COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..23387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 337..1077 product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY79 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene flgH CDS 1087..1605 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1593..1937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1934..3019) product flagellar biosynthetic protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene flhB CDS complement(3016..3789) product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene fliR1 CDS complement(3786..5864) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene flhA1 CDS complement(5960..8014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8011..8880) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene motA1 CDS complement(8905..9540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(9545..10099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10100..10630) product flagellar basal body protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10755..12452 product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY91 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene fliF CDS 12449..13054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 13047..13325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13333..14049 product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY94 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene fliP1 CDS 14064..14561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(14620..15720) product flagellar P-ring protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY97 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene flgI2 CDS complement(15720..16727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(16731..18185) product flagellar hook-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18209..19510) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4I1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene flgE CDS complement(19610..20461) product chemotaxis MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene motB1 CDS complement(20751..21428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(21609..22463) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 misc_feature complement(22770..>23387) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388734.1:peptide ABC transporter substrate-binding protein locus_tag LOCUS_00240 sequence002 source 1..22922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(1057..3915) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(4072..7044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(7181..8563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(8641..10062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(10323..12299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 12491..13000 product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 13336..14934 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(15030..16238) product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 16335..17240 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(17215..17925) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(17929..19254) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(19261..20595) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene glnA CDS complement(20592..21413) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(21410..22306) product putrescine/spermidine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 misc_feature complement(22316..>22922) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TM67:polyamine-transporting ATPase locus_tag LOCUS_00400 sequence003 source 1..21201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(834..1475) product invasion-associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 1967..3544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 3839..4615 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene paaG CDS complement(4616..4849) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(4846..5325) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(5322..6365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 6566..7810 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 7898..8239 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 8262..8585 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene soxD CDS 8582..11596 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene soxA CDS 11589..12149 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 12288..13313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 13413..14012 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y7 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 14209..14733 product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(14794..15342) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y6 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 15456..17066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 17175..19076 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 misc_feature complement(19289..>21201) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403686.1:multidrug resistance protein locus_tag LOCUS_00590 sequence004 source 1..18046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(564..1160) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(1163..2188) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(2192..2860) product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 2987..3454 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene fxsA CDS 3509..4021 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG6 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene secB CDS complement(4018..4707) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene dnaQ CDS complement(4707..5294) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG8 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene coaE CDS complement(5291..6124) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG9 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene aroE CDS complement(6121..6717) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH0 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 7134..7592 product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53229 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 7729..9000 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52156 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rho CDS 9023..10312 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH3 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene mnmE CDS 10315..12189 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y689 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene mnmG CDS 12186..12812 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH5 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rsmG CDS 12805..13596 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene parA CDS 13611..14498 product chromosome segregation DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene spo0J CDS complement(14495..15655) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene hemN1 CDS complement(15645..16253) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene ham1 CDS complement(16253..16936) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI2 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene rph sequence005 source 1..16730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(480..2345) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(2342..3367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(3445..4539) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(4536..5429) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y751 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene rfbA CDS complement(5426..6280) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene rmlD/rfbD CDS complement(6277..7326) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5T6 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene rfbB CDS complement(7323..7889) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene rfbC CDS 8566..9222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 9200..9706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 9706..12267 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 12264..13277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 13274..14617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 14734..15105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 misc_feature complement(15223..>16730) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088515.1:multidrug transporter AcrB locus_tag LOCUS_00940 sequence006 source 1..15030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(478..1422) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 1543..2247 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 2259..3176 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 3180..4676 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene dhaL CDS 4673..5434 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709521.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene proC1 CDS 5450..6778 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 6942..7907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(8062..9618) product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(9734..10483) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(10485..11783) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene xylH CDS complement(11859..12887) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene xylF CDS 13054..14271 product xylose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene xylR sequence007 source 1..14583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530046.1:isomerase locus_tag LOCUS_01070 CDS complement(711..1478) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene pdhR CDS complement(1548..2210) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(2332..3186) product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 3369..4013 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7I5 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene nth CDS 4010..5005 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(5015..5434) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887008.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(5495..6313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383017.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 6449..8026 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 8039..8422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 8567..8746 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(8750..9175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 9350..12145 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338672.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 12333..13298 product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 13348..14145 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 sequence008 source 1..14231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 104..1318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 1324..2616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 2620..3669 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086008.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 3987..4679 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(4812..6083) product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 6210..8021 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 8164..8607 product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 8829..9380 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(9441..10652) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene wecE CDS complement(10807..11646) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(11643..12575) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(12517..13041) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(13105..13836) product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 sequence009 source 1..13949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 256..1164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(1337..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(1906..2793) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene serB CDS 2954..4108 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382854.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene serC CDS 4227..5822 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY52 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 5954..7129 product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(7225..7572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(7909..8208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 8523..10655 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(10652..11662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338924.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 11840..12364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 12440..13624 product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY22 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene rlmN CDS complement(13704..13889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 sequence010 source 1..13943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..885 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W2 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 882..1574 product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rnc CDS 1698..2603 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W0 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene era CDS 2637..2963 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 3132..3863 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V8 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene recO CDS 4009..4281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(4325..6016) product (2S)-methylsuccinyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 6193..6963 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(7016..7603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 7684..8313 product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 8326..8811 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976843.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(8880..10478) product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V6 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene pckA CDS 10784..11485 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 11486..13216 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 13221..13679 product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 sequence011 source 1..13813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1391..2440) product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139929.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(2440..2907) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0B2 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene dut CDS complement(2991..4190) product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 4453..4980 product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 4977..5552 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 5611..6291 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 6340..7878 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(7929..8870) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U7 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene gshB CDS complement(8946..9299) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H3 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(9296..10180) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H4 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene rsmI CDS 10271..11443 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 sequence012 source 1..13683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(488..1198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(1229..2545) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 2836..3573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(3570..4028) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(4175..4501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(4505..5509) product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene cbpA CDS complement(5632..6039) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(6157..7338) product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(7350..7664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(7681..8664) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene adh CDS complement(8661..9416) product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967206.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(9420..10727) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTY8 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene hisD CDS complement(10740..12071) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(12084..12599) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(12717..13682) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 sequence013 source 1..13232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 137..421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(585..1514) product choline/ethanolamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(1527..3944) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 4118..5113 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(5293..6453) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(6513..7403) product sugar phosphate isomerase/epimerase IoIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(7425..8528) product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 8632..9609 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK4 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene iolC CDS 9619..10461 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 10458..11282 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 11344..12036 product phosphonate metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(12062..12904) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 sequence014 source 1..12826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..1412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(2210..2590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(2590..3915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(3912..4412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(4409..4630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 4957..5814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(5862..6062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(6002..6727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(6724..8763) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCL3 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene recD2 CDS 8704..8892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(9019..10011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(10085..10762) product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 10871..11554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 11770..11979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 11976..12335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 sequence015 source 1..12620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..959 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337267.1:mechanosensitive ion channel protein MscS locus_tag LOCUS_02160 CDS 956..1675 product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(1715..2797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(3113..3505) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(3521..5314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(5559..7619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(7716..8078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(8101..9072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 9525..10535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(10502..10726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(10833..11072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(11069..12247) product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y470 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene pdhB sequence016 source 1..12589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..1674 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene noeK CDS complement(1692..2690) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 2860..4179 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(4176..4874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(4899..5864) product KpsF/GutQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene kdsD CDS complement(5931..6887) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(6940..8337) product ATPase ParA type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene repA CDS 8742..9734 product plasmid replication initiator protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(9811..10113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 10042..10338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 note possible pseudo, internal stop codon, frameshifted CDS 10466..11722 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(11727..12365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 sequence017 source 1..12521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(689..1369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(1413..1871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(1908..2519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(2516..3058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(3058..4203) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(4285..5883) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9M3 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene prfC CDS complement(5952..6782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(6885..7886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 8018..8797 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 9683..10759 product spermidine/putrescine ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 10903..11127 product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D6 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene tatA CDS 11162..11647 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D5 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene tatB sequence018 source 1..12104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1462..2826 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene xanB CDS complement(2989..3687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(3701..4363) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene rkpS CDS complement(4375..5583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 5749..6498 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKG3 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene rkpT1 CDS complement(6559..7314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(7314..8039) product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703222.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(8032..10521) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(10656..11273) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene wcaJ misc_feature complement(11270..>12104) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338778.1:epimerase locus_tag LOCUS_02610 sequence019 source 1..12042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1423..2568) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 2744..5158 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N8 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(5234..5833) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 5876..6358 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(6710..6931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 7216..8307 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N5 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 8830..9345 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y991 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene mraZ CDS 9345..10355 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N3 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene rsmH CDS 10359..10721 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 sequence020 source 1..11983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 note possible pseudo, internal stop codon CDS complement(752..1942) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(1939..2604) product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(2623..3621) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(3618..4625) product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(4629..4940) product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 5043..5372 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(5853..8057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(8050..9492) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene lysA1 CDS complement(9485..10591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(10588..10878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 sequence021 source 1..11944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 744..1436 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(1405..2598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 2740..4119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 4128..5444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 5431..8211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(8184..9404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 9482..10303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 10300..11670 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 sequence022 source 1..11837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1899) product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene gltD CDS 2132..2935 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ4 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene uppP CDS complement(2932..3915) product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 tRNA 4096..4182 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 4204..4833 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 4844..5440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 5391..5936 product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563197.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 5943..6704 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721595.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 7004..7501 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene PSrp1 CDS 7556..8020 product PTS lactose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene PtsN CDS complement(8023..9453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(9457..11154) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 sequence023 source 1..11767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..555 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UA87:6-phosphogluconate dehydrogenase, decarboxylating locus_tag LOCUS_03010 CDS complement(552..1514) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 1620..3146 product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(3137..3817) product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 3925..6315 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 6312..8708 product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 8724..10031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 10116..10508 product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(10505..11425) product hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 sequence024 source 1..11709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(518..1306) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 1436..2419 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(2902..3123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(3168..4097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 note possible pseudo, frameshifted CDS complement(4110..4997) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708196.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(5349..5699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 5796..6167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(6360..6653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 7011..7229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 7386..7631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 7730..8266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 8708..10183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 10316..10648 product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 10867..11616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 sequence025 source 1..11688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..1006 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(1105..1521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(1569..2009) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(2014..2445) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(2450..3520) product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene AMACR CDS complement(3577..4500) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 4636..4872 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 4898..6037 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(6079..6609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338851.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 6851..7717 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 7714..8193 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 8193..10433 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 10433..10678 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(10696..10944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 misc_feature complement(11048..>11688) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389548.1:haloacid dehalogenase locus_tag LOCUS_03380 sequence026 source 1..11677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(23..1516) product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene mtlK CDS complement(1532..2305) product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene smoS CDS complement(2302..3309) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene smoK CDS complement(3322..4152) product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(4166..4996) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene smoF CDS complement(5154..6473) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene smoE CDS complement(6564..7595) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 7809..9257 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene xylB-1 tRNA complement(9629..9703) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(9778..11088) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(11245..11676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 sequence027 source 1..11677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(460..1824) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene glnA CDS complement(1897..2931) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(2979..4307) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(4307..4864) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(4864..5643) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 5762..6634 product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(7017..8123) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(8126..9271) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(9268..10986) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389545.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 misc_feature complement(10979..>11677) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389546.1:secretion protein HlyD locus_tag LOCUS_03580 sequence028 source 1..11675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..659) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(742..1215) product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31590 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cspR CDS complement(1287..1748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 1942..2616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 2722..3222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 3294..3788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(3841..6138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(6353..7933) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9Y7 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene lysK CDS 8059..8478 product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720750.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(8501..9439) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(9539..10987) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(11110..11673) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene nadD sequence029 source 1..11452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(403..1230) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ispE CDS complement(1227..2924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(3087..4724) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 4970..6235 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX9 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene lysA CDS 6261..8639 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(8815..9375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(9578..10390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 10558..11235 product cell division protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 sequence030 source 1..11056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..678) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 774..2228 product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(2263..3177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(3174..3905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(3907..5412) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(5409..6275) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(6355..7293) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(7351..10572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 sequence031 source 1..11001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 117..554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 636..1277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 1362..3236 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene cobT CDS 3233..5047 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 5123..5467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(5488..7176) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(7392..9044) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L2 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene recN CDS complement(9075..9947) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L3 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene comL misc_feature complement(10045..>11001) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4L4:UDP-3-O-acyl-N-acetylglucosamine deacetylase locus_tag LOCUS_03950 sequence032 source 1..10977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(393..1850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(2001..3131) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene tgt CDS 3291..3653 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 3736..4386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 4380..5081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 5137..5517 product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(5528..6451) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 6635..7351 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J536 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene cbbJ CDS complement(7330..8688) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(8688..9941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 10048..10275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 misc_feature complement(10409..>10977) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337871.1:indolepyruvate ferredoxin oxidoreductase locus_tag LOCUS_04070 sequence033 source 1..10682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..1127 product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 1528..2235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(2242..2799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 3151..5193 product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 5297..5956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 tRNA 6028..6101 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(6137..7744) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2U4 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene pgi CDS complement(7764..8438) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene pgl CDS complement(8435..9886) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2U6 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene zwf misc_feature complement(10019..>10682) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I6K2:guanidinopropionase locus_tag LOCUS_04160 sequence034 source 1..10584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(555..962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(1054..1485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(1607..2389) product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(2396..4411) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(4413..5573) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 5655..6644 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(6590..7615) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(7612..8190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(8269..9831) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 misc_feature complement(9893..>10584) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720577.1:phosphatase locus_tag LOCUS_04260 sequence035 source 1..10411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..724 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012710100.1:oxidoreductase locus_tag LOCUS_04270 CDS 820..2508 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 2523..2789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(2792..3085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(3082..4917) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene pepF CDS 5147..5422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(5426..5767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(5800..6846) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(6854..7537) product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(7571..8041) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(8038..8652) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 8635..9330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 9327..10145 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 sequence036 source 1..10334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(687..1085) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(1258..1632) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 1747..2193 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 2190..2711 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 2704..4020 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(4017..5072) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ94 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene pyrD CDS complement(5069..5830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 5958..7559 product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 note possible pseudo, internal stop codon CDS 7720..7884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 7930..8595 product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 8641..9510 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 9909..10073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 10070..10297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 sequence037 source 1..10127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1684) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33568 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene secF CDS complement(1689..3353) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5I9 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene SecD CDS complement(3380..3661) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene yajC CDS 3849..5453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(5444..5665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 5588..6880 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5J2 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene serS CDS complement(6905..8029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 8207..8992 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y494 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene surE CDS 8989..9630 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene pcm sequence038 source 1..9984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..1736 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 1740..4154 product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 4159..6573 product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(6581..7507) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene metR CDS 7610..8986 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 8988..9875 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ85 transl_table 11 codon_start 1 locus_tag LOCUS_04670 sequence039 source 1..9903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 711..1031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(1028..2278) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y677 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene ilvA CDS complement(2275..3024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 3100..4323 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene argG CDS complement(4320..5021) product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 5188..5457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(5450..5737) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 5893..6456 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 6623..7966 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 7963..8880 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene mepA CDS 8892..9740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 sequence040 source 1..9869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..945) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(963..1883) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(1994..2794) product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C2 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene deoD CDS complement(2882..3847) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(3851..4939) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(4939..6495) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(6663..7658) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(7797..8213) product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rimI CDS complement(8210..8869) product tRNA N6-adenosine(37)-N6-threonylcarbamoyltransferase complex dimerization subunit TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(8862..9314) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 misc_feature complement(9304..>9869) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337318.1:iron transporter locus_tag LOCUS_04890 sequence041 source 1..9809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1659) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 1747..2988 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(2985..3905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(3917..4525) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(4522..5361) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZK0 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene fghA CDS complement(5425..6363) product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 6465..7085 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(7143..7538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(7596..8708) product alcohol dehydrogenase class-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72324 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene adhI CDS 8890..9216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 sequence042 source 1..9793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..880) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY77 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(897..1622) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY76 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(1622..1888) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene fliQ CDS complement(1888..2184) product flagellar hook-basal body protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene fliE1 CDS complement(2197..2583) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(2596..2940) product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 3034..4341 product ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338885.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(4338..5132) product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385138.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene flgF CDS complement(5129..5533) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene flbT CDS complement(5530..5904) product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene flaF CDS complement(5992..7527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(7771..8118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(8115..8402) product peptidoglycan hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene cheL sequence043 source 1..9763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..1211 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(1208..2038) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(2049..2663) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(2663..3388) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene pcaH CDS complement(3385..3771) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene pcaC CDS complement(3798..4967) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene pobA CDS 5057..5989 product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene pcaQ CDS complement(6014..6640) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(6640..6867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(6867..7571) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(7661..8815) product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 8922..9269 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(9315..9554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 sequence044 source 1..9760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 388..1953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 1959..2810 product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 2830..3009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(3002..3769) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene dhrS4 CDS 3890..5107 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 5107..6126 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(6388..7914) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene betC sequence045 source 1..9758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(692..1909) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 2086..2418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(2484..3155) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 3283..3879 product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(4115..4534) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(4542..6017) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3M0 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene purF CDS complement(6196..6594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(6729..6920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 7090..7431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 7491..8000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(8141..8704) product colicin V production protein CvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 misc_feature complement(8738..>9758) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3L8:DNA repair protein RadA locus_tag LOCUS_05460 sequence046 source 1..9621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..8480) product cyclic beta 1-2 glucan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037218.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene ndvB CDS complement(8534..9424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 sequence047 source 1..9600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..1346 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5P2 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 1343..2026 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 2023..2736 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 2981..3997 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene bztA CDS 4139..5776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 5778..7088 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene bztC CDS 7101..7895 product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene bztD CDS complement(7948..8460) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(8457..9104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 sequence048 source 1..9599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(896..1447) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(1476..2525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(2522..3493) product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(3581..3949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(4056..4817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(4936..5316) product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(5434..6510) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(6507..7394) product silent information regulator protein Sir2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 sequence049 source 1..9405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 555..1745 product septum site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(1965..3071) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 3435..3914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(3984..7127) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3H4 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene valS CDS 7288..8361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 misc_feature complement(8524..>9405) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337156.1:DEAD/DEAH box helicase locus_tag LOCUS_05720 sequence050 source 1..9404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(657..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 1050..2396 product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(2452..2952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(2956..3312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(3305..3877) product RNA polymerase sigma subunit ECF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(3966..4478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 4630..5007 product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 4980..5672 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(5669..6601) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(6598..7512) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(7543..8427) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531193.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 sequence051 source 1..9353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..455) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W7 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene rpoZ CDS complement(534..1127) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene FolK CDS 1237..1812 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(1866..2495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083060.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(2523..3059) product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 3228..4178 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8J6 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene ispH CDS 4232..5347 product dimethylaniline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 5344..5931 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 5924..6382 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI4 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene rnhA CDS complement(6447..6833) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(6837..7073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(7115..7378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(7378..8289) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH6 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene fmt CDS complement(8429..8923) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH7 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene def sequence052 source 1..8804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1910 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 1928..2443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 2477..4483 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 4494..5183 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(5235..6443) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(6552..8000) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 misc_feature complement(7997..>8804) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXW8:glyceraldehyde-3-phosphate dehydrogenase locus_tag LOCUS_06050 sequence053 source 1..8754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(406..768) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(947..1225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(1225..2022) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(2019..2879) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(2876..3949) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(3942..5024) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(5177..6880) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 7099..7875 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 7859..8140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 note possible pseudo, internal stop codon CDS 8439..8636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 sequence054 source 1..8738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..943 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J252:S-adenosylmethionine:tRNA ribosyltransferase-isomerase locus_tag LOCUS_06160 CDS 1045..2334 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 2377..2958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 3071..4465 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(4529..7513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 sequence055 source 1..8727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..906) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 1025..2470 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene pykA CDS 2467..2697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 2772..3110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 3326..3760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 3883..4320 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY4 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene mscL CDS complement(4317..4649) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(4646..5347) product branched-chain amino acid transporter AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 5346..6290 product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKQ9 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene fdhD CDS 6290..6901 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKR0 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene mobA CDS 6898..7389 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene mobB CDS complement(7922..8662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 sequence056 source 1..8716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..1467) product capsular polysaccharide glycosyltransferase biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene wcbB CDS complement(1472..2275) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYP1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene galU CDS complement(2503..3708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(3705..4502) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene kdsB CDS complement(4504..5301) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 5433..6257 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 6284..6871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(6868..7470) product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 7664..8518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 sequence057 source 1..8587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 383..1069 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(1172..1708) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(1705..2907) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(2948..3562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(3800..4624) product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(4682..5689) product flagellar switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 5616..5831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(5762..8440) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 sequence058 source 1..8587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1368 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYM7:chaperone protein DnaK locus_tag LOCUS_06510 CDS 1448..2596 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM8 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene dnaJ CDS complement(2758..5019) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 5155..7794 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI5 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene mutS CDS complement(7791..8372) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI4 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene grpE CDS complement(8384..8587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 sequence059 source 1..8539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..1435) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(1559..2200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(2209..2739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(2750..4318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 4606..6036 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W2 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(6101..6589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(6656..7606) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 sequence060 source 1..8527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 654..971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 1090..1419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 1510..2250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 tRNA complement(2771..2860) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(2944..3891) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene glk CDS complement(3909..5237) product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2E9 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(5234..6286) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 6539..7882 product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 sequence061 source 1..8305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..1250 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(1254..1709) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 1855..2025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 2028..2672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(2669..3097) product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 3215..3664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(3672..4832) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J515 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rnd CDS complement(4939..5535) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J516 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene purN CDS complement(5532..6578) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J517 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene purM tRNA 6733..6809 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 6912..7094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 misc_feature complement(7178..>8305) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338061.1:two-component sensor histidine kinase locus_tag LOCUS_06820 sequence062 source 1..8263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..2083 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968570.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene deaD CDS complement(2211..4202) product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339452.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 4337..5530 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 5527..6351 product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 6407..7309 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 sequence063 source 1..8231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1096 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(1144..1845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(1911..3011) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY15 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene aroC CDS 3319..4236 product thiamine transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene thiB CDS 4212..5780 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene thiP CDS 5767..6456 product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6N7 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene thiQ CDS complement(6528..7334) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene fbcC misc_feature complement(7355..>8231) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY10:cytochrome b locus_tag LOCUS_06950 sequence064 source 1..8147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 500..934 product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 974..1468 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J263 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene coaD CDS 1540..2046 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I5 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 2039..2584 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y477 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene ppiB CDS 2699..3661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 3708..5525 product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(5594..6034) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(6092..6772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(6769..7431) product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 7685..7966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 sequence065 source 1..8129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..1145 product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 1151..2836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 2836..3453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 3466..4476 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 tRNA complement(5221..5307) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(5457..6062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 6391..7083 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A6 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene lipB CDS 7355..7561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 sequence066 source 1..8077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 706..912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 913..1665 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 1777..1941 product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(1980..2924) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 3034..3183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(3202..3924) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(3983..5158) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(5331..6170) product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 6297..6869 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(6866..7426) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene tlpA sequence067 source 1..7970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(969..1874) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(1879..2862) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(2856..3398) product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 3643..5046 product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338245.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene ubiD CDS 5043..5621 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0P4 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene ubiX tRNA complement(5856..5930) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(6033..7781) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 sequence068 source 1..7903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(397..1239) product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(1230..1841) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene eda CDS complement(1838..2734) product 2-keto-3-deoxy-galactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(2749..3519) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(3607..5316) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(5313..7394) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 misc_feature complement(7394..>7903) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524829.1:ABC transporter permease locus_tag LOCUS_07350 sequence069 source 1..7804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 975..2096 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 2093..3187 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 3188..5311 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C2 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene lptD CDS 5393..6574 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 6571..7557 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C0 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene pdxA sequence070 source 1..7794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..1085 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N7 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene cbbE CDS complement(1065..2351) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 2465..3367 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(3441..3797) product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG81 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 4027..5361 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 5361..5882 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J689 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 5916..7343 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 sequence071 source 1..7786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..1094 product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(1319..3367) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene kpsC CDS complement(3376..4515) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(4599..5891) product capsule biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene kpsS CDS 6057..6653 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 6747..7436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 sequence072 source 1..7764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..608 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973285.1:hemolysin locus_tag LOCUS_07540 CDS complement(800..1630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(1734..2597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 2734..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 2976..4706 product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 4744..7440 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 sequence073 source 1..7757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(724..1860) product helix-turn-helix domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 2076..2336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(2385..3932) product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene mttB CDS 4339..4965 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(5052..5750) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 5900..7471 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J210 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene guaA CDS 7462..7740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 sequence074 source 1..7724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 481..1314 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN2 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene surA CDS 1340..2701 product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN3 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene argJ CDS 2698..3096 product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene mutT CDS complement(3321..4361) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYK5 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene HemH CDS complement(4362..5234) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 5259..5981 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene comF CDS 6018..6275 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene grxC CDS 6313..7110 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 7107..7556 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 sequence075 source 1..7717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 621..1247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 1434..2657 product 5-aminolevulinate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04512 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene hemA CDS 2814..4061 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 4106..5269 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J241 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene gcpE CDS complement(5305..5610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 5664..7076 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 sequence076 source 1..7685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1627 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338787.1:multidrug ABC transporter ATP-binding protein locus_tag LOCUS_07820 CDS 1624..3459 product multidrug ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 3495..3917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 3948..5171 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene TrmA CDS complement(5296..7239) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y856 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene dxs sequence077 source 1..7664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3750..4748) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 misc_feature complement(4735..>7664) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205578.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase locus_tag LOCUS_07880 sequence078 source 1..7610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..1706 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 1718..3025 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(3149..3946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 4245..5159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 5384..7222 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYV3 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene mutL sequence079 source 1..7603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 857..1444 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 1544..1669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 1947..2732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 3028..3837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(3898..5046) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(5132..5572) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 5676..6626 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 sequence080 source 1..7581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1201 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338666.1:LytTR family transcriptional regulator locus_tag LOCUS_08020 CDS 1198..3270 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(3286..3645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 3790..4623 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ34 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 4763..5224 product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 5483..6343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(6370..7275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383548.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 sequence081 source 1..7477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..1090) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(1135..1557) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene fur CDS complement(1637..2680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(2677..3930) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 4126..5028 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(4997..5716) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 5797..6438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 misc_feature complement(6451..>7477) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TPG7:UPF0061 protein locus_tag LOCUS_08160 sequence082 source 1..7467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1068..2987) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J045 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene ftsH CDS complement(3069..4301) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene tilS CDS complement(4298..5122) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(5128..5607) product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(5688..7016) product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J041 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene tolB sequence083 source 1..7467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..960 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2M4:transcription-repair-coupling factor locus_tag LOCUS_08220 CDS complement(957..2177) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(2174..2818) product polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(2815..4284) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 4351..4974 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(5009..6040) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(6155..6940) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 sequence084 source 1..7411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1033) product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene ste14 CDS complement(1219..2793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 2927..3235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(3450..3890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(3894..4304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(4301..4645) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 4735..5184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(5370..5561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 tRNA 5760..5836 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(5854..6963) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 sequence085 source 1..7407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..1326) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L9 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene murB CDS complement(1319..1633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(1650..1898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(1898..2152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(2149..3354) product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(3361..4812) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene murC CDS complement(4809..5903) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M2 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene murG CDS complement(5908..7074) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719261.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene ftsW sequence086 source 1..7378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(354..1670) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(1733..2320) product N-acyl-L-homoserine lactone synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(2378..2962) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 3063..3236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(3325..3741) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5P7 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene rplQ CDS complement(3872..4888) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5P8 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene rpoA CDS complement(5005..5394) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5P9 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene rpsK CDS complement(5407..5775) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5B5 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene rpsM CDS complement(5973..6620) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5B6 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene adk misc_feature complement(6617..>7378) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y5B7:protein translocase subunit SecY locus_tag LOCUS_08550 sequence087 source 1..7361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 358..606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 751..1746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 1906..3642 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene dnaX CDS 3713..4057 product nucleoid-associated protein YbaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ7 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene YbaB CDS 4059..4658 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ6 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene recR CDS 4662..5723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(5845..6438) product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 sequence088 source 1..7283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(907..2715) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6P3 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ade CDS 2933..3598 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 3655..4320 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene Gst CDS 4317..5348 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYQ7 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene queG CDS 5345..6226 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(6271..6702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 sequence089 source 1..7268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..732 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2A2:phospho-2-dehydro-3-deoxyheptonate aldolase locus_tag LOCUS_08700 CDS complement(831..1499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 1649..2536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337847.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 2540..3193 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2A5 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene gmk CDS 3190..3708 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(3705..4328) product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 4367..4525 product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 4690..5460 product ornithine-acyl-ACP acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338955.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 5457..6281 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(6262..6891) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 sequence090 source 1..7225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1342 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337374.1:signal transduction histidine kinase locus_tag LOCUS_08800 CDS 1339..2040 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 2069..3013 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229553.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(3070..3978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(4197..4703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(4792..6003) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 6100..6261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 misc_feature complement(6264..>7225) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha locus_tag LOCUS_08870 sequence091 source 1..7131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1363..1824 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 1821..2642 product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 2777..4147 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 4137..4691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(4746..5534) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(5714..6841) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J246 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene prfB sequence092 source 1..7071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 618..851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(838..1236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(1407..2918) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7B8 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene gatB CDS 3115..3714 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 3776..4432 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(4429..4827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 misc_feature complement(4940..>7071) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337133.1:aminopeptidase N locus_tag LOCUS_09000 sequence093 source 1..7049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 711..1244 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1374..2531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 2535..5138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 misc_feature complement(5455..>7049) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337384.1:ATP-dependent Clp protease ATP-binding subunit ClpA locus_tag LOCUS_09040 sequence094 source 1..7027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..638) product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53091 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene moaE CDS complement(640..888) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX8 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene moaD CDS complement(881..1585) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX7 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene pgsA CDS complement(1605..2360) product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(2386..4254) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX6 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene uvrC CDS complement(4586..5551) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(5552..5734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(5739..6536) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene sohB sequence095 source 1..6997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(796..1218) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1289..2083 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene fadB CDS complement(2064..3260) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(3264..4736) product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene cxp CDS complement(4733..5875) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y7 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ctaA CDS complement(5995..6738) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXX1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene trmJ sequence096 source 1..6986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1165 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336785.1:DNA translocase FtsK locus_tag LOCUS_09190 CDS 1225..1833 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E7 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1830..2405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 2519..2959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(2975..4555) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(4801..5289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(5286..5636) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E2 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 5727..6938 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 sequence097 source 1..6970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..741) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T3 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene ung CDS complement(842..1858) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA8 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene trpD CDS complement(1855..2454) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene trpG CDS 2640..4055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(3963..4382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(4413..5615) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene aatA CDS 5751..6161 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 6158..6439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 sequence098 source 1..6920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(782..2272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(2262..2399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 2496..3068 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2I9 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene aroK CDS 3065..4180 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2J0 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene aroB CDS complement(5106..5327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 sequence099 source 1..6913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1020..1370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1495..2343) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(2343..3119) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(3189..4226) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(4233..4385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 note possible pseudo, internal stop codon CDS 4564..5328 product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 5325..5771 product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(5850..6659) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 sequence100 source 1..6907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(449..1114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1426..1746) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B4 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene trxA CDS complement(1813..5175) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 misc_feature complement(5172..>6907) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336807.1:double-strand break repair protein AddB locus_tag LOCUS_09520 sequence101 source 1..6899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..448) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(552..1919) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1909..2430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(2427..4658) product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 5006..5434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 5500..6102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 sequence102 source 1..6895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..781) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 983..1915 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 2023..3051 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 3048..5069 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 5066..5959 product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 sequence103 source 1..6878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 528..2075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(2078..2695) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(2701..3003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 3101..3442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(3810..4193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528902.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(4246..4665) product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(4667..4933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(4941..5885) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6D1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene gpsA misc_feature complement(5882..>6878) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J6D2:tRNA N6-adenosine threonylcarbamoyltransferase locus_tag LOCUS_09720 sequence104 source 1..6866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(427..612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 599..976 product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 989..1441 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1447..1866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1830..2495) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1H1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene aat CDS complement(2629..3975) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene accC CDS complement(3985..4479) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene accB CDS 4741..6072 product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 sequence105 source 1..6859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(397..1248) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene SseA CDS complement(1345..1821) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7U0 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene smpB CDS complement(1949..2821) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene dapA CDS 2966..4903 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(4878..5759) product RhaT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(5749..6387) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 sequence106 source 1..6858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(838..1182) product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J022 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene clpS CDS 1293..1997 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 2053..2376 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 2383..2817 product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 2837..3148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 3300..3926 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(3868..5097) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(5191..6180) product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 sequence107 source 1..6846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 933..1304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1301..2713) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene MltB CDS complement(2852..5107) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYS4 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene rnr CDS complement(5151..5891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(6025..6648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 sequence108 source 1..6745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1977 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338419.1:copper-translocating P-type ATPase locus_tag LOCUS_10000 CDS 1998..2156 product cytochrome oxidase maturation protein, cbb3-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rdxS CDS complement(2157..3599) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 3543..3755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 3943..4821 product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J026 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene hemF CDS 4842..5573 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(5666..6694) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32920 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene hemE sequence109 source 1..6717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..793 product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E4 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(797..1618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 note possible pseudo, internal stop codon, frameshifted CDS 1671..2123 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J463 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene tadA CDS complement(2130..2561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(2575..3267) product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4R8 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 3426..3713 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene gatC CDS 3713..5197 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J459 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene gatA CDS 5231..5896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 5893..6576 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene ampD sequence110 source 1..6715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(924..1847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1844..2773) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J346 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene argI CDS 2892..3323 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(3320..3787) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(3784..4362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 4696..5745 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence111 source 1..6660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 660..1148 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1229..1648 product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228242.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1673..2464) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(2474..2782) product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(2779..3969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003715.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(4051..4740) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(4800..5261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(5342..6646) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 sequence112 source 1..6608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(753..1739) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1752..2855) product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(2855..3361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(3361..4026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(4047..4784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 4873..5598 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(5602..6246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 sequence113 source 1..6552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 837..2156 product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 2429..3871 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene der CDS complement(3963..4322) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J271 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(4371..4607) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537908.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 misc_feature complement(4734..>6552) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J273:phosphoribosylformylglycinamidine synthase subunit PurL locus_tag LOCUS_10410 sequence114 source 1..6478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(741..1358) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1483..2697) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J683 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene icd CDS complement(2901..3122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(3130..3783) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 4001..4432 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 4570..5655 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 sequence115 source 1..6461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 823..1134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1103..1873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene vacJ CDS 1863..2474 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561627.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 2547..4505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(4533..6308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 sequence116 source 1..6455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(328..1689) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene ntrC CDS complement(1690..2754) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene ntrB CDS complement(2751..3722) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2L0 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene nifR3 CDS 3892..5067 product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y505 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene ispDF CDS 5064..5552 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y504 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pgpA CDS 5549..6019 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene cinA sequence117 source 1..6444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..904 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1010..1816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1847..2815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 3352..5295 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene acsA CDS 5299..5985 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene adk CDS 6085..6345 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 sequence118 source 1..6398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(304..1365) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1375..2325) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(2584..4224) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(4229..5152) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974600.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(5165..6121) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 sequence119 source 1..6396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 519..2483 product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene amsA CDS 2480..2977 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(3035..3886) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 3976..4272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(4286..4885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(5194..6099) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3F4 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene argF sequence120 source 1..6375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(879..2072) product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ84 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene sucC CDS complement(2418..3380) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7K1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene mdh CDS complement(3604..3915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 4222..5079 product (3S)-malyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3JV05 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene mcl2 CDS 5079..5630 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 sequence121 source 1..6317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888020.1:ornithine cyclodeaminase locus_tag LOCUS_10830 CDS complement(711..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 935..2347 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene sda CDS complement(2328..3509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(3603..4634) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 tRNA 4775..4851 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(4863..6053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 sequence122 source 1..6300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..991 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337304.1:3-hydroxyacyl-CoA dehydrogenase locus_tag LOCUS_10890 CDS 1128..2759 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(2872..3216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(3488..3775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(3778..4359) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 4645..5661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 sequence123 source 1..6299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 441..950 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1023..1898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1995..2258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 2495..2710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(2715..3416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(3494..3943) product S-isoprenylcysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(3958..4296) product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(4319..5113) product NG,NG-dimethylarginine dimethylaminohydrolase protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 misc_feature complement(5300..>6299) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y5F5:aconitate hydratase locus_tag LOCUS_11030 sequence124 source 1..6241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..1687 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1716..2387) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 2676..3776 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4D6 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene gcvT CDS 3804..4163 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4D5 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene gcvH sequence125 source 1..6237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3676 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337519.1:phage host specificity protein locus_tag LOCUS_11080 CDS 3669..4379 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 4474..5289 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene cysE misc_feature complement(5373..>6237) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3J1:acetyltransferase component of pyruvate dehydrogenase complex locus_tag LOCUS_11110 sequence126 source 1..6222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 180..395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 483..764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 843..2960 product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(3487..4638) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene cycH CDS complement(4635..5120) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45405 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene ccmH CDS complement(5117..5674) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 misc_feature complement(5679..>6222) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707359.1:c-type cytochrome biogenesis protein CcmF locus_tag LOCUS_11180 sequence127 source 1..6051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1549 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5C7:glycine--tRNA ligase beta subunit locus_tag LOCUS_11190 CDS 2054..4498 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene ppdK CDS 4706..5392 product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 sequence128 source 1..6040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1334..1645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1698..2615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393794.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 2686..3300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(3330..4256) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F9 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene ctaB CDS complement(4345..5184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 misc_feature complement(5217..>6040) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMM5:cytochrome c oxidase subunit 1 locus_tag LOCUS_11270 sequence129 source 1..6036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 476..925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1071..1838) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1905..2864 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ49 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene pyrB CDS 2857..3258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 3323..4615 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ48 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene pyrC CDS 4612..5223 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ47 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene plsY CDS complement(5379..5780) product FosX/FosE/FosI family fosfomycin resistance thiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(5784..5927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 sequence130 source 1..5991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1771..2742) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 2836..3711 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(3751..3972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 3893..4243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(4171..4488) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 4631..5599 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 sequence131 source 1..5969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1019..1870) product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P376 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene ugpE CDS complement(1870..2751) product sn-glycerol-3-phosphate transport system permease protein UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WD8 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene ugpA CDS complement(2851..4155) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 4313..5215 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene lysR misc_feature complement(5216..>5969) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI7:ribokinase locus_tag LOCUS_11460 sequence132 source 1..5956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..613 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ptpA CDS complement(719..1021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1024..1230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1147..2193) product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 2334..2774 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 2928..4010 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J445 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene hisC CDS 4007..4942 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 4939..5862 product extensin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 sequence133 source 1..5928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 16..732 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50936 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene hisA CDS 978..1217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1245..1436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1569..2348 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50937 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene hisF CDS 2345..2677 product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene hisE CDS complement(2679..3944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(3944..4309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(4549..5025) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(5205..5654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 sequence134 source 1..5927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(950..2173) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 2491..3063 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(3162..3800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 3902..4948 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 misc_feature complement(4942..>5927) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975589.1:AraC family transcriptional regulator locus_tag LOCUS_11680 sequence135 source 1..5905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 605..1294 product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1327..2382 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene nueB CDS 2379..2801 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 2806..3009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(3254..3733) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(3925..5328) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI8 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene leuC sequence136 source 1..5856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(958..2226) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(2226..2840) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(2840..3403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(3400..4218) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(4225..4917) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(4929..5648) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene narJ sequence137 source 1..5845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..1101 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X2 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene cdsA CDS 1098..2282 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene dxr CDS 2279..3610 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X0 transl_table 11 codon_start 1 locus_tag LOCUS_11840 sequence138 source 1..5835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1632) product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E2 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene ftsY CDS 1810..2052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(2158..2820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(2817..4502) product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 4643..5650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 sequence139 source 1..5805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 271..921 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 935..1978 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene sdh CDS complement(2078..2395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(2541..2735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 2872..3132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 3174..3821 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene rluA CDS complement(3857..4870) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 misc_feature complement(4947..>5805) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336795.1:aldehyde dehydrogenase locus_tag LOCUS_11970 sequence140 source 1..5790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(811..2112) product gamma-glutamylputrescine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(2122..3516) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene spuC CDS complement(3536..4924) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383557.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(5028..5678) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 sequence141 source 1..5785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2621..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 3279..4277 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2M2 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene hemB CDS complement(4281..4433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(4574..4891) product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene dksA sequence142 source 1..5741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(610..1632) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene cysK CDS complement(1694..2818) product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene trgB CDS complement(2829..3272) product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene trgA CDS complement(3397..4773) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003558.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 misc_feature complement(4814..>5741) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337262.1:cysteine desulfurase locus_tag LOCUS_12100 sequence143 source 1..5723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(498..1151) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F0 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene tal CDS 1239..3434 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene priA CDS complement(3580..3834) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 sequence144 source 1..5702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1054) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1175..2131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 2157..2621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 2625..4139 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 sequence145 source 1..5699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..549 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J340:putative arginyl-tRNA--protein transferase locus_tag LOCUS_12180 CDS complement(660..3020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(3046..3945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(4065..5153) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 sequence146 source 1..5658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..1192) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1189..1968) product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1996..2367) product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBI8 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene hypA CDS complement(2360..2593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(2672..3136) product peptidase M52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(3129..4205) product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 note possible pseudo, frameshifted CDS complement(4288..4419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(4412..5179) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 sequence147 source 1..5648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(622..1308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1421..2113) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(2395..2892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(3119..5575) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 sequence148 source 1..5631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1361..2389 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(2515..3072) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ52 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 3190..4032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 misc_feature complement(4049..>5631) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261108.1:acriflavin resistance protein locus_tag LOCUS_12370 sequence149 source 1..5612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..819) product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 800..1183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1183..1803 product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene cobO CDS 2199..3644 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR0 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene cobQ CDS 3685..4203 product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 4337..5233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 sequence150 source 1..5576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 note possible pseudo, internal stop codon CDS 1014..1244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 note possible pseudo, internal stop codon CDS 1347..1649 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene ihfA CDS 1658..2350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 tRNA 2430..2506 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 2568..3647 product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(3730..4929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 sequence151 source 1..5550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..606 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085289.1:flavin-dependent oxidoreductase locus_tag LOCUS_12500 CDS 603..1187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1184..2551 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 tRNA 2602..2686 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 2861..4186 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L8 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene tig sequence152 source 1..5538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..1347 product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene TyrB CDS 1510..2133 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 2436..3044 product potassium transporter KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106276.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 3048..5033 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 sequence153 source 1..5527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..651 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J086 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 648..1697 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1694..1876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 2220..3221 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975809.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene tauA CDS 3306..4112 product Taurine import ATP-binding protein TauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UX0 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene tauB CDS 4112..5383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 sequence154 source 1..5518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..2356) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene ptsI CDS complement(2682..3920) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y871 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(4126..4806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 misc_feature complement(4835..>5518) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3H1:glutamine--fructose-6-phosphate aminotransferase [isomerizing] locus_tag LOCUS_12670 sequence155 source 1..5489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..2846 product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(2938..4158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 4312..5475 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 sequence156 source 1..5455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(515..2281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(2330..3577) product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 3649..3831 product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(3843..4619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 misc_feature complement(4732..>5455) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYU4:4-hydroxy-tetrahydrodipicolinate reductase locus_tag LOCUS_12750 sequence157 source 1..5445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1041..1607) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1635..2447) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene iolB CDS complement(2447..2656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(2663..4492) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene iolD CDS complement(4505..5407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 sequence158 source 1..5405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..746) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene livF CDS complement(750..1532) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene livG CDS complement(1529..2509) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(2514..2942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(2942..4006) product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(4003..4752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(4745..5281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 sequence159 source 1..5404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1021..1458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1731..2918) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MN3 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene kynU CDS 2988..3812 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 3877..4914 product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 sequence160 source 1..5385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..1662) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2F5 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene guaB CDS complement(1764..2465) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene rlmE CDS complement(2694..3872) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 4123..4434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 sequence161 source 1..5372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1262..2122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(2287..3480) product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene wecE CDS complement(3524..4189) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene gph sequence162 source 1..5353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 401..568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 617..1177 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene ilvH CDS 1457..2620 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 2610..2831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(2854..3420) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 3602..4099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 sequence163 source 1..5318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(829..1671) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1920..2525) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LA1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene leuD CDS 2647..4209 product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(4189..4482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 sequence164 source 1..5303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..1280) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1277..2278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(2275..3687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 3790..4566 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D9 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene truA sequence165 source 1..5241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..797 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338931.1:N-formylglutamate amidohydrolase locus_tag LOCUS_13140 CDS complement(893..2146) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY04 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene dinB CDS 2253..3146 product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 3146..3430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(3525..4220) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y712 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene pyrF CDS complement(4447..4629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 sequence166 source 1..5236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 300..1454 product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene glcE1 CDS 1458..2756 product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ33 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 2929..3948 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402189.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 4050..5189 product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene yeaW sequence167 source 1..5231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..1235) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1306..2649) product AgaE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(2646..3809) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C5 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene argE CDS 4026..5033 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 sequence168 source 1..5182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 381..824 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLC8 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene aroQ CDS 890..1588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1676..2323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(2911..3786) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N5 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene tsf CDS complement(3870..4691) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N4 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene rpsB sequence169 source 1..5146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(787..1578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1579..1728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(2174..3244) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A7 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene pheS CDS 3379..3786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 3862..5010 product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence170 source 1..5142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 961..1842 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G4 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene ctaC CDS 1916..2848 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F9 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene ctaB CDS 2850..3041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 3038..3613 product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F7 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene ctaG CDS 3634..4476 product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene coxIII sequence171 source 1..5139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(674..1264) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY09 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene fbcF CDS complement(1498..1923) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1920..2525) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(2522..2803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(2856..3482) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 3771..4205 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6M2 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene ribH misc_feature complement(4248..>5139) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383138.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB locus_tag LOCUS_13490 sequence172 source 1..5134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1231..2040) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene znuB2 CDS complement(2037..2774) product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWB5 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene znuC CDS complement(2771..3253) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene zur CDS 3350..4255 product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262758.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene znuA2 tRNA complement(4414..4487) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence173 source 1..5077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 364..1401 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1413..2732 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene ctpA CDS 2734..3198 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rppH CDS 3258..3728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(3926..4831) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 sequence174 source 1..5073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(798..3248) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(3252..4151) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 misc_feature complement(4148..>5073) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531136.1:dimethylglycine dehydrogenase locus_tag LOCUS_13620 sequence175 source 1..5054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..637 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388139.1:transcriptional regulator locus_tag LOCUS_13630 CDS 713..1222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1384..2910 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(3009..3572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(3658..4050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 4188..4508 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene fdx sequence176 source 1..5050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 716..1645 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1868..3253) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene yhxA CDS 3422..4903 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 sequence177 source 1..5023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1001..1213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1624..2979 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 3064..4056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383631.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 misc_feature complement(4202..>5023) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J1G7:ATP-dependent Clp protease ATP-binding subunit ClpX locus_tag LOCUS_13750 sequence178 source 1..5015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(428..1624) product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene nhaA CDS 1873..2949 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene perM CDS 2953..3621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 sequence179 source 1..4992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1285..2064) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3E2 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene coaX CDS complement(2084..2833) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene birA CDS complement(2837..4276) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3E4 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene nuoN misc_feature complement(4287..>4992) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719680.1:NADH-quinone oxidoreductase subunit M locus_tag LOCUS_13820 sequence180 source 1..4985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1608 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528031.1:FAD-dependent oxidoreductase locus_tag LOCUS_13830 CDS complement(1666..2655) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene idhA2 CDS 2758..3576 product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973918.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 3695..4636 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 sequence181 source 1..4960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(633..2450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 note possible pseudo, frameshifted CDS complement(2447..3142) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724571.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 3129..3845 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(3820..4590) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338237.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene glpR sequence182 source 1..4953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 484..990 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 995..1732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1894..2481 product carnitine operon oxidoreductase caia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(2538..2732) product heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 sequence183 source 1..4893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..1283) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1280..2134) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385329.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 2421..2747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(2846..3805) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707778.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 3906..4541 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 sequence184 source 1..4885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 797..2626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 2631..3053 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 3153..3845 product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene TolQ CDS 3849..4322 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 sequence185 source 1..4868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1276..2286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(2286..3551) product selenocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064571.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene selA misc_feature complement(3548..>4868) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808822.1:aldehyde dehydrogenase locus_tag LOCUS_14070 sequence186 source 1..4858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..1053 product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene modB CDS 1050..2111 product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKL8 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene modC CDS complement(2127..2930) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886667.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene bdhA1 CDS complement(2927..4417) product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 sequence187 source 1..4847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 883..1479 product gamma-glutamyl kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1507..3756) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 misc_feature complement(3927..>4847) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338236.1:SAM-dependent methyltransferase locus_tag LOCUS_14140 sequence188 source 1..4776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 310..1755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1733..2893) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(3001..3927) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 sequence189 source 1..4747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1199 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382947.1:3-oxoacyl-ACP synthase locus_tag LOCUS_14180 CDS 1216..1992 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXE3 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene fabI CDS complement(1998..2588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 2834..3523 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 3520..4356 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 sequence190 source 1..4739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 408..1208 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene suhB CDS 1332..1520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1982..3019 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(3016..3732) product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E6 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(3755..4678) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene xerC sequence191 source 1..4738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..1328 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y3 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene pdxH CDS 1515..2036 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719511.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 2038..2499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 tRNA 2548..2624 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 2677..3663 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rfbG sequence192 source 1..4724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..935 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1176..1817 product carnitine operon oxidoreductase caia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538072.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1902..2219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 2409..2579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 2590..3975 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 sequence193 source 1..4655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(520..948) product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1130..1348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1405..1893 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J671 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene purE CDS 1886..2959 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene purK CDS complement(3176..3913) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 3908..4432 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 sequence194 source 1..4631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1059 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J077:UDP-N-acetylglucosamine 1-carboxyvinyltransferase locus_tag LOCUS_14450 CDS 1052..1522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1519..2034 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 2084..3394 product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J079 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene hisD1 CDS 3394..3876 product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J080 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 3945..4346 product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 sequence195 source 1..4619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 809..1900 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I2 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene anmK CDS complement(1884..3188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 misc_feature complement(3390..>4619) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3H9:enolase locus_tag LOCUS_14530 sequence196 source 1..4569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 520..774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 883..1635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(2380..3054) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(3190..4395) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene sqr sequence197 source 1..4564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(809..1447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1934..3007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(3065..3427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(3453..4559) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F8 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene nuoD sequence198 source 1..4551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(555..1403) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 sequence199 source 1..4550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 873..1763 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1936..3261) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene amt-2 CDS complement(3295..3633) product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene glnK sequence200 source 1..4542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1057..1239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 tRNA complement(1615..1704) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 1972..2787 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 2806..3975 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537978.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene dacC sequence201 source 1..4519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 399..581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 780..1049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1144..1509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1511..2380) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene ilvE1 CDS 2554..3069 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338743.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 3066..3779 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 sequence202 source 1..4509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..813) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1016..1690) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1687..2316) product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 2542..3765 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 misc_feature complement(3773..>4509) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58382:acetate kinase locus_tag LOCUS_14800 sequence203 source 1..4480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..2880) product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J336 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene glnE CDS 2972..3442 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 misc_feature complement(3432..>4480) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337682.1:lipid-A-disaccharide synthase locus_tag LOCUS_14830 sequence204 source 1..4477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1947..2933) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 3078..3620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 misc_feature complement(3660..>4477) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338342.1:peptidyl-dipeptidase Dcp locus_tag LOCUS_14860 sequence205 source 1..4464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1599 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970349.1:molybdopterin molybdenumtransferase MoeA locus_tag LOCUS_14870 CDS complement(1719..2741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(2778..3257) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L0 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene greA misc_feature complement(3604..>4464) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y8I1:argininosuccinate lyase locus_tag LOCUS_14900 sequence206 source 1..4463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1049 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140040.1:propionyl-CoA synthetase locus_tag LOCUS_14910 CDS 1134..2657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 2723..3115 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene cdd CDS 3120..4427 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J645 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene deoA sequence207 source 1..4463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1215..2225) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene hypE misc_feature complement(2222..>4463) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WKA0:carbamoyltransferase locus_tag LOCUS_14960 sequence208 source 1..4452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..1592 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW85 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene lnt CDS 1661..2842 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9E5 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene metK CDS 2918..3397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 3528..4172 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW88 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene trmB sequence209 source 1..4446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(558..1502) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene pldB CDS complement(1509..1802) product sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1946..2440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 sequence210 source 1..4409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 606..845 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1003..1188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1299..1949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1982..2794 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWW7 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene proC CDS 2791..3132 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene csaA CDS 3132..4079 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 sequence211 source 1..4404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 459..1373 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5J0 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene psuG CDS 1453..2256 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(2295..2699) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 misc_feature complement(2732..>4404) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537699.1:ABC transporter substrate-binding protein locus_tag LOCUS_15130 sequence212 source 1..4395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1246..1962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 2314..3354 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5H5 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene pyrC CDS 3419..4099 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5H4 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene pyrE sequence213 source 1..4387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(918..1226) product nucleoid-structuring protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene spb CDS complement(1360..3327) product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene MeaA CDS complement(3448..4074) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 sequence214 source 1..4385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(352..1191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1282..2310) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F8 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene ruvB CDS complement(2312..2956) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F6 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ruvA CDS complement(2953..3456) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F5 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene ruvC CDS 3792..3992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 sequence215 source 1..4377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..687) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 768..1373 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1460..2329 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene mtnP CDS 2471..3100 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 3150..3854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 sequence216 source 1..4362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 342..2558 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene glgB CDS 2597..3856 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8L5 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene glgC sequence217 source 1..4359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(603..1280) product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J285 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1277..2041) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(2090..3076) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J283 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(3087..4007) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 sequence218 source 1..4353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(651..1682) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1679..3868) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 sequence219 source 1..4328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1829 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709122.1:3-hydroxyacyl-CoA dehydrogenase locus_tag LOCUS_15410 CDS 1826..3847 product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene paaZ sequence220 source 1..4317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..1582 product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888023.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1594..2580 product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 2577..3740 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 sequence221 source 1..4310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..1530) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1647..3278) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene pgm misc_feature complement(3297..>4310) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTY8:4-alpha-glucanotransferase locus_tag LOCUS_15480 sequence222 source 1..4300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1000..1362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1371..2375) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 misc_feature complement(2372..>4300) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532890.1:ABC transporter permease locus_tag LOCUS_15510 sequence223 source 1..4296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1141..1902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1883..3616) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7R9 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene ilvD sequence224 source 1..4294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974044.1:ribokinase locus_tag LOCUS_15550 CDS 1032..2684 product phosphonate monoester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(2706..3863) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEQ5 transl_table 11 codon_start 1 locus_tag LOCUS_15570 sequence225 source 1..4271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1390..2409) product pyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(2409..3683) product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene porA CDS complement(3695..4213) product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 sequence226 source 1..4269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..941) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene pcaD CDS complement(1067..1963) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3R3 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene rpoH1 CDS complement(2139..3173) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3R4 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene rluD CDS 3172..3474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 3607..3945 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 3935..4138 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 sequence227 source 1..4264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..346 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ0 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene rpsU CDS complement(646..1296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338453.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1293..1451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1550..2359) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(2359..2829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(2822..3859) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(3912..4262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 sequence228 source 1..4260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..812 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583525.1:ABC transporter ATP-binding protein locus_tag LOCUS_15740 CDS 860..1264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 note possible pseudo, internal stop codon CDS 1283..2575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 note possible pseudo, internal stop codon CDS 2675..3685 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 sequence229 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722853.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 687..884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1107..1337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 1511..2329 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 2537..3946 product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 sequence230 source 1..4232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..2237 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537606.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene cpdB CDS 2993..4024 product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB36 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene rsgA sequence231 source 1..4209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 830..1195 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1228..2040 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 2165..3496 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 misc_feature complement(3688..>4209) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140073.1:guanine deaminase locus_tag LOCUS_15880 sequence232 source 1..4199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..1676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1739..2260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(2251..2877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(2995..3447) product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAH0 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene ccmE misc_feature complement(3585..>4199) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J276:glutamate racemase locus_tag LOCUS_15930 sequence233 source 1..4190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..1375) product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1372..1884) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1958..2950) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ5 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene hslO CDS 3042..3491 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 misc_feature complement(3469..>4190) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139992.1:fused response regulator/phosphatase locus_tag LOCUS_15980 sequence234 source 1..4175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 62..1462 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1615..3066 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene xylB sequence235 source 1..4173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2196..2423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 2626..3096 product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W5 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rsfS CDS 3106..3576 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene rlmH sequence236 source 1..4172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..1365 product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L6 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene mcl1 CDS 1483..2445 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L4 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene accA CDS complement(2462..3064) product pyridoxamine 5'-phosphate oxidase-related FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(3068..3790) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 sequence237 source 1..4158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..1737) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1838..2689) product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY8 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene ttcA CDS complement(2813..3058) product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY9 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(3055..3408) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene rnpA sequence238 source 1..4148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1354..2346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(2425..3951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 sequence239 source 1..4136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1769 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene glsF CDS 1842..2747 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene msrP CDS 2856..3467 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXZ4 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene msrQ sequence240 source 1..4125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..2172) product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(2192..2644) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 2789..3892 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 sequence241 source 1..4117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 717..2258 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 2245..3330 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 sequence242 source 1..4115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3151..3618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719293.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 sequence243 source 1..4075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..968 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976326.1:methyltransferase locus_tag LOCUS_16240 CDS complement(952..1929) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1974..2669) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene hutC CDS complement(2666..4033) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene hutF sequence244 source 1..4060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 532..1539 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1536..2429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 sequence245 source 1..4056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..1371) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6L5 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene rnhB CDS complement(1474..1941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 2119..2400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722131.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 2372..3076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(3308..3577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(3654..3935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 sequence246 source 1..4055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1879 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337816.1:carbon monoxide dehydrogenase locus_tag LOCUS_16360 CDS 1986..2777 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 2848..3393 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 misc_feature complement(3451..>4055) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970367.1:tungsten ABC transporter substrate-binding protein locus_tag LOCUS_16390 sequence247 source 1..4053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 755..1927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1924..2595 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(2614..3033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 sequence248 source 1..4052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1231) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1328..1576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1682..2329) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337043.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 2412..3053 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 misc_feature complement(2999..>4052) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337044.1:glycosyl transferase locus_tag LOCUS_16470 sequence249 source 1..4009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 437..733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 730..1161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1193..1585 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1900..2286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(3277..3543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 sequence250 source 1..4001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 401..1120 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 1117..3480 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 sequence251 source 1..3995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..739 product putative HTH-type transcriptional regulator y4tD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55658 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(873..1079) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene cspA CDS complement(1312..2301) product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene argK sequence252 source 1..3995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 772..1518 product N-acetylmannosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1515..2270) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(2267..3853) product glucose-methanol-choline oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730932.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 sequence253 source 1..3991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(260..769) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXE1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene fabA CDS 947..1378 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene fur CDS 1498..3318 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence254 source 1..3986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..1071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1068..2300) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(2297..3247) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 misc_feature complement(3235..>3986) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804036.1:oxidoreductase locus_tag LOCUS_16670 sequence255 source 1..3983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1241 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4D4:glycine dehydrogenase (decarboxylating) locus_tag LOCUS_16680 CDS complement(2047..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 2689..3078 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 sequence256 source 1..3965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..1445 product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1506..2513) product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene idiA CDS 2689..3864 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 sequence257 source 1..3959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..1334 product ammonia monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1321..2196) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 sequence258 source 1..3951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..994) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(991..1563) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL02 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1570..2289) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene yobR CDS complement(2286..3014) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene cinA1 sequence259 source 1..3946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(552..1535) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6I0 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene lpxK CDS complement(1535..2830) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene kdtA CDS complement(2841..3086) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(3149..3928) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 sequence260 source 1..3943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..933) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(943..1857) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1943..3196) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 misc_feature complement(3237..>3943) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528575.1:N-acetylmuramic acid 6-phosphate etherase locus_tag LOCUS_16870 sequence261 source 1..3942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..914 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RNH6:glycogen synthase locus_tag LOCUS_16880 CDS 911..3016 product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D9 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene glgX1 sequence262 source 1..3935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(479..1606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1649..2407) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(2444..2839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(2806..3402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 sequence263 source 1..3933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 718..1782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338066.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1799..2077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(2070..2258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 2399..2776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 2885..3451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 3451..3633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 sequence264 source 1..3920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1062..2168) product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(2165..2782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(2779..3846) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 sequence265 source 1..3917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1166..1990) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1987..2931) product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 3033..3338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 sequence266 source 1..3891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1812 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYY6:membrane protein insertase YidC locus_tag LOCUS_17080 CDS 1809..2558 product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 2549..3199 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y596 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene engB sequence267 source 1..3891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1369..2454) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M8 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene mraY CDS complement(2455..3879) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M9 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene murF sequence268 source 1..3889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..1044 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z7 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene fabD CDS 1150..1887 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene fabG CDS 1887..2789 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(2802..3446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 sequence269 source 1..3889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..888) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J376 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene pstB CDS complement(908..2227) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J375 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene pstA CDS complement(2224..3672) product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J374 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene pstC sequence270 source 1..3888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..959 product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AP9 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene nhaA CDS 1164..1823 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene kpsT CDS 1807..3414 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene kpsE CDS complement(3411..3887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 sequence271 source 1..3879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..674 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2C5:putative cytosol aminopeptidase locus_tag LOCUS_17240 CDS 679..1143 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1140..1721) product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1786..2406) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 transl_table 11 codon_start 1 locus_tag LOCUS_17270 misc_feature complement(2403..>3879) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384433.1:glycosyl transferase family 1 locus_tag LOCUS_17280 sequence272 source 1..3869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..1495) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728960.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1633..2238 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene pncA CDS 2259..2819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 2910..3485 product UPF0314 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH5 transl_table 11 codon_start 1 locus_tag LOCUS_17320 sequence273 source 1..3859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2306..3631) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 sequence274 source 1..3853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..1823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1858..2967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 sequence275 source 1..3831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1020..1709) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336760.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1722..2252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 2333..3382 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 sequence276 source 1..3829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(318..402) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 634..1050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1019..2662) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 2835..3173 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene glnB sequence277 source 1..3828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..525) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XW84 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene vapC CDS complement(525..755) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(821..1561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 1871..2032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 2694..2972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 sequence278 source 1..3818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..1838 product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene merA1 CDS 1869..3266 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 tRNA 3336..3412 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence279 source 1..3747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 554..2512 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene cpdB CDS 2665..3537 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 sequence280 source 1..3746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(413..1771) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene gor CDS complement(1876..2664) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J101 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene rpiA CDS complement(2738..3367) product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 sequence281 source 1..3734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(616..1056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 1742..2434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(2445..3587) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene mnmA sequence282 source 1..3719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1016..2029) product 2,3-diketo-L-gulonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene yiiZ CDS complement(2275..3609) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene mifR sequence283 source 1..3718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(605..1060) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 sequence284 source 1..3713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..751) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN4 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene bfr CDS complement(881..2482) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 2588..2881 product septum formation initiator precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 sequence285 source 1..3705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1425 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5A7:cytochrome c oxidase subunit 1 locus_tag LOCUS_17660 CDS 1425..1970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 2081..3445 product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEM1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene mntH sequence286 source 1..3705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(236..1075) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B7 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene prmC CDS complement(1072..2124) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X7 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene prfA CDS complement(2157..2636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(2701..3471) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 sequence287 source 1..3703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 404..1024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1119..2108 product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 2154..3083 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene cobC sequence288 source 1..3701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(584..1030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1295..1567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1914..2579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 2670..3101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 tRNA 3162..3236 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 sequence289 source 1..3685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..512 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene dtd CDS complement(509..1534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970722.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1648..1839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(2224..3477) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(3503..3685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 sequence290 source 1..3671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 813..2168 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51008 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene hemZ misc_feature complement(2360..>3671) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338426.1:peptide ABC transporter ATPase locus_tag LOCUS_17870 sequence291 source 1..3668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1338) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene lctB CDS complement(1566..2357) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9D1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene trpA CDS complement(2425..2835) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 sequence292 source 1..3664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..1230 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene paaK CDS 1243..1995 product ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 2073..2600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(2676..3599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 sequence293 source 1..3654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2179..2355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 sequence294 source 1..3650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 44..970 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1001..1624 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1621..1800 product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6F2 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1820..3079) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 sequence295 source 1..3643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..2707) product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708706.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 sequence296 source 1..3622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 813..1484 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY67 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1538..2875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 misc_feature complement(2943..>3622) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384184.1:peptidase S1 locus_tag LOCUS_18040 sequence297 source 1..3619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..1693 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1690..2895) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 misc_feature complement(2888..>3619) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538212.1:3-carboxy-cis,cis-muconate cycloisomerase locus_tag LOCUS_18070 sequence298 source 1..3593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 234..992 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1053..1505) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1502..2365) product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 misc_feature complement(2491..>3593) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0E2:isoleucine--tRNA ligase locus_tag LOCUS_18110 sequence299 source 1..3587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(98..640) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(682..1944) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1941..3329) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene thrC sequence300 source 1..3584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 395..748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(874..2244) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y8 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene rimO CDS 2359..2661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(2674..3462) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene dltE sequence301 source 1..3576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..762 product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Z5 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene pfkB CDS complement(828..1388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1740..3341 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003614.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 sequence302 source 1..3568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..1688 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1673..2344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(2299..3429) product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561701.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 sequence303 source 1..3567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 636..1388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1476..1862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 1960..2394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 2394..3089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 sequence304 source 1..3553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..591 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528803.1:abortive infection protein locus_tag LOCUS_18300 CDS 666..1613 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC3 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene accD CDS 1610..2890 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene folC sequence305 source 1..3547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..1009 product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528293.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 1006..1782 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 1784..3229 product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3B2 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene lcdH sequence306 source 1..3522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(928..1689) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene cobF CDS complement(1767..2492) product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(2512..2685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(3015..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 sequence307 source 1..3517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..816 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140202.1:methylenetetrahydrofolate reductase locus_tag LOCUS_18400 CDS 832..1809 product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1898..2917) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 sequence308 source 1..3503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(489..935) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1029..1454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719789.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2257..2418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(2523..2768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 sequence309 source 1..3485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 45..1049 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J265 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene gapB CDS 1578..2117 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 2415..3416 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAI2 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene gapB sequence310 source 1..3477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(836..1306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1387..1653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1711..1935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2323..2946) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6N6 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene petA sequence311 source 1..3475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(491..1003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1065..1967) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene truB CDS complement(2002..2748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2750..3148) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6P6 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rbfA sequence312 source 1..3455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..683 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4L8:D-alanine--D-alanine ligase locus_tag LOCUS_18590 CDS 671..1558 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L7 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene ftsQ CDS 1555..2889 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L6 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene ftsA sequence313 source 1..3452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 467..2080 product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 sequence314 source 1..3446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 871..2457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721144.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 sequence315 source 1..3441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1447..2916) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 misc_feature complement(2913..>3441) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707648.1:DNA-binding response regulator locus_tag LOCUS_18650 sequence316 source 1..3433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..3128) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA12 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene topA sequence317 source 1..3427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..1198) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J642 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene upp CDS complement(1195..2172) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene add CDS complement(2169..3377) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J644 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene deoB sequence318 source 1..3426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(2..77) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(164..1072) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 1201..3381 product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 sequence319 source 1..3410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(895..1986) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J364 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene plsX CDS complement(2017..2220) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5G2 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene rpmF CDS complement(2445..3023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337609.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 sequence320 source 1..3382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 425..1078 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1222..1872 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708566.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 sequence321 source 1..3381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708061.1:peptidase T4 locus_tag LOCUS_18770 CDS 628..1203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1214..2233) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(2346..2900) product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ15 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene atpF1 sequence322 source 1..3370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1153..3009) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ybaU sequence323 source 1..3359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..1285 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L98 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene galM CDS 1273..2562 product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 sequence324 source 1..3356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1515..2300) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(2312..2977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 note possible pseudo, internal stop codon sequence325 source 1..3350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..1245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 1245..2387 product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2488..3117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 sequence326 source 1..3340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(640..1212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 1752..2153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 misc_feature complement(2194..>3340) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IW81:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase locus_tag LOCUS_18920 sequence327 source 1..3334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 843..1496 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7Q5 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 1707..2243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 sequence328 source 1..3326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(789..2264) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWD2 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene hisS CDS 2375..2578 product slyX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 misc_feature complement(2796..>3326) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34653:fatty acid desaturase locus_tag LOCUS_18980 sequence329 source 1..3278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(316..1965) product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 misc_feature complement(1962..>3278) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089915.1:methylhydantoinase locus_tag LOCUS_19000 sequence330 source 1..3272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(600..1676) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(1676..1909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(1912..2898) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 sequence331 source 1..3266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 776..2722 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9I5 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene thrS sequence332 source 1..3250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..1083) product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 1154..1999 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2056..3108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 sequence333 source 1..3246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(521..1003) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(1100..1972) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene metF CDS 2064..2969 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene metR sequence334 source 1..3237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926703.1:C4-dicarboxylate ABC transporter permease locus_tag LOCUS_19110 CDS 927..1793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(1790..2665) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 sequence335 source 1..3234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 449..1288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 1433..1813 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene TRm11a CDS 1753..2382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 note possible pseudo, frameshifted CDS complement(2389..2694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 sequence336 source 1..3226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2142..2423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2436..2942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2992..3162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 sequence337 source 1..3217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..931) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene prmA CDS complement(1059..1709) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F2 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene msrA CDS complement(1770..3005) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 sequence338 source 1..3202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1252..2544) product crotonyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ91 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ccr misc_feature complement(2671..>3202) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y8D8:glycerol-3-phosphate 1-O-acyltransferase locus_tag LOCUS_19250 sequence339 source 1..3200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..1681 product potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene trkH1 CDS 1828..2061 product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2L7 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene hfq sequence340 source 1..3199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..1587) product Flp pilus assembly protein, ATPase CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1598..2845) product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(3074..3199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 sequence341 source 1..3188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 875..2140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2217..3080) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 sequence342 source 1..3187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..478) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene rplO CDS complement(765..953) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5B9 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene rpmD CDS complement(959..1534) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q5 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rpsE CDS complement(1683..2042) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q6 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rplR CDS complement(2054..2587) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q7 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene rplF CDS complement(2600..2992) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C3 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene rpsH sequence343 source 1..3185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(678..1370) product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA4 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene lexA CDS complement(1449..2624) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 sequence344 source 1..3173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..1717 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene sucB CDS 1908..2915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 sequence345 source 1..3170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 657..1700 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(1709..2749) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530418.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 sequence346 source 1..3166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..1084 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337924.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 1304..1771 product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 1956..2414 product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 misc_feature complement(2550..>3166) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J1L9:50S ribosomal protein L9 locus_tag LOCUS_19490 sequence347 source 1..3166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(392..1171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(1168..1992) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(2060..3007) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y788 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene dusA sequence348 source 1..3157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..599 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUI8:putative 2-ketoarginine decarboxylase AruI locus_tag LOCUS_19530 CDS 599..1774 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 tRNA complement(1872..1947) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(2127..2471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 sequence349 source 1..3137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..2259 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190520.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene fadH sequence350 source 1..3122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..1229 product UDP-glucuronate 5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 sequence351 source 1..3116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 445..1542 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D3 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene folE2 CDS 1655..1870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 sequence352 source 1..3112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1990 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene nadE CDS complement(2087..2536) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2620..3000 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 sequence353 source 1..3105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..954) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(947..1654) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(1861..2628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 sequence354 source 1..3102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 604..1866 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 1963..2856 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974047.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 sequence355 source 1..3093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6..1730) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 misc_feature complement(1917..>3093) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967776.1:dehydrogenase locus_tag LOCUS_19690 sequence356 source 1..3092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(835..1149) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 1327..2088 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S3 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene purC CDS 2153..2386 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene purS CDS 2383..3051 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S5 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene purQ sequence357 source 1..3082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..1374 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 1398..1805 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(1933..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene ytoQ misc_feature complement(2495..>3082) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5M6:phenylalanine--tRNA ligase beta subunit locus_tag LOCUS_19770 sequence358 source 1..3061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 sequence359 source 1..3053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..520 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521491.1:DUF2063 domain-containing protein locus_tag LOCUS_19790 CDS 532..1101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(1083..1409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 1633..1839 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(1872..2354) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0X0 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene folA misc_feature complement(2357..>3053) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89G35:thymidylate synthase locus_tag LOCUS_19840 sequence360 source 1..3053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..1539 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 sequence361 source 1..3051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..1003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(1000..1491) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919945.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 1677..2006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2003..3034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 sequence362 source 1..3045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..483) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY62 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene rpsT CDS complement(651..1427) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(1494..2357) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene mutM sequence363 source 1..3033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence364 source 1..3011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 718..1992 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 2079..2246 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene rpmG misc_feature complement(2404..>3011) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537939.1:membrane protein locus_tag LOCUS_19950 sequence365 source 1..3010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(893..1870) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2028..3008) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337089.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 sequence366 source 1..3004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..797 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975653.1:guanine deaminase locus_tag LOCUS_19980 CDS 945..2615 product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN3 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene betA sequence367 source 1..2990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..328 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 sequence368 source 1..2990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1201..1725) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 1837..2667 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene pheA sequence369 source 1..2980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1336 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 1333..2259 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338047.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 sequence370 source 1..2969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(589..1278) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 sequence371 source 1..2958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..1096) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 1247..1651 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 1651..1929 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971518.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(1901..2605) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 sequence372 source 1..2957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(227..>2957) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392406.1:ATPase locus_tag LOCUS_20100 sequence373 source 1..2956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1032..1799) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J436 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene gloB CDS 1863..2612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 sequence374 source 1..2948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 814..2019 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385060.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 2016..2789 product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene hpcH sequence375 source 1..2938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 542..1033 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(1257..1496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(1609..2535) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 sequence376 source 1..2937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083710.1:acyl CoA:acetate/3-ketoacid CoA transferase locus_tag LOCUS_20190 tRNA complement(1883..1958) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 2121..2861 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 sequence377 source 1..2917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(575..1279) product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene mtbC CDS 1410..2510 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 sequence378 source 1..2914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(778..1584) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(1614..2747) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 sequence379 source 1..2913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..875 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZWR3:putative thymidine phosphorylase locus_tag LOCUS_20250 CDS 872..1777 product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 1774..2676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 sequence380 source 1..2911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..1189) product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(1323..1781) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337040.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(1778..2233) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722770.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 sequence381 source 1..2909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..732 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090229.1:haloacetate dehalogenase locus_tag LOCUS_20310 CDS complement(857..2431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 sequence382 source 1..2905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 669..1259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 1247..1510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(1517..2668) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 sequence383 source 1..2893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..1757 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 sequence384 source 1..2875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(285..1325) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 sequence385 source 1..2860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 note possible pseudo, internal stop codon, frameshifted CDS 673..1080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 1233..2231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 sequence386 source 1..2837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(942..2126) product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 sequence387 source 1..2834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 misc_feature complement(941..>2834) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J504:malate synthase G locus_tag LOCUS_20440 sequence388 source 1..2823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..1448 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 misc_feature complement(1560..>2823) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4J9:ribonuclease E note possible pseudo, frameshifted locus_tag LOCUS_20460 sequence389 source 1..2808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(393..1010) product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E0 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene cmk CDS complement(1043..1561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(1566..1964) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 misc_feature complement(2103..>2808) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IW89:3-phosphoshikimate 1-carboxyvinyltransferase locus_tag LOCUS_20500 sequence390 source 1..2787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..989 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J243:aminotransferase locus_tag LOCUS_20510 CDS 1052..2260 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337889.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene amiC sequence391 source 1..2783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(325..2733) product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339409.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene xdhB sequence392 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1009 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RRI3:putative glutamate--cysteine ligase 2 locus_tag LOCUS_20540 CDS 1102..2247 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 sequence393 source 1..2771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..1329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 1326..2288 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 sequence394 source 1..2762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..1272) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 1401..2180 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 sequence395 source 1..2757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 781..1161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812491.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 1158..2318 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 sequence396 source 1..2749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(419..1273) product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UB8 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(1388..1783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2082..2522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 sequence397 source 1..2732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1297..2355) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888372.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene thuR sequence398 source 1..2716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 481..1437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 1434..2408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 sequence399 source 1..2696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(606..1193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 1287..2549 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D8 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene PurD sequence400 source 1..2690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1451) product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 1534..2481 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 sequence401 source 1..2687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(791..1879) product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZK7 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene ribA sequence402 source 1..2684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 841..1452 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720331.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(1582..1968) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 misc_feature complement(1965..>2684) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066584.1:dihydropyrimidine dehydrogenase subunit B locus_tag LOCUS_20770 sequence403 source 1..2676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..565 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337771.1:precorrin-8X methylmutase locus_tag LOCUS_20780 CDS 568..1284 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene cobI CDS 1281..2018 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene cobJ misc_feature complement(1994..>2676) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337774.1:precorrin-6A reductase locus_tag LOCUS_20810 sequence404 source 1..2655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 661..915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 1000..2289 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 sequence405 source 1..2652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 271..1257 product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene paaA CDS 1269..1553 product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene paaB CDS 1550..2314 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene paaI sequence406 source 1..2642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1359..1433) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(1502..2380) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 sequence407 source 1..2638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1251..>2638) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336861.1:phosphate acetyltransferase locus_tag LOCUS_20880 sequence408 source 1..2632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(872..1498) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 1576..1833 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384512.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 sequence409 source 1..2621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..1445 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 1517..2431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 sequence410 source 1..2612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 202..411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 492..662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(671..1027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(1014..1667) product nitrile hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(1671..2309) product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene nthA sequence411 source 1..2592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1051..1125 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 1297..1884 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y411 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene hisB CDS 1888..2526 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33565 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene hisH sequence412 source 1..2591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..1276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911050.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 1386..2051 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene tctD sequence413 source 1..2589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 983..2371 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3K2 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene mgtE sequence414 source 1..2589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 939..2225 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 sequence415 source 1..2588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..1483) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3A5 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene glmM CDS complement(1480..2493) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 transl_table 11 codon_start 1 locus_tag LOCUS_21060 sequence416 source 1..2579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..1579) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058017.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 sequence417 source 1..2570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1168 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337307.1:acyl-CoA dehydrogenase locus_tag LOCUS_21080 CDS 1179..1391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 1702..2343 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene gst sequence418 source 1..2568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(632..1414) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(1411..2454) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3L4 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene alr sequence419 source 1..2565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1089..2390) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 sequence420 source 1..2557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 388..1665 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 misc_feature complement(1668..>2557) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089749.1:cytochrome P450 locus_tag LOCUS_21150 sequence421 source 1..2539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..1586) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(1583..2431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 sequence422 source 1..2539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 277..1605 product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 sequence423 source 1..2503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..1113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 1110..2264 product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 sequence424 source 1..2491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..1022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(1019..1651) product glycoside hydrolase family 24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(1665..2321) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 sequence425 source 1..2485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 503..1765 product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene ttuD1 sequence426 source 1..2476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 495..1622 product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 1627..2103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 sequence427 source 1..2466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(420..>2466) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336818.1:ABC transporter permease locus_tag LOCUS_21280 sequence428 source 1..2451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 615..1358 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8J1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene pdxJ CDS 1441..2061 product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 sequence429 source 1..2439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(404..1192) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(1194..2309) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 sequence430 source 1..2429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1465..2226 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 sequence431 source 1..2424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence432 source 1..2424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..2384 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene ppsA sequence433 source 1..2418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(815..1204) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ02 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene rpsP CDS complement(1247..1543) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(1623..1910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 sequence434 source 1..2409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAG0:tyrosine--tRNA ligase locus_tag LOCUS_21390 CDS complement(850..1584) product ornithine-acyl-ACP acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337612.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 1723..2118 product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 sequence435 source 1..2400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence436 source 1..2398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..2398) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene ntrY sequence437 source 1..2370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 397..1542 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 misc_feature complement(1786..>2370) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q935L3:mercuric reductase locus_tag LOCUS_21440 sequence438 source 1..2365 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(924..1463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 sequence439 source 1..2363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence440 source 1..2360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 16..1377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 sequence441 source 1..2357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..950 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene btr CDS 1224..2171 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene ilvE2 CDS complement(2177..2356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 sequence442 source 1..2356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 853..1614 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 sequence443 source 1..2320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1839) product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q58 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene cobB sequence444 source 1..2320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 290..838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(855..2006) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2003..2320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 sequence445 source 1..2316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(361..1257) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 sequence446 source 1..2314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..631 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z5 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene rpsI CDS complement(736..2055) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 sequence447 source 1..2311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J6H4:methyltransferase locus_tag LOCUS_21590 CDS 871..1539 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 misc_feature complement(1536..>2311) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336763.1:alkane 1-monooxygenase locus_tag LOCUS_21610 sequence448 source 1..2308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..634) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53158 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene hisI CDS 702..1154 product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene nifU misc_feature complement(1626..>2308) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337615.1:ATP-dependent DNA helicase RecG locus_tag LOCUS_21640 sequence449 source 1..2304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(797..1585) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(1591..2031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 sequence450 source 1..2302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..598 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PMC8:UPF0271 protein locus_tag LOCUS_21670 CDS 639..1553 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 sequence451 source 1..2289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..999 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531218.1:ABC transporter substrate-binding protein locus_tag LOCUS_21690 misc_feature complement(1788..>2289) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336960.1:creatinase locus_tag LOCUS_21700 sequence452 source 1..2271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1065..>2271) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083174.1:fumarylacetoacetase locus_tag LOCUS_21710 sequence453 source 1..2269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(613..1935) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058014.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 sequence454 source 1..2258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 758..1558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene radC CDS complement(1569..1958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 sequence455 source 1..2257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1298..>2257) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337305.1:acetyl-CoA acetyltransferase locus_tag LOCUS_21760 sequence456 source 1..2248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(243..1490) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 misc_feature complement(1487..>2248) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090843.1:cycloisomerase locus_tag LOCUS_21780 sequence457 source 1..2238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1370 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYU8:bifunctional purine biosynthesis protein PurH locus_tag LOCUS_21790 CDS 1382..1855 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D2 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene lspA sequence458 source 1..2234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(713..1255) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(1261..1455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 misc_feature complement(1459..>2234) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085117.1:FAD-dependent oxidoreductase locus_tag LOCUS_21830 sequence459 source 1..2232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(892..2199) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 sequence460 source 1..2231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1200 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338470.1:MATE family efflux transporter locus_tag LOCUS_21860 sequence461 source 1..2219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..1182) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 sequence462 source 1..2196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1386..>2196) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5H6:bifunctional uridylyltransferase/uridylyl-removing enzyme locus_tag LOCUS_21880 sequence463 source 1..2190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..709 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339635.1:adenosylmethionine-8-amino-7-oxononanoate aminotransferase locus_tag LOCUS_21890 CDS complement(740..1630) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704503.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 sequence464 source 1..2155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(788..1795) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y407 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene deoC sequence465 source 1..2151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..803) product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 1090..1452 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEC3 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene nuoA sequence466 source 1..2141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(639..1010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719345.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(1429..1896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 sequence467 source 1..2137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence468 source 1..2128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 sequence469 source 1..2127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1088 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IW76:tRNA 2-selenouridine synthase locus_tag LOCUS_21980 misc_feature complement(1071..>2127) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FK1:selenide, water dikinase locus_tag LOCUS_21990 sequence470 source 1..2124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..641 product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 754..1644 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 sequence471 source 1..2121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..1561) product sensor histidine kinase RegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene regB sequence472 source 1..2112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(638..1540) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337872.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 sequence473 source 1..2103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1050..1733 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722664.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 sequence474 source 1..2100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1263..2006) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A230 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene hisA sequence475 source 1..2097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1516..>2097) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719253.1:cell division protein FtsI locus_tag LOCUS_22060 sequence476 source 1..2089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1102..1665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(1673..1840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 sequence477 source 1..2088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..689) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 845..1729 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 sequence478 source 1..2083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 467..994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 sequence479 source 1..2075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5..817 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ05 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene trmD sequence480 source 1..2070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence481 source 1..2069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..929 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336798.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 sequence482 source 1..2058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 sequence483 source 1..2058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1295) product periplasmic iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638696.2 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene afuA misc_feature complement(1265..>2058) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038449.1:sensor histidine kinase locus_tag LOCUS_22160 sequence484 source 1..2050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(373..1521) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(1518..1847) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162435.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(1881..2048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 sequence485 source 1..2045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..1355) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J426 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene ribF CDS complement(1502..1945) product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 sequence486 source 1..2041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..635 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003535109.1:oxidoreductase locus_tag LOCUS_22220 sequence487 source 1..2038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 misc_feature complement(1070..>2038) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YA71:argininosuccinate lyase locus_tag LOCUS_22240 sequence488 source 1..2024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(391..1938) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J310 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene glpD sequence489 source 1..2022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 233..610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(720..1559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 sequence490 source 1..2021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(834..1121) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene acpP1 misc_feature complement(1132..>2021) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009562231.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase locus_tag LOCUS_22290 sequence491 source 1..2015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 472..963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 960..1991 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 sequence492 source 1..2015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence493 source 1..2009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(455..700) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR4 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene xseB CDS complement(697..1635) product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 sequence494 source 1..2004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 619..1416 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 sequence495 source 1..1994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1475 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086713.1:C4-dicarboxylate ABC transporter locus_tag LOCUS_22350 sequence496 source 1..1993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(943..1977) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 sequence497 source 1..1992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331279.1:short-chain dehydrogenase locus_tag LOCUS_22370 CDS 689..1621 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 sequence498 source 1..1986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..1363 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 sequence499 source 1..1981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1121 product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene arcB misc_feature complement(1123..>1981) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336756.1:DNA methylase locus_tag LOCUS_22410 sequence500 source 1..1978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(328..1314) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM6 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene pip sequence501 source 1..1976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..1637 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 tRNA 1723..1798 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence502 source 1..1969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..530 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y897:molybdenum cofactor biosynthesis protein B locus_tag LOCUS_22440 sequence503 source 1..1968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 488..1579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 sequence504 source 1..1968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..644 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525213.1:flavin reductase locus_tag LOCUS_22460 CDS 646..1680 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 sequence505 source 1..1960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 136..600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385513.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(604..1056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 misc_feature complement(1344..>1960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338713.1:DNA recombination protein RmuC locus_tag LOCUS_22500 sequence506 source 1..1954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..718 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527057.1:betaine-aldehyde dehydrogenase locus_tag LOCUS_22510 misc_feature complement(715..>1954) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383264.1:GlcNAc-PI de-N-acetylase locus_tag LOCUS_22520 sequence507 source 1..1951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(23..355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(366..1499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(1499..1951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 sequence508 source 1..1945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..1896) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 sequence509 source 1..1936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 355..1500 product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J320 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene dgt sequence510 source 1..1929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..753) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719748.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene phoR1 CDS complement(743..1204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 note possible pseudo, internal stop codon CDS complement(1256..1459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 note possible pseudo, internal stop codon sequence511 source 1..1915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(830..>1915) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331455.1:sodium-independent anion transporter locus_tag LOCUS_22610 sequence512 source 1..1915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 500..922 product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene ndk CDS complement(997..1506) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene gpt sequence513 source 1..1899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(332..1285) product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene miaA sequence514 source 1..1899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 548..1387 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 sequence515 source 1..1898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..1045 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y475 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene pgk sequence516 source 1..1895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence517 source 1..1894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(804..1235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(1287..1448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 sequence518 source 1..1886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(610..1884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 sequence519 source 1..1880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1189..>1880) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720602.1:ABC transporter ATP-binding protein locus_tag LOCUS_22710 sequence520 source 1..1875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 9..521 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(573..1331) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3P7 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene cobV sequence521 source 1..1875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(180..560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(579..1376) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SD5 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene cpdA sequence522 source 1..1869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence523 source 1..1865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706297.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 861..1148 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4W8 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene rpmB misc_feature complement(1299..>1865) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IX94:NAD-dependent protein deacylase locus_tag LOCUS_22780 sequence524 source 1..1854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..1265 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J290 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene hutI sequence525 source 1..1853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..1552) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene patB sequence526 source 1..1833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..1651) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene nahG sequence527 source 1..1832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(745..1419) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN0 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene pth sequence528 source 1..1831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..977 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 sequence529 source 1..1814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence530 source 1..1813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..1212) product alpha-glucoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene aglG misc_feature complement(1212..>1813) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974502.1:alpha-glucoside ABC transporter permease locus_tag LOCUS_22850 sequence531 source 1..1807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(402..1805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 sequence532 source 1..1789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(226..1236) product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C7 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene moaA CDS 1310..1789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 sequence533 source 1..1788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 545..1066 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 sequence534 source 1..1775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..1269 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene rkpM CDS 1365..1571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 sequence535 source 1..1759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(689..1759) product type I secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385238.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 sequence536 source 1..1749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(494..1477) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 sequence537 source 1..1738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(277..603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(600..1688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 sequence538 source 1..1734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1376) product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH82 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene paaF sequence539 source 1..1710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1075 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5D4:O-succinylhomoserine sulfhydrylase locus_tag LOCUS_22970 sequence540 source 1..1691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(662..1093) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 misc_feature complement(1106..>1691) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704330.1:C4-dicarboxylate ABC transporter locus_tag LOCUS_22990 sequence541 source 1..1684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..1437 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 sequence542 source 1..1674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 6..803 product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089114.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 sequence543 source 1..1671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence544 source 1..1650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 493..1389 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene lysR repeat_region 1435..1619 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatactggctccgcccgttcggcgct sequence545 source 1..1649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(652..>1649) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388792.1:amidohydrolase locus_tag LOCUS_23030 sequence546 source 1..1648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(615..>1648) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003601.1:citramalate synthase locus_tag LOCUS_23040 sequence547 source 1..1638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1306) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338480.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene LolE sequence548 source 1..1627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1033 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385507.1:aspartate aminotransferase locus_tag LOCUS_23060 sequence549 source 1..1626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..916) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 misc_feature complement(921..>1626) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2W5:acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase locus_tag LOCUS_23080 sequence550 source 1..1620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence551 source 1..1598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(640..>1598) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104356.1:2-methylcitrate dehydratase locus_tag LOCUS_23090 sequence552 source 1..1591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence553 source 1..1587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(397..1548) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 sequence554 source 1..1585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1058..1585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 sequence555 source 1..1584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..1506 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 sequence556 source 1..1581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(789..>1581) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860914.1:polyketide cyclase locus_tag LOCUS_23130 sequence557 source 1..1572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..1003 product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 sequence558 source 1..1569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 sequence559 source 1..1565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 sequence560 source 1..1553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence561 source 1..1548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(241..>1548) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:glycine cleavage system protein T locus_tag LOCUS_23170 sequence562 source 1..1542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(706..793) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 sequence563 source 1..1542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..1227) product precorrin-6Y methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337775.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene cobL sequence564 source 1..1535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence565 source 1..1529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence566 source 1..1527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..1196) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976243.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(1244..1525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 sequence567 source 1..1524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 sequence568 source 1..1524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(730..1158) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 sequence569 source 1..1524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence570 source 1..1518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..1037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 sequence571 source 1..1518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..863) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY46 transl_table 11 codon_start 1 locus_tag LOCUS_23250 misc_feature complement(857..>1518) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338906.1:ATP-dependent DNA helicase RecQ locus_tag LOCUS_23260 sequence572 source 1..1517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence573 source 1..1515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..901 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804855.1:methionine synthase locus_tag LOCUS_23270 sequence574 source 1..1501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(444..>1501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J556:replicative DNA helicase locus_tag LOCUS_23280 sequence575 source 1..1500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 misc_feature complement(768..>1500) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UDD3:homogentisate 1,2-dioxygenase locus_tag LOCUS_23300