COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..29080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 171..1121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384623.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1442..2725 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 2762..3175 product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530449.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3219..3896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 3896..4825 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 5030..6169 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7343..7804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7842..9308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 9647..10570 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 10643..11785 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11778..13016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13013..14239 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706087.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(14270..15364) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525333.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 15593..16405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525334.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 16408..17031 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17487..18962) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene xanB CDS 19336..22179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(22230..23423) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(23528..24817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(24916..25944) product plasmid replication initiator protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 26321..27712 product ATPase ParA type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene repA CDS 27820..28980 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 sequence002 source 1..24645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..897 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538190.1:uracil-DNA glycosylase locus_tag LOCUS_00240 CDS complement(1037..1693) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(1788..3308) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(3313..3768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(3832..4797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 5062..5910 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 5912..6847 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene serA CDS 6849..7526 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene menG CDS 7530..8756 product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene lldD CDS 9394..10386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 10383..10886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 10891..12405 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(12591..13496) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089155.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 13871..15385 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 15545..17314 product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(17512..18858) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(18872..21322) product protease/lipase ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(21388..23538) product type I secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(23645..24229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 note possible pseudo, frameshifted sequence003 source 1..23110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 351..1130 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3E2 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene coaX CDS 1127..2800 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(2935..4623) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rhlE CDS complement(4778..5587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 5737..7479 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3V3 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene argS CDS 7584..8804 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 8918..9916 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J283 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 9909..10706 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 10728..11399 product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J285 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 11405..11617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(11641..12366) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 12633..13487 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene wbbL CDS complement(13593..14687) product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene dcd tRNA complement(14729..14806) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(15328..16650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(16666..16968) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene ihfA CDS complement(17076..18050) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J365 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene fabH CDS complement(18047..19174) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J364 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene plsX CDS complement(19195..19401) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J363 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene rpmF CDS complement(19640..20212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 20459..20926 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(21037..21432) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene msrB3 CDS 21553..22329 product ornithine-acyl-ACP acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337612.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 sequence004 source 1..22296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(255..1499) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(1507..2193) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(2201..2935) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(2932..3972) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(4025..5245) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(5246..6097) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(6320..7258) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 7348..8229 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 8238..8582 product translation initiation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 8579..9544 product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(9671..11107) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene hipO CDS complement(11097..12062) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(12059..13057) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(13060..13878) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(13932..14870) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(14949..16427) product putative peptide ABC transporter periplasmic-binding protein y4tO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55669 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(16657..18240) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(18266..19630) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(19627..21054) product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene dan CDS 21155..22087 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene lysR CDS 22020..22292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 sequence005 source 1..22016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..2467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 3018..4280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(4899..7622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(7909..8811) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 8960..10243 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene ordL CDS complement(10263..11249) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 11334..12191 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 12377..13396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 13635..15737 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(15916..17211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(17407..18840) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHR4 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene pntB CDS complement(18856..20430) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHR5 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene pntA CDS complement(20672..21487) product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 sequence006 source 1..21706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2937..4346 product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA3 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene gltX1 CDS 4422..5717 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4Z0 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene gltA CDS 5790..6449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(6658..7215) product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 7337..8008 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 8195..8980 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D0 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene surE CDS 8977..9639 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene pcm CDS 9698..10978 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(11036..11896) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(11898..12737) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D4 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene tatC CDS complement(12734..13561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(13617..13823) product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D6 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene tatA CDS 14273..14839 product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(14873..16039) product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 16191..16880 product phosphonate metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(16856..17398) product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V75 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene phnN OR nitR CDS complement(17400..18095) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(18092..19048) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene corA CDS complement(19053..19913) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(19910..20761) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89V34 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene phnJ misc_feature complement(20925..>21706) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888169.1:carbon-phosphorus lyase complex subunit PhnI locus_tag LOCUS_01190 sequence007 source 1..20235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..864 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CFN2:L-threonine aldolase locus_tag LOCUS_01200 CDS complement(845..1654) product putative hydrolase, alpha/beta fold LipV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(1654..2265) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 2370..3389 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J429 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene prsA CDS complement(3470..3910) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(3998..5083) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene purK CDS complement(5091..5576) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J671 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene purE CDS complement(5690..5908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 6213..6626 product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 6692..6919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(6998..8023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(8178..9884) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene sopT CDS complement(10143..11093) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene trxB CDS 11309..11809 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene putR CDS complement(11875..12681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(12952..13200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(13404..14159) product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J663 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(14404..15504) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(15501..16400) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J661 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene lgt CDS complement(16725..17030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(17357..17683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(17821..18522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 18999..19247 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(19474..19797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 sequence008 source 1..19191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYS4:ribonuclease R locus_tag LOCUS_01440 CDS complement(1130..2728) product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V6 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene pckA CDS 3062..3763 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 3760..5502 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 5587..5973 product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 5990..6898 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V2 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 6895..7293 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 7308..7595 product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336940.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 7625..8485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(8599..9474) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene hbdA CDS 9628..10449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(10526..10891) product putative HTH-type transcriptional regulator YtfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACN2 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene ytfH CDS 11021..11872 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(11974..12900) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene etfA CDS complement(12900..13661) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene etfB CDS complement(13851..14423) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene pduO CDS complement(14429..14629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(14715..15542) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(15645..16241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 16439..18697 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5U0 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene parC sequence009 source 1..18304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..685 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 744..2369 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 2370..3959 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene fucI CDS complement(3963..4673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 4763..5464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 5487..5654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 note possible pseudo, frameshifted CDS 5636..5797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 note possible pseudo, frameshifted CDS complement(5799..6728) product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(6882..7916) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(7913..8353) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWV4 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene aroQ CDS complement(8367..9083) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 9299..10291 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 10301..10804 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 10805..12100 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(12118..12810) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 12952..13779 product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(13763..14713) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 14817..16052 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(16072..16953) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y751 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene rfbA CDS complement(16950..17795) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene rmlD/rfbD sequence010 source 1..17376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(835..1800) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 1942..2607 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 2604..3998 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene tctE CDS 3968..5005 product periplasmic iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638696.2 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene afuA CDS 5119..6930 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 6930..10595 product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 10549..10797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(10699..12378) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(12432..13004) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYD3 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(13001..13156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 13257..14069 product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(14238..14399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(14456..15286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 15390..16424 product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 sequence011 source 1..17213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 802..1872 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N5 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 2774..3247 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y991 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene mraZ CDS 3244..4272 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N3 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene rsmH CDS 4272..4622 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 4619..6400 product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene ftsI CDS 6441..7922 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N0 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene murE CDS 7922..9379 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M9 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene murF CDS 9379..10461 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M8 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene mraY CDS 10632..12032 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M6 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene murD CDS 12560..13726 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene ftsW CDS 13737..14846 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M2 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene murG CDS 14843..16273 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene murC CDS 16270..16557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 sequence012 source 1..17015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 154..2205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 2202..2873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 2922..4298 product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(4355..5116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(5086..6036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(6033..7943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(8058..9023) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(9149..10810) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341224.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(10843..12258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(12262..13494) product aspartate aminotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58350 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene aatB CDS complement(13504..14499) product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(14598..15842) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 16081..16980 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 sequence013 source 1..16999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 803..1492 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 1526..2314 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 2375..3052 product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888217.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 3049..3699 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 3686..4414 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(4523..4852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 5202..6647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(6783..7565) product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(7562..8419) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(8412..10415) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532612.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(10426..12033) product methylcrotonoyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene mccB CDS complement(12030..13196) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337540.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene ivdH CDS complement(13210..16671) product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 sequence014 source 1..16136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..786 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038874.1:DUF1338 domain-containing protein locus_tag LOCUS_02390 CDS 786..3803 product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(3867..5033) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(5030..6403) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(6400..6717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(6821..7561) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 7761..8534 product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene crt CDS 8612..9673 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 9768..10847 product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8L1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 10844..12586 product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 12651..14171 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 14168..15250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 sequence015 source 1..15875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..833 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229035.1:CoA transferase locus_tag LOCUS_02510 CDS 830..1456 product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene pcaC CDS 1462..2100 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 2097..2864 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(3063..3815) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(3919..4581) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene gst CDS complement(4698..6785) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 7040..8248 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 8380..9222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(9516..10031) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE12 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(10019..11290) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(11292..11939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(11943..12971) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(12994..13896) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972804.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene mmsB CDS complement(13893..14186) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(14183..15547) product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 sequence016 source 1..15557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(636..1028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(1028..1414) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene cheY2 CDS complement(1405..2289) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1A6 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene cheR CDS complement(2286..2753) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52881 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene cheW CDS complement(2759..4966) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706837.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene cheA2 CDS complement(4979..5344) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene cheY1 CDS complement(5341..5619) product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(5735..6706) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene glk CDS complement(6710..8035) product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2E9 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(8309..9394) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 9722..11071 product alpha-glucoside ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene aglE CDS 11222..12217 product alpha-glucoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene aglF CDS 12231..13364 product alpha-glucoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene aglG CDS 13369..15003 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene aglA sequence017 source 1..15359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2871..3806 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 3821..4810 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene galE-2 CDS 4794..6590 product N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 6625..7548 product beta-mannanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 7786..8085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(8181..8483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(8787..9188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(9285..9680) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(9677..12166) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(12251..13120) product zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 13022..13282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(13483..14571) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 misc_feature complement(14604..>15359) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888301.1:sugar ABC transporter permease locus_tag LOCUS_02930 sequence018 source 1..14778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 917..2212 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(2298..4013) product methyl-accepting chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene tlpS CDS complement(4085..5236) product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J653 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene cheB1 CDS complement(5239..6183) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J654 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene cheR2 CDS complement(6180..6677) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene cheW3 CDS complement(6674..8335) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene mcpB CDS complement(8339..8809) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene cheW2 CDS complement(8806..10791) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene cheA2 CDS complement(10788..11156) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene cheY5 CDS complement(11168..11503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 12157..14751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 sequence019 source 1..14537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(919..1893) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(2036..2800) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rlmE CDS complement(2804..3913) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 4208..4516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 4546..5445 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 5449..6414 product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 6714..8192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 8264..8428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 8443..9624 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 9941..10273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 10266..10934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 10990..11679 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 11820..13025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 13022..14452 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 sequence020 source 1..13880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(624..4307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(4304..5092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(5257..6504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(6522..9278) product protein ClpV1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I742 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene clpV1 CDS complement(9366..10352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(10349..12226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(12230..12727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(12720..13580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(13673..13879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 sequence021 source 1..13785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..3567) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y786 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene dnaE2 CDS complement(3564..5036) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(4978..5709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(6981..7997) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene malI-2 CDS 8371..9513 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 9613..10458 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 10455..11324 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 11357..12400 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 12397..13674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 sequence022 source 1..13574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..943 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3D9:peptide chain release factor 3 locus_tag LOCUS_03370 CDS 1247..1996 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y582 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene map2 CDS complement(2137..2559) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene osmC CDS complement(2672..3865) product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J320 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene dgt CDS 3947..4279 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 4281..4982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 5012..5794 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene xthA CDS complement(5889..7061) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene nahG CDS complement(7279..7752) product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene dksA CDS 7897..8739 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 9050..11089 product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 11086..11655 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 11669..12403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 12646..13194 product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 tRNA 13498..13571 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 sequence023 source 1..13413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..918) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene lysR CDS 954..1262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 1271..2506 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 2510..3589 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(3874..4404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 4590..5702 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 5712..8792 product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 8986..9240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(9446..9655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 9740..11149 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 11528..12355 product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 12366..13172 product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 sequence024 source 1..13075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 681..1481 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 1478..3160 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V80 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene hutU CDS 3187..4008 product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 4080..4733 product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 4744..5403 product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 5429..6253 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 6552..7694 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCK6 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene hisC CDS 7691..9091 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(9251..9652) product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(10116..10850) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967030.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 11032..12231 product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 12235..13002 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 sequence025 source 1..12922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1387..3318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 3467..4600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(4633..5130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(5146..8625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(8741..9580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 9773..10456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 10580..12868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 sequence026 source 1..12482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..928) product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 1091..2149 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 2424..3554 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 3646..4524 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 4521..5498 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 5495..6241 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 6245..6964 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888331.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 6968..7912 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GE9 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 7905..8366 product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 8380..9612 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(9722..10630) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 10787..11923 product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene gbd sequence027 source 1..12463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1070..1291) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ07 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene rpmE CDS complement(1303..1743) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ06 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rplS CDS complement(1724..2632) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ05 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene trmD CDS complement(2629..3441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(3446..3955) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene rimM CDS complement(4083..4442) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ02 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene rpsP CDS complement(4510..4860) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene pheAa CDS complement(4857..6377) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ7 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene ffh CDS complement(6642..7235) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVU8 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene azoR CDS complement(7495..8004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(8268..8765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 8969..9907 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 9945..10820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 misc_feature complement(10879..>12463) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338628.1:protein meaA locus_tag LOCUS_04080 sequence028 source 1..12415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 602..2140 product 3-(3-hydroxyphenyl)propionate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014163.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene mhpA CDS 2158..3147 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 3144..4214 product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972380.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene macA CDS 4216..5055 product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(5422..6870) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2F5 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene guaB CDS complement(6949..7929) product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 8293..8475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 8542..9510 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 9625..10722 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 10904..11896 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 sequence029 source 1..12355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1686..2864) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(2983..4320) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 4401..5633 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(5652..5876) product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y859 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(5873..6502) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(6542..7459) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(7541..8329) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene xthA1 CDS 8719..9957 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(10033..10974) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(10971..11588) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(11581..12039) product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ9 transl_table 11 codon_start 1 locus_tag LOCUS_04300 sequence030 source 1..11998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..829 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY91:flagellar M-ring protein locus_tag LOCUS_04310 CDS 829..1431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 1424..1708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 1713..2441 product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY94 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene fliP1 CDS complement(2508..2888) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(3013..4110) product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4H8 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene flgI CDS complement(4107..5120) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4H9 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene flgL CDS complement(5123..6580) product flagellar hook-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(6618..7928) product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYA0 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene flgE1 CDS complement(8232..8996) product chemotaxis MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003749.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene motB1 CDS 9217..9885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 note possible pseudo, internal stop codon, frameshifted CDS 9882..10538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 note possible pseudo, internal stop codon, frameshifted sequence031 source 1..11874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 475..675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 782..1654 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 1859..3295 product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 3300..3938 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 4202..5464 product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 5475..6932 product Flp pilus assembly protein, ATPase CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 6957..7925 product pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 7937..8938 product pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 8987..9568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 9609..10469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 10473..10970 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 sequence032 source 1..11731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 791..1621 product short-chain alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene fixR CDS complement(1739..2386) product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY4 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene engB CDS complement(2386..3150) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(3147..5033) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY6 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene yidC CDS complement(5171..6706) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(6801..7697) product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY8 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene ttcA CDS complement(7687..7932) product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY9 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(7929..8444) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene rnpA CDS complement(8466..8600) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene rpmH CDS 8843..10243 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 10350..10910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 tRNA 11002..11078 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 sequence033 source 1..11726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1309 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2D6:alpha-1,4 glucan phosphorylase locus_tag LOCUS_04660 CDS 1348..3525 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene glgB CDS 3578..4849 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNH7 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene glgC CDS 4871..6316 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNH6 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene glgA CDS 6313..8445 product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D9 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene glgX1 CDS 8829..9863 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337601.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene pstS CDS 9972..11432 product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J374 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene pstC sequence034 source 1..11717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(854..1813) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 1942..2832 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(2990..3451) product putative enoyl-CoA hydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP3 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 3588..4811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 note possible pseudo, frameshifted CDS 4822..5883 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 5880..7034 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 7164..8294 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 8438..10396 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 10393..11211 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene pcaD sequence035 source 1..11643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..1055) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(1071..2174) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(2188..3129) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(3122..4015) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(4087..5361) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 5597..6616 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(6656..7546) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene gcvA CDS 7730..8911 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEA4 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 8938..10437 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338852.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 sequence036 source 1..11534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 666..1112 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 1194..3611 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY57 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene gyrB CDS complement(4051..6825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(7094..7348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 7229..8113 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rfbG CDS complement(8116..9225) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 9433..9870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 sequence037 source 1..11498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 864..1589 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 1668..2582 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(2638..2805) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(2922..3683) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(3684..3896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 3961..4962 product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(5025..5864) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene ispE CDS complement(5854..7581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(7676..9322) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 9670..10140 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L0 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene greA CDS 10147..11202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 sequence038 source 1..11125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAL2:crossover junction endodeoxyribonuclease RuvC locus_tag LOCUS_05120 CDS 549..1226 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F6 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene ruvA CDS 1390..2424 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F8 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene ruvB CDS 2471..3124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 3121..3522 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 3666..4364 product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720852.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene TolQ CDS 4368..4862 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 4873..6105 product cell envelope integrity/translocation protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 6105..7493 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J041 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene tolB CDS 7643..8167 product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 8175..9041 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 9032..10315 product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene tilS sequence039 source 1..11083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538123.1:RND transporter locus_tag LOCUS_05240 CDS 1149..4259 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 4256..5629 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene nodT CDS 5769..6458 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 6630..7517 product glutamine amidotransferase-like protein GlxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87390 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene glxB CDS 7519..8202 product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene fwdC CDS 8213..9544 product glutamate synthase large subunit-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87392 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene glxD CDS 9647..10948 product glutamine synthetase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87393 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene glnT sequence040 source 1..11043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 951..2645 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 2668..3447 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(3462..5429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 5981..7051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(7145..8641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(8651..9124) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(9343..10323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 misc_feature complement(10364..>11043) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083070.1:oxidoreductase locus_tag LOCUS_05390 sequence041 source 1..11017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(963..5627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(5856..6557) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(6625..6909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 7038..7640 product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 7612..8418 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 8415..9329 product monooxygenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 9333..10370 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene y4vJ sequence042 source 1..10971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..708 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338556.1:aminotransferase locus_tag LOCUS_05470 CDS complement(754..1101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 1317..2501 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene mltB CDS complement(2578..3888) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(3885..5633) product protease/lipase ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 5807..6559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338569.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene vacJ CDS 6549..7151 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(7365..9716) product glycosyl transferase family 51 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene MrcB CDS 9985..10323 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene glnK sequence043 source 1..10947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1401) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB36 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene rsgA CDS complement(1433..1666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 1717..2208 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(2274..2732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 tRNA complement(2852..2926) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 3029..4207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(4337..5170) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7J2 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene kdsA CDS complement(5213..6973) product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene kpsE CDS complement(6970..7611) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538104.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene kpsT CDS 7773..8426 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 8419..9249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(9348..9806) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(9803..10261) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 sequence044 source 1..10820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 note possible pseudo, internal stop codon CDS complement(917..1864) product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(1868..3163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(3163..3681) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(3678..4652) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(4747..5688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(5685..6728) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(6732..8240) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(8248..8709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(8763..9716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(9739..10419) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene menG sequence045 source 1..10687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..759 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973914.1:5-deoxy-glucuronate isomerase locus_tag LOCUS_05790 CDS complement(810..1196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 1409..2437 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene phoR CDS 2519..4144 product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene pgm CDS 4406..5104 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N7 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene cbbE CDS 5257..5928 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYC6 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene cbbZ CDS 6085..6519 product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 6684..7481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 7782..8012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(7946..8188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(8414..9292) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N5 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene tsf CDS complement(9409..10173) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N4 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rpsB sequence046 source 1..10674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(682..1962) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 2142..2528 product nickel transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(2546..3787) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y677 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene ilvA CDS 4021..5253 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene argG CDS 5250..5777 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene mogA CDS complement(5860..6816) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 tRNA 7153..7228 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(7253..8383) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(8545..9777) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 misc_feature complement(9850..>10674) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YA51:carboxynorspermidine/carboxyspermidine decarboxylase locus_tag LOCUS_06000 sequence047 source 1..10651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..535 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140071.1:LysR family transcriptional regulator locus_tag LOCUS_06010 CDS complement(627..1592) product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 1920..2282 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 2604..3416 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 3739..4782 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 4791..5132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 5155..5730 product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 5727..6623 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706660.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(6648..7364) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(7357..7788) product zinc-finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 7988..8728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 8876..9466 product RNA polymerase sigma subunit ECF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 9453..9872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 9875..10402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 sequence048 source 1..10633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(762..1763) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(1837..2745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(3146..3958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 4236..5159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 5219..6412 product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 6450..7202 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(7386..7793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 note possible pseudo, internal stop codon CDS complement(7830..9680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 note possible pseudo, internal stop codon CDS complement(9715..10206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 sequence049 source 1..10629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..642 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972907.1:GntR family transcriptional regulator locus_tag LOCUS_06250 CDS 669..1802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 2375..4015 product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FA54 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene opgG CDS 4012..4236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 4254..6050 product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FA52 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene opgH CDS 6043..7179 product OpgC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene opgC CDS complement(7242..7748) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J689 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(7834..8664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(8661..10076) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 10197..10553 product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J686 transl_table 11 codon_start 1 locus_tag LOCUS_06340 sequence050 source 1..10493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..1037 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(1072..2109) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(2220..3467) product helix-turn-helix domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337784.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 3594..3893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(3936..5534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 6021..6692 product invasion-associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(6768..7976) product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(7980..8243) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene acpP1 CDS complement(8256..9347) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene lpxD misc_feature complement(9410..>10493) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003614.1:murein L,D-transpeptidase locus_tag LOCUS_06440 sequence051 source 1..10469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(897..1907) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(2122..4068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 4301..5476 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene yliI CDS 5919..7784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(7848..9137) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 9239..9619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 misc_feature complement(9794..>10469) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339023.1:deoxyribodipyrimidine photo-lyase locus_tag LOCUS_06510 sequence052 source 1..10412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 466..1239 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(1468..2208) product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene bztD CDS complement(2219..3313) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(3318..4484) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530399.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(4562..5599) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(5725..6774) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene adhC CDS 7116..8543 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 tRNA complement(8950..9039) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 misc_feature complement(9481..>10412) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886858.1:multicopper oxidase locus_tag LOCUS_06590 sequence053 source 1..10368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3087..4289) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(4267..4944) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 5077..6315 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140001.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(6384..9731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 sequence054 source 1..10267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..1150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338918.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(1147..2199) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene lpsB CDS complement(2261..3118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(3254..7549) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 tRNA complement(7695..7770) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(7815..9338) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 sequence055 source 1..10231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..1228) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(1233..2798) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(2805..3794) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(3902..4357) product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rimI CDS complement(4354..5019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(5009..5572) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(5779..6234) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 6442..7350 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 7347..7961 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene wcaJ CDS 8074..10098 product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene wcaG sequence056 source 1..10084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..811 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5X0:4-hydroxy-3-methylbut-2-enyl diphosphate reductase locus_tag LOCUS_06790 CDS 822..1427 product RhtB family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 1424..1897 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI4 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rnhA CDS 1894..2517 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(2523..4199) product (2S)-methylsuccinyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 4364..5122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(5154..6344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(6374..8029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 8347..9507 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYS2 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene dapE sequence057 source 1..10073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1110..2054) product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J340 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene ate CDS complement(2220..2687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(2857..3402) product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 3509..6313 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J336 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene glnE CDS 6310..6603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(6824..7420) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390781.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(7573..9378) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 sequence058 source 1..10042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..937 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IXP4:dihydroxy-acid dehydratase locus_tag LOCUS_06950 CDS complement(1063..1377) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 1472..2668 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 2969..4459 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 4621..6234 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 6410..7018 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(7015..7758) product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY4 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene bioC CDS complement(7755..8261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(8402..9691) product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGC1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene bioA sequence059 source 1..10030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 686..937 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722116.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 941..2371 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene kdtA CDS 2371..3366 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6I0 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene lpxK CDS complement(3458..4597) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(4599..5282) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(5286..5837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 5921..6979 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 7058..8197 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(8333..9439) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 transl_table 11 codon_start 1 locus_tag LOCUS_07120 sequence060 source 1..9782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1467..2342) product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(2350..4197) product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(4204..4689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(4710..6032) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(6032..6574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(6578..7627) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(7761..8525) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene fad CDS complement(8543..9307) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 sequence061 source 1..9709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(533..865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 994..1140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 1322..1699 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883I5 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene rbsD CDS complement(1745..3544) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4P0 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene lepA CDS 3731..3919 product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 4095..4403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(4582..5307) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KLI0 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene exsE CDS complement(5304..5660) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJ90 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(5660..6373) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UN9 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene queC CDS complement(6567..7142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(7180..7542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(7776..8081) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4W8 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene rpmB CDS complement(8209..8943) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 9058..9387 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 sequence062 source 1..9643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1000..1902 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4F5 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene dapA CDS 1914..3332 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(3467..4363) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ME28 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene dapA CDS complement(4378..5679) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(5687..6205) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(6275..7315) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 7771..9003 product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 sequence063 source 1..9625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..517 product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 676..1194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(1349..2788) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(2891..3499) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene nadD CDS complement(3660..4715) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(4712..5293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(5363..7165) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(7448..8173) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(8201..8476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 sequence064 source 1..9513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1302..1808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 2088..3500 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene qxtA CDS 3497..4501 product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 4681..4953 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 5065..7542 product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(7616..8860) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2L8 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene hflX CDS complement(8917..9150) product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2L7 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene hfq CDS complement(9288..9512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 sequence065 source 1..9408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1622 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene flhA1 CDS 1619..2398 product flagellar biosynthesis protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene fliR1 CDS 2395..3480 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene fhlB CDS 3477..3857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(3999..4568) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(4576..5301) product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY79 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene flgH CDS complement(5314..5745) product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4G2 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene flgA CDS complement(5745..6530) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY77 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(6547..7263) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY76 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(7268..7537) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(7537..7830) product flagellar hook-basal body protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene fliE1 CDS complement(7848..8240) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(8252..8638) product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 sequence066 source 1..9396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..661 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337349.1:serine/threonine dehydratase locus_tag LOCUS_07730 CDS 904..1863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 1917..3287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 3407..3835 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(3980..4477) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene mucS CDS complement(4620..4925) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(4922..5398) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 5488..6690 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y488 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene aatA CDS 6726..7157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(7236..7949) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(8009..8398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 misc_feature complement(8551..>9396) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5C2:phosphoglucosamine mutase locus_tag LOCUS_07840 sequence067 source 1..9298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(345..1250) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 1485..2219 product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 2665..3909 product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene arsB CDS complement(4037..4690) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene hutC CDS 4819..5394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(5464..6819) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene hutF CDS 6921..8132 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31196 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene hutI sequence068 source 1..9261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 807..1517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(1723..1917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(2224..3012) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene znuB CDS complement(3005..3841) product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWB5 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene znuC CDS complement(3838..4356) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene zur CDS 4441..5514 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene znuA CDS 5710..6822 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene galM CDS 6849..7388 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(7462..8007) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(8038..8634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(8692..9183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 sequence069 source 1..9198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 179..931 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X3 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene uppS CDS 928..1809 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X2 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene cdsA CDS 1813..2997 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene dxr CDS 2994..4337 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X0 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 4435..4605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 4706..7045 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2W8 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene bamA CDS 7045..7884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 8064..8525 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2W6 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene fabZ sequence070 source 1..9188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(1413..1955) product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(2053..3945) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(4078..5862) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(6061..6957) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(7182..7574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 7488..8447 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 sequence071 source 1..9168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1054..2400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(2740..4161) product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337011.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene tldD CDS 4391..5266 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G0 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene coxII CDS 5334..6266 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F9 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene ctaB CDS 6266..6478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 6475..7050 product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F7 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene ctaG CDS 7082..7882 product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene coxIII CDS 7964..8632 product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F5 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene surf-1 sequence072 source 1..9165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1042..1830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(1938..3311) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2A2 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 3631..4620 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 4801..5985 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 6090..6884 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 6881..7585 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 7587..8597 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 sequence073 source 1..9148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(37..126) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 317..1447 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(1593..2315) product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(2312..4915) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(4912..5943) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene cysK CDS complement(6145..7386) product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene trgB CDS complement(7386..7826) product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene trgA CDS complement(7831..9093) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene ufaM sequence074 source 1..9136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..1706 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H7 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene mviN CDS complement(1755..2441) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 2627..3679 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H8 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene trpS CDS complement(3794..5134) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(5112..5672) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(5669..6157) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 6290..6697 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 6956..7354 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 sequence075 source 1..9115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..461 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(587..2131) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 2574..3731 product amino acid ABC substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene amiC CDS 3740..4387 product transcription antitermination regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene amiR CDS 4611..5855 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 5919..6812 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974750.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 6816..7937 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 7934..8689 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 sequence076 source 1..9104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1592..3649) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7E4 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene dnaG CDS 4155..5942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 5942..6508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 6510..7142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 7494..7748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 sequence077 source 1..9068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..549 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006316158.1:3-hydroxybutyryl-CoA dehydrogenase locus_tag LOCUS_08620 CDS complement(666..1364) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(1479..2918) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(2972..3373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(3442..4404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(4462..5955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(5958..6422) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309941.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(6463..7500) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089014.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(7497..8384) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(8445..8996) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene ssuE sequence078 source 1..9031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0D1:acetyl-coenzyme A synthetase locus_tag LOCUS_08720 CDS 836..1531 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene adk CDS 1600..1857 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 1873..3639 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 3725..5560 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 5570..6091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 6095..6589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 6586..8640 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 sequence079 source 1..8969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..674 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943203.1:two-component sensor histidine kinase locus_tag LOCUS_08800 CDS 689..1132 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 1137..3215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(3336..4118) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene paaG CDS complement(4185..4661) product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene ccmH CDS complement(4666..6627) product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene ccmF CDS complement(6832..7368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(7359..7970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(8053..8508) product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J278 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene ccmE sequence080 source 1..8949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1668..2624 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(2651..3226) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ52 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 3420..4214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(4222..7599) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 sequence081 source 1..8937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(890..1246) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 1472..1822 product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7H7 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene atpI CDS 1819..2577 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7H8 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene atpB CDS 2632..2865 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 2944..3498 product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ14 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene atpF2 CDS 3503..4060 product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ15 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene atpF1 CDS complement(4155..4925) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene pdhR CDS complement(5063..5728) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(5914..6912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 7092..7724 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7I5 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene nth CDS 7721..8707 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338674.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 sequence082 source 1..8875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1959 product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62K91 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene rbsA CDS 1956..2966 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene rbsC CDS 2990..3970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 3945..5510 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 5597..7369 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(7537..8226) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 sequence083 source 1..8822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1027..1284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 1543..2322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 2315..2512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(2736..3365) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene flcA CDS 3730..4260 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 4320..7370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(7577..8200) product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23364 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene cat sequence084 source 1..8783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(832..1851) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1890..2804) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(3114..3833) product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(4046..6580) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene ppdK CDS complement(6656..8716) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C7 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene glyS sequence085 source 1..8708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 648..1424 product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1611..2084 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0A4 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 2074..2934 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338352.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(3105..4661) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(4649..4975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 5141..6118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 sequence086 source 1..8678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..973 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(986..2332) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZA3 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene otsA CDS complement(2334..3008) product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SB3 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene otsB CDS 3158..4216 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYK5 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene HemH CDS complement(4362..4982) product ErfK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 5150..5662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(5783..6295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(6458..7681) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene TrmA misc_feature complement(7711..>8678) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338786.1:multidrug ABC transporter ATPase locus_tag LOCUS_09380 sequence087 source 1..8626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1814 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895494.1:type VI secretion system protein VgrG locus_tag LOCUS_09390 CDS 1829..2431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 2431..2730 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 2740..4218 product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene fha1 CDS 4268..5608 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene impJ CDS 5625..7046 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039003.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 sequence088 source 1..8599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(847..2019) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 2182..3081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(3190..7116) product enterobactin synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(7118..7366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 misc_feature complement(7363..>8599) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P40871:2,3-dihydroxybenzoate-AMP ligase locus_tag LOCUS_09490 sequence089 source 1..8549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1067 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087552.1:aldehyde dehydrogenase locus_tag LOCUS_09500 CDS 1295..1639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1931..2257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(2417..2953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 3130..4461 product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LP7 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene mntH CDS complement(4535..4969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(5126..5884) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(5881..6909) product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(6911..7735) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(7853..8269) product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 sequence090 source 1..8443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 680..1024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 note possible pseudo, internal stop codon, frameshifted CDS 967..1221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 note possible pseudo, internal stop codon, frameshifted CDS 2030..3169 product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y788 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene dusA CDS 3297..4112 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(4178..5047) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 5111..6274 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 6610..6948 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene YajC sequence091 source 1..8304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(638..1621) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(2034..2681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(2678..3439) product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene hpaI1 CDS complement(3500..4282) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886714.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene hpaH1 CDS complement(4290..5183) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(5433..6230) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(6227..6931) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(7778..7945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 note possible pseudo, internal stop codon, frameshifted sequence092 source 1..8301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(390..1565) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1941..3029 product DUF4432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 3209..4306 product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI0 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 4513..5880 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene cls CDS 5877..6608 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 misc_feature complement(6706..>8301) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337091.1:membrane protein locus_tag LOCUS_09800 sequence093 source 1..8293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 469..621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 621..941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 941..2215 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX9 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene lysA CDS 2267..4981 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(5070..6080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 6190..6894 product cell division protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 6891..7790 product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 sequence094 source 1..8211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1544..2875 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW81 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene miaB CDS 3100..3663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 3675..3986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 4156..5172 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 5156..5662 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW83 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene ybeY CDS 5694..6641 product conjugation transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 sequence095 source 1..8097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1767) product flagellar switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1947..4655) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(4655..4936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(4936..5343) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(5434..6801) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 6955..8091 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 sequence096 source 1..8085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..1040) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1138..1389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1811..3184) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene yhxA CDS 3350..3898 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 4234..5865 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(5940..6911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(6946..7593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 sequence097 source 1..8065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3435 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2M4:transcription-repair-coupling factor locus_tag LOCUS_10090 CDS complement(3560..4801) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(4798..5433) product polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(5438..6058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065048.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 6292..6915 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(7148..7471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 sequence098 source 1..8060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..1130) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1255..2943) product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 3124..4149 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(4136..5692) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(5696..6358) product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(6430..7281) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 misc_feature complement(7425..>8060) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975071.1:inositol phosphatase locus_tag LOCUS_10210 sequence099 source 1..8059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1372 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976013.1:dihydroxy-acid dehydratase locus_tag LOCUS_10220 CDS 1600..2247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 2335..3666 product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 3739..5214 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene der CDS complement(5364..6065) product seryl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(6124..7416) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5J2 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene serS sequence100 source 1..8033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..768 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331282.1:dihydrodipicolinate synthase family protein locus_tag LOCUS_10280 CDS 771..2279 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene dhaL CDS 2297..3643 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 3665..4612 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266140.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 4907..5110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 note possible pseudo, internal stop codon CDS 5201..5770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 note possible pseudo, internal stop codon CDS 5833..6924 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 6926..7765 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 sequence101 source 1..7925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(330..1973) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0Z1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene pyrG CDS complement(2219..2581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 note possible pseudo, frameshifted CDS complement(2809..3693) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZA8 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene purU CDS complement(4045..4368) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 4614..5195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(5628..7124) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 misc_feature complement(7394..>7925) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J104:protein HflC locus_tag LOCUS_10420 sequence102 source 1..7919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..1348 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337889.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene amiC CDS 1638..4193 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene mrcA CDS 4315..5442 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J246 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene prfB CDS complement(5610..6620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 6842..7618 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 sequence103 source 1..7872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..599 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067010.1:hemolysin D locus_tag LOCUS_10480 CDS 605..2173 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528494.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(2170..2727) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(2728..3135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 3239..4543 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3L6 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene purB CDS 4710..5777 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719378.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 5997..7001 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J265 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene gapB CDS 7010..7153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 sequence104 source 1..7863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..997 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(978..1337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1239..1499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 note possible pseudo, internal stop codon CDS complement(1626..2060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(2073..3215) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(3264..4721) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(4777..5805) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887388.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(5802..6677) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(6674..7621) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRN3 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rbsK sequence105 source 1..7860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..1610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1613..2458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 2451..3890 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(3945..5363) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(5405..6649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 misc_feature complement(6646..>7860) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895572.1:FAD/NAD(P)-binding oxidoreductase locus_tag LOCUS_10700 sequence106 source 1..7834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1150) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene dapA CDS complement(1223..2197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(2348..3844) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(3838..4191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(4448..5266) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 5453..7150 product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene dhbK CDS 7394..7642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 sequence107 source 1..7829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 844..1248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene mexG CDS 1248..1919 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1956..2579) product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 2687..3583 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 3580..3882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 4067..4675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 5227..5982 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 5987..6661 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 6658..7389 product L-cystine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence108 source 1..7821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..717 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZN1:NAD kinase locus_tag LOCUS_10880 CDS complement(776..2335) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(2332..3843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(4058..5950) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene acsA misc_feature complement(6157..>7821) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336861.1:phosphate acetyltransferase locus_tag LOCUS_10920 sequence109 source 1..7802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1024..2469) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene xylB CDS complement(2565..4100) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SG4 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene glpD CDS complement(4093..4917) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(4917..6257) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 6432..7445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 sequence110 source 1..7795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1816..2649 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene thyA CDS 2649..3137 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0X0 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene folA CDS complement(3134..4546) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(4552..4866) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFZ6 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene rhaM CDS complement(4873..5922) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(5919..6902) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 misc_feature complement(6899..>7795) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MFZ3:ribose import ATP-binding protein RbsA locus_tag LOCUS_11040 sequence111 source 1..7681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4D4:glycine dehydrogenase (decarboxylating) locus_tag LOCUS_11050 CDS 701..1147 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene trx tRNA 1230..1305 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(1860..2819) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(2816..3166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(3176..4459) product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(4464..4937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(4951..5955) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 6054..6986 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 sequence112 source 1..7669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..1235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720945.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1232..1849) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 2093..3385 product capsule biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene kpsS CDS 3467..4597 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 4843..6639 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene kpsC misc_feature complement(6636..>7669) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0W7:riboflavin biosynthesis protein RibD locus_tag LOCUS_11180 sequence113 source 1..7646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..940 product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene modA CDS 937..1617 product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene modB CDS 1614..2699 product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene modC CDS complement(2746..2934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 3036..3353 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 3622..3876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(4019..4312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 4447..5061 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 5168..5560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 5557..6252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 6421..7308 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 sequence114 source 1..7629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..825 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 810..1964 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene lpxB CDS complement(2053..3189) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene mnmA CDS 3347..3625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 3721..4434 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene ctrA CDS 4680..6956 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J355 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene ligA sequence115 source 1..7617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1865..3481) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(3600..3839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 3738..4145 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(4158..6452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(6570..6983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 misc_feature complement(7085..>7617) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0C6:lysine--tRNA ligase locus_tag LOCUS_11410 sequence116 source 1..7598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..663 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2U4:glucose-6-phosphate isomerase locus_tag LOCUS_11420 CDS complement(823..2076) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 2258..2905 product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 2902..3561 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 3870..4151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 4148..4714 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 5069..6502 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 sequence117 source 1..7583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..610 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337304.1:3-hydroxyacyl-CoA dehydrogenase locus_tag LOCUS_11490 CDS complement(659..1324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1549..2199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(2208..3122) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 3073..3447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 3467..4483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336868.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(4628..6166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(6229..6861) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J642 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene upp misc_feature complement(6854..>7583) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336865.1:adenosine deaminase locus_tag LOCUS_11570 sequence118 source 1..7564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(545..1393) product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385138.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene flgF CDS complement(1390..1797) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene flbT CDS complement(1794..2171) product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene flaF CDS complement(2261..3460) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4F1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(3666..4010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(4000..4359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 4471..6789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 6804..7475 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY67 transl_table 11 codon_start 1 locus_tag LOCUS_11650 sequence119 source 1..7558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(558..1385) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR9 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene dapD CDS 1482..2303 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 2584..3948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(4052..5269) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY22 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene rlmN CDS complement(5442..5972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721985.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 6143..7132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 sequence120 source 1..7552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..662 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337003.1:ATPase AAA locus_tag LOCUS_11720 CDS complement(812..1756) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U7 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene gshB CDS complement(1864..2220) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H3 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(2259..3122) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H4 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene rsmI CDS 3240..4415 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 4515..7370 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H6 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene glnD sequence121 source 1..7525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(688..1413) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1426..2418 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ43 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene ubiA CDS complement(2308..2676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 2570..4852 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 4905..5234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(5425..5646) product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene fdsD CDS complement(5643..6455) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYW9 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene fdsC misc_feature complement(6463..>7525) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338701.1:formate dehydrogenase subunit alpha locus_tag LOCUS_11860 sequence122 source 1..7501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..901 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWW7 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene proC CDS 898..1230 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene csaA CDS 1242..2189 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 2280..2480 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene csbD CDS complement(2580..3167) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9V9 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene tdk CDS complement(3389..4723) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rhlE2 CDS 5468..5773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 5835..6497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(6546..6995) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene dtd misc_feature complement(6995..>7501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337354.1:carbohydrate kinase locus_tag LOCUS_11960 sequence123 source 1..7474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..977) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(977..1966) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1956..2444) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140033.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(2485..4083) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(4208..5572) product sensor histidine kinase RegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6C1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene regB CDS 5780..6418 product protein senC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene prrC CDS 6501..7055 product photosynthetic apparatus regulatory protein RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53228 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene regA CDS 7142..7456 product trans-acting regulatory protein hvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722219.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene spbA sequence124 source 1..7458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..689 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4G1:methylenetetrahydrofolate reductase locus_tag LOCUS_12050 CDS complement(727..1890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(2040..3185) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 3406..3843 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 3968..4210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 4348..7188 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBS5 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene valS sequence125 source 1..7343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..628) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(778..1977) product septum site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338101.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 2117..2872 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(2983..3546) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1B4 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene efp CDS 3763..4083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(4319..5893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(6119..6769) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 tRNA 7129..7202 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 sequence126 source 1..7282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1491) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1544..2158) product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 2254..3129 product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(3272..4012) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J055 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(4112..5890) product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(5903..6937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 sequence127 source 1..7277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 922..1368 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UL98 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene aroQ CDS complement(1384..2070) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970532.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(2296..3765) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene blcA CDS 3872..4681 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene blcR CDS complement(4707..5630) product 2-keto-3-deoxygluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene kdgK CDS complement(5723..6106) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(6271..6888) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227480.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 sequence128 source 1..7259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 692..1867 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D4 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene metZ CDS 1965..3062 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D3 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene folE2 CDS 3274..5691 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N8 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(5997..6779) product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0Z0 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene rlmJ repeat_region 6915..7248 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctcagggaggaggaggag sequence129 source 1..7241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 5..1540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1562..3649) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene recQ CDS complement(3654..3950) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 4308..4838 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 5100..6473 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 sequence130 source 1..7240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1180..1386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1455..2231 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y712 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene pyrF CDS complement(2456..2767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(2870..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(3139..4053) product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 4177..5439 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY04 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene dinB CDS complement(5445..6314) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 tRNA 6467..6541 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 6611..6736 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY06 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene rpmJ sequence131 source 1..7231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..823) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene nuoE CDS complement(913..1785) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1970..2788 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene sohB CDS 2978..3931 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 3945..4748 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 5052..6941 product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX6 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene uvrC sequence132 source 1..7225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532260.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1371..2291 product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 2334..2627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 2812..3300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 3508..4284 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 4334..5053 product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 5109..5990 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720537.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 5987..6823 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720538.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 sequence133 source 1..7191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 tRNA 809..885 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 1031..1402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1499..2011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 2289..2996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(3139..4203) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 4415..5362 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(5525..6610) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 misc_feature complement(6664..>7191) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009564218.1:ABC transporter permease locus_tag LOCUS_12700 sequence134 source 1..7180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1409..1855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 2111..4624 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 4654..6285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 sequence135 source 1..7169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2807 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:adhesin locus_tag LOCUS_12740 CDS 2818..4194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 4238..6535 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 sequence136 source 1..7168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 507..800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 816..1322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 note possible pseudo, internal stop codon, frameshifted CDS complement(1342..2337) product acrylyl-CoA reductase AcuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6K9 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene acuI CDS complement(2423..4933) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(4994..6553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 misc_feature complement(6643..>7168) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706545.1:choline dehydrogenase locus_tag LOCUS_12820 sequence137 source 1..7129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1756 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190520.1:NADPH-dependent 2,4-dienoyl-CoA reductase locus_tag LOCUS_12830 CDS complement(1833..2189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(2200..2973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(3110..3790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 4065..4976 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC3 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene accD CDS 5092..6366 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene folC sequence138 source 1..7078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(642..1514) product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1511..2623) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(2655..3704) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(4101..5033) product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089907.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 5173..6090 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene rbcR misc_feature complement(6091..>7078) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706365.1:FAD-linked oxidase locus_tag LOCUS_12940 sequence139 source 1..7025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1227 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382978.1:hemolysin locus_tag LOCUS_12950 CDS 1328..2431 product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 2552..3634 product ABC polyamine/opine transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 3814..5064 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 5161..6072 product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 6159..6683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 sequence140 source 1..7017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..840 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(984..1985) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061402.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(2064..3089) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(3113..4642) product putative ribose/galactose/methyl galactoside import ATP-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAK2 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(4804..5745) product rhizopine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 5648..5914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(6053..7015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 sequence141 source 1..6970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(511..1560) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1566..3560) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706260.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(3660..4763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 4914..5582 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 5582..6946 product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 sequence142 source 1..6970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1875..2831 product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L6 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene mcl1 CDS complement(2975..3265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 3264..4223 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5L4 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene accA CDS 4398..5462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(5546..6151) product pyridoxamine 5'-phosphate oxidase-related FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(6162..6905) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 sequence143 source 1..6939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(582..1100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1174..4695 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 4676..5053 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 5205..6290 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(6341..6937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 sequence144 source 1..6930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..698 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338535.1:porin locus_tag LOCUS_13260 CDS 837..1490 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1487..2035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(2032..3108) product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZK7 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene ribA CDS 3267..3953 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(4062..4871) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU4 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene dapB CDS 5119..5448 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU3 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene rbfA CDS 5456..6214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 sequence145 source 1..6873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 778..1293 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1362..3995) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 4129..4311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 4491..6644 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J504 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene glcB sequence146 source 1..6767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..1659 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1702..2670) product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J029 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene hemC CDS 2784..3818 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32920 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene hemE CDS complement(3909..6050) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974281.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 repeat_region 4171..4377 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccggtttgtcgccataggca misc_feature complement(6243..>6767) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383211.1:lysine transporter LysE locus_tag LOCUS_13420 sequence147 source 1..6765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 271..840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 860..3526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 3785..6445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(6524..6763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 sequence148 source 1..6728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8..685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(773..1777) product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1968..4148) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336961.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 4622..5377 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(5506..5850) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 sequence149 source 1..6687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1449 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UAA5:2,3-bisphosphoglycerate-independent phosphoglycerate mutase locus_tag LOCUS_13520 CDS 1446..2606 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 2610..3956 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene ctpA CDS 4023..4520 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene rppH CDS complement(4581..5417) product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 misc_feature complement(5407..>6687) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S64:L-aspartate oxidase locus_tag LOCUS_13570 sequence150 source 1..6686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J317:glycerol kinase locus_tag LOCUS_13580 CDS 1112..2257 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(2318..3127) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(3342..4037) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(4041..4781) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(4778..6010) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 misc_feature complement(6111..>6686) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338134.1:branched-chain amino acid ABC transporter permease locus_tag LOCUS_13640 sequence151 source 1..6683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..227) product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 260..898 product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1081..1836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1833..2363) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(2651..3454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970921.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 note possible pseudo, frameshifted CDS complement(3713..4978) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXX7 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene proA tRNA complement(5076..5152) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(5209..5285) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(5615..6553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368588.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 sequence152 source 1..6661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 801..2045 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(2165..3232) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L61 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene asd CDS complement(3615..4187) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 4554..4982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 5006..5233 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1M0 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene rpsR CDS 5246..5824 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L9 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rplI sequence153 source 1..6647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(678..1817) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene rodA CDS complement(1814..3724) product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene pbpA CDS complement(3754..4293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(4304..5164) product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene mreC CDS complement(5256..6293) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene mreB sequence154 source 1..6569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(985..2502) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(2499..3779) product xylose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene xylR CDS 3988..5010 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 5123..6442 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529275.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 sequence155 source 1..6568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..614 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888250.1:Fis family transcriptional regulator locus_tag LOCUS_13880 CDS 869..1876 product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR9 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene dctP CDS 1938..2618 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 2622..4010 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(4170..4553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(4742..5491) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J536 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene cbbJ CDS complement(5636..5992) product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 sequence156 source 1..6540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..1534) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZM2 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene ychF CDS 1638..2429 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E8 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene trpA CDS 2608..3771 product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene lctB CDS complement(3787..4929) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 5307..5918 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZM8 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene rplY sequence157 source 1..6501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..1271) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 1562..2644 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(2638..2862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 2747..3622 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 3619..4410 product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 4413..5459 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(5561..6433) product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 sequence158 source 1..6477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 888..4250 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 sequence159 source 1..6465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 509..1306 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7E6 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1345..4167) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(4299..4484) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 4602..5540 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(5641..6015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 sequence160 source 1..6428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..566 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P2K2:siroheme synthase locus_tag LOCUS_14130 CDS complement(577..1608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1794..2042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(2353..2919) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(3203..3940) product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 4007..5479 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 sequence161 source 1..6425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(256..1932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1973..2110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 2410..3039 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2I9 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene aroK CDS 3043..4152 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2J0 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene aroB CDS 4173..6263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 sequence162 source 1..6405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 478..1599 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1672..2157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 2182..3489 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 3508..4215 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(4417..6051) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 sequence163 source 1..6352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(653..1990) product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338052.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 2302..2802 product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene accB CDS 2810..4159 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene accC CDS 4318..4485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(4623..5327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 5411..6061 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1H1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene aat sequence164 source 1..6346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940072.1:flagellar motor protein MotA locus_tag LOCUS_14350 CDS 564..944 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene exbD CDS 948..1361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1358..2272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(2276..3148) product D-galactarolactone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ7 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(3148..4296) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene gci CDS complement(4302..5207) product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UB77 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(5284..6018) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 sequence165 source 1..6346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..1209) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKG3 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene rkpT1 CDS 1320..1733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1730..2869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 note possible pseudo, frameshifted CDS 2874..3542 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene rkpS CDS complement(3553..6051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385226.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 sequence166 source 1..6339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1273..2025) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY65 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene ubiE CDS 2102..2953 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene mutM CDS 3013..3789 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 3881..4147 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY62 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene rpsT CDS 4654..6018 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY61 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene dnaA sequence167 source 1..6336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..1552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 2003..3367 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533162.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(3545..5107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(5104..5763) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 sequence168 source 1..6258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(497..1945) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D2 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene TrkH2 CDS complement(1938..2147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(2587..2793) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ0 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene rpsU CDS 2906..3577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 3574..4587 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 4630..5031 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(5081..5722) product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 sequence169 source 1..6254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..1550) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J346 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene argI CDS 1837..2043 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(2266..3984) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3D5 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene metG CDS complement(4070..5290) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 tRNA 5447..5530 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 misc_feature complement(5640..>6254) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336880.1:sigma-54-dependent Fis family transcriptional regulator locus_tag LOCUS_14680 sequence170 source 1..6249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..904 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338191.1:gamma-glutamylputrescine oxidase locus_tag LOCUS_14690 CDS 1003..2220 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene wecE CDS complement(2275..3273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 3493..4431 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 tRNA complement(4530..4613) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 4800..5588 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 5762..6202 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 sequence171 source 1..6249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..1454) product D-galactose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969077.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene gal CDS complement(1459..2613) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene gguB CDS complement(2640..4157) product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061407.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(4225..5292) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene chvE misc_feature complement(5674..>6249) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337665.1:metal ABC transporter permease locus_tag LOCUS_14790 sequence172 source 1..6230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 710..2875 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZS6 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ppk CDS 2936..4489 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(4486..4941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(4973..6022) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(6024..6230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 sequence173 source 1..6167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..665 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724361.1:calcium-binding protein locus_tag LOCUS_14860 CDS 1068..1445 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816971.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1442..1972 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 2193..2939 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 2936..3892 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337985.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene smoC CDS 4117..5430 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene smoE sequence174 source 1..6130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 824..1243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1255..2748 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 2804..3844 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 3949..4989 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 sequence175 source 1..6126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 404..1780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1833..3014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(3074..3208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 3422..4135 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338511.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(4278..4988) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338510.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 5127..5531 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 5531..5797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338509.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 sequence176 source 1..6091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..1230) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ94 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene pyrD CDS complement(1227..1565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1737..3311 product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 tRNA 3582..3655 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(3951..4106) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(4103..4288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 4516..5436 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 sequence177 source 1..6083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..735 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528657.1:hemolysin secretion protein D locus_tag LOCUS_15090 CDS 732..1709 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1750..2898 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 3005..3460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 3457..4146 product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(4143..5135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 misc_feature complement(5313..>6083) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92SZ2:N-acetylglucosamine-6-phosphate deacetylase locus_tag LOCUS_15150 sequence178 source 1..6082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..927 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887778.1:aldehyde dehydrogenase locus_tag LOCUS_15160 CDS complement(855..1127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1030..2040 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 2110..2988 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 2990..3790 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 3787..4872 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(4900..5652) product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ55 transl_table 11 codon_start 1 locus_tag LOCUS_15220 sequence179 source 1..6081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..1117) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1511..3538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(3902..4216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 4560..5321 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S3 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene purC CDS 5357..5575 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene purS sequence180 source 1..6070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(722..2230) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(2232..2744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(3349..4341) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(4457..5389) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 sequence181 source 1..5995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..862 product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973471.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(890..1819) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 2027..2899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 3098..4597 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 4676..5590 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 sequence182 source 1..5983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(488..1603) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXW9 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene ctaA CDS complement(1744..2481) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y8 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene rrm2 CDS 2588..3208 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 3212..3841 product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene frcK CDS complement(3957..5099) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene tgt sequence183 source 1..5908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 888..1253 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1335..2729) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(2762..3352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(3417..4664) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(4773..5822) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J252 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene queA sequence184 source 1..5841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..649 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2K7 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene pgpA CDS 646..1122 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene cinA CDS 1366..2544 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene amt-1 CDS complement(2567..3004) product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719940.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 3125..3664 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene HPRT CDS 3675..4223 product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089401.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 4220..4414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 4487..5395 product diheme cytochrome c-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53143 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene cycG sequence185 source 1..5836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J205:homoserine O-succinyltransferase locus_tag LOCUS_15550 CDS 554..1501 product hydrolase or acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1560..2435 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 2428..3045 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 3083..4261 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI69 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(4286..5110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 tRNA 5275..5364 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(5727..5816) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 sequence186 source 1..5823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..993) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1034..2548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(2570..3007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(3017..3985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(4050..4523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(4734..5702) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 sequence187 source 1..5802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1190 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339645.1:ATPase locus_tag LOCUS_15670 CDS 1205..2284 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(2368..2934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 3027..3695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 sequence188 source 1..5799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..1104 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B7 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene prmC CDS complement(1479..2114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 2145..2561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(2670..3512) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X4 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene rsmA CDS complement(3624..4646) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C0 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene pdxA misc_feature complement(4758..>5799) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2C1:chaperone SurA locus_tag LOCUS_15760 sequence189 source 1..5795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(626..1909) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(2227..2982) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89R43 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(3057..4334) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088366.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 4834..5418 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 sequence190 source 1..5783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(649..1959) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1976..2500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(2621..3598) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(3877..4494) product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(4696..4947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 misc_feature complement(5170..>5783) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337531.1:ribonucleotide-diphosphate reductase subunit alpha locus_tag LOCUS_15870 sequence191 source 1..5749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..518 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5E0:exodeoxyribonuclease 7 large subunit locus_tag LOCUS_15880 CDS complement(639..1052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1248..2381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 2565..3641 product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E2 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene ftsY CDS 3652..4074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 4109..5011 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 5021..5644 product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E4 transl_table 11 codon_start 1 locus_tag LOCUS_15940 sequence192 source 1..5730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(845..1291) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1460..2494 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ5 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene hslO CDS 2487..3080 product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 3161..4267 product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 sequence193 source 1..5723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 489..1253 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 tRNA complement(1376..1452) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1498..2001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(2016..2591) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719511.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(2707..3330) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y3 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene pdxH CDS 3494..4318 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y4 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene fabI1 CDS 4320..4937 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 4960..5463 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y6 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene gpt sequence194 source 1..5683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1643..2491 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 2612..3805 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1C0 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene kynU CDS 3984..5036 product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R33 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene nadA sequence195 source 1..5667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1282..5244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(5500..5667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 sequence196 source 1..5657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 280..1086 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1121..2050) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(2160..2897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 3448..4752 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene repA sequence197 source 1..5652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..572 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085107.1:transcriptional regulator locus_tag LOCUS_16160 CDS 569..1960 product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1950..3050 product tricarballylate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704751.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 3398..4546 product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(4825..5046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 note possible pseudo, internal stop codon CDS complement(5260..5649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 sequence198 source 1..5651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..932) product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene cobP CDS 1014..1646 product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene bluF CDS 1643..2473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 2473..3414 product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0S7 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene cobD CDS 3424..4401 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene cobC CDS 4391..5014 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG5 transl_table 11 codon_start 1 locus_tag LOCUS_16270 misc_feature complement(5050..>5651) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZR0:cobyric acid synthase locus_tag LOCUS_16280 sequence199 source 1..5601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1460) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1457..3382) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(3379..4332) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 misc_feature complement(4356..>5601) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016360.1:diguanylate phosphodiesterase locus_tag LOCUS_16320 sequence200 source 1..5593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 474..1352 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1468..2862) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene noeK CDS 3190..5313 product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 sequence201 source 1..5572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..701) product molybdopterin-guanine dinucleotide biosynthesis protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338449.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene mobC CDS complement(698..1402) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX0 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene mobA CDS 1592..2317 product branched-chain amino acid transporter AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 2317..2646 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(2713..3321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(3344..3478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(3589..4056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(4053..5129) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 sequence202 source 1..5570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..1103) product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene ispA CDS complement(1103..1351) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T828 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene xseB CDS complement(1379..2017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(2048..3328) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(3325..4164) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZB6 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene dapF tRNA 4387..4462 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 4715..5374 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 sequence203 source 1..5566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..2160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 2337..2945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(3150..3467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(3724..4251) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene ccmG CDS complement(4244..4402) product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5I3 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ccmD CDS complement(4402..5133) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ccmC sequence204 source 1..5557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1175 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064864.1:ABC transporter ATP-binding protein locus_tag LOCUS_16560 CDS 1236..2603 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 2618..4039 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 4104..5183 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 sequence205 source 1..5540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..1019 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1101..1319 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA38 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene infA CDS 1398..2000 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J086 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1997..3043 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 3045..3227 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J088 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene yacG tRNA 3716..3791 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(4553..5239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 sequence206 source 1..5516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(565..1035) product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCK6 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene dps CDS 1301..1765 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1777..2889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(3452..3685) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3L2 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene acpP CDS complement(3859..4596) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene fabG misc_feature complement(4920..>5516) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2Z7:malonyl CoA-acyl carrier protein transacylase locus_tag LOCUS_16710 sequence207 source 1..5487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1842..3182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 3189..4142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719571.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 4139..4951 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337475.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 sequence208 source 1..5477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1654..2046 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 2039..2755 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(2739..4400) product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 4489..5043 product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D4 transl_table 11 codon_start 1 locus_tag LOCUS_16780 sequence209 source 1..5451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..1741) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene metC CDS complement(1731..3332) product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(3342..3929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 misc_feature complement(3980..>5451) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000463030.1:C4-dicarboxylate ABC transporter permease locus_tag LOCUS_16820 sequence210 source 1..5449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1129..1728) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 1727..2755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(2826..3959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(3956..4909) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 misc_feature complement(4914..>5449) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J445:histidinol-phosphate aminotransferase locus_tag LOCUS_16870 sequence211 source 1..5447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..1762) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L2 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene recN CDS complement(1793..2635) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L3 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene comL CDS complement(2752..3744) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L4 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene envA misc_feature complement(4014..>5447) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4L5:cell division protein FtsZ locus_tag LOCUS_16910 sequence212 source 1..5445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(583..1416) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1423..2715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(2712..3056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(3238..3699) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 3875..4348 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(4364..5164) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 sequence213 source 1..5433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(550..1809) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D6 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(2041..2688) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(2714..3145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(3247..4506) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337457.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene kdtA1 sequence214 source 1..5412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..1268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1487..2422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(2668..3360) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene phoR1 CDS complement(3365..4087) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J377 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene phoU CDS complement(4102..4899) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J376 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene pstB sequence215 source 1..5392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 6..824 product acrylyl-CoA reductase AcuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6K9 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene acuI CDS 1365..2099 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F0 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(2239..3111) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene dapA CDS 3255..5186 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 sequence216 source 1..5386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..736 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719967.1:nitrogen regulation protein NR(I) locus_tag LOCUS_17110 CDS 870..3101 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene ntrY CDS 3098..4519 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene ntrX sequence217 source 1..5356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113731.1:AGCS sodium/alanine/glycine symporter locus_tag LOCUS_17140 CDS complement(814..1692) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene ansA CDS complement(1696..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 2551..3423 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 3585..4622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 sequence218 source 1..5341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1261..2067) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene cobM CDS complement(2064..2432) product precorrin methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene cobE CDS complement(2423..3616) product precorrin-6Y methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene cobL CDS 3615..4385 product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene cobK CDS complement(4340..5095) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene cobJ sequence219 source 1..5339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1076 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403169.1:dipeptidase locus_tag LOCUS_17240 CDS complement(1197..2186) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(2208..3125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 3033..3239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(3489..4391) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3R3 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene rpoH1 misc_feature complement(4624..>5339) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3R4:pseudouridine synthase locus_tag LOCUS_17290 sequence220 source 1..5334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 727..1845 product PAPS-dependent sulfotransferase Stf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLG1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene stf3 CDS 1842..3092 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 3092..3277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 3315..3995 product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 misc_feature complement(4222..>5334) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814355.1:membrane protein locus_tag LOCUS_17340 sequence221 source 1..5321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 626..1876 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAG0 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene tyrS CDS complement(2055..2639) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I4 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(2632..3138) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y476 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 3273..4463 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I6 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene pgk sequence222 source 1..5318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2399 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003581.1:ATP-dependent helicase MgpS locus_tag LOCUS_17390 CDS 2399..2770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 2878..3216 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene fdxA CDS 3571..4080 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 misc_feature complement(4307..>5318) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719583.1:potassium transporter locus_tag LOCUS_17430 sequence223 source 1..5265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1655..2485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 misc_feature complement(2752..>5265) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337854.1:type I secretion protein locus_tag LOCUS_17450 sequence224 source 1..5263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 343..858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 918..1928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 sequence225 source 1..5247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1047 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4F4:DNA topoisomerase 1 locus_tag LOCUS_17480 CDS 1237..1938 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1942..2571 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 2561..2872 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 3082..4020 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 sequence226 source 1..5232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..663 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(667..1194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1216..2328 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 2443..2652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(2706..3917) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 4083..5093 product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338644.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 sequence227 source 1..5206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1152..3068 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene cpdB CDS 3230..4270 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 4329..5111 product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 sequence228 source 1..5182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 602..1633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1516..2178) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(2175..4592) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 misc_feature complement(4649..>5182) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337061.1:ATPase locus_tag LOCUS_17650 sequence229 source 1..5152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(474..872) product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene mutT CDS complement(869..2239) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN3 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene argJ CDS complement(2314..3159) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN2 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene surA sequence230 source 1..5127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 855..1262 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1408..2397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(2423..2632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 3022..4098 product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Z5 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene pfkB misc_feature complement(4160..>5127) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337405.1:NAD+ synthase locus_tag LOCUS_17740 sequence231 source 1..5095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1088..2287) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140227.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(2393..3622) product 5-aminolevulinate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04512 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene hemA sequence232 source 1..5093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(891..1214) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene soxD CDS complement(1260..1421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1588..2835) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719837.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 3104..4405 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 4402..4878 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 transl_table 11 codon_start 1 locus_tag LOCUS_17810 sequence233 source 1..5087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1494 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene ugpA CDS 1688..2647 product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene ugpA CDS 2654..3496 product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1Q5 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ugpE CDS 3506..4606 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCV4 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ugpC sequence234 source 1..5082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 826..1671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1822..2091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 2118..2891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2942..3124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(3076..3297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 note possible pseudo, internal stop codon CDS 3568..3747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 sequence235 source 1..5056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(655..1665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1802..4669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 sequence236 source 1..5051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..1465 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1490..2998) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(3078..3920) product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(3928..4995) product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene macA sequence237 source 1..5042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 698..2047 product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene pmbA CDS 2034..2834 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(2844..3482) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708151.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(3479..4024) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene SigD CDS 4201..4476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 sequence238 source 1..5031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(779..1486) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1483..2100) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(2218..3315) product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 3395..3649 product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U0 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(3701..3952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 4201..5022 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719501.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 sequence239 source 1..5011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence240 source 1..5008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1812 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337683.1:elongation factor 3 locus_tag LOCUS_18090 CDS complement(2125..4722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 sequence241 source 1..5006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9..905) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(996..1898) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886750.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2159..2635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(2732..3379) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY27 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 3560..3904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 sequence242 source 1..4988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..527 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887427.1:phosphonate ABC transporter, permease protein PhnE locus_tag LOCUS_18160 CDS 613..1230 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1251..2435) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene phnM CDS complement(2530..3288) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969863.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 3431..3880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 3892..4461 product carbon-phosphorus lyase subunit PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene phnH sequence243 source 1..4973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(350..850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(915..1925) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(2177..3547) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195503.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 misc_feature complement(3608..>4973) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528554.1:amino acid permease locus_tag LOCUS_18250 sequence244 source 1..4957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(487..774) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(905..2386) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY18 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene amn CDS complement(2383..4185) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6P3 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene ade CDS 4315..4632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 sequence245 source 1..4956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1664..2224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(2367..2861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(2971..4353) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y8 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene rimO sequence246 source 1..4936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..556 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 558..1289 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1325..2119) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2116..3036) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(3223..3669) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(3675..4481) product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C2 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene deoD CDS complement(4465..4935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 sequence247 source 1..4932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1286 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139917.1:Fe-S cluster assembly protein SufD locus_tag LOCUS_18400 CDS 1286..1786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 1776..2366 product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2368..3588 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0S6 transl_table 11 codon_start 1 locus_tag LOCUS_18430 tRNA 3677..3753 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 4012..4087 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 sequence248 source 1..4923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..870) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J276 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene murI CDS 1315..2226 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2618..3205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 sequence249 source 1..4906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(510..1778) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888073.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(1765..2187) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2671..3291) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(3408..4274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140016.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 misc_feature complement(4358..>4906) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721953.1:penicillin-insensitive murein endopeptidase locus_tag LOCUS_18510 sequence250 source 1..4905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1395 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976285.1:gamma-glutamyltranspeptidase locus_tag LOCUS_18520 CDS complement(1539..2390) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 2482..3651 product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085125.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene pobA CDS complement(3696..4595) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 sequence251 source 1..4902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(776..2326) product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2539..3024) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWY8 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene bfr CDS complement(3029..3268) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(3333..4592) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 sequence252 source 1..4897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 968..2095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 misc_feature complement(2181..>4897) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918232.1:methyl-accepting chemotaxis protein locus_tag LOCUS_18610 sequence253 source 1..4891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1169..2266) product MurB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(2267..3769) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 4135..4392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 sequence254 source 1..4848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..1063) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3R7 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene ssb CDS 1391..1984 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(2121..2738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2912..3922) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2M2 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene hemB CDS 4157..4696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 sequence255 source 1..4827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 338..811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(892..1767) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene pheA CDS 1888..2412 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720887.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2595..4535 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338427.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 sequence256 source 1..4820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(520..783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(874..1527) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6D8 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1527..2150) product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(2233..2685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 3104..3451 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E2 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 3441..3926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(3977..4303) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 sequence257 source 1..4813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(707..2038) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L6 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ftsA CDS complement(2035..3471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(3459..4394) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L8 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene ddl sequence258 source 1..4799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..1456 product Glu-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene gatA CDS 1453..2592 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene nrgC CDS 2617..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 3018..4292 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 4289..4783 product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 sequence259 source 1..4781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(830..1459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(1477..3087) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN7 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene nusA CDS complement(3091..3702) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN8 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene rimP misc_feature complement(3843..>4781) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYM6:proline iminopeptidase locus_tag LOCUS_18920 sequence260 source 1..4747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 1414..4008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 sequence261 source 1..4704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..527) product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 691..1182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337125.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(1428..2585) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J515 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene rnd CDS 2787..3770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(3861..4451) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J516 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene purN sequence262 source 1..4685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..1638 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337050.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 tRNA 1885..1971 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence263 source 1..4653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(364..1368) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2W6 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene apbE CDS complement(1409..3616) product NADPH flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(3629..4099) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 sequence264 source 1..4623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..1527) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51008 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene hemZ CDS 1586..2332 product transcriptional activator protein FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51007 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene fnrL CDS complement(2435..3274) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720879.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 sequence265 source 1..4619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 887..2035 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJB1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene sbcD sequence266 source 1..4617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..539 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 591..1979 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ89 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2228..2881) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(3093..3797) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 3953..4285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 tRNA 4533..4608 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence267 source 1..4607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 573..1511 product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene pcaQ CDS complement(1527..2150) product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706096.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2241..4121) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 sequence268 source 1..4604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 114..773 product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930397.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 782..1504 product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 1501..2523 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530437.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2596..2955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 note possible pseudo, internal stop codon, frameshifted CDS 3625..4440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 sequence269 source 1..4564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1040 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001894508.1:aspartate kinase locus_tag LOCUS_19210 CDS 1064..1927 product putative amino-acid ABC transporter periplasmic-binding protein y4tE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55659 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2005..2676 product putative amino-acid ABC transporter permease protein y4tF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55660 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2680..3372 product putative amino-acid ABC transporter permease protein y4tG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55661 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 3369..4220 product putative amino-acid ABC transporter ATP-binding protein y4tH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55662 transl_table 11 codon_start 1 locus_tag LOCUS_19250 sequence270 source 1..4561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZL4:leucine--tRNA ligase locus_tag LOCUS_19260 CDS 2595..3047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 3052..4074 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 sequence271 source 1..4560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..671 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336821.1:signal peptidase locus_tag LOCUS_19290 CDS 674..1753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 1763..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2428..2634) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(3070..3957) product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 sequence272 source 1..4552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 456..1088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 1082..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 1456..3519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 sequence273 source 1..4548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537909.1:transketolase locus_tag LOCUS_19370 CDS 807..1718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 1729..2616 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2675..3688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 sequence274 source 1..4532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1303..1887) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1887..3149) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 misc_feature complement(3146..>4532) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337015.1:threonine synthase locus_tag LOCUS_19430 sequence275 source 1..4494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 539..1273 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(1280..1435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(1435..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(1764..2663) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K0 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene fmt CDS complement(2669..3169) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH7 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene def CDS complement(3169..3690) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH9 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene def sequence276 source 1..4475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1205..1777 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 1774..3570 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 misc_feature complement(3813..>4475) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528215.1:ABC transporter substrate-binding protein locus_tag LOCUS_19520 sequence277 source 1..4473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..1718) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene gatA CDS 2079..3017 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene myg1 misc_feature complement(3059..>4473) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003341224.1:tryptophan synthase subunit alpha locus_tag LOCUS_19550 sequence278 source 1..4467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1707..3179) product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene mtlK CDS complement(3181..3948) product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene smoS CDS complement(3948..4466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 sequence279 source 1..4459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 813..1130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 1181..1432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722114.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(1501..1977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2424..2666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2715..3563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 misc_feature complement(3560..>4459) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140017.1:leucyl aminopeptidase locus_tag LOCUS_19640 sequence280 source 1..4451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 436..1545 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ3 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene leuB CDS 1691..2665 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 tRNA 2721..2797 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(2998..3504) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528171.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 sequence281 source 1..4450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336808.1:double-strand break repair helicase AddA locus_tag LOCUS_19680 CDS 2325..2645 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B4 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene trxA CDS complement(2703..3629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336809.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 3708..4265 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B2 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene hslV sequence282 source 1..4449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1161..2078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2080..3288 product tellurium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene telA CDS 3308..4264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337360.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 sequence283 source 1..4442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..1516 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 1526..2254 product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(2406..3509) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 misc_feature complement(3506..>4442) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919504.1:AP endonuclease locus_tag LOCUS_19780 sequence284 source 1..4441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 155..694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 691..1983 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ48 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene pyrC CDS 1980..2591 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ47 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene plsY CDS complement(2699..4066) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene gshA sequence285 source 1..4436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..1916) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(1987..2322) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene qacE CDS complement(2371..3006) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(3116..3718) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 sequence286 source 1..4431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..976) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene speB CDS 1206..1679 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 1835..2014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 2608..3096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(3093..3515) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene ndk sequence287 source 1..4390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1255..2355) product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2348..3340) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 sequence288 source 1..4384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..1667 product MFS transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(1719..2078) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAH6 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2101..2343) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2504..3502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 misc_feature complement(3638..>4384) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J273:phosphoribosylformylglycinamidine synthase subunit PurL locus_tag LOCUS_19980 sequence289 source 1..4373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1494..2456) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2629..3087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 sequence290 source 1..4372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 735..2048 product putative aminotransferase y4qG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55628 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 2059..2469 product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC3 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene ectC CDS 2489..3427 product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 sequence291 source 1..4368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1158 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI5:DNA mismatch repair protein MutS locus_tag LOCUS_20050 CDS 1155..1547 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(1599..2141) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI4 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene grpE CDS complement(2147..3211) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI3 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene hrcA CDS 3371..4081 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI2 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene rph sequence292 source 1..4341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 256..1161 product protein iolH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene holH CDS complement(1576..1965) product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(1986..2138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2453..2929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 misc_feature complement(3199..>4341) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976107.1:GntR family transcriptional regulator locus_tag LOCUS_20150 sequence293 source 1..4330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1005..1376) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M3 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene rplT CDS complement(1394..1594) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M2 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene rpmI CDS complement(1770..2000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2035..3480) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5M1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene pykA sequence294 source 1..4316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1044..2021) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene xdhC misc_feature complement(2018..>4316) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339409.1:aldehyde oxidase locus_tag LOCUS_20210 sequence295 source 1..4295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..827) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene cobI CDS complement(831..1460) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene cobH CDS complement(1450..2640) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 misc_feature complement(2637..>4295) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337770.1:cobaltochelatase subunit CobN locus_tag LOCUS_20250 sequence296 source 1..4291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(743..1915) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974678.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(1912..2874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 3018..4031 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974677.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 sequence297 source 1..4287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..961 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(1108..1896) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene catD CDS complement(2105..3043) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene catA CDS complement(3110..3400) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTP0 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(3409..4284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 sequence298 source 1..4282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 571..2676 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2688..3893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550678.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 sequence299 source 1..4281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 17..2932 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E2 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene ileS CDS complement(2990..3868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 sequence300 source 1..4272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1206 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888317.1:dehydroascorbate transporter locus_tag LOCUS_20380 CDS 1249..2262 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2333..3784 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 sequence301 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1420..1746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(1754..2155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2191..2496) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UC38 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene ureB CDS complement(2501..3070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(3081..3383) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RFF5 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene ureA CDS complement(3392..4213) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J149 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene ureD sequence302 source 1..4236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 774..1205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(1232..1840) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 1914..2645 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2731..3831) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY15 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene aroC sequence303 source 1..4231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..1225 product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene phcN CDS 1305..2204 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 2301..3203 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061596.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 sequence304 source 1..4225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..2202 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2199..2534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2542..3255) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 sequence305 source 1..4216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 898..1317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 1323..2432 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 sequence306 source 1..4210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 198..1079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(1156..1461) product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(1687..2904) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2908..4053) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 sequence307 source 1..4198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(755..1384) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene cyoC CDS complement(1381..3402) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(3392..4198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 sequence308 source 1..4197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1626 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338646.1:monovalent cation/H+ antiporter subunit A locus_tag LOCUS_20680 CDS 1630..2013 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene phaC CDS 2010..3533 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338647.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene phaD CDS 3546..4037 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene phaE sequence309 source 1..4189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..825 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2A5 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene gmk CDS 822..1343 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337845.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(1350..2468) product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2551..3399 product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 sequence310 source 1..4186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1485 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337100.1:sulfite reductase locus_tag LOCUS_20760 CDS 1457..2242 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J542 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene cysH CDS 2239..2610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337098.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 2704..3528 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 sequence311 source 1..4168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..531) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene pecS CDS 597..1478 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970783.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene pecM CDS complement(1504..2148) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2237..3346) product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 3569..3934 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 sequence312 source 1..4147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..726 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565364.1:methylmalonate-semialdehyde dehydrogenase (acylating) locus_tag LOCUS_20850 CDS 791..1879 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2015..2218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2405..2836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2948..3637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 sequence313 source 1..4145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..423 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J022 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene clpS CDS 553..1626 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 1679..2488 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2573..3010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 3126..4022 product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J026 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene hemF sequence314 source 1..4136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..742) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene pncA CDS 872..1780 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Q6 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(1777..1977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2127..3104 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 sequence315 source 1..4108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..502 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140423.1:N-methylproline demethylase locus_tag LOCUS_20990 CDS complement(527..916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337249.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(913..2298) product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2705..3046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 misc_feature complement(3236..>4108) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337127.1:Xaa-Pro aminopeptidase locus_tag LOCUS_21030 sequence316 source 1..4094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..1503) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene argH CDS 1527..2096 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene tlpA CDS 2332..3171 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 sequence317 source 1..4091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..612) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YBV0 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(609..1088) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 1216..2097 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2117..2551) product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2564..3328) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 misc_feature complement(3325..>4091) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268215.1:ABC transporter permease locus_tag LOCUS_21120 sequence318 source 1..4066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..1297) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066544.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(1361..2632) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336872.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2655..3131) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 misc_feature complement(3237..>4066) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336874.1:C4-dicarboxylate ABC transporter locus_tag LOCUS_21160 sequence319 source 1..4053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..967 product (3S)-malyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3JV05 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene mcl2 CDS 978..1535 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 1532..1735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 1735..2766 product mesaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ78 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene mch CDS 3007..3390 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 3401..3775 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 sequence320 source 1..4047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 613..687 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(1065..1514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384293.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(1553..1816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(1797..2051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2233..3516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974710.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 sequence321 source 1..4028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..700) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337538.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene gph CDS 826..2175 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3H0 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene glmU CDS 2176..3990 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3H1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene glmS sequence322 source 1..4000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1034) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 1279..1617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(1669..2319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2330..2617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722578.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2829..3665) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5N0 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene panC sequence323 source 1..3977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(542..1912) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(1977..2666) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2926..3957) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720539.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 sequence324 source 1..3959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..1127 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338779.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene comF CDS 1164..1418 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene grxC CDS 1422..2267 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2269..2712 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2709..3470) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM5 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene ubiG sequence325 source 1..3958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J045:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_21430 CDS 1063..1857 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085533.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene tam CDS 1835..2416 product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(2417..2638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 3007..3285 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561857.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 sequence326 source 1..3942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 674..2041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2038..2922) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 sequence327 source 1..3939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 980..1372 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336862.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene cdd CDS 1372..2682 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J645 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene deoA CDS 2679..3890 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J644 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene deoB sequence328 source 1..3913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 649..1155 product exclusion protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563277.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene fxsA CDS 1209..1706 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG6 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene secB CDS 1805..2347 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z5D3 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene idi CDS complement(2344..2646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 sequence329 source 1..3910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1424..3025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 3147..3710 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Y6 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(3738..3908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 sequence330 source 1..3904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2185..2334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 3291..3575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 sequence331 source 1..3901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(687..1646) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6D1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene gpsA CDS complement(1643..2737) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6D2 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene tsaD CDS 2813..3544 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 sequence332 source 1..3893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..849) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW88 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene trmB CDS 1310..1798 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(1859..2323) product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD54 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene queF CDS complement(2325..3491) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW86 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene metK CDS complement(3557..3889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 sequence333 source 1..3885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(689..1486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566974.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(1591..3078) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J459 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene gatA CDS complement(3075..3362) product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene gatC sequence334 source 1..3884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1000 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UDZ7:ammonium transporter locus_tag LOCUS_21740 CDS complement(1095..2639) product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2636..3724) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 sequence335 source 1..3876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZH5:chromosome partition protein Smc locus_tag LOCUS_21770 CDS 1975..2436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 2438..3199 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 sequence336 source 1..3870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 770..1555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(1715..2740) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2947..3870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 sequence337 source 1..3843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1181..1855) product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene pcaJ CDS complement(1852..2574) product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene pcaI CDS 2702..3469 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973948.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene pcaR sequence338 source 1..3831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(512..1015) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066705.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(1012..1734) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene fabG2 CDS complement(1731..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(3285..3572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 sequence339 source 1..3821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 316..1272 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(1425..1742) product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene hisE CDS complement(1754..2275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2278..3036) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50937 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene hisF CDS complement(3287..3565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 sequence340 source 1..3819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..1165) product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4F0 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene betI CDS 1284..2198 product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene proX CDS 2284..3120 product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene proW sequence341 source 1..3807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..887 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(902..1792) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 1962..2843 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene mtnP CDS 2840..3373 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E9 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene apt CDS 3520..3678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 sequence342 source 1..3804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(1365..1814) product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene nifU CDS 1878..2237 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53158 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene hisI CDS complement(2304..3125) product tRNA glutamyl-Q synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337617.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene gltX/glnS misc_feature complement(3161..>3804) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J349:methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO locus_tag LOCUS_22070 sequence343 source 1..3803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..771 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972972.1:protein involved in propionate catabolism locus_tag LOCUS_22080 CDS 785..2149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 2154..2753 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038848.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene gst sequence344 source 1..3794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..1575) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L8 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene tig tRNA complement(1595..1679) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1849..2610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 misc_feature complement(2742..>3794) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to U5NMV0:ADP-dependent (S)-NAD(P)H-hydrate dehydratase locus_tag LOCUS_22130 sequence345 source 1..3759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(403..1125) product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA4 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene lexA CDS complement(1198..2382) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2379..2855) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA6 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene moaC CDS complement(2852..3646) product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94327 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene trpC sequence346 source 1..3753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1401 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J342:acetolactate synthase locus_tag LOCUS_22180 CDS 1486..2046 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene ilvH CDS complement(2080..2400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2620..3456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 sequence347 source 1..3720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 677..1957 product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 2921..3259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 note possible pseudo, internal stop codon, frameshifted sequence348 source 1..3702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 313..2097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2111..3700 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D3 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene purH sequence349 source 1..3700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1808..2692) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 sequence350 source 1..3689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(868..1641) product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(1657..1830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2133..2459) product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2456..3202) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337778.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene cobA sequence351 source 1..3682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..1192) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(1194..3023) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 sequence352 source 1..3671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..513 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZG8:SsrA-binding protein locus_tag LOCUS_22330 CDS 617..1504 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene SseA CDS 1569..2750 product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383317.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene tyrB CDS 2892..3374 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 sequence353 source 1..3662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..789) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG8 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene coaE CDS complement(786..1628) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYG9 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene aroE CDS complement(1625..2215) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH0 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2627..3076 product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53229 transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence354 source 1..3635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(674..1504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(1501..1902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(1913..2416) product flagellar basal body protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 sequence355 source 1..3629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(558..1739) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4X6 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene argD CDS complement(2092..2973) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 sequence356 source 1..3626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(487..735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 918..1133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(1233..3542) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339391.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 sequence357 source 1..3616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(932..2056) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(2053..3228) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337830.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 sequence358 source 1..3606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..676 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J158 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene ureG CDS complement(710..1678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(1816..2913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 misc_feature complement(2997..>3606) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338855.1:acyl-CoA dehydrogenase locus_tag LOCUS_22540 sequence359 source 1..3606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 418..1230 product hypothetical carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(1264..2568) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene ordL1 CDS 2692..3378 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 sequence360 source 1..3589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..589 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140381.1:SDR family oxidoreductase locus_tag LOCUS_22580 CDS complement(607..2181) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 sequence361 source 1..3578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..854 product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene rnc CDS 847..1824 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W0 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene era CDS 1824..2159 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722422.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 2286..3014 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V8 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene recO misc_feature complement(3011..>3578) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89Q75:adenosylcobinamide-GDP ribazoletransferase locus_tag LOCUS_22640 sequence362 source 1..3571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1674) product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45744 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene dhbC CDS complement(1801..2739) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 misc_feature complement(2720..>3571) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147548.1:bifunctional transcriptional activator/DNA repair enzyme protein Ada locus_tag LOCUS_22670 sequence363 source 1..3566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 868..1833 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0V6 transl_table 11 codon_start 1 locus_tag LOCUS_22690 sequence364 source 1..3551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..797 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975279.1:amino acid ABC transporter substrate-binding protein locus_tag LOCUS_22700 CDS 880..2076 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 2080..3198 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 sequence365 source 1..3541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..1748) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(1935..2927) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 sequence366 source 1..3541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J241:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) locus_tag LOCUS_22750 CDS complement(1172..1918) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2574..3245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 sequence367 source 1..3536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..1566) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2157..3206 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 sequence368 source 1..3500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..1845 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 1842..2729 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene dapA sequence369 source 1..3484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 437..1150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336840.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(1129..1926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(2301..2996) product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 sequence370 source 1..3473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(603..2423) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 sequence371 source 1..3467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 363..1106 product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene ccdA CDS 1140..1577 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 1719..2183 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z4 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene rplM CDS 2185..2676 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z5 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene rpsI sequence372 source 1..3464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 721..1341 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004223.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(1345..2475) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 misc_feature complement(2541..>3464) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267888.1:membrane protein locus_tag LOCUS_22920 sequence373 source 1..3455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 697..975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(1230..2006) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene frcA CDS complement(2006..3079) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563035.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 sequence374 source 1..3437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1050) product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene pppA CDS complement(1047..1700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 misc_feature complement(1702..>3437) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895493.1:type VI secretion protein IcmF locus_tag LOCUS_22980 sequence375 source 1..3425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1112) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 1238..1675 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8B0 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene mscL CDS complement(1727..2845) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY5 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene ald sequence376 source 1..3414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(1082..1636) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337630.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(1640..2857) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337629.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 sequence377 source 1..3413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2084 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0R1:alanine--tRNA ligase locus_tag LOCUS_23050 CDS 2081..2377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2573..3370 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 sequence378 source 1..3408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..798) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140204.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 1130..2998 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337750.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 sequence379 source 1..3408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(355..1791) product prenyltransferase UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(1796..2626) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2993..3187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 sequence380 source 1..3385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1490..2659) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 misc_feature complement(2857..>3385) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X1S1:D-glycerate 2-kinase locus_tag LOCUS_23140 sequence381 source 1..3369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..1167 product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene idnD CDS 1215..2231 product lactate-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK82 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2310..2894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 sequence382 source 1..3350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1986 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919528.1:methyl-accepting chemotaxis protein locus_tag LOCUS_23180 CDS 2239..2649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 misc_feature complement(2689..>3350) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338477.1:RNA-binding protein locus_tag LOCUS_23200 sequence383 source 1..3346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..2523) product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815582.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 sequence384 source 1..3343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(386..1021) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J157 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene ureF CDS complement(1018..1632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(1778..2011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2186..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2615..3343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 sequence385 source 1..3333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(663..1709) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888286.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene idnD CDS complement(1722..2669) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 sequence386 source 1..3322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 798..1208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 misc_feature complement(1212..>3322) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338902.1:penicillin-binding protein 1C locus_tag LOCUS_23310 sequence387 source 1..3322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..1413 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene dgoK CDS 1440..2066 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(2084..2851) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene glpR sequence388 source 1..3320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1466..1876 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339404.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2021..2227) product slyX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 sequence389 source 1..3312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1312 product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 1577..2896 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 sequence390 source 1..3285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 924..1865 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2125..2760 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531484.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 sequence391 source 1..3276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2263..>3276) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338700.1:formate dehydrogenase subunit beta locus_tag LOCUS_23410 sequence392 source 1..3272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..766) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338318.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 841..3138 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene priA sequence393 source 1..3261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..1298 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 1295..1627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 1754..2770 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2767..3261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 sequence394 source 1..3257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..1225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 1399..2166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722722.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 misc_feature complement(2179..>3257) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563776.1:phosphoenolpyruvate--protein phosphotransferase locus_tag LOCUS_23500 sequence395 source 1..3255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 964..1929 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035278.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene serA tRNA 1428..1518 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1949..2605) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 sequence396 source 1..3247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..1061 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337043.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 1238..1459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 1529..2734 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 sequence397 source 1..3242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(775..1416) product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33570 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene ccmA CDS complement(1469..1834) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(1821..2804) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33568 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene secF sequence398 source 1..3216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..848 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337103.1:cytochrome P450 locus_tag LOCUS_23590 CDS complement(1142..1603) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 1693..2520 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 2517..2822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 sequence399 source 1..3204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..569 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338916.1:alpha-glucosidase locus_tag LOCUS_23630 CDS complement(574..1326) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(1319..2305) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 misc_feature complement(2302..>3204) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061821.1:monosaccharide-transporting ATPase locus_tag LOCUS_23660 sequence400 source 1..3195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..679 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYR6:1-deoxy-D-xylulose-5-phosphate synthase 2 locus_tag LOCUS_23670 CDS 1012..2220 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087637.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2272..3138) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 sequence401 source 1..3189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 793..987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(1109..1471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(1563..2435) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene prmA misc_feature complement(2597..>3189) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0F2:peptide methionine sulfoxide reductase MsrA locus_tag LOCUS_23730 sequence402 source 1..3188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705231.1:multidrug efflux RND transporter permease subunit locus_tag LOCUS_23740 CDS 1827..2525 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 sequence403 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1398 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 1453..2577 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 sequence404 source 1..3148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(550..1701) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(1698..3086) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 sequence405 source 1..3143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(914..1714) product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(1711..2565) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 misc_feature complement(2627..>3143) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338405.1:DNA polymerase III subunit delta' locus_tag LOCUS_23820 sequence406 source 1..3141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..592 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 798..1214 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369893.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(1392..2309) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 2598..2852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 sequence407 source 1..3135 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..987 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720543.1:aspartate aminotransferase family protein locus_tag LOCUS_23870 CDS complement(1236..1799) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(2075..2530) product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2656..3135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 sequence408 source 1..3130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..1819) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003733.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(1893..2438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2469..2957) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU9 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene LspA sequence409 source 1..3124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..504 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974753.1:ABC transporter ATP-binding protein locus_tag LOCUS_23940 CDS 623..1798 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene blcB CDS complement(1895..2536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 sequence410 source 1..3119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1007..1171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(1300..2055) product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 misc_feature complement(2124..>3119) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IY52:D-3-phosphoglycerate dehydrogenase locus_tag LOCUS_23990 sequence411 source 1..3117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(424..1443) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene pldB CDS complement(1443..1730) product sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719575.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 1777..2367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 sequence412 source 1..3109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(988..2364) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2439..2855) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene phaG sequence413 source 1..3109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..1660 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5D1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene trkH3 CDS complement(1667..2968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 sequence414 source 1..3083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706102.1:ABC transporter substrate-binding protein locus_tag LOCUS_24080 CDS 977..1501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 1512..2786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 note possible pseudo, internal stop codon, frameshifted sequence415 source 1..3076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..807) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338597.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene yobR CDS complement(804..1532) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene cinA1 CDS 1661..2470 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC9 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene map1 CDS 2581..2901 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene sugE sequence416 source 1..3059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1413..1763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(1879..2583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 sequence417 source 1..3044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(851..1858) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 sequence418 source 1..3030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1409 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338715.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 sequence419 source 1..3024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1710) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 1876..2838 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 sequence420 source 1..3007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..1269 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGY5 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene bioB CDS 1266..2420 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 sequence421 source 1..3006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 636..1589 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338180.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(1586..2206) product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 sequence422 source 1..3005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..1056) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(1113..2423) product tripartite transporter large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(2426..3004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 sequence423 source 1..2987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..772 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(1289..1876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339300.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 misc_feature complement(1890..>2987) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339301.1:glutathionylspermidine synthase locus_tag LOCUS_24310 sequence424 source 1..2976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1916..2620 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723102.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 sequence425 source 1..2970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1228 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337397.1:cytochrome c4 locus_tag LOCUS_24330 sequence426 source 1..2957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 732..1187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(1274..2320) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 sequence427 source 1..2949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..1464) product ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314797.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(1752..2159) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 misc_feature complement(2239..>2949) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970718.1:ABC transporter locus_tag LOCUS_24380 sequence428 source 1..2942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869125.1:C4-dicarboxylate ABC transporter permease locus_tag LOCUS_24390 CDS 1623..2699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence429 source 1..2940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..1267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336766.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(1239..1529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722131.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 1707..2243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 sequence430 source 1..2939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..799 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene fadB CDS complement(885..1229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(1386..2027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 note possible pseudo, frameshifted CDS complement(2000..2362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 note possible pseudo, frameshifted CDS complement(2490..2729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 note possible pseudo, frameshifted sequence431 source 1..2935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 12..644 product carnitine operon oxidoreductase caia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 tRNA 748..824 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(1197..2567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 sequence432 source 1..2928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1057..1728) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337699.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene pgl misc_feature complement(1728..>2928) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2U6:glucose-6-phosphate 1-dehydrogenase locus_tag LOCUS_24520 sequence433 source 1..2908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 note possible pseudo, frameshifted CDS 1324..1809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(1917..2891) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 sequence434 source 1..2902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..615) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538084.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(675..1658) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970533.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(1868..2689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 sequence435 source 1..2901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1103 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4E9:NAD/NADP-dependent betaine aldehyde dehydrogenase locus_tag LOCUS_24590 CDS 1196..2854 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E8 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene betA sequence436 source 1..2895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 794..2185 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 sequence437 source 1..2891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1081 product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene fabB CDS 1089..1877 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXE3 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene fabI CDS complement(2652..2846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 sequence438 source 1..2891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(276..896) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S6 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene tmk CDS complement(896..2191) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 misc_feature complement(2277..>2891) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011841512.1:sporulation protein locus_tag LOCUS_24670 sequence439 source 1..2888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2094 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528642.1:C4-dicarboxylate ABC transporter locus_tag LOCUS_24680 CDS 2091..2450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 sequence440 source 1..2883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..1291) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ49 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene pyrB CDS 1455..2273 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338649.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 sequence441 source 1..2873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1850..2266) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709589.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 sequence442 source 1..2870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1105 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338530.1:NAD(FAD)-utilizing dehydrogenase locus_tag LOCUS_24730 CDS complement(1143..1364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 sequence443 source 1..2868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence444 source 1..2864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(520..2730) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene afuB sequence445 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..807) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 1022..2029 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034588.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 2090..2569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 sequence446 source 1..2852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(745..>2852) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533597.1:short chain dehydrogenase locus_tag LOCUS_24790 sequence447 source 1..2836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..852 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene gapA CDS complement(938..1708) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(1844..2074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 sequence448 source 1..2835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709542.1:methionine synthase locus_tag LOCUS_24830 CDS complement(1351..2058) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337269.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(2069..2644) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene yohD sequence449 source 1..2822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1149..>2822) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324929.1:nitrate ABC transporter ATP-binding protein locus_tag LOCUS_24860 sequence450 source 1..2816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(302..2152) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337149.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene ybaU sequence451 source 1..2814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence452 source 1..2809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..973) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D9 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene truA CDS 1038..2453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338326.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 sequence453 source 1..2807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..915 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ91:crotonyl-CoA reductase locus_tag LOCUS_24900 CDS 968..2149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 note possible pseudo, internal stop codon CDS 2255..2638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 note possible pseudo, internal stop codon sequence454 source 1..2762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..1262 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 1255..2163 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 sequence455 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2476 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387755.1:glycosyl transferase locus_tag LOCUS_24950 sequence456 source 1..2742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(273..1577) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337783.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene corB CDS complement(1626..2558) product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2I7 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene xerD sequence457 source 1..2739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(897..1457) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene rfbC sequence458 source 1..2727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..774 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 771..1898 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975565.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene nrtA sequence459 source 1..2724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(698..1534) product salt-stress induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338463.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene SspA CDS complement(1801..2127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 sequence460 source 1..2718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J3L4:alanine racemase locus_tag LOCUS_25030 CDS 739..1509 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 1506..2252 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719612.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 sequence461 source 1..2707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(169..939) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(936..2243) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338710.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 sequence462 source 1..2707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1131 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338426.1:peptide ABC transporter ATPase locus_tag LOCUS_25080 CDS 1145..2353 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 sequence463 source 1..2706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(801..1460) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene gst sequence464 source 1..2698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(786..1496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337251.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(1518..1676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(1780..2472) product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene mtbC sequence465 source 1..2686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 1070..1942 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 tRNA 2243..2326 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence466 source 1..2672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..689 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J210:GMP synthase [glutamine-hydrolyzing] locus_tag LOCUS_25160 CDS 1126..2079 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 sequence467 source 1..2672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(279..1184) product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW19 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(1483..2514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 sequence468 source 1..2662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..1478) product histidinol dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J079 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene hisD1 CDS complement(1671..2147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338374.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 misc_feature complement(2144..>2662) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J077:UDP-N-acetylglucosamine 1-carboxyvinyltransferase locus_tag LOCUS_25220 sequence469 source 1..2660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 757..1158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 1263..1625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(1646..2566) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene glsA sequence470 source 1..2658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..785 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IWS4:4-hydroxythreonine-4-phosphate dehydrogenase locus_tag LOCUS_25260 CDS complement(833..2011) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969614.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 misc_feature complement(2092..>2658) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009562709.1:GntR family transcriptional regulator locus_tag LOCUS_25280 sequence471 source 1..2658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1217..1753) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(1753..2547) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719486.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 sequence472 source 1..2656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 951..1886 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 1922..2356 product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 sequence473 source 1..2654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..1550) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(1573..2310) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 sequence474 source 1..2649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(527..907) product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 1252..1869 product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene cobO sequence475 source 1..2634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..1663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 misc_feature complement(1831..>2634) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q93IX0:nuclease SbcCD subunit C locus_tag LOCUS_25380 sequence476 source 1..2631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..839 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene pcaD CDS 832..1230 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene pcaC CDS 1227..1949 product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene pcaH CDS 1946..2566 product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene pcaG sequence477 source 1..2630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 598..1803 product cobalamin synthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 1816..2091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382891.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 sequence478 source 1..2629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence479 source 1..2628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(61..>2628) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919528.1:methyl-accepting chemotaxis protein locus_tag LOCUS_25450 sequence480 source 1..2624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence481 source 1..2622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence482 source 1..2617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(420..926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 876..1667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 sequence483 source 1..2612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..2325) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene glcB sequence484 source 1..2601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..981 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139967.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene lyrS CDS complement(1045..2076) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338598.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 misc_feature complement(2073..>2601) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338597.1:N-acetyltransferase locus_tag LOCUS_25510 sequence485 source 1..2598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(698..1699) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(1777..2598) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974646.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene dapA sequence486 source 1..2598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(571..1194) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene ompW CDS 2033..2398 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3G1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene nuoA sequence487 source 1..2598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(904..1107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 tRNA 1212..1286 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 2143..2574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 sequence488 source 1..2589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1901) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971185.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 sequence489 source 1..2580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(960..1823) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 misc_feature complement(1834..>2580) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722599.1:dipeptide epimerase locus_tag LOCUS_25610 sequence490 source 1..2572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 550..1698 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene serC sequence491 source 1..2567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence492 source 1..2566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1811 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2C2:LPS-assembly protein LptD locus_tag LOCUS_25630 sequence493 source 1..2553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 290..925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537877.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 868..1347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 sequence494 source 1..2550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 456..1007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 tRNA complement(1090..1164) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(1321..1395) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1552..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 sequence495 source 1..2549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(698..2428) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 sequence496 source 1..2530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 146..1438 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY37 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene pncB misc_feature complement(1524..>2530) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4G3:phosphate transporter locus_tag LOCUS_25700 sequence497 source 1..2528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 632..1225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 misc_feature complement(1226..>2528) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003693.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_25720 sequence498 source 1..2526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..645 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258123.1:ABC transporter ATP-binding protein locus_tag LOCUS_25730 CDS 722..2428 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 note possible pseudo, frameshifted sequence499 source 1..2513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..1488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(1549..2475) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808786.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 sequence500 source 1..2494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(692..1603) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 sequence501 source 1..2490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(499..1329) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338549.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(1609..2214) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ0 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene leuD sequence502 source 1..2485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..638 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973794.1:nitrate reductase locus_tag LOCUS_25800 CDS complement(672..1865) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338153.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene nnrS CDS complement(1963..2409) product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 sequence503 source 1..2484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(842..2092) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720329.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 sequence504 source 1..2480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1589 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene gor sequence505 source 1..2477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..1488) product plasmid replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723340.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 sequence506 source 1..2472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 552..1580 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3R5 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene cheB CDS 1577..2113 product putative chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87719 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene cheD sequence507 source 1..2460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1459..2010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836226.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 sequence508 source 1..2458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(744..>2458) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4G7:bifunctional protein PutA locus_tag LOCUS_25890 sequence509 source 1..2450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(406..1311) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089016.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(1399..2262) product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 sequence510 source 1..2449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1097 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969247.1:carbohydrate kinase locus_tag LOCUS_25920 CDS 1090..2184 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 sequence511 source 1..2438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(578..1681) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561816.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 misc_feature complement(1681..>2438) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720885.1:microcin C ABC transporter permease YejB locus_tag LOCUS_25950 sequence512 source 1..2437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..516 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259624.1:ATP-dependent acyl-CoA ligase locus_tag LOCUS_25960 CDS 574..1356 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene paaG CDS 1516..2316 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 sequence513 source 1..2437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 631..1506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 misc_feature complement(1562..>2437) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119394.1:nucleoside-diphosphate-sugar epimerase locus_tag LOCUS_26000 sequence514 source 1..2433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..705 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338802.1:coproporphyrinogen III oxidase note possible pseudo, frameshifted locus_tag LOCUS_26010 CDS 702..920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 note possible pseudo, frameshifted CDS 921..1274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(1275..2171) product chromosome segregation DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene spo0J sequence515 source 1..2424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(499..>2424) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337156.1:DEAD/DEAH box helicase locus_tag LOCUS_26050 sequence516 source 1..2412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..591) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W7 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene rpoZ CDS complement(680..1132) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene FolK CDS 1367..1936 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722410.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 sequence517 source 1..2404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(557..1150) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene trpG sequence518 source 1..2393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..745 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972320.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 sequence519 source 1..2387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 61..540 product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J080 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 543..1007 product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338371.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 1004..1408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 1401..2006 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 sequence520 source 1..2383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..1365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44992 transl_table 11 codon_start 1 locus_tag LOCUS_26150 misc_feature complement(1403..>2383) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000153839.1:dehydroascorbate transporter locus_tag LOCUS_26160 sequence521 source 1..2381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 582..1481 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2X6 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene miaA sequence522 source 1..2359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..828 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976142.1:ornithine cyclodeaminase locus_tag LOCUS_26180 CDS complement(897..1334) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 1478..2323 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887460.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 sequence523 source 1..2355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 779..2290 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J556 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene dnaB sequence524 source 1..2353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 898..1587 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339223.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 sequence525 source 1..2350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..1564) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338768.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene xylB CDS complement(1564..2325) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338769.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 sequence526 source 1..2341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence527 source 1..2338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..1309 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBV7 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(1421..2083) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 sequence528 source 1..2323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(967..1821) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 misc_feature complement(1823..>2323) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002215451.1:iron-siderophore ABC transporter permease locus_tag LOCUS_26280 sequence529 source 1..2318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..1604 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719323.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene metR sequence530 source 1..2318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(452..727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(740..1492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(1489..1851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339455.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(1959..2123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 sequence531 source 1..2311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..1816) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Z9 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene leuA sequence532 source 1..2303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(418..1278) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(1248..1556) product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZF4 transl_table 11 codon_start 1 locus_tag LOCUS_26360 sequence533 source 1..2291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..1149) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 1247..2131 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 sequence534 source 1..2285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1141 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6B1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene hslU sequence535 source 1..2280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 35..1165 product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene ydjI sequence536 source 1..2266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence537 source 1..2260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..694 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973464.1:oxidoreductase locus_tag LOCUS_26410 CDS 691..1782 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 sequence538 source 1..2253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 705..1820 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene perM sequence539 source 1..2236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(531..1499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 sequence540 source 1..2235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 572..1510 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530140.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 1660..2118 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 sequence541 source 1..2225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..636 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337809.1:ABC transporter ATP-binding protein locus_tag LOCUS_26470 sequence542 source 1..2224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..926 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2C5:putative cytosol aminopeptidase locus_tag LOCUS_26480 CDS 928..1398 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337829.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(1421..2104) product HyuE hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140360.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 sequence543 source 1..2222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..1470 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 1478..2215 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 sequence544 source 1..2218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..884 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085944.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 1064..2038 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086645.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 sequence545 source 1..2186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 180..953 product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNF3 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(1065..1850) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene pssA sequence546 source 1..2175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385286.1:arginine ABC transporter ATP-binding protein locus_tag LOCUS_26570 CDS 602..2005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089102.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 sequence547 source 1..2170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..763) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(975..1244) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXY1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene rpmA CDS complement(1251..1712) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXY2 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene rplU sequence548 source 1..2155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(798..1769) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707984.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 sequence549 source 1..2149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..1220) product vanillate O-demethylase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene vanB CDS complement(1217..1978) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(1978..2148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 sequence550 source 1..2148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1174..>2148) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106412.1:nitrate ABC transporter substrate-binding protein locus_tag LOCUS_26670 sequence551 source 1..2146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..876) product thiamine import ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY12 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene thiQ misc_feature complement(863..>2146) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338928.1:thiamine/thiamine pyrophosphate ABC transporter permease ThiP locus_tag LOCUS_26690 sequence552 source 1..2119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 356..1531 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 sequence553 source 1..2119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZFA8:anthranilate phosphoribosyltransferase locus_tag LOCUS_26710 CDS 1031..1684 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T3 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene ung sequence554 source 1..2116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(626..1444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 misc_feature complement(1586..>2116) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390781.1:adenylate kinase locus_tag LOCUS_26740 sequence555 source 1..2109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..911 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533631.1:LysR family transcriptional regulator locus_tag LOCUS_26750 CDS 1041..2009 product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 sequence556 source 1..2106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1126..1530 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972246.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(1642..2052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 note possible pseudo, internal stop codon sequence557 source 1..2102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(361..1266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 misc_feature complement(1263..>2102) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263659.1:3-hydroxy-3-methylglutaryl-CoA reductase locus_tag LOCUS_26800 sequence558 source 1..2100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(458..1279) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887867.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 sequence559 source 1..2095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(709..1278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 sequence560 source 1..2069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(715..1578) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 sequence561 source 1..2044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence562 source 1..2025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence563 source 1..2022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(433..1038) product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887490.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(1042..1974) product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529294.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 sequence564 source 1..2020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 428..898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 sequence565 source 1..2016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337047.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(1065..1517) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563806.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 sequence566 source 1..2008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..1180) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J517 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene purM CDS 1352..1795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 tRNA 1887..1962 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence567 source 1..2008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1196..>2008) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720466.1:urea ABC transporter substrate-binding protein locus_tag LOCUS_26910 sequence568 source 1..2004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 466..921 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337306.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 921..1133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 1277..1906 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085295.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 sequence569 source 1..1993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 26..115 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(290..1108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 sequence570 source 1..1980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..1047) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(1253..1846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722215.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 sequence571 source 1..1980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(481..1389) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140098.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 1488..1808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719181.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 sequence572 source 1..1980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(380..1402) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974645.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 sequence573 source 1..1973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 421..1461 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 sequence574 source 1..1970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(955..1314) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4D5 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene gcvH misc_feature complement(1326..>1970) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4D6:aminomethyltransferase locus_tag LOCUS_27040 sequence575 source 1..1969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..1180 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 sequence576 source 1..1960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..555 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083169.1:DeoR family transcriptional regulator locus_tag LOCUS_27060 misc_feature complement(563..>1960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IX78:D-aminopeptidase locus_tag LOCUS_27070 sequence577 source 1..1960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..585 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI1:non-canonical purine NTP pyrophosphatase locus_tag LOCUS_27080 CDS 585..968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene tdcF sequence578 source 1..1957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(570..1055) product putative TRAP transporter small permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44994 transl_table 11 codon_start 1 locus_tag LOCUS_27100 sequence579 source 1..1950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1016..1492) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W3 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene acpS sequence580 source 1..1941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 438..1481 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J554 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene pyrC sequence581 source 1..1933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 529..942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 misc_feature complement(939..>1933) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384544.1:TIGR01620 family protein locus_tag LOCUS_27140 sequence582 source 1..1930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(379..1134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 sequence583 source 1..1928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..721 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090105.1:hydrolase locus_tag LOCUS_27160 CDS 730..1119 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 sequence584 source 1..1927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(263..937) product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064044.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(943..1815) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064045.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 sequence585 source 1..1924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..1728) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886779.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 sequence586 source 1..1920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..929 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086340.1:two-component sensor histidine kinase locus_tag LOCUS_27210 sequence587 source 1..1906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(787..>1906) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338340.1:choline-sulfatase locus_tag LOCUS_27220 sequence588 source 1..1903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..834) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 sequence589 source 1..1898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..722 product ECF RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYV6 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene rpoE CDS 727..1374 product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene chrR CDS 1432..1797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540506.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 sequence590 source 1..1896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence591 source 1..1893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..1740 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538212.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene pcaB sequence592 source 1..1873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1011..>1873) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IWD2:histidine--tRNA ligase locus_tag LOCUS_27280 sequence593 source 1..1872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..639 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339415.1:glycerol-3-phosphate dehydrogenase locus_tag LOCUS_27290 CDS 757..1299 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 misc_feature complement(1365..>1872) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339417.1:dimethylglycine dehydrogenase locus_tag LOCUS_27310 sequence594 source 1..1869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(958..1434) product UPF0303 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDA3 transl_table 11 codon_start 1 locus_tag LOCUS_27320 sequence595 source 1..1864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence596 source 1..1859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 532..1251 product sulfate/molybdate ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene cysA misc_feature complement(1301..>1859) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809257.1:membrane protein locus_tag LOCUS_27350 sequence597 source 1..1858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..927 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338480.1:ABC transporter substrate-binding protein locus_tag LOCUS_27360 CDS 920..1594 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZT1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene lolD sequence598 source 1..1857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(892..>1857) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172863.1:tripartite transporter large subunit locus_tag LOCUS_27380 sequence599 source 1..1854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..761 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336968.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 sequence600 source 1..1854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083069.1:transcriptional regulator locus_tag LOCUS_27400 sequence601 source 1..1846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 728..1555 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 sequence602 source 1..1825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..1355) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762837.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 sequence603 source 1..1823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 406..1236 product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708987.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 1246..1704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 note possible pseudo, internal stop codon sequence604 source 1..1820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 340..792 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339286.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 834..1787 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 sequence605 source 1..1815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1119 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J310:glycerol-3-phosphate dehydrogenase locus_tag LOCUS_27480 sequence606 source 1..1803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(726..1289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 misc_feature complement(1282..>1803) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532909.1:sarcosine oxidase subunit alpha locus_tag LOCUS_27510 sequence607 source 1..1800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence608 source 1..1800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(356..1396) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 sequence609 source 1..1798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..750 product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 sequence610 source 1..1792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 sequence611 source 1..1790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(914..>1790) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339411.1:ABC transporter locus_tag LOCUS_27550 sequence612 source 1..1788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..881 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012710145.1:endonuclease locus_tag LOCUS_27560 CDS complement(948..1787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 sequence613 source 1..1778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(418..762) product nucleoid-associated protein YbaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ7 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene YbaB misc_feature complement(772..>1778) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383690.1:DNA polymerase III subunit gamma/tau locus_tag LOCUS_27590 sequence614 source 1..1774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..707 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888074.1:homoserine kinase note possible pseudo, internal stop codon locus_tag LOCUS_27600 CDS 753..959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 959..1420 product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 sequence615 source 1..1770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..848 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385794.1:peptidase M20 locus_tag LOCUS_27630 sequence616 source 1..1765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1047..>1765) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973917.1:5-dehydro-2-deoxygluconokinase locus_tag LOCUS_27640 sequence617 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..769 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338047.1:ABC transporter permease locus_tag LOCUS_27650 sequence618 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(830..1315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 sequence619 source 1..1755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(368..1399) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338668.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 sequence620 source 1..1744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(437..775) product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene glnB sequence621 source 1..1744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1018 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338896.1:cell division protein ZapE locus_tag LOCUS_27690 misc_feature complement(1079..>1744) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385339.1:luciferase locus_tag LOCUS_27700 sequence622 source 1..1734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(499..1167) product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 misc_feature complement(1198..>1734) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724163.1:polyamine ABC transporter permease locus_tag LOCUS_27720 sequence623 source 1..1719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..852 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338149.1:nitric oxide reductase locus_tag LOCUS_27730 CDS 849..1655 product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene norQ sequence624 source 1..1712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(378..1088) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722382.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 misc_feature complement(1202..>1712) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336875.1:GntR family transcriptional regulator locus_tag LOCUS_27760 sequence625 source 1..1707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..927 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087813.1:chromate transporter locus_tag LOCUS_27770 CDS complement(920..1357) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(1364..1630) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 sequence626 source 1..1698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..965 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 1005..1688 product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 sequence627 source 1..1697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence628 source 1..1696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..902 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086440.1:FAD-binding dehydrogenase locus_tag LOCUS_27820 CDS complement(1115..1450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 sequence629 source 1..1694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..816 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4E6:propionyl-CoA carboxylase regulator locus_tag LOCUS_27840 CDS complement(882..1121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 sequence630 source 1..1681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..1333 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384661.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 sequence631 source 1..1677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(466..>1677) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y998:pyruvate carboxylase locus_tag LOCUS_27870 sequence632 source 1..1670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..755 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92WJ0:Fe(3+) ions import ATP-binding protein FbpC 1 locus_tag LOCUS_27880 sequence633 source 1..1653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence634 source 1..1653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(841..1653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 sequence635 source 1..1653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1605) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXX8 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene proB sequence636 source 1..1650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 316..1212 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene iolE sequence637 source 1..1642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence638 source 1..1634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(260..>1634) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003601.1:citramalate synthase locus_tag LOCUS_27930 sequence639 source 1..1626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence640 source 1..1623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(605..1372) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 sequence641 source 1..1622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence642 source 1..1618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(343..>1618) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706152.1:tripartite tricarboxylate transporter TctA locus_tag LOCUS_27950 sequence643 source 1..1607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1562 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene sda sequence644 source 1..1599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..1520) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87388 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene soxB sequence645 source 1..1599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 506..943 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719611.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 sequence646 source 1..1597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 465..992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 sequence647 source 1..1594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1033..1422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 sequence648 source 1..1582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225693.1:acyl-CoA dehydrogenase locus_tag LOCUS_28010 misc_feature complement(581..>1582) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192524.1:3-hydroxyacyl-CoA dehydrogenase locus_tag LOCUS_28020 sequence649 source 1..1575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(408..1040) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720331.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 sequence650 source 1..1574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence651 source 1..1574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..1200) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39071 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene dhbA CDS complement(1197..1574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 sequence652 source 1..1573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 408..1007 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UH45 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene thiE sequence653 source 1..1566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 770..1363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 sequence654 source 1..1551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(772..>1551) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384199.1:kinase locus_tag LOCUS_28090 sequence655 source 1..1550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1540 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 sequence656 source 1..1542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(355..1131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(1373..1540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 sequence657 source 1..1541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1187 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719482.1:glutamine synthetase locus_tag LOCUS_28130 sequence658 source 1..1536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..1150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 sequence659 source 1..1527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence660 source 1..1524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 sequence661 source 1..1517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence662 source 1..1505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..761 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975070.1:ABC transporter substrate-binding protein locus_tag LOCUS_28160 sequence663 source 1..1503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..743 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722307.1:glutamine synthetase locus_tag LOCUS_28170 CDS 907..1074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 sequence664 source 1..1503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1266 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640539.1:xanthine dehydrogenase small subunit locus_tag LOCUS_28190 sequence665 source 1..1503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200