LOCUS_21330 3793 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence0354 <1 1206 gene locus_tag LOCUS_21340 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DGH0:serine hydroxymethyltransferase 1537 2394 gene locus_tag LOCUS_21350 1537 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21350 2446 2724 gene locus_tag LOCUS_21360 gene soxD 2446 2724 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence0355 2001 418 gene locus_tag LOCUS_21370 2001 418 CDS product tetronasin ABC transporter integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898775.1 protein_id gnl|my_center|LOCUS_21370 2876 1998 gene locus_tag LOCUS_21380 2876 1998 CDS product tetronasin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900295.1 protein_id gnl|my_center|LOCUS_21380 3496 2873 gene locus_tag LOCUS_21390 3496 2873 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence0356 47 1132 gene locus_tag LOCUS_21400 47 1132 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_21400 3080 1224 gene locus_tag LOCUS_21410 gene nhaA2 3080 1224 CDS product Na(+)/H(+) antiporter NhaA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2C8 protein_id gnl|my_center|LOCUS_21410 >Feature sequence0357 <1 2505 gene locus_tag LOCUS_21420 <1 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393286.1:aminotransferase <4174 2499 gene locus_tag LOCUS_21430 <4174 2499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705231.1:putative membrane protein, MmpL >Feature sequence0358 >Feature sequence0359 1508 1029 gene locus_tag LOCUS_21440 1508 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2031 3293 gene locus_tag LOCUS_21450 2031 3293 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_21450 4026 3307 gene locus_tag LOCUS_21460 4026 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898119.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence0360 1099 344 gene locus_tag LOCUS_21470 1099 344 CDS product serine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727295.1 protein_id gnl|my_center|LOCUS_21470 1431 2732 gene locus_tag LOCUS_21480 1431 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704787.1 protein_id gnl|my_center|LOCUS_21480 2744 3592 gene locus_tag LOCUS_21490 2744 3592 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence0361 1916 669 gene locus_tag LOCUS_21500 1916 669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810258.1 protein_id gnl|my_center|LOCUS_21500 2002 2883 gene locus_tag LOCUS_21510 2002 2883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887260.1 protein_id gnl|my_center|LOCUS_21510 <4156 2951 gene locus_tag LOCUS_21520 <4156 2951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230984.1:phosphatase >Feature sequence0362 2123 174 gene locus_tag LOCUS_21530 2123 174 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804144.1 protein_id gnl|my_center|LOCUS_21530 2172 2402 gene locus_tag LOCUS_21540 2172 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2424 2885 gene locus_tag LOCUS_21550 2424 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21550 2895 4073 gene locus_tag LOCUS_21560 2895 4073 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence0363 2325 262 gene locus_tag LOCUS_21570 2325 262 CDS product putative acyl-CoA synthetase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704219.1 protein_id gnl|my_center|LOCUS_21570 3826 2483 gene locus_tag LOCUS_21580 3826 2483 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence0364 127 678 gene locus_tag LOCUS_21590 127 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1261 965 gene locus_tag LOCUS_21600 1261 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3812 1287 gene locus_tag LOCUS_21610 3812 1287 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_21610 4129 3809 gene locus_tag LOCUS_21620 4129 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence0365 347 712 gene locus_tag LOCUS_21630 gene crcB 347 712 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBA0 protein_id gnl|my_center|LOCUS_21630 755 1315 gene locus_tag LOCUS_21640 755 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703176.1 protein_id gnl|my_center|LOCUS_21640 1881 2561 gene locus_tag LOCUS_21650 1881 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2868 3305 gene locus_tag LOCUS_21660 2868 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence0366 1224 295 gene locus_tag LOCUS_21670 1224 295 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_21670 3840 1336 gene locus_tag LOCUS_21680 3840 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence0367 701 285 gene locus_tag LOCUS_21690 701 285 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_21690 2421 703 gene locus_tag LOCUS_21700 2421 703 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896081.1 protein_id gnl|my_center|LOCUS_21700 2996 2508 gene locus_tag LOCUS_21710 2996 2508 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1C4 protein_id gnl|my_center|LOCUS_21710 3842 3162 gene locus_tag LOCUS_21720 3842 3162 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence0368 786 463 gene locus_tag LOCUS_21730 786 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1268 813 gene locus_tag LOCUS_21740 1268 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3124 2270 gene locus_tag LOCUS_21750 gene fadB2 3124 2270 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP7 protein_id gnl|my_center|LOCUS_21750 >Feature sequence0369 339 587 gene locus_tag LOCUS_21760 339 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 584 2770 gene locus_tag LOCUS_21770 584 2770 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_21770 2814 3047 gene locus_tag LOCUS_21780 2814 3047 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_21780 3044 3781 gene locus_tag LOCUS_21790 gene ubiE 3044 3781 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence0370 2051 657 gene locus_tag LOCUS_21800 2051 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702249.1 protein_id gnl|my_center|LOCUS_21800 2692 2051 gene locus_tag LOCUS_21810 2692 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0371 504 935 gene locus_tag LOCUS_21820 504 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2447 954 gene locus_tag LOCUS_21830 2447 954 CDS product acetyl-CoA carboxylase carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730679.1 protein_id gnl|my_center|LOCUS_21830 3657 2458 gene locus_tag LOCUS_21840 3657 2458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0372 733 1476 gene locus_tag LOCUS_21850 733 1476 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402330.1 protein_id gnl|my_center|LOCUS_21850 1646 1473 gene locus_tag LOCUS_21860 1646 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1719 2264 gene locus_tag LOCUS_21870 gene pfpI 1719 2264 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228555.1 protein_id gnl|my_center|LOCUS_21870 2281 3270 gene locus_tag LOCUS_21880 2281 3270 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_21880 3811 3341 gene locus_tag LOCUS_21890 3811 3341 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222101.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence0373 1223 186 gene locus_tag LOCUS_21900 1223 186 CDS product putative cytochrome D ubiquinol oxydase CydB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703365.1 protein_id gnl|my_center|LOCUS_21900 2702 1233 gene locus_tag LOCUS_21910 2702 1233 CDS product putative integral membrane cytochrome D ubiquinol oxidase subunit I CydA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703364.1 protein_id gnl|my_center|LOCUS_21910 3685 2834 gene locus_tag LOCUS_21920 3685 2834 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730796.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0374 811 1809 gene locus_tag LOCUS_21930 811 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727891.1 protein_id gnl|my_center|LOCUS_21930 1955 1791 gene locus_tag LOCUS_21940 1955 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2703 2017 gene locus_tag LOCUS_21950 2703 2017 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727889.1 protein_id gnl|my_center|LOCUS_21950 2906 3373 gene locus_tag LOCUS_21960 2906 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence0375 1137 1412 gene locus_tag LOCUS_21970 1137 1412 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 protein_id gnl|my_center|LOCUS_21970 2485 1424 gene locus_tag LOCUS_21980 gene trpD 2485 1424 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D056 protein_id gnl|my_center|LOCUS_21980 3013 2537 gene locus_tag LOCUS_21990 3013 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224079.1 protein_id gnl|my_center|LOCUS_21990 3210 3776 gene locus_tag LOCUS_22000 3210 3776 CDS product putative cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702705.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence0376 <1 1625 gene locus_tag LOCUS_22010 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728254.1:histidine kinase 1743 2564 gene locus_tag LOCUS_22020 1743 2564 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_22020 2605 3438 gene locus_tag LOCUS_22030 2605 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence0377 2988 259 gene locus_tag LOCUS_22040 2988 259 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_22040 <4054 2981 gene locus_tag LOCUS_22050 <4054 2981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224291.1:acetoin utilization protein AcuC >Feature sequence0378 497 2143 gene locus_tag LOCUS_22060 497 2143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031633.1 protein_id gnl|my_center|LOCUS_22060 3460 2132 gene locus_tag LOCUS_22070 3460 2132 CDS product putative L-carnitine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702626.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence0379 189 734 gene locus_tag LOCUS_22080 189 734 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_22080 842 2431 gene locus_tag LOCUS_22090 842 2431 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_22090 2452 3744 gene locus_tag LOCUS_22100 2452 3744 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence0380 1183 683 gene locus_tag LOCUS_22110 1183 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1500 3680 gene locus_tag LOCUS_22120 1500 3680 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401001.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence0381 <1 543 gene locus_tag LOCUS_22130 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q59560:protein RecA 556 1107 gene locus_tag LOCUS_22140 gene recX 556 1107 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94965 protein_id gnl|my_center|LOCUS_22140 2079 1204 gene locus_tag LOCUS_22150 2079 1204 CDS product putative glutamate ABC transporter, permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703785.1 protein_id gnl|my_center|LOCUS_22150 2753 2076 gene locus_tag LOCUS_22160 2753 2076 CDS product glutamate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 protein_id gnl|my_center|LOCUS_22160 3680 2850 gene locus_tag LOCUS_22170 3680 2850 CDS product glutamate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_22170 3990 3733 gene locus_tag LOCUS_22180 3990 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence0382 1485 43 gene locus_tag LOCUS_22190 1485 43 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731572.1 protein_id gnl|my_center|LOCUS_22190 2559 1510 gene locus_tag LOCUS_22200 2559 1510 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNE9 protein_id gnl|my_center|LOCUS_22200 <3990 2707 gene locus_tag LOCUS_22210 <3990 2707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225258.1:ferredoxin--NADP(+) reductase >Feature sequence0383 <1 1050 gene locus_tag LOCUS_22220 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727629.1:sugar ABC transporter permease 1105 2076 gene locus_tag LOCUS_22230 1105 2076 CDS product ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_22230 2180 3658 gene locus_tag LOCUS_22240 2180 3658 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence0384 315 1487 gene locus_tag LOCUS_22250 315 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704110.1 protein_id gnl|my_center|LOCUS_22250 2803 1475 gene locus_tag LOCUS_22260 2803 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704109.1 protein_id gnl|my_center|LOCUS_22260 2955 3716 gene locus_tag LOCUS_22270 2955 3716 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727378.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence0385 <1 941 gene locus_tag LOCUS_22280 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CZX9:dihydroxy-acid dehydratase 1961 1014 gene locus_tag LOCUS_22290 1961 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2055 3203 gene locus_tag LOCUS_22300 gene lppZ 2055 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950811.1 protein_id gnl|my_center|LOCUS_22300 <3966 3276 gene locus_tag LOCUS_22310 <3966 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MDU1:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B >Feature sequence0386 1167 376 gene locus_tag LOCUS_22320 1167 376 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_22320 2799 1453 gene locus_tag LOCUS_22330 2799 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703410.1 protein_id gnl|my_center|LOCUS_22330 3830 2901 gene locus_tag LOCUS_22340 3830 2901 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence0387 307 1335 gene locus_tag LOCUS_22350 307 1335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 protein_id gnl|my_center|LOCUS_22350 1274 1182 gene locus_tag LOCUS_t00170 1274 1182 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1332 2357 gene locus_tag LOCUS_22360 1332 2357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729923.1 protein_id gnl|my_center|LOCUS_22360 2354 3142 gene locus_tag LOCUS_22370 2354 3142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_22370 3693 3223 gene locus_tag LOCUS_22380 3693 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0388 238 501 gene locus_tag LOCUS_22390 238 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 568 1224 gene locus_tag LOCUS_22400 568 1224 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419708.1 protein_id gnl|my_center|LOCUS_22400 1909 1289 gene locus_tag LOCUS_22410 1909 1289 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030562.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence0389 926 621 gene locus_tag LOCUS_22420 gene rpoZ 926 621 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWT1 protein_id gnl|my_center|LOCUS_22420 1610 999 gene locus_tag LOCUS_22430 gene gmk 1610 999 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWS9 protein_id gnl|my_center|LOCUS_22430 1936 1616 gene locus_tag LOCUS_22440 1936 1616 CDS product putative integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703557.1 protein_id gnl|my_center|LOCUS_22440 2972 2142 gene locus_tag LOCUS_22450 gene pyrF 2972 2142 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQ40 protein_id gnl|my_center|LOCUS_22450 <3940 2969 gene locus_tag LOCUS_22460 <3940 2969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCD5:carbamoyl-phosphate synthase large chain >Feature sequence0390 <1 1792 gene locus_tag LOCUS_22470 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705413.1:putative non-ribosomal peptide synthetase PstA 1902 2954 gene locus_tag LOCUS_22480 1902 2954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence0391 1134 106 gene locus_tag LOCUS_22490 gene terC 1134 106 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_22490 1838 1308 gene locus_tag LOCUS_22500 1838 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1874 3325 gene locus_tag LOCUS_22510 gene dprE1 1874 3325 CDS product FAD-dependent decaprenylphosphoryl-beta-D-ribofuranose 2-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R607 protein_id gnl|my_center|LOCUS_22510 >Feature sequence0392 1443 607 gene locus_tag LOCUS_22520 1443 607 CDS product putative O-antigen/lipopolysaccharide transport integral membrane protein ABC transporter RfbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700955.1 protein_id gnl|my_center|LOCUS_22520 2126 1548 gene locus_tag LOCUS_22530 2126 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2260 3507 gene locus_tag LOCUS_22540 2260 3507 CDS product putative aminotransferase/cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700960.1 protein_id gnl|my_center|LOCUS_22540 3925 3581 gene locus_tag LOCUS_22550 3925 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence0393 13 915 gene locus_tag LOCUS_22560 13 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2363 1065 gene locus_tag LOCUS_22570 2363 1065 CDS product putative acetyl-CoA acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705166.1 protein_id gnl|my_center|LOCUS_22570 2488 3849 gene locus_tag LOCUS_22580 gene fabG 2488 3849 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726889.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0394 285 1064 gene locus_tag LOCUS_22590 285 1064 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224817.1 protein_id gnl|my_center|LOCUS_22590 1061 2362 gene locus_tag LOCUS_22600 gene ufaA1 1061 2362 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402250.1 protein_id gnl|my_center|LOCUS_22600 2359 3684 gene locus_tag LOCUS_22610 gene cfa 2359 3684 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224815.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence0395 1587 1000 gene locus_tag LOCUS_22620 1587 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2562 1750 gene locus_tag LOCUS_22630 2562 1750 CDS product putative shikimate-5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703581.1 protein_id gnl|my_center|LOCUS_22630 3778 2564 gene locus_tag LOCUS_22640 3778 2564 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894408.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence0396 <1 613 gene locus_tag LOCUS_22650 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186417.1:DNA translocase FtsK 724 2481 gene locus_tag LOCUS_22660 gene pbpB 724 2481 CDS product penicillin-binding protein PbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R022 protein_id gnl|my_center|LOCUS_22660 >Feature sequence0397 3645 508 gene locus_tag LOCUS_22670 gene ileS 3645 508 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC13 protein_id gnl|my_center|LOCUS_22670 >Feature sequence0398 <1 633 gene locus_tag LOCUS_22680 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RDN0:aldose 1-epimerase 750 1751 gene locus_tag LOCUS_22690 750 1751 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_22690 1762 3393 gene locus_tag LOCUS_22700 1762 3393 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226241.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence0399 3 206 gene locus_tag LOCUS_22710 3 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225230.1 protein_id gnl|my_center|LOCUS_22710 1379 213 gene locus_tag LOCUS_22720 gene galK 1379 213 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3S8 protein_id gnl|my_center|LOCUS_22720 2518 1376 gene locus_tag LOCUS_22730 gene galT 2518 1376 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIK1 protein_id gnl|my_center|LOCUS_22730 3330 2515 gene locus_tag LOCUS_22740 3330 2515 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_22740 3695 3420 gene locus_tag LOCUS_22750 3695 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence0400 2356 1448 gene locus_tag LOCUS_22760 gene dapA 2356 1448 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVT1 protein_id gnl|my_center|LOCUS_22760 3184 2456 gene locus_tag LOCUS_22770 gene thyX 3184 2456 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD42 protein_id gnl|my_center|LOCUS_22770 3362 3838 gene locus_tag LOCUS_22780 3362 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence0401 1683 1222 gene locus_tag LOCUS_22790 1683 1222 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895083.1 protein_id gnl|my_center|LOCUS_22790 2667 1906 gene locus_tag LOCUS_22800 2667 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703152.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence0402 1574 1086 gene locus_tag LOCUS_22810 1574 1086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_22810 2630 1674 gene locus_tag LOCUS_22820 2630 1674 CDS product putative citrate lyase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702109.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence0403 1202 2206 gene locus_tag LOCUS_22830 gene ctaB 1202 2206 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWY2 protein_id gnl|my_center|LOCUS_22830 3200 2235 gene locus_tag LOCUS_22840 3200 2235 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728817.1 protein_id gnl|my_center|LOCUS_22840 3336 3710 gene locus_tag LOCUS_22850 3336 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703489.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence0404 1171 146 gene locus_tag LOCUS_22860 1171 146 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390324.1 protein_id gnl|my_center|LOCUS_22860 1452 2240 gene locus_tag LOCUS_22870 1452 2240 CDS product BtpA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_22870 2244 3140 gene locus_tag LOCUS_22880 gene rbsK 2244 3140 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI7 protein_id gnl|my_center|LOCUS_22880 >Feature sequence0405 193 807 gene locus_tag LOCUS_22890 gene rdgB 193 807 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1W7 protein_id gnl|my_center|LOCUS_22890 810 1619 gene locus_tag LOCUS_22900 810 1619 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_22900 1975 1622 gene locus_tag LOCUS_22910 1975 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702227.1 protein_id gnl|my_center|LOCUS_22910 2394 1972 gene locus_tag LOCUS_22920 gene lprD 2394 1972 CDS product putative lipoprotein LprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK51 protein_id gnl|my_center|LOCUS_22920 3122 2463 gene locus_tag LOCUS_22930 3122 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899142.1 protein_id gnl|my_center|LOCUS_22930 3275 3193 gene locus_tag LOCUS_t00180 3275 3193 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0406 2281 983 gene locus_tag LOCUS_22940 gene aroA 2281 983 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z470 protein_id gnl|my_center|LOCUS_22940 2926 2306 gene locus_tag LOCUS_22950 gene ebsC 2926 2306 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFJ3 protein_id gnl|my_center|LOCUS_22950 2889 3665 gene locus_tag LOCUS_22960 gene sigH 2889 3665 CDS product ECF RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTP2 protein_id gnl|my_center|LOCUS_22960 >Feature sequence0407 2086 1244 gene locus_tag LOCUS_22970 2086 1244 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_22970 3708 2194 gene locus_tag LOCUS_22980 gene lig 3708 2194 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHV3 protein_id gnl|my_center|LOCUS_22980 >Feature sequence0408 59 646 gene locus_tag LOCUS_22990 59 646 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_22990 655 867 gene locus_tag LOCUS_23000 655 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1213 878 gene locus_tag LOCUS_23010 1213 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23010 2305 1364 gene locus_tag LOCUS_23020 2305 1364 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_23020 2722 2423 gene locus_tag LOCUS_23030 2722 2423 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence0409 2224 728 gene locus_tag LOCUS_23040 2224 728 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230201.1 protein_id gnl|my_center|LOCUS_23040 <3779 2359 gene locus_tag LOCUS_23050 <3779 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977903.1:oxidoreductase >Feature sequence0410 536 348 gene locus_tag LOCUS_23060 536 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1038 589 gene locus_tag LOCUS_23070 1038 589 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730654.1 protein_id gnl|my_center|LOCUS_23070 1244 1417 gene locus_tag LOCUS_23080 1244 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2524 1505 gene locus_tag LOCUS_23090 2524 1505 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225933.1 protein_id gnl|my_center|LOCUS_23090 3268 2957 gene locus_tag LOCUS_23100 3268 2957 CDS product branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227128.1 protein_id gnl|my_center|LOCUS_23100 <3778 3265 gene locus_tag LOCUS_23110 <3778 3265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227129.1:branched-chain amino acid ABC transporter permease >Feature sequence0411 528 920 gene locus_tag LOCUS_23120 528 920 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229230.1 protein_id gnl|my_center|LOCUS_23120 993 1796 gene locus_tag LOCUS_23130 993 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225930.1 protein_id gnl|my_center|LOCUS_23130 2457 1744 gene locus_tag LOCUS_23140 2457 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2765 2556 gene locus_tag LOCUS_23150 2765 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0412 1454 867 gene locus_tag LOCUS_23160 1454 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703779.1 protein_id gnl|my_center|LOCUS_23160 3007 1451 gene locus_tag LOCUS_23170 gene miaB 3007 1451 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVX5 protein_id gnl|my_center|LOCUS_23170 >Feature sequence0413 859 1917 gene locus_tag LOCUS_23180 gene moaA 859 1917 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z1 protein_id gnl|my_center|LOCUS_23180 1983 3164 gene locus_tag LOCUS_23190 gene moeA 1983 3164 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230283.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence0414 1977 802 gene locus_tag LOCUS_23200 1977 802 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_23200 2056 2610 gene locus_tag LOCUS_23210 gene phoE 2056 2610 CDS product putative phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07617 protein_id gnl|my_center|LOCUS_23210 2625 3107 gene locus_tag LOCUS_23220 2625 3107 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776604.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence0415 1488 205 gene locus_tag LOCUS_23230 1488 205 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729325.1 protein_id gnl|my_center|LOCUS_23230 1603 2625 gene locus_tag LOCUS_23240 gene kdgK 1603 2625 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227854.1 protein_id gnl|my_center|LOCUS_23240 2622 3374 gene locus_tag LOCUS_23250 2622 3374 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227853.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence0416 1481 882 gene locus_tag LOCUS_23260 1481 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2037 1495 gene locus_tag LOCUS_23270 2037 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2459 2034 gene locus_tag LOCUS_23280 2459 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2619 2440 gene locus_tag LOCUS_23290 2619 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2958 2674 gene locus_tag LOCUS_23300 2958 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3268 2978 gene locus_tag LOCUS_23310 3268 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701988.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence0417 2 790 gene locus_tag LOCUS_23320 2 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1571 990 gene locus_tag LOCUS_23330 1571 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence0418 1820 441 gene locus_tag LOCUS_23340 1820 441 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKW8 protein_id gnl|my_center|LOCUS_23340 2008 3012 gene locus_tag LOCUS_23350 2008 3012 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726795.1 protein_id gnl|my_center|LOCUS_23350 3027 3455 gene locus_tag LOCUS_23360 3027 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence0419 817 1251 gene locus_tag LOCUS_23370 817 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705410.1 protein_id gnl|my_center|LOCUS_23370 1383 2834 gene locus_tag LOCUS_23380 1383 2834 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224461.1 protein_id gnl|my_center|LOCUS_23380 3112 2837 gene locus_tag LOCUS_23390 3112 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0420 915 1388 gene locus_tag LOCUS_23400 915 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887751.1 protein_id gnl|my_center|LOCUS_23400 2491 1385 gene locus_tag LOCUS_23410 2491 1385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730626.1 protein_id gnl|my_center|LOCUS_23410 3369 2503 gene locus_tag LOCUS_23420 3369 2503 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730627.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence0421 <1 2779 gene locus_tag LOCUS_23430 <1 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MDM4:pyruvate carboxylase 2776 3348 gene locus_tag LOCUS_23440 2776 3348 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence0422 1637 297 gene locus_tag LOCUS_23450 1637 297 CDS product putative aminotransferase class-III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704374.1 protein_id gnl|my_center|LOCUS_23450 1750 3285 gene locus_tag LOCUS_23460 1750 3285 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727883.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence0423 1886 1497 gene locus_tag LOCUS_23470 1886 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3247 1877 gene locus_tag LOCUS_23480 gene cobB 3247 1877 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63836 protein_id gnl|my_center|LOCUS_23480 >Feature sequence0424 907 290 gene locus_tag LOCUS_23490 907 290 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_23490 2825 1068 gene locus_tag LOCUS_23500 2825 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 <3697 3087 gene locus_tag LOCUS_23510 <3697 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R2I0:aminotransferase >Feature sequence0425 <1 1291 gene locus_tag LOCUS_23520 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MG04:succinate dehydrogenase flavoprotein subunit 1293 2075 gene locus_tag LOCUS_23530 gene sdhB 1293 2075 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893076.1 protein_id gnl|my_center|LOCUS_23530 3342 2137 gene locus_tag LOCUS_23540 gene gcdH 3342 2137 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence0426 1756 119 gene locus_tag LOCUS_23550 1756 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1910 2539 gene locus_tag LOCUS_23560 1910 2539 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence0427 <1 880 gene locus_tag LOCUS_23570 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MG60:60 kDa chaperonin 1253 960 gene locus_tag LOCUS_23580 gene whiB3 1253 960 CDS product putative transcriptional regulator WhiB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QST8 protein_id gnl|my_center|LOCUS_23580 1832 2782 gene locus_tag LOCUS_23590 1832 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704453.1 protein_id gnl|my_center|LOCUS_23590 3098 3496 gene locus_tag LOCUS_23600 3098 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence0428 >Feature sequence0429 <3671 1986 gene locus_tag LOCUS_23610 <3671 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703445.1:putative methylmalonyl-CoA mutase small subunit MutA >Feature sequence0430 <1 742 gene locus_tag LOCUS_23620 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419740.1:anion transporter ATPase 1086 763 gene locus_tag LOCUS_23630 gene whiB4 1086 763 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5I1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence0431 271 1593 gene locus_tag LOCUS_23640 gene secY 271 1593 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSH7 protein_id gnl|my_center|LOCUS_23640 1590 2144 gene locus_tag LOCUS_23650 gene adk 1590 2144 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49973 protein_id gnl|my_center|LOCUS_23650 2144 2941 gene locus_tag LOCUS_23660 gene map 2144 2941 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGB2 protein_id gnl|my_center|LOCUS_23660 >Feature sequence0432 2149 794 gene locus_tag LOCUS_23670 2149 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2426 2683 gene locus_tag LOCUS_23680 2426 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence0433 1923 349 gene locus_tag LOCUS_23690 1923 349 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880701.1 protein_id gnl|my_center|LOCUS_23690 2175 3599 gene locus_tag LOCUS_23700 2175 3599 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence0434 395 2125 gene locus_tag LOCUS_23710 gene glpD2 395 2125 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT70 protein_id gnl|my_center|LOCUS_23710 3481 2279 gene locus_tag LOCUS_23720 gene rpoE 3481 2279 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230890.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence0435 544 83 gene locus_tag LOCUS_23730 544 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1507 677 gene locus_tag LOCUS_23740 1507 677 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227312.1 protein_id gnl|my_center|LOCUS_23740 1798 2211 gene locus_tag LOCUS_23750 1798 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2426 3337 gene locus_tag LOCUS_23760 2426 3337 CDS product Mn-containing catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224926.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence0436 <3630 793 gene locus_tag LOCUS_23770 <3630 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727880.1:DEAD/DEAH box helicase >Feature sequence0437 111 1127 gene locus_tag LOCUS_23780 111 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2168 1212 gene locus_tag LOCUS_23790 2168 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705217.1 protein_id gnl|my_center|LOCUS_23790 2772 2179 gene locus_tag LOCUS_23800 2772 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 <3618 2864 gene locus_tag LOCUS_23810 <3618 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MDZ6:cytochrome c oxidase subunit 1 >Feature sequence0438 <1 726 gene locus_tag LOCUS_23820 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029929.1:thymidine phosphorylase 2103 736 gene locus_tag LOCUS_23830 2103 736 CDS product putative aminotransferase, class III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704056.1 protein_id gnl|my_center|LOCUS_23830 2564 2100 gene locus_tag LOCUS_23840 2564 2100 CDS product putative transcriptional regulator, AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704057.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence0439 337 819 gene locus_tag LOCUS_23850 337 819 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227796.1 protein_id gnl|my_center|LOCUS_23850 839 2011 gene locus_tag LOCUS_23860 839 2011 CDS product monovalent cation:H+ antiporter-2, CPA2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 protein_id gnl|my_center|LOCUS_23860 2025 2681 gene locus_tag LOCUS_23870 2025 2681 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_853836.1 protein_id gnl|my_center|LOCUS_23870 <3615 2743 gene locus_tag LOCUS_23880 <3615 2743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701599.1:putative fatty oxidation protein FadB >Feature sequence0440 2748 2110 gene locus_tag LOCUS_23890 2748 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 <3611 2748 gene locus_tag LOCUS_23900 <3611 2748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707175.1:carbon monoxide dehydrogenase >Feature sequence0441 723 175 gene locus_tag LOCUS_23910 723 175 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805038.1 protein_id gnl|my_center|LOCUS_23910 899 1279 gene locus_tag LOCUS_23920 899 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1368 2477 gene locus_tag LOCUS_23930 1368 2477 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_23930 2491 2922 gene locus_tag LOCUS_23940 2491 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence0442 1807 245 gene locus_tag LOCUS_23950 1807 245 CDS product putative Uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704719.1 protein_id gnl|my_center|LOCUS_23950 2926 1967 gene locus_tag LOCUS_23960 gene hemC 2926 1967 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHI5 protein_id gnl|my_center|LOCUS_23960 <3609 2923 gene locus_tag LOCUS_23970 <3609 2923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MHI6:glutamyl-tRNA reductase >Feature sequence0443 <1 997 gene locus_tag LOCUS_23980 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223372.1:histidine kinase 994 1338 gene locus_tag LOCUS_23990 994 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730753.1 protein_id gnl|my_center|LOCUS_23990 1419 2096 gene locus_tag LOCUS_24000 1419 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2104 2706 gene locus_tag LOCUS_24010 2104 2706 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_24010 3033 2686 gene locus_tag LOCUS_24020 3033 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3113 3442 gene locus_tag LOCUS_24030 3113 3442 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031457.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence0444 280 1260 gene locus_tag LOCUS_24040 280 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1425 2783 gene locus_tag LOCUS_24050 1425 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230373.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence0445 2 469 gene locus_tag LOCUS_24060 2 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 502 2046 gene locus_tag LOCUS_24070 gene lipT 502 2046 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ01 protein_id gnl|my_center|LOCUS_24070 2905 2039 gene locus_tag LOCUS_24080 2905 2039 CDS product putative formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701782.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence0446 <1 792 gene locus_tag LOCUS_24090 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729521.1:fatty-acid--CoA ligase 1717 830 gene locus_tag LOCUS_24100 1717 830 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194445.1 protein_id gnl|my_center|LOCUS_24100 2774 1728 gene locus_tag LOCUS_24110 2774 1728 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013903.1 protein_id gnl|my_center|LOCUS_24110 3379 2798 gene locus_tag LOCUS_24120 3379 2798 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence0447 1322 132 gene locus_tag LOCUS_24130 gene sbcD 1322 132 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJB1 protein_id gnl|my_center|LOCUS_24130 1422 2612 gene locus_tag LOCUS_24140 1422 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence0448 1228 233 gene locus_tag LOCUS_24150 1228 233 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_24150 1411 2166 gene locus_tag LOCUS_24160 1411 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2163 2921 gene locus_tag LOCUS_24170 gene rskA 2163 2921 CDS product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGX5 protein_id gnl|my_center|LOCUS_24170 3560 2964 gene locus_tag LOCUS_24180 3560 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence0449 >Feature sequence0450 2384 111 gene locus_tag LOCUS_24190 2384 111 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728262.1 protein_id gnl|my_center|LOCUS_24190 2489 2881 gene locus_tag LOCUS_24200 2489 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 3551 2904 gene locus_tag LOCUS_24210 3551 2904 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027173.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence0451 246 395 gene locus_tag LOCUS_24220 246 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 629 1060 gene locus_tag LOCUS_24230 629 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3036 2281 gene locus_tag LOCUS_24240 3036 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3493 3293 gene locus_tag LOCUS_24250 3493 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence0452 <1 2660 gene locus_tag LOCUS_24260 <1 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225383.1:helicase 2660 3412 gene locus_tag LOCUS_24270 2660 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0453 82 1323 gene locus_tag LOCUS_24280 82 1323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028420.1 protein_id gnl|my_center|LOCUS_24280 1320 2981 gene locus_tag LOCUS_24290 1320 2981 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257624.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence0454 2813 270 gene locus_tag LOCUS_24300 gene gyrA 2813 270 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ME58 protein_id gnl|my_center|LOCUS_24300 3535 2879 gene locus_tag LOCUS_24310 3535 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence0455 1336 791 gene locus_tag LOCUS_24320 1336 791 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257362.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence0456 941 516 gene locus_tag LOCUS_24330 941 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 837 1469 gene locus_tag LOCUS_24340 837 1469 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776018.1 protein_id gnl|my_center|LOCUS_24340 1846 1496 gene locus_tag LOCUS_24350 1846 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1731 2117 gene locus_tag LOCUS_24360 1731 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3007 2540 gene locus_tag LOCUS_24370 3007 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence0457 63 695 gene locus_tag LOCUS_24380 gene lspA 63 695 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK99 protein_id gnl|my_center|LOCUS_24380 692 1618 gene locus_tag LOCUS_24390 692 1618 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC08 protein_id gnl|my_center|LOCUS_24390 1618 2277 gene locus_tag LOCUS_24400 1618 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence0458 <1 1506 gene locus_tag LOCUS_24410 <1 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QWV6:UvrABC system protein C 1506 2459 gene locus_tag LOCUS_24420 1506 2459 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWV7 protein_id gnl|my_center|LOCUS_24420 2456 3484 gene locus_tag LOCUS_24430 2456 3484 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC90 protein_id gnl|my_center|LOCUS_24430 >Feature sequence0459 2288 1149 gene locus_tag LOCUS_24440 gene dxr 2288 1149 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDC7 protein_id gnl|my_center|LOCUS_24440 2411 2932 gene locus_tag LOCUS_24450 2411 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413569.1 protein_id gnl|my_center|LOCUS_24450 <3510 2934 gene locus_tag LOCUS_24460 <3510 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703667.1:polysaccharide deacetylase family protein >Feature sequence0460 49 576 gene locus_tag LOCUS_24470 49 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 protein_id gnl|my_center|LOCUS_24470 1716 634 gene locus_tag LOCUS_24480 gene pyrD 1716 634 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MPD4 protein_id gnl|my_center|LOCUS_24480 2057 1797 gene locus_tag LOCUS_24490 2057 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702840.1 protein_id gnl|my_center|LOCUS_24490 3107 2118 gene locus_tag LOCUS_24500 3107 2118 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226470.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence0461 <1 560 gene locus_tag LOCUS_24510 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q49721:putative oxidoreductase 749 2503 gene locus_tag LOCUS_24520 gene choD 749 2503 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMV9 protein_id gnl|my_center|LOCUS_24520 >Feature sequence0462 <1 681 gene locus_tag LOCUS_24530 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WGW1:Holliday junction ATP-dependent DNA helicase RuvB 820 1245 gene locus_tag LOCUS_24540 820 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1407 3176 gene locus_tag LOCUS_24550 gene secD 1407 3176 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCI8 protein_id gnl|my_center|LOCUS_24550 >Feature sequence0463 1312 104 gene locus_tag LOCUS_24560 1312 104 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_24560 1844 1371 gene locus_tag LOCUS_24570 1844 1371 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029420.1 protein_id gnl|my_center|LOCUS_24570 2944 1841 gene locus_tag LOCUS_24580 2944 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence0464 1313 2302 gene locus_tag LOCUS_24590 1313 2302 CDS product putative luciferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704367.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence0465 1069 224 gene locus_tag LOCUS_24600 1069 224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566704.1 protein_id gnl|my_center|LOCUS_24600 1924 1121 gene locus_tag LOCUS_24610 1924 1121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892452.1 protein_id gnl|my_center|LOCUS_24610 3039 2077 gene locus_tag LOCUS_24620 3039 2077 CDS product glutathione ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727399.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence0466 <1 1531 gene locus_tag LOCUS_24630 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MEW8:UPF0182 protein 2243 1674 gene locus_tag LOCUS_24640 2243 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2745 2821 gene locus_tag LOCUS_t00190 2745 2821 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2927 3439 gene locus_tag LOCUS_24650 2927 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence0467 67 717 gene locus_tag LOCUS_24660 67 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1444 824 gene locus_tag LOCUS_24670 1444 824 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_24670 1620 2480 gene locus_tag LOCUS_24680 1620 2480 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_24680 2591 3028 gene locus_tag LOCUS_24690 2591 3028 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence0468 >Feature sequence0469 635 225 gene locus_tag LOCUS_24700 635 225 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225300.1 protein_id gnl|my_center|LOCUS_24700 1291 731 gene locus_tag LOCUS_24710 1291 731 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731396.1 protein_id gnl|my_center|LOCUS_24710 1376 2161 gene locus_tag LOCUS_24720 1376 2161 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence0470 41 418 gene locus_tag LOCUS_24730 41 418 CDS product putative nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704251.1 protein_id gnl|my_center|LOCUS_24730 415 1620 gene locus_tag LOCUS_24740 415 1620 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704250.1 protein_id gnl|my_center|LOCUS_24740 1620 2351 gene locus_tag LOCUS_24750 1620 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704249.1 protein_id gnl|my_center|LOCUS_24750 3372 2308 gene locus_tag LOCUS_24760 3372 2308 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence0471 52 1398 gene locus_tag LOCUS_24770 52 1398 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731050.1 protein_id gnl|my_center|LOCUS_24770 1428 2381 gene locus_tag LOCUS_24780 1428 2381 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731049.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence0472 270 1175 gene locus_tag LOCUS_24790 270 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1329 2279 gene locus_tag LOCUS_24800 1329 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892156.1 protein_id gnl|my_center|LOCUS_24800 2292 2912 gene locus_tag LOCUS_24810 2292 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence0473 778 326 gene locus_tag LOCUS_24820 778 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_24820 1580 861 gene locus_tag LOCUS_24830 1580 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2823 3404 gene locus_tag LOCUS_24840 2823 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0474 418 765 gene locus_tag LOCUS_24850 418 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2585 762 gene locus_tag LOCUS_24860 2585 762 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_24860 <3407 2578 gene locus_tag LOCUS_24870 <3407 2578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030255.1:ABC transporter >Feature sequence0475 173 466 gene locus_tag LOCUS_24880 173 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_24880 488 691 gene locus_tag LOCUS_24890 488 691 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_24890 777 1952 gene locus_tag LOCUS_24900 gene gcd 777 1952 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_24900 1952 2749 gene locus_tag LOCUS_24910 1952 2749 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_24910 <3375 2764 gene locus_tag LOCUS_24920 <3375 2764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729863.1:acyl-CoA oxidase >Feature sequence0476 371 1651 gene locus_tag LOCUS_24930 371 1651 CDS product inositol phosphorylceramide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029191.1 protein_id gnl|my_center|LOCUS_24930 1958 1617 gene locus_tag LOCUS_24940 1958 1617 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_24940 2212 1955 gene locus_tag LOCUS_24950 2212 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2862 2209 gene locus_tag LOCUS_24960 2862 2209 CDS product putative cation antiporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701385.1 protein_id gnl|my_center|LOCUS_24960 <3364 2859 gene locus_tag LOCUS_24970 <3364 2859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701386.1:putative cation antiporter NADH dehydrogenase subunit >Feature sequence0477 <1 578 gene locus_tag LOCUS_24980 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893427.1:NADH-quinone oxidoreductase subunit F 575 3115 gene locus_tag LOCUS_24990 gene nuoG 575 3115 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU30 protein_id gnl|my_center|LOCUS_24990 >Feature sequence0478 412 1269 gene locus_tag LOCUS_25000 412 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25000 1266 2069 gene locus_tag LOCUS_25010 1266 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence0479 634 1413 gene locus_tag LOCUS_25020 634 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701493.1 protein_id gnl|my_center|LOCUS_25020 1410 1823 gene locus_tag LOCUS_25030 1410 1823 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730788.1 protein_id gnl|my_center|LOCUS_25030 2078 2554 gene locus_tag LOCUS_25040 2078 2554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897207.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence0480 559 1488 gene locus_tag LOCUS_25050 559 1488 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_25050 1737 2057 gene locus_tag LOCUS_25060 1737 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence0481 19 2094 gene locus_tag LOCUS_25070 19 2094 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265665.1 protein_id gnl|my_center|LOCUS_25070 2745 2149 gene locus_tag LOCUS_25080 2745 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence0482 1626 517 gene locus_tag LOCUS_25090 1626 517 CDS product putative glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701758.1 protein_id gnl|my_center|LOCUS_25090 2818 1616 gene locus_tag LOCUS_25100 2818 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence0483 33 1127 gene locus_tag LOCUS_25110 33 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1278 1565 gene locus_tag LOCUS_25120 1278 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 1727 2671 gene locus_tag LOCUS_25130 1727 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence0484 734 1855 gene locus_tag LOCUS_25140 gene aes 734 1855 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_25140 2947 1925 gene locus_tag LOCUS_25150 2947 1925 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229252.1 protein_id gnl|my_center|LOCUS_25150 3325 2981 gene locus_tag LOCUS_25160 3325 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence0485 836 249 gene locus_tag LOCUS_25170 836 249 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089436.1 protein_id gnl|my_center|LOCUS_25170 2088 805 gene locus_tag LOCUS_25180 2088 805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_25180 2176 2490 gene locus_tag LOCUS_25190 2176 2490 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977875.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence0486 1109 1954 gene locus_tag LOCUS_25200 1109 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701184.1 protein_id gnl|my_center|LOCUS_25200 3093 2320 gene locus_tag LOCUS_25210 3093 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701183.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence0487 1019 234 gene locus_tag LOCUS_25220 1019 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_25220 1084 2067 gene locus_tag LOCUS_25230 1084 2067 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728584.1 protein_id gnl|my_center|LOCUS_25230 2616 2089 gene locus_tag LOCUS_25240 2616 2089 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 protein_id gnl|my_center|LOCUS_25240 3065 2613 gene locus_tag LOCUS_25250 3065 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence0488 3176 1092 gene locus_tag LOCUS_25260 gene ponA1 3176 1092 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7G2 protein_id gnl|my_center|LOCUS_25260 >Feature sequence0489 1471 3054 gene locus_tag LOCUS_25270 1471 3054 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730330.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence0490 2080 1133 gene locus_tag LOCUS_25280 2080 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703098.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence0491 1532 1116 gene locus_tag LOCUS_25290 gene panD 1532 1116 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNF3 protein_id gnl|my_center|LOCUS_25290 2890 1532 gene locus_tag LOCUS_25300 2890 1532 CDS product putative anthranilate synthase component I TrpE2/ Salicylate synthase MbtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702980.1 protein_id gnl|my_center|LOCUS_25300 >Feature sequence0492 <1 545 gene locus_tag LOCUS_25310 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731054.1:dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein 538 1533 gene locus_tag LOCUS_25320 538 1533 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731053.1 protein_id gnl|my_center|LOCUS_25320 1530 2270 gene locus_tag LOCUS_25330 1530 2270 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence0493 702 142 gene locus_tag LOCUS_25340 702 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704846.1 protein_id gnl|my_center|LOCUS_25340 811 1740 gene locus_tag LOCUS_25350 811 1740 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013903.1 protein_id gnl|my_center|LOCUS_25350 2413 1667 gene locus_tag LOCUS_25360 2413 1667 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925773.1 protein_id gnl|my_center|LOCUS_25360 3117 2425 gene locus_tag LOCUS_25370 3117 2425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 protein_id gnl|my_center|LOCUS_25370 3304 3110 gene locus_tag LOCUS_25380 3304 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0494 637 212 gene locus_tag LOCUS_25390 637 212 CDS product hypothetical HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701427.1 protein_id gnl|my_center|LOCUS_25390 726 1997 gene locus_tag LOCUS_25400 726 1997 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701672.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence0495 1251 718 gene locus_tag LOCUS_25410 1251 718 CDS product putative transcriptional regulator, MarR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701926.1 protein_id gnl|my_center|LOCUS_25410 2630 1287 gene locus_tag LOCUS_25420 2630 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_25420 <3298 2737 gene locus_tag LOCUS_25430 <3298 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777112.1:SAM-dependent methyltransferase >Feature sequence0496 <1 561 gene locus_tag LOCUS_25440 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897816.1:haloacid dehalogenase 2820 640 gene locus_tag LOCUS_25450 2820 640 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731266.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence0497 2599 2174 gene locus_tag LOCUS_25460 2599 2174 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_25460 <3294 2680 gene locus_tag LOCUS_25470 <3294 2680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228540.1:amidohydrolase >Feature sequence0498 1668 664 gene locus_tag LOCUS_25480 1668 664 CDS product pyruvate dehydrogenase E1 component beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705639.1 protein_id gnl|my_center|LOCUS_25480 2747 1665 gene locus_tag LOCUS_25490 2747 1665 CDS product pyruvate dehydrogenase E1 component alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705640.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence0499 647 162 gene locus_tag LOCUS_25500 647 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1208 672 gene locus_tag LOCUS_25510 1208 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1442 2371 gene locus_tag LOCUS_25520 1442 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence0500 <1 841 gene locus_tag LOCUS_25530 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703217.1:putative monooxygenase 975 1448 gene locus_tag LOCUS_25540 975 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2073 1474 gene locus_tag LOCUS_25550 2073 1474 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895798.1 protein_id gnl|my_center|LOCUS_25550 2141 3049 gene locus_tag LOCUS_25560 2141 3049 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence0501 3 740 gene locus_tag LOCUS_25570 gene proC 3 740 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR08 protein_id gnl|my_center|LOCUS_25570 868 1104 gene locus_tag LOCUS_25580 868 1104 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727305.1 protein_id gnl|my_center|LOCUS_25580 1604 2731 gene locus_tag LOCUS_25590 1604 2731 CDS product putative UDP-glucose 4-epimerase GalE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704731.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence0502 >Feature sequence0503 1127 1789 gene locus_tag LOCUS_25600 1127 1789 CDS product putative HNH endonuclease precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702306.1 protein_id gnl|my_center|LOCUS_25600 1871 2122 gene locus_tag LOCUS_25610 1871 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412671.1 protein_id gnl|my_center|LOCUS_25610 2109 2588 gene locus_tag LOCUS_25620 2109 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1B5 protein_id gnl|my_center|LOCUS_25620 <3278 2706 gene locus_tag LOCUS_25630 <3278 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412666.1:aminopeptidase >Feature sequence0504 188 853 gene locus_tag LOCUS_25640 188 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701950.1 protein_id gnl|my_center|LOCUS_25640 976 1998 gene locus_tag LOCUS_25650 976 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 protein_id gnl|my_center|LOCUS_25650 2132 2872 gene locus_tag LOCUS_25660 2132 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703269.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence0505 1295 666 gene locus_tag LOCUS_25670 1295 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702221.1 protein_id gnl|my_center|LOCUS_25670 2433 1348 gene locus_tag LOCUS_25680 2433 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730182.1 protein_id gnl|my_center|LOCUS_25680 2985 2443 gene locus_tag LOCUS_25690 2985 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence0506 125 586 gene locus_tag LOCUS_25700 125 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2007 670 gene locus_tag LOCUS_25710 2007 670 CDS product putative peptidase M1, membrane alanine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701262.1 protein_id gnl|my_center|LOCUS_25710 <3273 2014 gene locus_tag LOCUS_25720 <3273 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701263.1:putative non-ribosomal peptide synthase >Feature sequence0507 607 1272 gene locus_tag LOCUS_25730 607 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701950.1 protein_id gnl|my_center|LOCUS_25730 <3268 1309 gene locus_tag LOCUS_25740 <3268 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730424.1:membrane protein >Feature sequence0508 693 346 gene locus_tag LOCUS_25750 693 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1961 789 gene locus_tag LOCUS_25760 1961 789 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_25760 2936 2031 gene locus_tag LOCUS_25770 2936 2031 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence0509 1459 5 gene locus_tag LOCUS_25780 gene zwf 1459 5 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_25780 2716 1508 gene locus_tag LOCUS_25790 2716 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703819.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence0510 >Feature sequence0511 <1 1181 gene locus_tag LOCUS_25800 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730437.1:membrane protein 1187 1567 gene locus_tag LOCUS_25810 1187 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2809 1616 gene locus_tag LOCUS_25820 2809 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013328.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence0512 202 1095 gene locus_tag LOCUS_25830 gene mshB 202 1095 CDS product 1D-myo-inositol 2-acetamido-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2I7 protein_id gnl|my_center|LOCUS_25830 1123 1281 gene locus_tag LOCUS_25840 1123 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1368 1820 gene locus_tag LOCUS_25850 1368 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2463 1747 gene locus_tag LOCUS_25860 2463 1747 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_25860 <3231 2505 gene locus_tag LOCUS_25870 <3231 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406262.1:membrane protein >Feature sequence0513 664 1008 gene locus_tag LOCUS_25880 664 1008 CDS product protein lsr2 precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701298.1 protein_id gnl|my_center|LOCUS_25880 1360 1716 gene locus_tag LOCUS_25890 1360 1716 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDG9 protein_id gnl|my_center|LOCUS_25890 1716 3221 gene locus_tag LOCUS_25900 1716 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68908 protein_id gnl|my_center|LOCUS_25900 >Feature sequence0514 1583 192 gene locus_tag LOCUS_25910 1583 192 CDS product putative putrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705047.1 protein_id gnl|my_center|LOCUS_25910 2906 1758 gene locus_tag LOCUS_25920 2906 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence0515 <3220 900 gene locus_tag LOCUS_25930 <3220 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QS29:RecBCD enzyme subunit RecB >Feature sequence0516 <1 1341 gene locus_tag LOCUS_25940 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027517.1:cyclic diguanylate phosphodiesterase 1459 2802 gene locus_tag LOCUS_25950 1459 2802 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAV2 protein_id gnl|my_center|LOCUS_25950 >Feature sequence0517 274 1035 gene locus_tag LOCUS_25960 274 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1207 1686 gene locus_tag LOCUS_25970 1207 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1683 1925 gene locus_tag LOCUS_25980 1683 1925 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFM7 protein_id gnl|my_center|LOCUS_25980 1941 2480 gene locus_tag LOCUS_25990 gene rimM 1941 2480 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDI4 protein_id gnl|my_center|LOCUS_25990 2484 3164 gene locus_tag LOCUS_26000 gene trmD 2484 3164 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV40 protein_id gnl|my_center|LOCUS_26000 >Feature sequence0518 2679 1264 gene locus_tag LOCUS_26010 2679 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0519 1089 157 gene locus_tag LOCUS_26020 1089 157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_26020 2243 1134 gene locus_tag LOCUS_26030 2243 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2393 3100 gene locus_tag LOCUS_26040 2393 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence0520 1858 2268 gene locus_tag LOCUS_26050 1858 2268 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_26050 2329 3081 gene locus_tag LOCUS_26060 2329 3081 CDS product PEP phosphonomutase and related enzymes inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705134.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence0521 459 540 gene locus_tag LOCUS_t00200 459 540 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1099 2268 gene locus_tag LOCUS_26070 gene dnaN 1099 2268 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDH7 protein_id gnl|my_center|LOCUS_26070 >Feature sequence0522 2060 891 gene locus_tag LOCUS_26080 2060 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703588.1 protein_id gnl|my_center|LOCUS_26080 3122 2214 gene locus_tag LOCUS_26090 3122 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728762.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence0523 2116 734 gene locus_tag LOCUS_26100 2116 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 <3170 2146 gene locus_tag LOCUS_26110 <3170 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729681.1:endopeptidase >Feature sequence0524 <1 1131 gene locus_tag LOCUS_26120 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525316.1:diguanylate cyclase 1405 1109 gene locus_tag LOCUS_26130 1405 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1487 1690 gene locus_tag LOCUS_26140 1487 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26140 1736 2212 gene locus_tag LOCUS_26150 1736 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26150 2213 2839 gene locus_tag LOCUS_26160 2213 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26160 >Feature sequence0525 958 80 gene locus_tag LOCUS_26170 958 80 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_26170 1283 1116 gene locus_tag LOCUS_26180 1283 1116 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_26180 1988 1380 gene locus_tag LOCUS_26190 1988 1380 CDS product putative DNA-3-methyladenine glycosylase I TagA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702091.1 protein_id gnl|my_center|LOCUS_26190 2398 1985 gene locus_tag LOCUS_26200 2398 1985 CDS product cell division protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908107.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence0526 1247 2392 gene locus_tag LOCUS_26210 1247 2392 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NT50 protein_id gnl|my_center|LOCUS_26210 2398 2685 gene locus_tag LOCUS_26220 2398 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2712 3041 gene locus_tag LOCUS_26230 2712 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704133.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence0527 1 450 gene locus_tag LOCUS_26240 1 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 560 634 gene locus_tag LOCUS_t00210 560 634 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 824 897 gene locus_tag LOCUS_t00220 824 897 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1289 2239 gene locus_tag LOCUS_26250 1289 2239 CDS product putative acyl-[acyl-carrier protein] desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705127.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence0528 1612 536 gene locus_tag LOCUS_26260 1612 536 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 protein_id gnl|my_center|LOCUS_26260 2900 1908 gene locus_tag LOCUS_26270 2900 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence0529 256 975 gene locus_tag LOCUS_26280 256 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703269.1 protein_id gnl|my_center|LOCUS_26280 1791 988 gene locus_tag LOCUS_26290 gene nei 1791 988 CDS product putative endonuclease 8 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86820 protein_id gnl|my_center|LOCUS_26290 <3142 1862 gene locus_tag LOCUS_26300 <3142 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267888.1:membrane protein >Feature sequence0530 <1 1960 gene locus_tag LOCUS_26310 <1 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702133.1:putative 2-oxoglutarate dehydrogenase SucA 2889 2242 gene locus_tag LOCUS_26320 2889 2242 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027364.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence0531 443 985 gene locus_tag LOCUS_26330 443 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2261 1479 gene locus_tag LOCUS_26340 2261 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2145 2417 gene locus_tag LOCUS_26350 2145 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence0532 2162 1083 gene locus_tag LOCUS_26360 2162 1083 CDS product FMNH2-utilizing oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_26360 <3137 2155 gene locus_tag LOCUS_26370 <3137 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900733.1:peptide ABC transporter ATP-binding protein >Feature sequence0533 >Feature sequence0534 3 236 gene locus_tag LOCUS_26380 3 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 243 791 gene locus_tag LOCUS_26390 243 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704338.1 protein_id gnl|my_center|LOCUS_26390 1878 832 gene locus_tag LOCUS_26400 1878 832 CDS product putative sugar-phosphate nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704340.1 protein_id gnl|my_center|LOCUS_26400 2827 1916 gene locus_tag LOCUS_26410 2827 1916 CDS product putative dTDP-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704341.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence0535 403 912 gene locus_tag LOCUS_26420 gene pra 403 912 CDS product protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119407.1 protein_id gnl|my_center|LOCUS_26420 957 1679 gene locus_tag LOCUS_26430 957 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223665.1 protein_id gnl|my_center|LOCUS_26430 2858 1749 gene locus_tag LOCUS_26440 2858 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704668.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence0536 86 1447 gene locus_tag LOCUS_26450 86 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899270.1 protein_id gnl|my_center|LOCUS_26450 1912 1487 gene locus_tag LOCUS_26460 1912 1487 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_26460 2381 2001 gene locus_tag LOCUS_26470 2381 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702938.1 protein_id gnl|my_center|LOCUS_26470 <3123 2400 gene locus_tag LOCUS_26480 <3123 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702936.1:putative cobalamin biosynthesis protein CobN >Feature sequence0537 826 2478 gene locus_tag LOCUS_26490 gene argS 826 2478 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X5M0 protein_id gnl|my_center|LOCUS_26490 >Feature sequence0538 1352 318 gene locus_tag LOCUS_26500 1352 318 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_26500 1430 1942 gene locus_tag LOCUS_26510 1430 1942 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222196.1 protein_id gnl|my_center|LOCUS_26510 2001 2086 gene locus_tag LOCUS_t00230 2001 2086 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0539 782 1636 gene locus_tag LOCUS_26520 782 1636 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_26520 1709 2536 gene locus_tag LOCUS_26530 1709 2536 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703834.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0540 5 610 gene locus_tag LOCUS_26540 5 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1147 611 gene locus_tag LOCUS_26550 1147 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1649 1209 gene locus_tag LOCUS_26560 1649 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731305.1 protein_id gnl|my_center|LOCUS_26560 2646 1720 gene locus_tag LOCUS_26570 2646 1720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_26570 2982 2728 gene locus_tag LOCUS_26580 gene rpsR 2982 2728 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66455 protein_id gnl|my_center|LOCUS_26580 >Feature sequence0541 >Feature sequence0542 2261 2917 gene locus_tag LOCUS_26590 2261 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence0543 357 431 gene locus_tag LOCUS_t00240 357 431 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 500 1642 gene locus_tag LOCUS_26600 500 1642 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_26600 1639 2748 gene locus_tag LOCUS_26610 1639 2748 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230064.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence0544 60 980 gene locus_tag LOCUS_26620 60 980 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRZ8 protein_id gnl|my_center|LOCUS_26620 1626 991 gene locus_tag LOCUS_26630 1626 991 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence0545 762 475 gene locus_tag LOCUS_26640 762 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900476.1 protein_id gnl|my_center|LOCUS_26640 1495 845 gene locus_tag LOCUS_26650 gene sepF 1495 845 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP43 protein_id gnl|my_center|LOCUS_26650 2314 1577 gene locus_tag LOCUS_26660 2314 1577 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729651.1 protein_id gnl|my_center|LOCUS_26660 3021 2311 gene locus_tag LOCUS_26670 3021 2311 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP41 protein_id gnl|my_center|LOCUS_26670 >Feature sequence0546 2291 1590 gene locus_tag LOCUS_26680 2291 1590 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730747.1 protein_id gnl|my_center|LOCUS_26680 2386 3072 gene locus_tag LOCUS_26690 2386 3072 CDS product mycofactocin system creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727661.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence0547 496 984 gene locus_tag LOCUS_26700 496 984 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316616.1 protein_id gnl|my_center|LOCUS_26700 1992 1003 gene locus_tag LOCUS_26710 1992 1003 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892375.1 protein_id gnl|my_center|LOCUS_26710 2143 2424 gene locus_tag LOCUS_26720 2143 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704722.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence0548 1344 2207 gene locus_tag LOCUS_26730 1344 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730466.1 protein_id gnl|my_center|LOCUS_26730 <3084 2275 gene locus_tag LOCUS_26740 <3084 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R3L4:bifunctional purine biosynthesis protein PurH >Feature sequence0549 760 1077 gene locus_tag LOCUS_26750 760 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26750 1168 1464 gene locus_tag LOCUS_26760 1168 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26760 1493 2203 gene locus_tag LOCUS_26770 gene dedA 1493 2203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230838.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence0550 <1 594 gene locus_tag LOCUS_26780 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9XA53:transport permease protein 1138 617 gene locus_tag LOCUS_26790 1138 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1164 1361 gene locus_tag LOCUS_26800 1164 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2281 1313 gene locus_tag LOCUS_26810 2281 1313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_26810 <3067 2353 gene locus_tag LOCUS_26820 <3067 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224485.1:23S rRNA methyltransferase >Feature sequence0551 1379 1453 gene locus_tag LOCUS_t00250 1379 1453 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0552 220 765 gene locus_tag LOCUS_26830 220 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26830 774 2399 gene locus_tag LOCUS_26840 gene ctpC 774 2399 CDS product putative manganese/zinc-exporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPT5 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26840 2702 2445 gene locus_tag LOCUS_26850 2702 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703314.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence0553 1774 320 gene locus_tag LOCUS_26860 1774 320 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_26860 2837 2067 gene locus_tag LOCUS_26870 2837 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence0554 1874 204 gene locus_tag LOCUS_26880 1874 204 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223933.1 protein_id gnl|my_center|LOCUS_26880 <3040 1973 gene locus_tag LOCUS_26890 <3040 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731200.1:penicillin-binding protein >Feature sequence0555 2871 394 gene locus_tag LOCUS_26900 gene relA 2871 394 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894345.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence0556 1290 1571 gene locus_tag LOCUS_26910 1290 1571 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_26910 2481 1579 gene locus_tag LOCUS_26920 2481 1579 CDS product putative NADH pyrophosphatase/NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704243.1 protein_id gnl|my_center|LOCUS_26920 <3029 2505 gene locus_tag LOCUS_26930 <3029 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416831.1:NAD-binding protein of Kef-type K+ transporter >Feature sequence0557 2827 2183 gene locus_tag LOCUS_26940 2827 2183 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893568.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence0558 317 586 gene locus_tag LOCUS_26950 317 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 <3020 557 gene locus_tag LOCUS_26960 <3020 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QX55:DNA-directed DNA polymerase >Feature sequence0559 >Feature sequence0560 9 830 gene locus_tag LOCUS_26970 9 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 827 2932 gene locus_tag LOCUS_26980 827 2932 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence0561 2322 1129 gene locus_tag LOCUS_26990 2322 1129 CDS product putative ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702703.1 protein_id gnl|my_center|LOCUS_26990 <3009 2319 gene locus_tag LOCUS_27000 <3009 2319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702704.1:putative ubiquinol-cytochrome c reductase cytochrome c subunit >Feature sequence0562 801 106 gene locus_tag LOCUS_27010 801 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1748 798 gene locus_tag LOCUS_27020 1748 798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_27020 2104 1745 gene locus_tag LOCUS_27030 2104 1745 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804331.1 protein_id gnl|my_center|LOCUS_27030 2208 2780 gene locus_tag LOCUS_27040 2208 2780 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728457.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence0563 170 793 gene locus_tag LOCUS_27050 170 793 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 protein_id gnl|my_center|LOCUS_27050 1202 849 gene locus_tag LOCUS_27060 1202 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence0564 <1 794 gene locus_tag LOCUS_27070 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229307.1:sarcosine oxidase subunit alpha 787 1365 gene locus_tag LOCUS_27080 gene soxG 787 1365 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_27080 1398 2324 gene locus_tag LOCUS_27090 gene folP 1398 2324 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_27090 2321 2731 gene locus_tag LOCUS_27100 gene gcvH 2321 2731 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6S0 protein_id gnl|my_center|LOCUS_27100 >Feature sequence0565 2349 2981 gene locus_tag LOCUS_27110 2349 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702311.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence0566 2193 88 gene locus_tag LOCUS_27120 2193 88 CDS product putative serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704951.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence0567 646 452 gene locus_tag LOCUS_27130 646 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 949 1461 gene locus_tag LOCUS_27140 949 1461 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 protein_id gnl|my_center|LOCUS_27140 1550 1861 gene locus_tag LOCUS_27150 1550 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence0568 1107 265 gene locus_tag LOCUS_27160 1107 265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 protein_id gnl|my_center|LOCUS_27160 1288 1443 gene locus_tag LOCUS_27170 1288 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence0569 <1 533 gene locus_tag LOCUS_27180 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QUY7:glutamate--tRNA ligase 580 1590 gene locus_tag LOCUS_27190 580 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 <2975 1542 gene locus_tag LOCUS_27200 <2975 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228747.1:DNA polymerase I >Feature sequence0570 1891 1205 gene locus_tag LOCUS_27210 1891 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 <2975 1888 gene locus_tag LOCUS_27220 <2975 1888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_885251.2:monovalent cation/H+ antiporter subunit A >Feature sequence0571 483 1313 gene locus_tag LOCUS_27230 483 1313 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_27230 1438 1620 gene locus_tag LOCUS_27240 1438 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1639 2193 gene locus_tag LOCUS_27250 1639 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 <2970 2380 gene locus_tag LOCUS_27260 <2970 2380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730151.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence0572 1170 457 gene locus_tag LOCUS_27270 1170 457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_27270 1290 2336 gene locus_tag LOCUS_27280 1290 2336 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence0573 125 736 gene locus_tag LOCUS_27290 125 736 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXV0 protein_id gnl|my_center|LOCUS_27290 2553 871 gene locus_tag LOCUS_27300 2553 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence0574 474 1877 gene locus_tag LOCUS_27310 474 1877 CDS product putative dihydrolipoamide dehydrogenase LpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704384.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence0575 1356 2090 gene locus_tag LOCUS_27320 1356 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416873.1 protein_id gnl|my_center|LOCUS_27320 2228 2455 gene locus_tag LOCUS_27330 2228 2455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence0576 2 223 gene locus_tag LOCUS_27340 2 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1741 254 gene locus_tag LOCUS_27350 1741 254 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727084.1 protein_id gnl|my_center|LOCUS_27350 2863 1805 gene locus_tag LOCUS_27360 2863 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704668.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence0577 991 1278 gene locus_tag LOCUS_27370 gene rpsF 991 1278 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMI2 protein_id gnl|my_center|LOCUS_27370 1336 1881 gene locus_tag LOCUS_27380 gene ssb 1336 1881 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGD5 protein_id gnl|my_center|LOCUS_27380 1924 2166 gene locus_tag LOCUS_27390 gene rpsR1 1924 2166 CDS product 30S ribosomal protein S18 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66470 protein_id gnl|my_center|LOCUS_27390 2182 2637 gene locus_tag LOCUS_27400 gene rplI 2182 2637 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH79 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0578 1361 618 gene locus_tag LOCUS_27410 1361 618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537572.1 protein_id gnl|my_center|LOCUS_27410 2137 1358 gene locus_tag LOCUS_27420 2137 1358 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_27420 <2944 2134 gene locus_tag LOCUS_27430 <2944 2134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530914.1:ABC transporter permease >Feature sequence0579 447 43 gene locus_tag LOCUS_27440 447 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2428 596 gene locus_tag LOCUS_27450 gene cotA 2428 596 CDS product spore coat protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07788 protein_id gnl|my_center|LOCUS_27450 >Feature sequence0580 <1 687 gene locus_tag LOCUS_27460 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974568.1:iron ABC transporter substrate-binding protein 2665 791 gene locus_tag LOCUS_27470 2665 791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence0581 2061 1315 gene locus_tag LOCUS_27480 2061 1315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731193.1 protein_id gnl|my_center|LOCUS_27480 2933 2058 gene locus_tag LOCUS_27490 2933 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence0582 <1 1452 gene locus_tag LOCUS_27500 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393615.1:CdaR family transcriptional regulator >Feature sequence0583 2574 1342 gene locus_tag LOCUS_27510 2574 1342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence0584 1636 2628 gene locus_tag LOCUS_27520 1636 2628 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731057.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence0585 665 1936 gene locus_tag LOCUS_27530 gene ampG4 665 1936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_27530 2380 1961 gene locus_tag LOCUS_27540 2380 1961 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031354.1 protein_id gnl|my_center|LOCUS_27540 2780 2469 gene locus_tag LOCUS_27550 2780 2469 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence0586 2364 976 gene locus_tag LOCUS_27560 2364 976 CDS product UBA/THIF-type NAD/FAD binding fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702828.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence0587 770 138 gene locus_tag LOCUS_27570 770 138 CDS product putative two-component response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703361.1 protein_id gnl|my_center|LOCUS_27570 891 967 gene locus_tag LOCUS_t00260 891 967 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1031 1207 gene locus_tag LOCUS_27580 1031 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1211 1942 gene locus_tag LOCUS_27590 1211 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_27590 <2911 1927 gene locus_tag LOCUS_27600 <2911 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258990.1:AraC family transcriptional regulator >Feature sequence0588 545 1216 gene locus_tag LOCUS_27610 545 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1328 2227 gene locus_tag LOCUS_27620 1328 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701631.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence0589 <2896 173 gene locus_tag LOCUS_27630 <2896 173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QWX4:phosphoenolpyruvate carboxylase >Feature sequence0590 1164 865 gene locus_tag LOCUS_27640 gene groS 1164 865 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSS3 protein_id gnl|my_center|LOCUS_27640 >Feature sequence0591 127 873 gene locus_tag LOCUS_27650 127 873 CDS product putative polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702942.1 protein_id gnl|my_center|LOCUS_27650 1381 893 gene locus_tag LOCUS_27660 1381 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27660 1690 1418 gene locus_tag LOCUS_27670 1690 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2361 1687 gene locus_tag LOCUS_27680 2361 1687 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence0592 2734 1343 gene locus_tag LOCUS_27690 2734 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728198.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence0593 <1 910 gene locus_tag LOCUS_27700 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893402.1:NADPH:quinone oxidoreductase 2287 932 gene locus_tag LOCUS_27710 2287 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703126.1 protein_id gnl|my_center|LOCUS_27710 2874 2284 gene locus_tag LOCUS_27720 2874 2284 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence0594 1009 149 gene locus_tag LOCUS_27730 1009 149 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP24 protein_id gnl|my_center|LOCUS_27730 1294 2373 gene locus_tag LOCUS_27740 1294 2373 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence0595 636 1427 gene locus_tag LOCUS_27750 636 1427 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726964.1 protein_id gnl|my_center|LOCUS_27750 1582 1887 gene locus_tag LOCUS_27760 1582 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0596 183 803 gene locus_tag LOCUS_27770 183 803 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_27770 1906 815 gene locus_tag LOCUS_27780 gene aroF 1906 815 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0X4 protein_id gnl|my_center|LOCUS_27780 >Feature sequence0597 948 415 gene locus_tag LOCUS_27790 948 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 protein_id gnl|my_center|LOCUS_27790 2129 999 gene locus_tag LOCUS_27800 2129 999 CDS product putative dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702927.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence0598 <1 865 gene locus_tag LOCUS_27810 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227899.1:ABC transporter ATP-binding protein 862 1719 gene locus_tag LOCUS_27820 862 1719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227901.1 protein_id gnl|my_center|LOCUS_27820 2592 1726 gene locus_tag LOCUS_27830 2592 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223088.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence0599 1790 1128 gene locus_tag LOCUS_27840 1790 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence0600 >Feature sequence0601 422 916 gene locus_tag LOCUS_27850 422 916 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897577.1 protein_id gnl|my_center|LOCUS_27850 941 1873 gene locus_tag LOCUS_27860 941 1873 CDS product putative epoxide hydrolase EphE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701175.1 protein_id gnl|my_center|LOCUS_27860 <2849 1884 gene locus_tag LOCUS_27870 <2849 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731101.1:acid resistance periplasmic serine protease MarP >Feature sequence0602 739 107 gene locus_tag LOCUS_27880 739 107 CDS product putative O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLM0 protein_id gnl|my_center|LOCUS_27880 904 1584 gene locus_tag LOCUS_27890 gene sigE 904 1584 CDS product ECF RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGG7 protein_id gnl|my_center|LOCUS_27890 1601 1927 gene locus_tag LOCUS_27900 gene rseA 1601 1927 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2D3 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0603 1822 104 gene locus_tag LOCUS_27910 1822 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702687.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence0604 585 130 gene locus_tag LOCUS_27920 585 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 994 662 gene locus_tag LOCUS_27930 994 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1075 1776 gene locus_tag LOCUS_27940 1075 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2191 1817 gene locus_tag LOCUS_27950 2191 1817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230088.1 protein_id gnl|my_center|LOCUS_27950 2840 2409 gene locus_tag LOCUS_27960 2840 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0605 <1 765 gene locus_tag LOCUS_27970 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083776.1:diguanylate cyclase 787 2724 gene locus_tag LOCUS_27980 787 2724 CDS product putative gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703521.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence0606 1026 418 gene locus_tag LOCUS_27990 gene desR 1026 418 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_27990 2186 1023 gene locus_tag LOCUS_28000 gene desK 2186 1023 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226388.1 protein_id gnl|my_center|LOCUS_28000 <2842 2179 gene locus_tag LOCUS_28010 <2842 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228377.1:ABC transporter >Feature sequence0607 913 1179 gene locus_tag LOCUS_28020 gene tatA 913 1179 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66890 protein_id gnl|my_center|LOCUS_28020 1289 2260 gene locus_tag LOCUS_28030 gene tatC 1289 2260 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ39 protein_id gnl|my_center|LOCUS_28030 >Feature sequence0608 305 862 gene locus_tag LOCUS_28040 305 862 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227130.1 protein_id gnl|my_center|LOCUS_28040 1045 1872 gene locus_tag LOCUS_28050 1045 1872 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_28050 2173 1988 gene locus_tag LOCUS_28060 2173 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2531 2145 gene locus_tag LOCUS_28070 2531 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0609 1320 397 gene locus_tag LOCUS_28080 gene coaA 1320 397 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKN0 protein_id gnl|my_center|LOCUS_28080 1456 2652 gene locus_tag LOCUS_28090 1456 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730416.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence0610 1918 1355 gene locus_tag LOCUS_28100 1918 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence0611 1023 274 gene locus_tag LOCUS_28110 1023 274 CDS product acetylglucosaminylphosphatidylinositol deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766237.1 protein_id gnl|my_center|LOCUS_28110 2015 1017 gene locus_tag LOCUS_28120 2015 1017 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637016.2 protein_id gnl|my_center|LOCUS_28120 2731 2012 gene locus_tag LOCUS_28130 2731 2012 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727406.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence0612 <1 748 gene locus_tag LOCUS_28140 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896467.1:ABC transporter permease 748 1581 gene locus_tag LOCUS_28150 748 1581 CDS product putative sugar ABC transporter, permease protein SugB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702114.1 protein_id gnl|my_center|LOCUS_28150 1587 2756 gene locus_tag LOCUS_28160 1587 2756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence0613 153 1160 gene locus_tag LOCUS_28170 153 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027633.1 protein_id gnl|my_center|LOCUS_28170 2410 1184 gene locus_tag LOCUS_28180 2410 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0614 750 1397 gene locus_tag LOCUS_28190 gene pdxH 750 1397 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R420 protein_id gnl|my_center|LOCUS_28190 1394 2725 gene locus_tag LOCUS_28200 1394 2725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence0615 953 264 gene locus_tag LOCUS_28210 953 264 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729212.1 protein_id gnl|my_center|LOCUS_28210 2674 953 gene locus_tag LOCUS_28220 gene ureC 2674 953 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYE0 protein_id gnl|my_center|LOCUS_28220 >Feature sequence0616 4 951 gene locus_tag LOCUS_28230 4 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1183 2397 gene locus_tag LOCUS_28240 1183 2397 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229356.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence0617 52 867 gene locus_tag LOCUS_28250 52 867 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228326.1 protein_id gnl|my_center|LOCUS_28250 1225 1632 gene locus_tag LOCUS_28260 1225 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence0618 875 474 gene locus_tag LOCUS_28270 875 474 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978036.1 protein_id gnl|my_center|LOCUS_28270 977 1129 gene locus_tag LOCUS_28280 977 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence0619 1745 1230 gene locus_tag LOCUS_28290 gene argR 1745 1230 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB01 protein_id gnl|my_center|LOCUS_28290 2677 1742 gene locus_tag LOCUS_28300 gene argF 2677 1742 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYS8 protein_id gnl|my_center|LOCUS_28300 >Feature sequence0620 128 349 gene locus_tag LOCUS_28310 128 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1056 634 gene locus_tag LOCUS_28320 1056 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1757 2641 gene locus_tag LOCUS_28330 1757 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence0621 676 1146 gene locus_tag LOCUS_28340 676 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401230.1 protein_id gnl|my_center|LOCUS_28340 1143 1808 gene locus_tag LOCUS_28350 1143 1808 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727344.1 protein_id gnl|my_center|LOCUS_28350 <2801 1795 gene locus_tag LOCUS_28360 <2801 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402890.1:integral membrane protein >Feature sequence0622 >Feature sequence0623 371 1624 gene locus_tag LOCUS_28370 gene serS 371 1624 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R638 protein_id gnl|my_center|LOCUS_28370 2450 1632 gene locus_tag LOCUS_28380 2450 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence0624 >Feature sequence0625 1050 310 gene locus_tag LOCUS_28390 1050 310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_28390 1243 1043 gene locus_tag LOCUS_28400 1243 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28400 1846 1340 gene locus_tag LOCUS_28410 1846 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28410 <2792 1843 gene locus_tag LOCUS_28420 <2792 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887722.1:branched-chain amino acid ABC transporter permease >Feature sequence0626 45 974 gene locus_tag LOCUS_28430 45 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1088 1903 gene locus_tag LOCUS_28440 1088 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2003 2203 gene locus_tag LOCUS_28450 2003 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 2200 2586 gene locus_tag LOCUS_28460 2200 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2628 2780 gene locus_tag LOCUS_28470 2628 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence0627 531 40 gene locus_tag LOCUS_28480 531 40 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705154.1 protein_id gnl|my_center|LOCUS_28480 <2786 702 gene locus_tag LOCUS_28490 <2786 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228760.1:vanomycin resistance protein VanB >Feature sequence0628 <1 1222 gene locus_tag LOCUS_28500 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704131.1:putative monooxygenase 1789 1298 gene locus_tag LOCUS_28510 1789 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1998 1786 gene locus_tag LOCUS_28520 1998 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2131 1982 gene locus_tag LOCUS_28530 2131 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence0629 1570 2016 gene locus_tag LOCUS_28540 1570 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence0630 1824 781 gene locus_tag LOCUS_28550 1824 781 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence0631 1800 1054 gene locus_tag LOCUS_28560 1800 1054 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804160.1 protein_id gnl|my_center|LOCUS_28560 2753 1893 gene locus_tag LOCUS_28570 2753 1893 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence0632 <1 1414 gene locus_tag LOCUS_28580 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R0W9:trehalase 2381 1425 gene locus_tag LOCUS_28590 2381 1425 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702380.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence0633 1912 2646 gene locus_tag LOCUS_28600 1912 2646 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729568.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence0634 185 1366 gene locus_tag LOCUS_28610 185 1366 CDS product putative lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701711.1 protein_id gnl|my_center|LOCUS_28610 1363 2535 gene locus_tag LOCUS_28620 1363 2535 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896558.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence0635 1270 617 gene locus_tag LOCUS_28630 1270 617 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 protein_id gnl|my_center|LOCUS_28630 1350 2672 gene locus_tag LOCUS_28640 gene mqo 1350 2672 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5E9 protein_id gnl|my_center|LOCUS_28640 >Feature sequence0636 1075 1497 gene locus_tag LOCUS_28650 1075 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702623.1 protein_id gnl|my_center|LOCUS_28650 1529 1990 gene locus_tag LOCUS_28660 1529 1990 CDS product putative peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIE3 protein_id gnl|my_center|LOCUS_28660 2078 2151 gene locus_tag LOCUS_t00270 2078 2151 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0637 <1 1184 gene locus_tag LOCUS_28670 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QV25:chromosome partition protein Smc 1824 1192 gene locus_tag LOCUS_28680 1824 1192 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence0638 1449 388 gene locus_tag LOCUS_28690 1449 388 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_28690 2483 1446 gene locus_tag LOCUS_28700 2483 1446 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence0639 1707 442 gene locus_tag LOCUS_28710 1707 442 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN07 protein_id gnl|my_center|LOCUS_28710 >Feature sequence0640 <1 1155 gene locus_tag LOCUS_28720 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704861.1:putative lipase 1207 1848 gene locus_tag LOCUS_28730 1207 1848 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027327.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0641 <1 2125 gene locus_tag LOCUS_28740 <1 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727490.1:membrane protein >Feature sequence0642 626 18 gene locus_tag LOCUS_28750 626 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1207 704 gene locus_tag LOCUS_28760 1207 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704795.1 protein_id gnl|my_center|LOCUS_28760 1765 1286 gene locus_tag LOCUS_28770 1765 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence0643 660 142 gene locus_tag LOCUS_28780 gene lprB 660 142 CDS product putative lipoprotein LprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U093 protein_id gnl|my_center|LOCUS_28780 2148 733 gene locus_tag LOCUS_28790 2148 733 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703660.1 protein_id gnl|my_center|LOCUS_28790 <2728 2195 gene locus_tag LOCUS_28800 <2728 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224757.1:TetR family transcriptional regulator >Feature sequence0644 612 974 gene locus_tag LOCUS_28810 612 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1095 2501 gene locus_tag LOCUS_28820 1095 2501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence0645 <1 857 gene locus_tag LOCUS_28830 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230815.1:lipase 854 2605 gene locus_tag LOCUS_28840 854 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence0646 2026 92 gene locus_tag LOCUS_28850 gene glgE 2026 92 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RP48 protein_id gnl|my_center|LOCUS_28850 >Feature sequence0647 1058 1714 gene locus_tag LOCUS_28860 1058 1714 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225737.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence0648 1124 2626 gene locus_tag LOCUS_28870 1124 2626 CDS product putative amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704061.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence0649 381 1043 gene locus_tag LOCUS_28880 381 1043 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_28880 1070 2632 gene locus_tag LOCUS_28890 1070 2632 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878190.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence0650 1919 1005 gene locus_tag LOCUS_28900 gene argB 1919 1005 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAZ8 protein_id gnl|my_center|LOCUS_28900 <2708 1916 gene locus_tag LOCUS_28910 <2708 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QYT1:arginine biosynthesis bifunctional protein ArgJ >Feature sequence0651 831 1454 gene locus_tag LOCUS_28920 831 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223230.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence0652 734 345 gene locus_tag LOCUS_28930 734 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 896 822 gene locus_tag LOCUS_t00280 896 822 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1005 934 gene locus_tag LOCUS_t00290 1005 934 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1094 1022 gene locus_tag LOCUS_t00300 1094 1022 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1360 1432 gene locus_tag LOCUS_t00310 1360 1432 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1502 1972 gene locus_tag LOCUS_28940 1502 1972 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence0653 <1 675 gene locus_tag LOCUS_28950 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727572.1:FAD-binding molybdopterin dehydrogenase >Feature sequence0654 161 1654 gene locus_tag LOCUS_28960 161 1654 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224441.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence0655 100 1683 gene locus_tag LOCUS_28970 100 1683 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702304.1 protein_id gnl|my_center|LOCUS_28970 2414 1725 gene locus_tag LOCUS_28980 2414 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730018.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence0656 <1 980 gene locus_tag LOCUS_28990 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228607.1:amino acid permease 2416 986 gene locus_tag LOCUS_29000 2416 986 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence0657 1612 2049 gene locus_tag LOCUS_29010 1612 2049 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894859.1 protein_id gnl|my_center|LOCUS_29010 <2663 2057 gene locus_tag LOCUS_29020 <2663 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730021.1:ABC transporter permease >Feature sequence0658 <1 2440 gene locus_tag LOCUS_29030 <1 2440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R1C2:NAD-specific glutamate dehydrogenase >Feature sequence0659 1211 2509 gene locus_tag LOCUS_29040 1211 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence0660 1610 2143 gene locus_tag LOCUS_29050 1610 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence0661 127 738 gene locus_tag LOCUS_29060 127 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702888.1 protein_id gnl|my_center|LOCUS_29060 987 1184 gene locus_tag LOCUS_29070 987 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730798.1 protein_id gnl|my_center|LOCUS_29070 2386 1259 gene locus_tag LOCUS_29080 gene purM 2386 1259 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI02 protein_id gnl|my_center|LOCUS_29080 >Feature sequence0662 25 1254 gene locus_tag LOCUS_29090 25 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1620 1399 gene locus_tag LOCUS_29100 1620 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 2048 1740 gene locus_tag LOCUS_29110 2048 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence0663 >Feature sequence0664 1804 500 gene locus_tag LOCUS_29120 1804 500 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence0665 <1 550 gene locus_tag LOCUS_29130 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728090.1:molybdate-binding protein 547 1356 gene locus_tag LOCUS_29140 gene modB 547 1356 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728089.1 protein_id gnl|my_center|LOCUS_29140 1353 2447 gene locus_tag LOCUS_29150 1353 2447 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728088.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence0666 1499 252 gene locus_tag LOCUS_29160 1499 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410095.1 protein_id gnl|my_center|LOCUS_29160 1672 2574 gene locus_tag LOCUS_29170 1672 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728192.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence0667 624 10 gene locus_tag LOCUS_29180 624 10 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_29180 739 1020 gene locus_tag LOCUS_29190 739 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 1445 1017 gene locus_tag LOCUS_29200 1445 1017 CDS product putative glyoxalase/bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703602.1 protein_id gnl|my_center|LOCUS_29200 1524 2540 gene locus_tag LOCUS_29210 gene corA 1524 2540 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW96 protein_id gnl|my_center|LOCUS_29210 >Feature sequence0668 >Feature sequence0669 1100 423 gene locus_tag LOCUS_29220 1100 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1272 1093 gene locus_tag LOCUS_29230 1272 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 1463 1281 gene locus_tag LOCUS_29240 1463 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence0670 214 1194 gene locus_tag LOCUS_29250 214 1194 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385705.1 protein_id gnl|my_center|LOCUS_29250 1187 2083 gene locus_tag LOCUS_29260 1187 2083 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804198.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence0671 1 1011 gene locus_tag LOCUS_29270 1 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 1394 1101 gene locus_tag LOCUS_29280 1394 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1795 1391 gene locus_tag LOCUS_29290 1795 1391 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973373.1 protein_id gnl|my_center|LOCUS_29290 <2614 1849 gene locus_tag LOCUS_29300 <2614 1849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CZA2:dihydrolipoyl dehydrogenase >Feature sequence0672 <1 1018 gene locus_tag LOCUS_29310 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MPG7:NADH-quinone oxidoreductase subunit D 1015 1911 gene locus_tag LOCUS_29320 gene nuoE 1015 1911 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65574 protein_id gnl|my_center|LOCUS_29320 >Feature sequence0673 440 997 gene locus_tag LOCUS_29330 gene frr 440 997 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGY1 protein_id gnl|my_center|LOCUS_29330 1034 1948 gene locus_tag LOCUS_29340 gene cdsA 1034 1948 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVE1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence0674 985 1725 gene locus_tag LOCUS_29350 985 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2359 1820 gene locus_tag LOCUS_29360 2359 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence0675 1492 506 gene locus_tag LOCUS_29370 1492 506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897523.1 protein_id gnl|my_center|LOCUS_29370 2430 1501 gene locus_tag LOCUS_29380 2430 1501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731055.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence0676 441 1277 gene locus_tag LOCUS_29390 441 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727857.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence0677 1327 869 gene locus_tag LOCUS_29400 1327 869 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728214.1 protein_id gnl|my_center|LOCUS_29400 1883 1392 gene locus_tag LOCUS_29410 gene ppa 1883 1392 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGT3 protein_id gnl|my_center|LOCUS_29410 >Feature sequence0678 2096 1452 gene locus_tag LOCUS_29420 2096 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence0679 209 1285 gene locus_tag LOCUS_29430 gene prfA 209 1285 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R214 protein_id gnl|my_center|LOCUS_29430 1392 2186 gene locus_tag LOCUS_29440 1392 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0680 795 1880 gene locus_tag LOCUS_29450 795 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1975 2559 gene locus_tag LOCUS_29460 1975 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence0681 22 98 gene locus_tag LOCUS_t00320 22 98 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 219 1340 gene locus_tag LOCUS_29470 219 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1557 2444 gene locus_tag LOCUS_29480 1557 2444 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068782.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0682 326 727 gene locus_tag LOCUS_29490 326 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 846 1040 gene locus_tag LOCUS_29500 846 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1600 1779 gene locus_tag LOCUS_29510 1600 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 2490 1918 gene locus_tag LOCUS_29520 2490 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence0683 1147 530 gene locus_tag LOCUS_29530 1147 530 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223522.1 protein_id gnl|my_center|LOCUS_29530 1622 1419 gene locus_tag LOCUS_29540 gene cspA 1622 1419 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence0684 108 830 gene locus_tag LOCUS_29550 gene livF 108 830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_29550 857 1735 gene locus_tag LOCUS_29560 gene livH 857 1735 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence0685 187 1341 gene locus_tag LOCUS_29570 187 1341 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_29570 1310 2185 gene locus_tag LOCUS_29580 1310 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence0686 2535 1666 gene locus_tag LOCUS_29590 2535 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence0687 1009 95 gene locus_tag LOCUS_29600 1009 95 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228378.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence0688 <2529 502 gene locus_tag LOCUS_29610 <2529 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016776.1:disulfide isomerase >Feature sequence0689 2166 553 gene locus_tag LOCUS_29620 2166 553 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence0690 1287 808 gene locus_tag LOCUS_29630 1287 808 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406264.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence0691 981 70 gene locus_tag LOCUS_29640 981 70 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 protein_id gnl|my_center|LOCUS_29640 1034 2056 gene locus_tag LOCUS_29650 1034 2056 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200039.1 protein_id gnl|my_center|LOCUS_29650 2043 2495 gene locus_tag LOCUS_29660 2043 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence0692 1704 775 gene locus_tag LOCUS_29670 1704 775 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886895.1 protein_id gnl|my_center|LOCUS_29670 <2524 1772 gene locus_tag LOCUS_29680 <2524 1772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730385.1:4-aminobutyrate aminotransferase >Feature sequence0693 287 640 gene locus_tag LOCUS_29690 287 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 785 1681 gene locus_tag LOCUS_29700 785 1681 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776004.1 protein_id gnl|my_center|LOCUS_29700 2522 1674 gene locus_tag LOCUS_29710 2522 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0694 1514 669 gene locus_tag LOCUS_29720 1514 669 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228709.1 protein_id gnl|my_center|LOCUS_29720 2143 1511 gene locus_tag LOCUS_29730 2143 1511 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_294753.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence0695 2 304 gene locus_tag LOCUS_29740 2 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 301 1557 gene locus_tag LOCUS_29750 301 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730045.1 protein_id gnl|my_center|LOCUS_29750 1574 1819 gene locus_tag LOCUS_29760 1574 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 protein_id gnl|my_center|LOCUS_29760 <2515 1921 gene locus_tag LOCUS_29770 <2515 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701783.1:putative short-chain dehydrogenase/reductase >Feature sequence0696 242 784 gene locus_tag LOCUS_29780 gene clpP3 242 784 CDS product ATP-dependent Clp protease proteolytic subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7R9 protein_id gnl|my_center|LOCUS_29780 781 1410 gene locus_tag LOCUS_29790 gene clpP4 781 1410 CDS product putative ATP-dependent Clp protease proteolytic subunit-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7S0 protein_id gnl|my_center|LOCUS_29790 1670 1368 gene locus_tag LOCUS_29800 1670 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2237 1737 gene locus_tag LOCUS_29810 2237 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702036.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence0697 <1 717 gene locus_tag LOCUS_29820 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MGY6:putative tRNA/rRNA methyltransferase 1647 793 gene locus_tag LOCUS_29830 1647 793 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230113.1 protein_id gnl|my_center|LOCUS_29830 2246 1644 gene locus_tag LOCUS_29840 2246 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence0698 602 1966 gene locus_tag LOCUS_29850 gene apeB 602 1966 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4G8 protein_id gnl|my_center|LOCUS_29850 >Feature sequence0699 <1 604 gene locus_tag LOCUS_29860 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704820.1:putative allophanate hydrolase 594 2327 gene locus_tag LOCUS_29870 gene atzF 594 2327 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728210.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0700 413 162 gene locus_tag LOCUS_29880 413 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 <2484 441 gene locus_tag LOCUS_29890 <2484 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028362.1:membrane protein >Feature sequence0701 1609 536 gene locus_tag LOCUS_29900 1609 536 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039311.1 protein_id gnl|my_center|LOCUS_29900 <2483 1708 gene locus_tag LOCUS_29910 <2483 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase >Feature sequence0702 392 1921 gene locus_tag LOCUS_29920 392 1921 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence0703 400 1212 gene locus_tag LOCUS_29930 400 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1203 2189 gene locus_tag LOCUS_29940 1203 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence0704 1318 68 gene locus_tag LOCUS_29950 1318 68 CDS product stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_29950 2467 1448 gene locus_tag LOCUS_29960 2467 1448 CDS product stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0705 815 156 gene locus_tag LOCUS_29970 gene rnhB 815 156 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDH9 protein_id gnl|my_center|LOCUS_29970 1705 914 gene locus_tag LOCUS_29980 1705 914 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNZ3 protein_id gnl|my_center|LOCUS_29980 2231 1890 gene locus_tag LOCUS_29990 gene rplS 2231 1890 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2Q6 protein_id gnl|my_center|LOCUS_29990 >Feature sequence0706 1502 393 gene locus_tag LOCUS_30000 gene gcvT 1502 393 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R067 protein_id gnl|my_center|LOCUS_30000 >Feature sequence0707 <1 1144 gene locus_tag LOCUS_30010 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730981.1:acetoacetyl-CoA synthetase 1554 1120 gene locus_tag LOCUS_30020 1554 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702301.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence0708 <1 935 gene locus_tag LOCUS_30030 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538267.1:hydantoinase B/oxoprolinase 881 2140 gene locus_tag LOCUS_30040 881 2140 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence0709 162 1754 gene locus_tag LOCUS_30050 162 1754 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896797.1 protein_id gnl|my_center|LOCUS_30050 1906 2262 gene locus_tag LOCUS_30060 1906 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence0710 35 898 gene locus_tag LOCUS_30070 35 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1553 891 gene locus_tag LOCUS_30080 1553 891 CDS product putative phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700887.1 protein_id gnl|my_center|LOCUS_30080 <2456 1553 gene locus_tag LOCUS_30090 <2456 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WIC3:prephenate dehydratase >Feature sequence0711 1268 153 gene locus_tag LOCUS_30100 1268 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894133.1 protein_id gnl|my_center|LOCUS_30100 2142 1438 gene locus_tag LOCUS_30110 2142 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence0712 53 769 gene locus_tag LOCUS_30120 gene pcaH 53 769 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_30120 762 1400 gene locus_tag LOCUS_30130 gene pcaG 762 1400 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence0713 >Feature sequence0714 2143 1505 gene locus_tag LOCUS_30140 2143 1505 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224709.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence0715 1384 410 gene locus_tag LOCUS_30150 1384 410 CDS product putative amino acid ABC transporter, substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701015.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence0716 <1 860 gene locus_tag LOCUS_30160 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R2E6:glucosyl-3-phosphoglycerate synthase <2427 1037 gene locus_tag LOCUS_30170 <2427 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704783.1:putative acyl-CoA synthetase >Feature sequence0717 547 38 gene locus_tag LOCUS_30180 547 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 835 1119 gene locus_tag LOCUS_30190 835 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 <2426 1131 gene locus_tag LOCUS_30200 <2426 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QXX7:catalase-peroxidase 2 >Feature sequence0718 >Feature sequence0719 933 1478 gene locus_tag LOCUS_30210 933 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM49 protein_id gnl|my_center|LOCUS_30210 >Feature sequence0720 <2420 1488 gene locus_tag LOCUS_30220 <2420 1488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727161.1:xanthine dehydrogenase >Feature sequence0721 461 174 gene locus_tag LOCUS_30230 461 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 643 1701 gene locus_tag LOCUS_30240 643 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1698 2207 gene locus_tag LOCUS_30250 1698 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230314.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence0722 356 180 gene locus_tag LOCUS_30260 356 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 687 382 gene locus_tag LOCUS_30270 687 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1669 791 gene locus_tag LOCUS_30280 1669 791 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727278.1 protein_id gnl|my_center|LOCUS_30280 <2408 1669 gene locus_tag LOCUS_30290 <2408 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45745:dimodular nonribosomal peptide synthase >Feature sequence0723 82 1155 gene locus_tag LOCUS_30300 82 1155 CDS product putative nucleoside hydrolase IunH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704439.1 protein_id gnl|my_center|LOCUS_30300 2130 1132 gene locus_tag LOCUS_30310 2130 1132 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728859.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence0724 <2396 1151 gene locus_tag LOCUS_30320 <2396 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226249.1:xylose ABC transporter ATP-binding protein >Feature sequence0725 1096 71 gene locus_tag LOCUS_30330 1096 71 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414790.1 protein_id gnl|my_center|LOCUS_30330 2127 1093 gene locus_tag LOCUS_30340 gene yphD 2127 1093 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565164.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence0726 310 1446 gene locus_tag LOCUS_30350 310 1446 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 protein_id gnl|my_center|LOCUS_30350 1443 2048 gene locus_tag LOCUS_30360 1443 2048 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974900.1 protein_id gnl|my_center|LOCUS_30360 2393 2055 gene locus_tag LOCUS_30370 2393 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence0727 <1 582 gene locus_tag LOCUS_30380 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42449:isocitrate lyase 747 1622 gene locus_tag LOCUS_30390 747 1622 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704821.1 protein_id gnl|my_center|LOCUS_30390 1714 1989 gene locus_tag LOCUS_30400 1714 1989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727212.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence0728 1232 1846 gene locus_tag LOCUS_30410 gene purN 1232 1846 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AQN4 protein_id gnl|my_center|LOCUS_30410 >Feature sequence0729 173 1555 gene locus_tag LOCUS_30420 173 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 <2390 1633 gene locus_tag LOCUS_30430 <2390 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNU5:DNA polymerase I >Feature sequence0730 192 1025 gene locus_tag LOCUS_30440 192 1025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_30440 1055 1900 gene locus_tag LOCUS_30450 1055 1900 CDS product putative ABC-transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701327.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence0731 <1 1367 gene locus_tag LOCUS_30460 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MIQ6:amine oxidase 1867 1496 gene locus_tag LOCUS_30470 1867 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence0732 >Feature sequence0733 166 1221 gene locus_tag LOCUS_30480 166 1221 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891989.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence0734 1 420 gene locus_tag LOCUS_30490 1 420 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_30490 420 1193 gene locus_tag LOCUS_30500 420 1193 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R390 protein_id gnl|my_center|LOCUS_30500 <2360 1168 gene locus_tag LOCUS_30510 <2360 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409492.1:membrane protein >Feature sequence0735 >Feature sequence0736 1769 765 gene locus_tag LOCUS_30520 1769 765 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898118.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence0737 1941 1672 gene locus_tag LOCUS_30530 gene rpsO 1941 1672 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD64 protein_id gnl|my_center|LOCUS_30530 >Feature sequence0738 <1 1457 gene locus_tag LOCUS_30540 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703829.1:putative transmembrane carbonic anhydrase >Feature sequence0739 <1 786 gene locus_tag LOCUS_30550 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QYQ1:pseudouridine synthase 786 1469 gene locus_tag LOCUS_30560 gene cmk 786 1469 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB31 protein_id gnl|my_center|LOCUS_30560 >Feature sequence0740 >Feature sequence0741 1066 68 gene locus_tag LOCUS_30570 1066 68 CDS product methylene-tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804400.1 protein_id gnl|my_center|LOCUS_30570 1131 1505 gene locus_tag LOCUS_30580 1131 1505 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_30580 2332 1502 gene locus_tag LOCUS_30590 2332 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence0742 341 1501 gene locus_tag LOCUS_30600 gene fadE12 341 1501 CDS product acyl-CoA dehydrogenase fadE12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQG3 protein_id gnl|my_center|LOCUS_30600 1501 2253 gene locus_tag LOCUS_30610 gene echA7 1501 2253 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence0743 1373 426 gene locus_tag LOCUS_30620 1373 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1686 1366 gene locus_tag LOCUS_30630 1686 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence0744 <1 609 gene locus_tag LOCUS_30640 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MHS0:deoxyribose-phosphate aldolase 1417 671 gene locus_tag LOCUS_30650 1417 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1549 2115 gene locus_tag LOCUS_30660 1549 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence0745 <1 700 gene locus_tag LOCUS_30670 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031584.1:membrane protein 768 1361 gene locus_tag LOCUS_30680 768 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226642.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30680 >Feature sequence0746 551 1282 gene locus_tag LOCUS_30690 551 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1381 1929 gene locus_tag LOCUS_30700 1381 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence0747 1 171 gene locus_tag LOCUS_30710 1 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 881 144 gene locus_tag LOCUS_30720 881 144 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402330.1 protein_id gnl|my_center|LOCUS_30720 1291 935 gene locus_tag LOCUS_30730 1291 935 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027712.1 protein_id gnl|my_center|LOCUS_30730 <2319 1322 gene locus_tag LOCUS_30740 <2319 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196314.1:MFS transporter >Feature sequence0748 750 977 gene locus_tag LOCUS_30750 750 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 974 1867 gene locus_tag LOCUS_30760 974 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence0749 1044 4 gene locus_tag LOCUS_30770 1044 4 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_30770 1991 1152 gene locus_tag LOCUS_30780 1991 1152 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230819.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence0750 1313 909 gene locus_tag LOCUS_30790 1313 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704450.1 protein_id gnl|my_center|LOCUS_30790 1613 2269 gene locus_tag LOCUS_30800 1613 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence0751 476 2107 gene locus_tag LOCUS_30810 476 2107 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence0752 <2308 590 gene locus_tag LOCUS_30820 <2308 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MDN5:ATP-dependent DNA helicase RecG >Feature sequence0753 <1 1893 gene locus_tag LOCUS_30830 <1 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MMK6:leucine--tRNA ligase >Feature sequence0754 495 1271 gene locus_tag LOCUS_30840 495 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence0755 716 417 gene locus_tag LOCUS_30850 gene nuoK 716 417 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU26 protein_id gnl|my_center|LOCUS_30850 1480 713 gene locus_tag LOCUS_30860 gene nuoJ 1480 713 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_30860 2022 1477 gene locus_tag LOCUS_30870 gene nuoI 2022 1477 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MPH2 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0756 3 626 gene locus_tag LOCUS_30880 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 623 1153 gene locus_tag LOCUS_30890 623 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015410.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0757 >Feature sequence0758 <2294 1647 gene locus_tag LOCUS_30900 <2294 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896889.1:acetyl-CoA carboxylase carboxyltransferase subunit >Feature sequence0759 <2292 1181 gene locus_tag LOCUS_30910 <2292 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026910.1:phytoene dehydrogenase >Feature sequence0760 1037 204 gene locus_tag LOCUS_30920 gene hmuV 1037 204 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKQ4 protein_id gnl|my_center|LOCUS_30920 2101 1034 gene locus_tag LOCUS_30930 2101 1034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence0761 739 1020 gene locus_tag LOCUS_30940 739 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1315 1869 gene locus_tag LOCUS_30950 1315 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0762 15 416 gene locus_tag LOCUS_30960 15 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 586 1101 gene locus_tag LOCUS_30970 gene rpoE 586 1101 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_30970 1098 1700 gene locus_tag LOCUS_30980 1098 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence0763 363 1688 gene locus_tag LOCUS_30990 gene ugpB 363 1688 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding lipoprotein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414501.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence0764 <1 732 gene locus_tag LOCUS_31000 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402868.1:UDP-glucose 4-epimerase 725 1378 gene locus_tag LOCUS_31010 725 1378 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMY1 protein_id gnl|my_center|LOCUS_31010 1375 2031 gene locus_tag LOCUS_31020 1375 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727343.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0765 2093 738 gene locus_tag LOCUS_31030 2093 738 CDS product xylulose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727632.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence0766 189 653 gene locus_tag LOCUS_31040 189 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence0767 1409 486 gene locus_tag LOCUS_31050 1409 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414151.1 protein_id gnl|my_center|LOCUS_31050 1642 2040 gene locus_tag LOCUS_31060 1642 2040 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728091.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence0768 2174 1341 gene locus_tag LOCUS_31070 2174 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889062.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0769 303 512 gene locus_tag LOCUS_31080 303 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 777 496 gene locus_tag LOCUS_31090 gene arsR 777 496 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_31090 906 1952 gene locus_tag LOCUS_31100 906 1952 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence0770 1688 333 gene locus_tag LOCUS_31110 1688 333 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_31110 <2270 1685 gene locus_tag LOCUS_31120 <2270 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223674.1:ABC transporter permease >Feature sequence0771 322 507 gene locus_tag LOCUS_31130 gene rpsZ 322 507 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG2 protein_id gnl|my_center|LOCUS_31130 1297 599 gene locus_tag LOCUS_31140 1297 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 <2268 1299 gene locus_tag LOCUS_31150 <2268 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224459.1:glutamine synthetase >Feature sequence0772 <1 1127 gene locus_tag LOCUS_31160 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729172.1:alpha-amylase 1343 2104 gene locus_tag LOCUS_31170 gene fabG 1343 2104 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013843.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence0773 <1 862 gene locus_tag LOCUS_31180 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013841.1:monooxygenase 1765 875 gene locus_tag LOCUS_31190 1765 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence0774 423 842 gene locus_tag LOCUS_31200 423 842 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_31200 895 1164 gene locus_tag LOCUS_31210 895 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896787.1 protein_id gnl|my_center|LOCUS_31210 1293 1772 gene locus_tag LOCUS_31220 gene furA 1293 1772 CDS product transcriptional regulator FurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A583 protein_id gnl|my_center|LOCUS_31220 >Feature sequence0775 1480 893 gene locus_tag LOCUS_31230 gene pyrR 1480 893 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCE0 protein_id gnl|my_center|LOCUS_31230 2176 1622 gene locus_tag LOCUS_31240 gene nusB 2176 1622 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWR5 protein_id gnl|my_center|LOCUS_31240 >Feature sequence0776 626 2170 gene locus_tag LOCUS_31250 626 2170 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence0777 449 1204 gene locus_tag LOCUS_31260 449 1204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727803.1 protein_id gnl|my_center|LOCUS_31260 <2262 1214 gene locus_tag LOCUS_31270 <2262 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P63776:CinA-like protein >Feature sequence0778 1481 846 gene locus_tag LOCUS_31280 1481 846 CDS product hypothetical MutT/nudix family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703100.1 protein_id gnl|my_center|LOCUS_31280 <2254 1478 gene locus_tag LOCUS_31290 <2254 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MB24:CTP synthase >Feature sequence0779 <1 663 gene locus_tag LOCUS_31300 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230133.1:fatty-acyl-CoA synthase 1311 697 gene locus_tag LOCUS_31310 1311 697 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 protein_id gnl|my_center|LOCUS_31310 >Feature sequence0780 1547 243 gene locus_tag LOCUS_31320 gene egtB 1547 243 CDS product hercynine oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAZ7 protein_id gnl|my_center|LOCUS_31320 <2244 1544 gene locus_tag LOCUS_31330 <2244 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D6W8:glutamate--cysteine ligase EgtA >Feature sequence0781 2226 1663 gene locus_tag LOCUS_31340 2226 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence0782 104 322 gene locus_tag LOCUS_31350 104 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 828 340 gene locus_tag LOCUS_31360 828 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_31360 1397 825 gene locus_tag LOCUS_31370 1397 825 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031763.1 protein_id gnl|my_center|LOCUS_31370 <2240 1467 gene locus_tag LOCUS_31380 <2240 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226857.1:multidrug ABC transporter permease >Feature sequence0783 1476 139 gene locus_tag LOCUS_31390 1476 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 protein_id gnl|my_center|LOCUS_31390 1584 2099 gene locus_tag LOCUS_31400 1584 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223196.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence0784 530 1240 gene locus_tag LOCUS_31410 530 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894179.1 protein_id gnl|my_center|LOCUS_31410 <2238 1250 gene locus_tag LOCUS_31420 <2238 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703908.1:putative FAD-dependent pyridine nucleotide-disulphide oxidoreductase >Feature sequence0785 <1 550 gene locus_tag LOCUS_31430 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730628.1:mannitol 2-dehydrogenase 1199 534 gene locus_tag LOCUS_31440 1199 534 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_31440 <2231 1192 gene locus_tag LOCUS_31450 <2231 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776429.1:potassium transporter Trk >Feature sequence0786 1670 2194 gene locus_tag LOCUS_31460 1670 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704122.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence0787 1558 674 gene locus_tag LOCUS_31470 1558 674 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031574.1 protein_id gnl|my_center|LOCUS_31470 2223 1636 gene locus_tag LOCUS_31480 2223 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence0788 296 484 gene locus_tag LOCUS_31490 296 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 681 481 gene locus_tag LOCUS_31500 681 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 931 1779 gene locus_tag LOCUS_31510 931 1779 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence0789 <2222 1368 gene locus_tag LOCUS_31520 <2222 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703279.1:putative agmatine deiminase >Feature sequence0790 <1 659 gene locus_tag LOCUS_31530 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897864.1:sulfate permease 700 2100 gene locus_tag LOCUS_31540 gene xylB 700 2100 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728930.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence0791 731 1327 gene locus_tag LOCUS_31550 gene cysE 731 1327 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730911.1 protein_id gnl|my_center|LOCUS_31550 1324 1857 gene locus_tag LOCUS_31560 1324 1857 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730915.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence0792 >Feature sequence0793 <1 800 gene locus_tag LOCUS_31570 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533091.1:2,4-dichlorophenol 6-monooxygenase 1534 788 gene locus_tag LOCUS_31580 1534 788 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804094.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence0794 <1 882 gene locus_tag LOCUS_31590 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3P1W9:1,4-dihydroxy-2-naphthoyl-CoA synthase 928 2010 gene locus_tag LOCUS_31600 928 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704668.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence0795 1837 626 gene locus_tag LOCUS_31610 1837 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence0796 1035 430 gene locus_tag LOCUS_31620 gene ruvA 1035 430 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWH5 protein_id gnl|my_center|LOCUS_31620 1649 1032 gene locus_tag LOCUS_31630 gene ruvC 1649 1032 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWH4 protein_id gnl|my_center|LOCUS_31630 >Feature sequence0797 1093 410 gene locus_tag LOCUS_31640 1093 410 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704985.1 protein_id gnl|my_center|LOCUS_31640 1707 1090 gene locus_tag LOCUS_31650 1707 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence0798 514 2064 gene locus_tag LOCUS_31660 514 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701864.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence0799 296 2056 gene locus_tag LOCUS_31670 296 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence0800 322 1038 gene locus_tag LOCUS_31680 322 1038 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_31680 1108 1181 gene locus_tag LOCUS_t00330 1108 1181 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1241 2167 gene locus_tag LOCUS_31690 1241 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence0801 505 1236 gene locus_tag LOCUS_31700 505 1236 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence0802 560 345 gene locus_tag LOCUS_31710 560 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 924 685 gene locus_tag LOCUS_31720 924 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 1185 1406 gene locus_tag LOCUS_31730 1185 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence0803 <1 850 gene locus_tag LOCUS_31740 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222995.1:MFS transporter 1667 921 gene locus_tag LOCUS_31750 1667 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence0804 >Feature sequence0805 <2150 771 gene locus_tag LOCUS_31760 <2150 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RKB5:Baeyer-Villiger monooxygenase >Feature sequence0806 1410 325 gene locus_tag LOCUS_31770 1410 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence0807 52 1179 gene locus_tag LOCUS_31780 52 1179 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894374.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence0808 >Feature sequence0809 213 620 gene locus_tag LOCUS_31790 213 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703796.1 protein_id gnl|my_center|LOCUS_31790 1999 674 gene locus_tag LOCUS_31800 1999 674 CDS product putative PhoH-like protein PhoH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701981.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence0810 834 511 gene locus_tag LOCUS_31810 834 511 CDS product putative ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702069.1 protein_id gnl|my_center|LOCUS_31810 1704 949 gene locus_tag LOCUS_31820 1704 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704222.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence0811 2102 780 gene locus_tag LOCUS_31830 2102 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702409.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence0812 669 1052 gene locus_tag LOCUS_31840 669 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 protein_id gnl|my_center|LOCUS_31840 1077 1556 gene locus_tag LOCUS_31850 gene rraA 1077 1556 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R664 protein_id gnl|my_center|LOCUS_31850 <2133 1620 gene locus_tag LOCUS_31860 <2133 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768991.1:arylesterase >Feature sequence0813 519 301 gene locus_tag LOCUS_31870 519 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 537 701 gene locus_tag LOCUS_31880 537 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 976 1182 gene locus_tag LOCUS_31890 976 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31890 1477 2010 gene locus_tag LOCUS_31900 1477 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence0814 >Feature sequence0815 906 340 gene locus_tag LOCUS_31910 906 340 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014531.1 protein_id gnl|my_center|LOCUS_31910 <2124 930 gene locus_tag LOCUS_31920 <2124 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142818.1:cholesterol oxidase >Feature sequence0816 >Feature sequence0817 <2120 890 gene locus_tag LOCUS_31930 <2120 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730186.1:peptidase >Feature sequence0818 402 680 gene locus_tag LOCUS_31940 402 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 677 949 gene locus_tag LOCUS_31950 677 949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227045.1 protein_id gnl|my_center|LOCUS_31950 1542 976 gene locus_tag LOCUS_31960 1542 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1818 1618 gene locus_tag LOCUS_31970 1818 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence0819 170 565 gene locus_tag LOCUS_31980 170 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0820 838 449 gene locus_tag LOCUS_31990 838 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1184 900 gene locus_tag LOCUS_32000 1184 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0821 552 304 gene locus_tag LOCUS_32010 552 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 676 1011 gene locus_tag LOCUS_32020 676 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1330 1004 gene locus_tag LOCUS_32030 1330 1004 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029816.1 protein_id gnl|my_center|LOCUS_32030 1894 1385 gene locus_tag LOCUS_32040 1894 1385 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD46 protein_id gnl|my_center|LOCUS_32040 >Feature sequence0822 <1 1100 gene locus_tag LOCUS_32050 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730033.1:acetyl/propionyl-CoA carboxylase subunit alpha >Feature sequence0823 <1 1315 gene locus_tag LOCUS_32060 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224965.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon >Feature sequence0824 552 79 gene locus_tag LOCUS_32070 gene ptpA 552 79 CDS product putative low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIA1 protein_id gnl|my_center|LOCUS_32070 1241 549 gene locus_tag LOCUS_32080 1241 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702638.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence0825 978 109 gene locus_tag LOCUS_32090 978 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222956.1 protein_id gnl|my_center|LOCUS_32090 1932 1018 gene locus_tag LOCUS_32100 gene glfT1 1932 1018 CDS product galactofuranosyl transferase GlfT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5Z2 protein_id gnl|my_center|LOCUS_32100 >Feature sequence0826 1773 898 gene locus_tag LOCUS_32110 gene map 1773 898 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVI6 protein_id gnl|my_center|LOCUS_32110 >Feature sequence0827 535 825 gene locus_tag LOCUS_32120 535 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 <2092 870 gene locus_tag LOCUS_32130 <2092 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730606.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence0828 861 1496 gene locus_tag LOCUS_32140 861 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_32140 <2090 1519 gene locus_tag LOCUS_32150 <2090 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D8V6:pyridoxal 5'-phosphate synthase subunit PdxS >Feature sequence0829 345 896 gene locus_tag LOCUS_32160 345 896 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093334.1 protein_id gnl|my_center|LOCUS_32160 902 2026 gene locus_tag LOCUS_32170 902 2026 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968894.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence0830 584 147 gene locus_tag LOCUS_32180 584 147 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_32180 1073 606 gene locus_tag LOCUS_32190 1073 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0831 1733 429 gene locus_tag LOCUS_32200 1733 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702020.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence0832 355 1212 gene locus_tag LOCUS_32210 355 1212 CDS product putative acyl-[acyl-carrier protein] desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705127.1 protein_id gnl|my_center|LOCUS_32210 <2081 1366 gene locus_tag LOCUS_32220 <2081 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MKP6:fumarate hydratase class II >Feature sequence0833 3 1430 gene locus_tag LOCUS_32230 3 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 <2073 1434 gene locus_tag LOCUS_32240 <2073 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891354.1:glutamine amidotransferase >Feature sequence0834 <1 875 gene locus_tag LOCUS_32250 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728056.1:alcohol dehydrogenase 922 1245 gene locus_tag LOCUS_32260 922 1245 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_32260 <2072 1242 gene locus_tag LOCUS_32270 <2072 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085766.1:alpha/beta hydrolase >Feature sequence0835 342 902 gene locus_tag LOCUS_32280 342 902 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731153.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence0836 1997 1311 gene locus_tag LOCUS_32290 1997 1311 CDS product Mycobacterial persistence regulator MrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701820.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence0837 1115 423 gene locus_tag LOCUS_32300 gene thiE 1115 423 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQK7 protein_id gnl|my_center|LOCUS_32300 >Feature sequence0838 <1 1411 gene locus_tag LOCUS_32310 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729326.1:N-acyl-D-amino-acid deacylase 1408 2046 gene locus_tag LOCUS_32320 gene eda 1408 2046 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence0839 1000 1917 gene locus_tag LOCUS_32330 1000 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence0840 1417 167 gene locus_tag LOCUS_32340 gene purD 1417 167 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHV7 protein_id gnl|my_center|LOCUS_32340 <2056 1494 gene locus_tag LOCUS_32350 <2056 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029390.1:glycosyl transferase >Feature sequence0841 1704 739 gene locus_tag LOCUS_32360 1704 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703102.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence0842 <2051 1266 gene locus_tag LOCUS_32370 <2051 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R016:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase >Feature sequence0843 242 1759 gene locus_tag LOCUS_32380 242 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence0844 >Feature sequence0845 1379 687 gene locus_tag LOCUS_32390 1379 687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_32390 1865 1497 gene locus_tag LOCUS_tm00010 1865 1497 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0846 <1 1499 gene locus_tag LOCUS_32400 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003408022.1:thiol reductant ABC exporter subunit CydD >Feature sequence0847 1107 280 gene locus_tag LOCUS_32410 1107 280 CDS product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701102.1 protein_id gnl|my_center|LOCUS_32410 1269 1772 gene locus_tag LOCUS_32420 1269 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence0848 <1 1348 gene locus_tag LOCUS_32430 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776259.1:choline oxidase >Feature sequence0849 1010 36 gene locus_tag LOCUS_32440 1010 36 CDS product putative amino acid ABC transporter, substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704963.1 protein_id gnl|my_center|LOCUS_32440 1850 1053 gene locus_tag LOCUS_32450 1850 1053 CDS product putative amino acid ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704964.1 protein_id gnl|my_center|LOCUS_32450 >Feature sequence0850 1086 130 gene locus_tag LOCUS_32460 gene pip1 1086 130 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R16 protein_id gnl|my_center|LOCUS_32460 1384 1088 gene locus_tag LOCUS_32470 1384 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence0851 531 1937 gene locus_tag LOCUS_32480 531 1937 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028665.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence0852 1691 747 gene locus_tag LOCUS_32490 1691 747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728828.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence0853 150 590 gene locus_tag LOCUS_32500 150 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence0854 1439 669 gene locus_tag LOCUS_32510 1439 669 CDS product putative ABC transporter, membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704941.1 protein_id gnl|my_center|LOCUS_32510 <2026 1439 gene locus_tag LOCUS_32520 <2026 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230969.1:ABC transporter ATP-binding protein >Feature sequence0855 499 62 gene locus_tag LOCUS_32530 499 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence0856 1018 245 gene locus_tag LOCUS_32540 gene hisF 1018 245 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX87 protein_id gnl|my_center|LOCUS_32540 1845 1015 gene locus_tag LOCUS_32550 gene impA 1845 1015 CDS product inositol-1-monophosphatase ImpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX86 protein_id gnl|my_center|LOCUS_32550 >Feature sequence0857 >Feature sequence0858 489 869 gene locus_tag LOCUS_32560 489 869 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223930.1 protein_id gnl|my_center|LOCUS_32560 1892 879 gene locus_tag LOCUS_32570 1892 879 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730717.1 protein_id gnl|my_center|LOCUS_32570 >Feature sequence0859 <1 1504 gene locus_tag LOCUS_32580 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P46817:catalase-peroxidase 1646 1813 gene locus_tag LOCUS_32590 1646 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence0860 311 1663 gene locus_tag LOCUS_32600 311 1663 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence0861 851 249 gene locus_tag LOCUS_32610 851 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence0862 72 1715 gene locus_tag LOCUS_32620 72 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence0863 <1 667 gene locus_tag LOCUS_32630 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705161.1:putative acyl-CoA dehydrogenase FadE 1783 698 gene locus_tag LOCUS_32640 1783 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence0864 1612 926 gene locus_tag LOCUS_32650 1612 926 CDS product iron-dependent repressor IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703761.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence0865 >Feature sequence0866 1538 228 gene locus_tag LOCUS_32660 1538 228 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79VF1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence0867 <1 1421 gene locus_tag LOCUS_32670 <1 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896718.1:glutamine ABC transporter permease >Feature sequence0868 455 1087 gene locus_tag LOCUS_32680 455 1087 CDS product Zn-dependent hydrolase or glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599572.1 protein_id gnl|my_center|LOCUS_32680 1201 1746 gene locus_tag LOCUS_32690 1201 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence0869 <1 619 gene locus_tag LOCUS_32700 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015250.1:MFS transporter 1437 616 gene locus_tag LOCUS_32710 1437 616 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_32710 >Feature sequence0870 >Feature sequence0871 >Feature sequence0872 1591 683 gene locus_tag LOCUS_32720 1591 683 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKI2 protein_id gnl|my_center|LOCUS_32720 >Feature sequence0873 459 917 gene locus_tag LOCUS_32730 459 917 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_32730 <1965 904 gene locus_tag LOCUS_32740 <1965 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976020.1:ABC transporter substrate-binding protein >Feature sequence0874 <1 845 gene locus_tag LOCUS_32750 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MMH8:replicative DNA helicase 1203 1697 gene locus_tag LOCUS_32760 1203 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence0875 714 484 gene locus_tag LOCUS_32770 714 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1565 828 gene locus_tag LOCUS_32780 1565 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence0876 574 500 gene locus_tag LOCUS_t00340 574 500 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1653 592 gene locus_tag LOCUS_32790 1653 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701160.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence0877 649 308 gene locus_tag LOCUS_32800 649 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 1386 859 gene locus_tag LOCUS_32810 1386 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence0878 <1 1911 gene locus_tag LOCUS_32820 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R588:ATP-dependent zinc metalloprotease FtsH >Feature sequence0879 635 1111 gene locus_tag LOCUS_32830 635 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32830 1875 1330 gene locus_tag LOCUS_32840 1875 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence0880 75 425 gene locus_tag LOCUS_32850 75 425 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976333.1 protein_id gnl|my_center|LOCUS_32850 1222 428 gene locus_tag LOCUS_32860 1222 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32860 >Feature sequence0881 <1 804 gene locus_tag LOCUS_32870 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230152.1:deoxyribodipyrimidine photo-lyase 1713 811 gene locus_tag LOCUS_32880 1713 811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence0882 1290 511 gene locus_tag LOCUS_32890 1290 511 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460373.1 protein_id gnl|my_center|LOCUS_32890 1363 1437 gene locus_tag LOCUS_t00350 1363 1437 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0883 948 4 gene locus_tag LOCUS_32900 gene ltaA 948 4 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230783.1 protein_id gnl|my_center|LOCUS_32900 1085 1723 gene locus_tag LOCUS_32910 1085 1723 CDS product putative transcription regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701437.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence0884 <1 1226 gene locus_tag LOCUS_32920 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226873.1:ABC transporter ATP-binding protein <1936 1278 gene locus_tag LOCUS_32930 <1936 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028198.1:carboxylesterase >Feature sequence0885 97 993 gene locus_tag LOCUS_32940 97 993 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFA9 protein_id gnl|my_center|LOCUS_32940 990 1403 gene locus_tag LOCUS_32950 990 1403 CDS product putative SufE-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGC3 protein_id gnl|my_center|LOCUS_32950 >Feature sequence0886 >Feature sequence0887 >Feature sequence0888 875 1453 gene locus_tag LOCUS_32960 875 1453 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029965.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence0889 63 1826 gene locus_tag LOCUS_32970 gene leuA 63 1826 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5Q2 protein_id gnl|my_center|LOCUS_32970 >Feature sequence0890 >Feature sequence0891 923 1771 gene locus_tag LOCUS_32980 923 1771 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702268.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence0892 >Feature sequence0893 1671 259 gene locus_tag LOCUS_32990 1671 259 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728675.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence0894 1225 68 gene locus_tag LOCUS_33000 1225 68 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728492.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence0895 >Feature sequence0896 1763 483 gene locus_tag LOCUS_33010 1763 483 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728577.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence0897 477 1004 gene locus_tag LOCUS_33020 477 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1050 1463 gene locus_tag LOCUS_33030 1050 1463 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence0898 1752 820 gene locus_tag LOCUS_33040 1752 820 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence0899 541 1152 gene locus_tag LOCUS_33050 541 1152 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence0900 674 1603 gene locus_tag LOCUS_33060 674 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence0901 1445 30 gene locus_tag LOCUS_33070 1445 30 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence0902 1528 365 gene locus_tag LOCUS_33080 1528 365 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031113.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence0903 1425 436 gene locus_tag LOCUS_33090 gene trxB 1425 436 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJB8 protein_id gnl|my_center|LOCUS_33090 1736 1422 gene locus_tag LOCUS_33100 1736 1422 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence0904 >Feature sequence0905 205 1008 gene locus_tag LOCUS_33110 205 1008 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225689.1 protein_id gnl|my_center|LOCUS_33110 <1889 1100 gene locus_tag LOCUS_33120 <1889 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R196:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence0906 <1 700 gene locus_tag LOCUS_33130 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730006.1:formamidopyrimidine-DNA glycosylase 1520 711 gene locus_tag LOCUS_33140 1520 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 1690 1617 gene locus_tag LOCUS_t00360 1690 1617 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0907 >Feature sequence0908 685 1863 gene locus_tag LOCUS_33150 685 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727192.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence0909 149 1339 gene locus_tag LOCUS_33160 149 1339 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence0910 >Feature sequence0911 >Feature sequence0912 908 249 gene locus_tag LOCUS_33170 908 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33170 1219 791 gene locus_tag LOCUS_33180 1219 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33180 <1872 1301 gene locus_tag LOCUS_33190 <1872 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015511.1:universal stress protein >Feature sequence0913 >Feature sequence0914 <1 859 gene locus_tag LOCUS_33200 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014191.1:membrane protein 1655 1176 gene locus_tag LOCUS_33210 1655 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence0915 >Feature sequence0916 114 359 gene locus_tag LOCUS_33220 114 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 424 879 gene locus_tag LOCUS_33230 424 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 974 1195 gene locus_tag LOCUS_33240 974 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1195 1539 gene locus_tag LOCUS_33250 1195 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence0917 <1 651 gene locus_tag LOCUS_33260 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029787.1:MFS transporter 1054 614 gene locus_tag LOCUS_33270 1054 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 1560 1051 gene locus_tag LOCUS_33280 1560 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414516.1 protein_id gnl|my_center|LOCUS_33280 >Feature sequence0918 1218 238 gene locus_tag LOCUS_33290 gene crtB 1218 238 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence0919 471 1667 gene locus_tag LOCUS_33300 471 1667 CDS product hypothetical protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703836.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence0920 106 294 gene locus_tag LOCUS_33310 106 294 CDS product kanamycin biosynthetic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730673.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence0921 220 1515 gene locus_tag LOCUS_33320 220 1515 CDS product transposase for insertion sequence element IS1081 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60231 protein_id gnl|my_center|LOCUS_33320 1512 1703 gene locus_tag LOCUS_33330 1512 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence0922 2 748 gene locus_tag LOCUS_33340 2 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 944 1801 gene locus_tag LOCUS_33350 944 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence0923 >Feature sequence0924 <1 582 gene locus_tag LOCUS_33360 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224577.1:ATPase >Feature sequence0925 965 612 gene locus_tag LOCUS_33370 965 612 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708712.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence0926 1025 375 gene locus_tag LOCUS_33380 1025 375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027147.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence0927 >Feature sequence0928 <1 1577 gene locus_tag LOCUS_33390 <1 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229470.1:ATP-dependent DNA helicase DinG >Feature sequence0929 >Feature sequence0930 261 1625 gene locus_tag LOCUS_33400 261 1625 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_33400 >Feature sequence0931 1305 1138 gene locus_tag LOCUS_33410 gene rpmF 1305 1138 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3I9 protein_id gnl|my_center|LOCUS_33410 1569 1309 gene locus_tag LOCUS_33420 gene rpmE 1569 1309 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D733 protein_id gnl|my_center|LOCUS_33420 >Feature sequence0932 880 951 gene locus_tag LOCUS_t00370 880 951 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0933 1514 129 gene locus_tag LOCUS_33430 1514 129 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978182.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence0934 318 758 gene locus_tag LOCUS_33440 318 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 1285 830 gene locus_tag LOCUS_33450 gene ogt 1285 830 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223117.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence0935 <1 1329 gene locus_tag LOCUS_33460 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337850.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence0936 <1803 639 gene locus_tag LOCUS_33470 <1803 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036278.1:glycosyl hydrolase >Feature sequence0937 1221 307 gene locus_tag LOCUS_33480 gene mazG 1221 307 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3C4 protein_id gnl|my_center|LOCUS_33480 <1801 1224 gene locus_tag LOCUS_33490 <1801 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MKF3:transcription-repair-coupling factor >Feature sequence0938 1315 563 gene locus_tag LOCUS_33500 gene thiG 1315 563 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIR8 protein_id gnl|my_center|LOCUS_33500 1523 1308 gene locus_tag LOCUS_33510 gene thiS 1523 1308 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727196.1 protein_id gnl|my_center|LOCUS_33510 1801 1520 gene locus_tag LOCUS_33520 1801 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence0939 1523 1610 gene locus_tag LOCUS_t00380 1523 1610 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0940 125 1072 gene locus_tag LOCUS_33530 125 1072 CDS product putative phenylacetic acid degradation protein PaaA/phenylacetate-CoA oxygenase, PaaG subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701654.1 protein_id gnl|my_center|LOCUS_33530 1069 1446 gene locus_tag LOCUS_33540 gene paaB 1069 1446 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223464.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence0941 101 835 gene locus_tag LOCUS_33550 101 835 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_33550 825 1688 gene locus_tag LOCUS_33560 825 1688 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223001.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence0942 826 1590 gene locus_tag LOCUS_33570 826 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705284.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence0943 >Feature sequence0944 527 1711 gene locus_tag LOCUS_33580 gene glgC 527 1711 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2E1 protein_id gnl|my_center|LOCUS_33580 >Feature sequence0945 >Feature sequence0946 <1774 626 gene locus_tag LOCUS_33590 <1774 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701939.1:putative cystathionine gamma-synthase >Feature sequence0947 >Feature sequence0948 1180 365 gene locus_tag LOCUS_33600 1180 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence0949 >Feature sequence0950 347 1453 gene locus_tag LOCUS_33610 347 1453 CDS product cyanuric acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence0951 1522 503 gene locus_tag LOCUS_33620 1522 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence0952 810 106 gene locus_tag LOCUS_33630 gene nuoC 810 106 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJH3 protein_id gnl|my_center|LOCUS_33630 1361 807 gene locus_tag LOCUS_33640 gene nuoB 1361 807 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MPG5 protein_id gnl|my_center|LOCUS_33640 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 637 939 gene locus_tag LOCUS_33650 637 939 CDS product mycofactocin system protein MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892808.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence0956 1377 334 gene locus_tag LOCUS_33660 gene hrcA 1377 334 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN38 protein_id gnl|my_center|LOCUS_33660 >Feature sequence0957 >Feature sequence0958 <1 537 gene locus_tag LOCUS_33670 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228965.1:amidohydrolase 619 1440 gene locus_tag LOCUS_33680 619 1440 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence0959 196 651 gene locus_tag LOCUS_33690 196 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 1177 746 gene locus_tag LOCUS_33700 1177 746 CDS product putative pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703330.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence0960 >Feature sequence0961 973 554 gene locus_tag LOCUS_33710 973 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 1526 1005 gene locus_tag LOCUS_33720 1526 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence0962 >Feature sequence0963 >Feature sequence0964 762 286 gene locus_tag LOCUS_33730 762 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 1025 858 gene locus_tag LOCUS_33740 1025 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 <1725 1109 gene locus_tag LOCUS_33750 <1725 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O07177:maltokinase >Feature sequence0965 210 872 gene locus_tag LOCUS_33760 210 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 <1725 862 gene locus_tag LOCUS_33770 <1725 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730303.1:long-chain-acyl-CoA synthetase >Feature sequence0966 >Feature sequence0967 165 1043 gene locus_tag LOCUS_33780 165 1043 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600571.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence0968 <1 563 gene locus_tag LOCUS_33790 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031600.1:MFS transporter <1710 598 gene locus_tag LOCUS_33800 <1710 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228941.1:amidohydrolase >Feature sequence0969 956 402 gene locus_tag LOCUS_33810 956 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence0970 <1 588 gene locus_tag LOCUS_33820 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896559.1:DNA-binding response regulator 602 961 gene locus_tag LOCUS_33830 602 961 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896560.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence0971 271 1506 gene locus_tag LOCUS_33840 271 1506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728305.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence0972 755 114 gene locus_tag LOCUS_33850 755 114 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972614.1 protein_id gnl|my_center|LOCUS_33850 918 1385 gene locus_tag LOCUS_33860 918 1385 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 protein_id gnl|my_center|LOCUS_33860 1457 1609 gene locus_tag LOCUS_33870 1457 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence0973 >Feature sequence0974 1509 160 gene locus_tag LOCUS_33880 gene pncB 1509 160 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1X8 protein_id gnl|my_center|LOCUS_33880 >Feature sequence0975 1295 1107 gene locus_tag LOCUS_33890 1295 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33890 >Feature sequence0976 <1 677 gene locus_tag LOCUS_33900 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730913.1:glycosyl transferase 667 1470 gene locus_tag LOCUS_33910 667 1470 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMX9 protein_id gnl|my_center|LOCUS_33910 >Feature sequence0977 >Feature sequence0978 1153 1326 gene locus_tag LOCUS_33920 1153 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704871.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence0979 >Feature sequence0980 126 848 gene locus_tag LOCUS_33930 126 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600200.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence0981 <1 518 gene locus_tag LOCUS_33940 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013312.1:alpha/beta hydrolase 646 1671 gene locus_tag LOCUS_33950 646 1671 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_33950 >Feature sequence0982 1160 828 gene locus_tag LOCUS_33960 gene yidH 1160 828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223738.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence0983 435 722 gene locus_tag LOCUS_33970 435 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence0984 229 1344 gene locus_tag LOCUS_33980 229 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence0985 50 868 gene locus_tag LOCUS_33990 50 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893532.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence0986 <1 1621 gene locus_tag LOCUS_34000 <1 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003902404.1:acyl-CoA dehydrogenase FadE22 >Feature sequence0987 >Feature sequence0988 <1 1000 gene locus_tag LOCUS_34010 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QSU3:inosine-5'-monophosphate dehydrogenase >Feature sequence0989 710 42 gene locus_tag LOCUS_34020 710 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 <1651 707 gene locus_tag LOCUS_34030 <1651 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCU3:uroporphyrinogen decarboxylase >Feature sequence0990 <1651 1106 gene locus_tag LOCUS_34040 <1651 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229684.1:ABC transporter permease >Feature sequence0991 749 129 gene locus_tag LOCUS_34050 gene orn 749 129 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMQ6 protein_id gnl|my_center|LOCUS_34050 >Feature sequence0992 654 1325 gene locus_tag LOCUS_34060 654 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031937.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence0993 >Feature sequence0994 <1 527 gene locus_tag LOCUS_34070 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896645.1:DNA-binding response regulator >Feature sequence0995 <1641 985 gene locus_tag LOCUS_34080 <1641 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P46814:diaminopimelate epimerase >Feature sequence0996 411 866 gene locus_tag LOCUS_34090 gene ribH 411 866 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6M2 protein_id gnl|my_center|LOCUS_34090 880 1257 gene locus_tag LOCUS_34100 880 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence0997 284 1426 gene locus_tag LOCUS_34110 gene xdhC 284 1426 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence0998 >Feature sequence0999 1047 385 gene locus_tag LOCUS_34120 1047 385 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229531.1 protein_id gnl|my_center|LOCUS_34120 <1634 1114 gene locus_tag LOCUS_34130 <1634 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DIJ3:release factor glutamine methyltransferase >Feature sequence1000 >Feature sequence1001 91 759 gene locus_tag LOCUS_34140 gene hpf 91 759 CDS product ribosome hibernation promotion factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05886 protein_id gnl|my_center|LOCUS_34140 >Feature sequence1002 >Feature sequence1003 117 788 gene locus_tag LOCUS_34150 117 788 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence1004 <1609 347 gene locus_tag LOCUS_34160 <1609 347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727117.1:cytochrome P450 >Feature sequence1005 >Feature sequence1006 2 1144 gene locus_tag LOCUS_34170 2 1144 CDS product putative folylpolyglutamate synthase FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702343.1 protein_id gnl|my_center|LOCUS_34170 1141 1530 gene locus_tag LOCUS_34180 1141 1530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896005.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence1007 1488 436 gene locus_tag LOCUS_34190 1488 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027294.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence1008 189 950 gene locus_tag LOCUS_34200 189 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34200 >Feature sequence1009 1322 378 gene locus_tag LOCUS_34210 1322 378 CDS product putative proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702073.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence1010 >Feature sequence1011 131 469 gene locus_tag LOCUS_34220 131 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 466 780 gene locus_tag LOCUS_34230 466 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence1012 526 1488 gene locus_tag LOCUS_34240 526 1488 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223258.1 protein_id gnl|my_center|LOCUS_34240 >Feature sequence1013 >Feature sequence1014 3 260 gene locus_tag LOCUS_34250 3 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence1015 912 256 gene locus_tag LOCUS_34260 912 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence1016 <1579 438 gene locus_tag LOCUS_34270 <1579 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064882.1:CoA transferase >Feature sequence1017 2 286 gene locus_tag LOCUS_34280 2 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 283 600 gene locus_tag LOCUS_34290 283 600 CDS product putative ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701647.1 protein_id gnl|my_center|LOCUS_34290 597 992 gene locus_tag LOCUS_34300 597 992 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031682.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence1018 >Feature sequence1019 <1569 114 gene locus_tag LOCUS_34310 <1569 114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QYS5:argininosuccinate lyase >Feature sequence1020 1002 1442 gene locus_tag LOCUS_34320 1002 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence1021 263 766 gene locus_tag LOCUS_34330 263 766 CDS product ferric uptake regulation protein FurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703206.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence1022 1426 215 gene locus_tag LOCUS_34340 1426 215 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence1023 >Feature sequence1024 193 1056 gene locus_tag LOCUS_34350 193 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 >Feature sequence1025 142 624 gene locus_tag LOCUS_34360 142 624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229282.1 protein_id gnl|my_center|LOCUS_34360 624 830 gene locus_tag LOCUS_34370 624 830 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229283.1 protein_id gnl|my_center|LOCUS_34370 <1559 843 gene locus_tag LOCUS_34380 <1559 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QV73:pyruvate dehydrogenase E1 component >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 <1 655 gene locus_tag LOCUS_34390 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409345.1:alcohol dehydrogenase 810 1010 gene locus_tag LOCUS_34400 810 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 >Feature sequence1029 144 464 gene locus_tag LOCUS_34410 144 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 820 443 gene locus_tag LOCUS_34420 820 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1383 958 gene locus_tag LOCUS_34430 1383 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence1030 <1555 922 gene locus_tag LOCUS_34440 <1555 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027250.1:MBL fold metallo-hydrolase >Feature sequence1031 >Feature sequence1032 >Feature sequence1033 821 1414 gene locus_tag LOCUS_34450 821 1414 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730200.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence1034 >Feature sequence1035 762 79 gene locus_tag LOCUS_34460 762 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 1539 619 gene locus_tag LOCUS_34470 1539 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence1039 492 331 gene locus_tag LOCUS_34480 492 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 656 489 gene locus_tag LOCUS_34490 656 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 1032 682 gene locus_tag LOCUS_34500 1032 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898592.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence1040 <1 1176 gene locus_tag LOCUS_34510 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225919.1:isorenieratene synthase >Feature sequence1041 <1 768 gene locus_tag LOCUS_34520 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027321.1:protease >Feature sequence1042 269 33 gene locus_tag LOCUS_34530 269 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence1043 >Feature sequence1044 <1527 517 gene locus_tag LOCUS_34540 <1527 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MFU7:RecBCD enzyme subunit RecD >Feature sequence1045 <1525 916 gene locus_tag LOCUS_34550 <1525 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728677.1:bifunctional D-altronate/D-mannonate dehydratase >Feature sequence1046 1294 311 gene locus_tag LOCUS_34560 1294 311 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775844.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence1047 1134 337 gene locus_tag LOCUS_34570 gene mtnP 1134 337 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHE9 protein_id gnl|my_center|LOCUS_34570 >Feature sequence1048 1 1278 gene locus_tag LOCUS_34580 1 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence1049 1418 555 gene locus_tag LOCUS_34590 1418 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence1050 <1516 855 gene locus_tag LOCUS_34600 <1516 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228155.1:short-chain dehydrogenase >Feature sequence1051 >Feature sequence1052 <1 854 gene locus_tag LOCUS_34610 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028622.1:MFS transporter 1493 837 gene locus_tag LOCUS_34620 1493 837 CDS product transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NU70 protein_id gnl|my_center|LOCUS_34620 >Feature sequence1053 <1 949 gene locus_tag LOCUS_34630 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MC89:putative sporulation transcription regulator WhiA >Feature sequence1054 <1 1496 gene locus_tag LOCUS_34640 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258690.1:restriction endonuclease NspV >Feature sequence1055 74 247 gene locus_tag LOCUS_34650 74 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 244 1014 gene locus_tag LOCUS_34660 gene ppiB 244 1014 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWK5 protein_id gnl|my_center|LOCUS_34660 >Feature sequence1056 361 720 gene locus_tag LOCUS_34670 361 720 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R409 protein_id gnl|my_center|LOCUS_34670 <1502 732 gene locus_tag LOCUS_34680 <1502 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A5Z9:sensor-type histidine kinase PrrB