>Feature sequence001 2471 531 gene locus_tag LOCUS_00010 2471 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_00010 4094 2802 gene locus_tag LOCUS_00020 gene purA 4094 2802 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_00020 5306 4101 gene locus_tag LOCUS_00030 gene hisZ 5306 4101 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_00030 6454 5399 gene locus_tag LOCUS_00040 6454 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6778 6458 gene locus_tag LOCUS_00050 6778 6458 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085874.1 protein_id gnl|my_center|LOCUS_00050 7420 6881 gene locus_tag LOCUS_00060 7420 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8816 7389 gene locus_tag LOCUS_00070 8816 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9345 8821 gene locus_tag LOCUS_00080 9345 8821 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881088.1 protein_id gnl|my_center|LOCUS_00080 10011 9409 gene locus_tag LOCUS_00090 10011 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10228 11871 gene locus_tag LOCUS_00100 10228 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11871 13451 gene locus_tag LOCUS_00110 gene ggt 11871 13451 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_00110 13577 14275 gene locus_tag LOCUS_00120 gene fnr 13577 14275 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228525.1 protein_id gnl|my_center|LOCUS_00120 14744 15109 gene locus_tag LOCUS_00130 14744 15109 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_00130 15143 16549 gene locus_tag LOCUS_00140 gene pleD 15143 16549 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_00140 16751 16584 gene locus_tag LOCUS_00150 gene rpmG 16751 16584 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE5 protein_id gnl|my_center|LOCUS_00150 <18326 16891 gene locus_tag LOCUS_00160 <18326 16891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390952.1:peptidase S41 >Feature sequence002 171 755 gene locus_tag LOCUS_00170 171 755 CDS product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_00170 904 1299 gene locus_tag LOCUS_00180 904 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 1438 3615 gene locus_tag LOCUS_00190 1438 3615 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_00190 3688 4278 gene locus_tag LOCUS_00200 3688 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 protein_id gnl|my_center|LOCUS_00200 4281 5036 gene locus_tag LOCUS_00210 gene pdxJ 4281 5036 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_00210 5033 5443 gene locus_tag LOCUS_00220 gene acpS 5033 5443 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ6 protein_id gnl|my_center|LOCUS_00220 5535 6269 gene locus_tag LOCUS_00230 5535 6269 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_00230 6266 6982 gene locus_tag LOCUS_00240 gene rnc 6266 6982 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_00240 6979 7905 gene locus_tag LOCUS_00250 gene era 6979 7905 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 protein_id gnl|my_center|LOCUS_00250 7923 8657 gene locus_tag LOCUS_00260 gene recO 7923 8657 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT96 protein_id gnl|my_center|LOCUS_00260 9009 8701 gene locus_tag LOCUS_00270 9009 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 9288 11552 gene locus_tag LOCUS_00280 gene parC 9288 11552 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_00280 11818 11570 gene locus_tag LOCUS_00290 11818 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 12820 11828 gene locus_tag LOCUS_00300 12820 11828 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_00300 13709 12984 gene locus_tag LOCUS_00310 gene ate 13709 12984 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA0 protein_id gnl|my_center|LOCUS_00310 14107 13784 gene locus_tag LOCUS_00320 14107 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 14162 14683 gene locus_tag LOCUS_00330 14162 14683 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389594.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 995 336 gene locus_tag LOCUS_00340 995 336 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_00340 1369 998 gene locus_tag LOCUS_00350 1369 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_00350 1784 1383 gene locus_tag LOCUS_00360 1784 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_00360 1927 3708 gene locus_tag LOCUS_00370 1927 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 3716 4099 gene locus_tag LOCUS_00380 3716 4099 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533616.1 protein_id gnl|my_center|LOCUS_00380 4096 5157 gene locus_tag LOCUS_00390 gene pyrD 4096 5157 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_00390 6235 5162 gene locus_tag LOCUS_00400 6235 5162 CDS product ammonia monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 protein_id gnl|my_center|LOCUS_00400 7170 6403 gene locus_tag LOCUS_00410 gene nadK 7170 6403 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_00410 7658 7506 gene locus_tag LOCUS_00420 7658 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 7847 7689 gene locus_tag LOCUS_00430 7847 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8166 8795 gene locus_tag LOCUS_00440 8166 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 8914 9342 gene locus_tag LOCUS_00450 8914 9342 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_00450 9342 9557 gene locus_tag LOCUS_00460 9342 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 10053 9589 gene locus_tag LOCUS_00470 10053 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 11072 10083 gene locus_tag LOCUS_00480 gene moaA 11072 10083 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_00480 12957 11173 gene locus_tag LOCUS_00490 12957 11173 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088232.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence004 <1 1521 gene locus_tag LOCUS_00500 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:dehydrogenase 1599 2507 gene locus_tag LOCUS_00510 gene garR 1599 2507 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSH1 protein_id gnl|my_center|LOCUS_00510 2512 3567 gene locus_tag LOCUS_00520 2512 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_00520 4508 3564 gene locus_tag LOCUS_00530 4508 3564 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090122.1 protein_id gnl|my_center|LOCUS_00530 4646 5719 gene locus_tag LOCUS_00540 4646 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807559.1 protein_id gnl|my_center|LOCUS_00540 5840 6430 gene locus_tag LOCUS_00550 5840 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6430 7914 gene locus_tag LOCUS_00560 6430 7914 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_00560 7931 9055 gene locus_tag LOCUS_00570 7931 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9060 9377 gene locus_tag LOCUS_00580 9060 9377 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723669.1 protein_id gnl|my_center|LOCUS_00580 9407 10036 gene locus_tag LOCUS_00590 9407 10036 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_00590 10479 10099 gene locus_tag LOCUS_00600 10479 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_00600 12367 10460 gene locus_tag LOCUS_00610 12367 10460 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence005 1059 1865 gene locus_tag LOCUS_00620 1059 1865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975294.1 protein_id gnl|my_center|LOCUS_00620 2100 1873 gene locus_tag LOCUS_00630 2100 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2256 3128 gene locus_tag LOCUS_00640 2256 3128 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530117.1 protein_id gnl|my_center|LOCUS_00640 3263 3466 gene locus_tag LOCUS_00650 3263 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3507 3773 gene locus_tag LOCUS_00660 3507 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4593 3805 gene locus_tag LOCUS_00670 4593 3805 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531360.1 protein_id gnl|my_center|LOCUS_00670 5433 4696 gene locus_tag LOCUS_00680 5433 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6802 5456 gene locus_tag LOCUS_00690 6802 5456 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_00690 6915 8552 gene locus_tag LOCUS_00700 6915 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8561 9721 gene locus_tag LOCUS_00710 8561 9721 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390176.1 protein_id gnl|my_center|LOCUS_00710 12188 9768 gene locus_tag LOCUS_00720 gene rne 12188 9768 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSE6 protein_id gnl|my_center|LOCUS_00720 >Feature sequence006 2789 1989 gene locus_tag LOCUS_00730 gene lpxA 2789 1989 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_00730 3253 2786 gene locus_tag LOCUS_00740 gene fabZ 3253 2786 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_00740 4279 3257 gene locus_tag LOCUS_00750 gene lpxD2 4279 3257 CDS product UDP-3-O-acylglucosamine N-acyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRD8 protein_id gnl|my_center|LOCUS_00750 4882 4283 gene locus_tag LOCUS_00760 4882 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7156 4892 gene locus_tag LOCUS_00770 gene bamA 7156 4892 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 protein_id gnl|my_center|LOCUS_00770 8360 7221 gene locus_tag LOCUS_00780 8360 7221 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_00780 9620 8412 gene locus_tag LOCUS_00790 gene dxr 9620 8412 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_00790 10303 9611 gene locus_tag LOCUS_00800 10303 9611 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 protein_id gnl|my_center|LOCUS_00800 11012 10272 gene locus_tag LOCUS_00810 11012 10272 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 protein_id gnl|my_center|LOCUS_00810 >Feature sequence007 <1 599 gene locus_tag LOCUS_00820 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391540.1:molybdopterin biosynthesis protein 596 1054 gene locus_tag LOCUS_00830 596 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391539.1 protein_id gnl|my_center|LOCUS_00830 1241 1681 gene locus_tag LOCUS_00840 1241 1681 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_00840 2503 1700 gene locus_tag LOCUS_00850 2503 1700 CDS product 2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_00850 3900 2500 gene locus_tag LOCUS_00860 3900 2500 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388887.1 protein_id gnl|my_center|LOCUS_00860 4899 3919 gene locus_tag LOCUS_00870 4899 3919 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265998.1 protein_id gnl|my_center|LOCUS_00870 5088 5591 gene locus_tag LOCUS_00880 5088 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6194 5604 gene locus_tag LOCUS_00890 6194 5604 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_00890 7571 6222 gene locus_tag LOCUS_00900 7571 6222 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_00900 8153 7722 gene locus_tag LOCUS_00910 8153 7722 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_00910 8733 8305 gene locus_tag LOCUS_00920 8733 8305 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_00920 9690 8866 gene locus_tag LOCUS_00930 gene fabI 9690 8866 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WC1 protein_id gnl|my_center|LOCUS_00930 10895 9687 gene locus_tag LOCUS_00940 gene fabB 10895 9687 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence008 939 523 gene locus_tag LOCUS_00950 939 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 3220 953 gene locus_tag LOCUS_00960 3220 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 3642 4631 gene locus_tag LOCUS_00970 3642 4631 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084113.1 protein_id gnl|my_center|LOCUS_00970 5098 5589 gene locus_tag LOCUS_00980 5098 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 7099 5729 gene locus_tag LOCUS_00990 gene trmFO 7099 5729 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI8 protein_id gnl|my_center|LOCUS_00990 7193 8566 gene locus_tag LOCUS_01000 7193 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920120.1 protein_id gnl|my_center|LOCUS_01000 8600 9424 gene locus_tag LOCUS_01010 gene gctA 8600 9424 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_01010 9421 10230 gene locus_tag LOCUS_01020 9421 10230 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence009 145 1107 gene locus_tag LOCUS_01030 145 1107 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_01030 1104 1871 gene locus_tag LOCUS_01040 1104 1871 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_01040 1868 2641 gene locus_tag LOCUS_01050 1868 2641 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946557.1 protein_id gnl|my_center|LOCUS_01050 2642 3679 gene locus_tag LOCUS_01060 2642 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_01060 3701 4759 gene locus_tag LOCUS_01070 3701 4759 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_01070 4759 6558 gene locus_tag LOCUS_01080 4759 6558 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_01080 6895 6578 gene locus_tag LOCUS_01090 6895 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707412.1 protein_id gnl|my_center|LOCUS_01090 7181 8239 gene locus_tag LOCUS_01100 gene pyrC 7181 8239 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFU4 protein_id gnl|my_center|LOCUS_01100 8264 9271 gene locus_tag LOCUS_01110 8264 9271 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_01110 9382 9969 gene locus_tag LOCUS_01120 9382 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence010 1633 239 gene locus_tag LOCUS_01130 1633 239 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_01130 3829 1634 gene locus_tag LOCUS_01140 3829 1634 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_01140 6056 3840 gene locus_tag LOCUS_01150 6056 3840 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_01150 6885 6067 gene locus_tag LOCUS_01160 6885 6067 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_01160 7584 6889 gene locus_tag LOCUS_01170 7584 6889 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_01170 8459 7692 gene locus_tag LOCUS_01180 gene phnC 8459 7692 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_01180 9453 8536 gene locus_tag LOCUS_01190 gene phnD 9453 8536 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707869.1 protein_id gnl|my_center|LOCUS_01190 >Feature sequence011 1757 252 gene locus_tag LOCUS_01200 1757 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 2485 1754 gene locus_tag LOCUS_01210 2485 1754 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_01210 2662 3102 gene locus_tag LOCUS_01220 2662 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 3283 3528 gene locus_tag LOCUS_01230 3283 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3614 4126 gene locus_tag LOCUS_01240 3614 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4133 5002 gene locus_tag LOCUS_01250 gene tatC 4133 5002 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_01250 5035 6315 gene locus_tag LOCUS_01260 gene serS 5035 6315 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEQ2 protein_id gnl|my_center|LOCUS_01260 6305 7087 gene locus_tag LOCUS_01270 gene surE 6305 7087 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH6 protein_id gnl|my_center|LOCUS_01270 7084 7722 gene locus_tag LOCUS_01280 gene pcm 7084 7722 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_01280 7976 8743 gene locus_tag LOCUS_01290 7976 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01290 8797 9045 gene locus_tag LOCUS_01300 8797 9045 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532091.1 protein_id gnl|my_center|LOCUS_01300 9097 9801 gene locus_tag LOCUS_01310 9097 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708718.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence012 1850 1380 gene locus_tag LOCUS_01320 1850 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3102 1969 gene locus_tag LOCUS_01330 gene phnW 3102 1969 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NF6 protein_id gnl|my_center|LOCUS_01330 4857 3127 gene locus_tag LOCUS_01340 4857 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5971 4862 gene locus_tag LOCUS_01350 gene fbpC 5971 4862 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJ32 protein_id gnl|my_center|LOCUS_01350 7142 6096 gene locus_tag LOCUS_01360 7142 6096 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_01360 7968 7357 gene locus_tag LOCUS_01370 7968 7357 CDS product pyridoxamine 5'-phosphate oxidase-like FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_01370 9092 7965 gene locus_tag LOCUS_01380 9092 7965 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence013 2397 616 gene locus_tag LOCUS_01390 2397 616 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_01390 3245 2472 gene locus_tag LOCUS_01400 3245 2472 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VK4 protein_id gnl|my_center|LOCUS_01400 3335 3682 gene locus_tag LOCUS_01410 3335 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44515 protein_id gnl|my_center|LOCUS_01410 5326 3947 gene locus_tag LOCUS_01420 5326 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 7397 6000 gene locus_tag LOCUS_01430 7397 6000 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_01430 7480 8160 gene locus_tag LOCUS_01440 7480 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence014 398 889 gene locus_tag LOCUS_01450 398 889 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_01450 1304 900 gene locus_tag LOCUS_01460 1304 900 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_01460 3810 1318 gene locus_tag LOCUS_01470 3810 1318 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971462.1 protein_id gnl|my_center|LOCUS_01470 5154 4315 gene locus_tag LOCUS_01480 5154 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 5272 5979 gene locus_tag LOCUS_01490 5272 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410610.1 protein_id gnl|my_center|LOCUS_01490 6102 7634 gene locus_tag LOCUS_01500 6102 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388309.1 protein_id gnl|my_center|LOCUS_01500 7710 8318 gene locus_tag LOCUS_01510 7710 8318 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence015 498 61 gene locus_tag LOCUS_01520 gene fliX 498 61 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 protein_id gnl|my_center|LOCUS_01520 622 422 gene locus_tag LOCUS_01530 622 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 848 2446 gene locus_tag LOCUS_01540 gene flgE 848 2446 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P9 protein_id gnl|my_center|LOCUS_01540 2773 2997 gene locus_tag LOCUS_01550 2773 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3722 3015 gene locus_tag LOCUS_01560 3722 3015 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_01560 4077 3922 gene locus_tag LOCUS_01570 4077 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4027 4350 gene locus_tag LOCUS_01580 4027 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5204 4485 gene locus_tag LOCUS_01590 5204 4485 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084981.1 protein_id gnl|my_center|LOCUS_01590 5373 7103 gene locus_tag LOCUS_01600 5373 7103 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence016 151 1662 gene locus_tag LOCUS_01610 151 1662 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU48 protein_id gnl|my_center|LOCUS_01610 1691 3157 gene locus_tag LOCUS_01620 1691 3157 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389423.1 protein_id gnl|my_center|LOCUS_01620 3249 3333 gene locus_tag LOCUS_t00010 3249 3333 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3368 4807 gene locus_tag LOCUS_01630 gene tig 3368 4807 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_01630 4824 5498 gene locus_tag LOCUS_01640 gene clpP 4824 5498 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 protein_id gnl|my_center|LOCUS_01640 5714 6979 gene locus_tag LOCUS_01650 gene clpX 5714 6979 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 protein_id gnl|my_center|LOCUS_01650 >Feature sequence017 1910 222 gene locus_tag LOCUS_01660 1910 222 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969974.1 protein_id gnl|my_center|LOCUS_01660 2972 1929 gene locus_tag LOCUS_01670 2972 1929 CDS product LAO/AO ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969975.1 protein_id gnl|my_center|LOCUS_01670 4396 2969 gene locus_tag LOCUS_01680 4396 2969 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_01680 4836 4423 gene locus_tag LOCUS_01690 4836 4423 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_01690 5386 4844 gene locus_tag LOCUS_01700 5386 4844 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_01700 6100 5411 gene locus_tag LOCUS_01710 6100 5411 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920935.1 protein_id gnl|my_center|LOCUS_01710 6249 7838 gene locus_tag LOCUS_01720 6249 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 8243 7908 gene locus_tag LOCUS_01730 8243 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8902 8321 gene locus_tag LOCUS_01740 8902 8321 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence018 1596 190 gene locus_tag LOCUS_01750 1596 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_01750 3449 1593 gene locus_tag LOCUS_01760 3449 1593 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_01760 4651 3629 gene locus_tag LOCUS_01770 4651 3629 CDS product TRAP ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_01770 5623 6420 gene locus_tag LOCUS_01780 gene pyrK 5623 6420 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HES9 protein_id gnl|my_center|LOCUS_01780 6414 7394 gene locus_tag LOCUS_01790 gene pyrD 6414 7394 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGM0 protein_id gnl|my_center|LOCUS_01790 7375 8232 gene locus_tag LOCUS_01800 7375 8232 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707175.1 protein_id gnl|my_center|LOCUS_01800 8225 8707 gene locus_tag LOCUS_01810 8225 8707 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088978.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence019 1092 964 gene locus_tag LOCUS_01820 1092 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 1361 1954 gene locus_tag LOCUS_01830 1361 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2424 1984 gene locus_tag LOCUS_01840 2424 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01840 2817 2425 gene locus_tag LOCUS_01850 2817 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01850 3183 4571 gene locus_tag LOCUS_01860 3183 4571 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_01860 4784 5995 gene locus_tag LOCUS_01870 4784 5995 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD7 protein_id gnl|my_center|LOCUS_01870 6176 8806 gene locus_tag LOCUS_01880 6176 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence020 2046 586 gene locus_tag LOCUS_01890 2046 586 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_01890 2236 3546 gene locus_tag LOCUS_01900 2236 3546 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056263.1 protein_id gnl|my_center|LOCUS_01900 3549 3995 gene locus_tag LOCUS_01910 gene dtd 3549 3995 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 protein_id gnl|my_center|LOCUS_01910 5576 4668 gene locus_tag LOCUS_01920 5576 4668 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 protein_id gnl|my_center|LOCUS_01920 5660 8122 gene locus_tag LOCUS_01930 5660 8122 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887734.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence021 393 1046 gene locus_tag LOCUS_01940 393 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_01940 1048 2430 gene locus_tag LOCUS_01950 1048 2430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_01950 3815 2484 gene locus_tag LOCUS_01960 3815 2484 CDS product polynucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388119.1 protein_id gnl|my_center|LOCUS_01960 4127 3840 gene locus_tag LOCUS_01970 4127 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4718 4128 gene locus_tag LOCUS_01980 4718 4128 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972174.1 protein_id gnl|my_center|LOCUS_01980 5305 4715 gene locus_tag LOCUS_01990 5305 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388121.1 protein_id gnl|my_center|LOCUS_01990 5346 6368 gene locus_tag LOCUS_02000 5346 6368 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388122.1 protein_id gnl|my_center|LOCUS_02000 6379 7302 gene locus_tag LOCUS_02010 6379 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence022 74 310 gene locus_tag LOCUS_02020 gene rpsQ 74 310 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW9 protein_id gnl|my_center|LOCUS_02020 348 716 gene locus_tag LOCUS_02030 gene rplN 348 716 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ0 protein_id gnl|my_center|LOCUS_02030 716 1039 gene locus_tag LOCUS_02040 gene rplX 716 1039 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_02040 1055 1816 gene locus_tag LOCUS_02050 1055 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1809 2114 gene locus_tag LOCUS_02060 gene rpsN 1809 2114 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J97 protein_id gnl|my_center|LOCUS_02060 2128 2526 gene locus_tag LOCUS_02070 gene rpsH 2128 2526 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_02070 2557 3090 gene locus_tag LOCUS_02080 gene rplF 2557 3090 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX5 protein_id gnl|my_center|LOCUS_02080 3090 3452 gene locus_tag LOCUS_02090 gene rplR 3090 3452 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA0 protein_id gnl|my_center|LOCUS_02090 3463 4113 gene locus_tag LOCUS_02100 gene rpsE 3463 4113 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX7 protein_id gnl|my_center|LOCUS_02100 4118 4315 gene locus_tag LOCUS_02110 gene rpmD 4118 4315 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 protein_id gnl|my_center|LOCUS_02110 4334 4993 gene locus_tag LOCUS_02120 4334 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 5003 6343 gene locus_tag LOCUS_02130 gene secY 5003 6343 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_02130 6343 6987 gene locus_tag LOCUS_02140 gene adk 6343 6987 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 protein_id gnl|my_center|LOCUS_02140 7116 7490 gene locus_tag LOCUS_02150 gene rpsM 7116 7490 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U881 protein_id gnl|my_center|LOCUS_02150 7510 7902 gene locus_tag LOCUS_02160 gene rpsK 7510 7902 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY3 protein_id gnl|my_center|LOCUS_02160 >Feature sequence023 644 2074 gene locus_tag LOCUS_02170 644 2074 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_02170 3462 2095 gene locus_tag LOCUS_02180 3462 2095 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_02180 4254 3499 gene locus_tag LOCUS_02190 4254 3499 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWX0 protein_id gnl|my_center|LOCUS_02190 4322 5242 gene locus_tag LOCUS_02200 gene ubiA 4322 5242 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 protein_id gnl|my_center|LOCUS_02200 5743 5246 gene locus_tag LOCUS_02210 5743 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6546 5821 gene locus_tag LOCUS_02220 6546 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 <8140 6554 gene locus_tag LOCUS_02230 <8140 6554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:phosphodiesterase >Feature sequence024 3065 1134 gene locus_tag LOCUS_02240 3065 1134 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_02240 4657 3071 gene locus_tag LOCUS_02250 4657 3071 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_02250 5430 4669 gene locus_tag LOCUS_02260 5430 4669 CDS product Hdr menaquinol oxidoreductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_02260 5815 5483 gene locus_tag LOCUS_02270 gene tusE 5815 5483 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEK2 protein_id gnl|my_center|LOCUS_02270 6176 5856 gene locus_tag LOCUS_02280 gene dsrH 6176 5856 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_02280 6565 6173 gene locus_tag LOCUS_02290 gene dsrF 6565 6173 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_02290 6935 6576 gene locus_tag LOCUS_02300 gene tusD 6935 6576 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRJ4 protein_id gnl|my_center|LOCUS_02300 7852 6965 gene locus_tag LOCUS_02310 gene dsrB-1 7852 6965 CDS product sulfite reductase, dissimilatory-type beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence025 1262 381 gene locus_tag LOCUS_02320 1262 381 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_02320 1325 2518 gene locus_tag LOCUS_02330 1325 2518 CDS product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_02330 2540 2944 gene locus_tag LOCUS_02340 2540 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4092 2941 gene locus_tag LOCUS_02350 4092 2941 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_02350 4563 4162 gene locus_tag LOCUS_02360 4563 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5497 4820 gene locus_tag LOCUS_02370 5497 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708718.1 protein_id gnl|my_center|LOCUS_02370 6805 5579 gene locus_tag LOCUS_02380 6805 5579 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_02380 7842 7213 gene locus_tag LOCUS_02390 7842 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence026 454 14 gene locus_tag LOCUS_02400 454 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 621 1589 gene locus_tag LOCUS_02410 621 1589 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_02410 1615 2553 gene locus_tag LOCUS_02420 1615 2553 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_02420 3300 2569 gene locus_tag LOCUS_02430 3300 2569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_02430 4015 3290 gene locus_tag LOCUS_02440 4015 3290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_02440 4965 4012 gene locus_tag LOCUS_02450 4965 4012 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_02450 5838 4966 gene locus_tag LOCUS_02460 5838 4966 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_02460 7137 5866 gene locus_tag LOCUS_02470 7137 5866 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence027 363 157 gene locus_tag LOCUS_02480 363 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1292 555 gene locus_tag LOCUS_02490 gene truA 1292 555 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNZ9 protein_id gnl|my_center|LOCUS_02490 1617 2660 gene locus_tag LOCUS_02500 1617 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_02500 3663 2728 gene locus_tag LOCUS_02510 gene fmt 3663 2728 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP00 protein_id gnl|my_center|LOCUS_02510 4207 3692 gene locus_tag LOCUS_02520 gene def 4207 3692 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP01 protein_id gnl|my_center|LOCUS_02520 4286 5377 gene locus_tag LOCUS_02530 4286 5377 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_02530 5978 5385 gene locus_tag LOCUS_02540 gene recR 5978 5385 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_02540 6316 5993 gene locus_tag LOCUS_02550 6316 5993 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM9 protein_id gnl|my_center|LOCUS_02550 6378 7208 gene locus_tag LOCUS_02560 6378 7208 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_02560 <7770 7205 gene locus_tag LOCUS_02570 <7770 7205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391220.1:DNA polymerase III subunit gamma/tau >Feature sequence028 <1 687 gene locus_tag LOCUS_02580 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920340.1:non-motile and phage-resistance protein 1041 4535 gene locus_tag LOCUS_02590 1041 4535 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_02590 4795 5790 gene locus_tag LOCUS_02600 4795 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5836 6762 gene locus_tag LOCUS_02610 gene tsf 5836 6762 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_02610 6896 7612 gene locus_tag LOCUS_02620 gene pyrH 6896 7612 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 protein_id gnl|my_center|LOCUS_02620 >Feature sequence029 1453 113 gene locus_tag LOCUS_02630 gene pcaB 1453 113 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_02630 2421 1510 gene locus_tag LOCUS_02640 2421 1510 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_02640 5215 2435 gene locus_tag LOCUS_02650 5215 2435 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_02650 5715 6476 gene locus_tag LOCUS_02660 5715 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7446 6496 gene locus_tag LOCUS_02670 7446 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence030 1161 145 gene locus_tag LOCUS_02680 1161 145 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_02680 1537 1761 gene locus_tag LOCUS_02690 1537 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085319.1 protein_id gnl|my_center|LOCUS_02690 1745 2518 gene locus_tag LOCUS_02700 1745 2518 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_02700 3248 2529 gene locus_tag LOCUS_02710 3248 2529 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_02710 3399 3683 gene locus_tag LOCUS_02720 3399 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3771 4661 gene locus_tag LOCUS_02730 gene glyQ 3771 4661 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_02730 4665 6776 gene locus_tag LOCUS_02740 gene glyS 4665 6776 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ43 protein_id gnl|my_center|LOCUS_02740 >Feature sequence031 2463 2041 gene locus_tag LOCUS_02750 2463 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2496 3173 gene locus_tag LOCUS_02760 2496 3173 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809168.1 protein_id gnl|my_center|LOCUS_02760 3863 3180 gene locus_tag LOCUS_02770 3863 3180 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_02770 4128 4508 gene locus_tag LOCUS_02780 4128 4508 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_02780 5310 4522 gene locus_tag LOCUS_02790 5310 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5191 5562 gene locus_tag LOCUS_02800 5191 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5677 5763 gene locus_tag LOCUS_t00020 5677 5763 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5796 6422 gene locus_tag LOCUS_02810 5796 6422 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence032 1079 744 gene locus_tag LOCUS_02820 1079 744 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 protein_id gnl|my_center|LOCUS_02820 1008 1211 gene locus_tag LOCUS_02830 1008 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1642 2649 gene locus_tag LOCUS_02840 1642 2649 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW8 protein_id gnl|my_center|LOCUS_02840 3503 2739 gene locus_tag LOCUS_02850 gene motB 3503 2739 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418111.1 protein_id gnl|my_center|LOCUS_02850 4309 3503 gene locus_tag LOCUS_02860 gene pomA 4309 3503 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086581.1 protein_id gnl|my_center|LOCUS_02860 4430 4861 gene locus_tag LOCUS_02870 4430 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4869 5504 gene locus_tag LOCUS_02880 gene thiE 4869 5504 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_02880 5601 6170 gene locus_tag LOCUS_02890 gene efp 5601 6170 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_02890 6175 6972 gene locus_tag LOCUS_02900 6175 6972 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence033 254 1267 gene locus_tag LOCUS_02910 254 1267 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA8 protein_id gnl|my_center|LOCUS_02910 1859 1353 gene locus_tag LOCUS_02920 1859 1353 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_02920 2125 1880 gene locus_tag LOCUS_02930 2125 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3477 2260 gene locus_tag LOCUS_02940 3477 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3683 6076 gene locus_tag LOCUS_02950 3683 6076 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_02950 6083 7315 gene locus_tag LOCUS_02960 6083 7315 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence034 271 1332 gene locus_tag LOCUS_02970 271 1332 CDS product TPP-dependent acetoin dehydrogenase complex, E1 protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_02970 1333 2496 gene locus_tag LOCUS_02980 gene rfbH 1333 2496 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_02980 2523 3467 gene locus_tag LOCUS_02990 2523 3467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_02990 3624 4355 gene locus_tag LOCUS_03000 gene hddC 3624 4355 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_03000 4397 5065 gene locus_tag LOCUS_03010 4397 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5077 5892 gene locus_tag LOCUS_03020 5077 5892 CDS product transketolase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228762.1 protein_id gnl|my_center|LOCUS_03020 5889 6836 gene locus_tag LOCUS_03030 5889 6836 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_03030 <7404 6843 gene locus_tag LOCUS_03040 <7404 6843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881241.1:dolichol-phosphate mannosyltransferase >Feature sequence035 347 144 gene locus_tag LOCUS_03050 347 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 457 1098 gene locus_tag LOCUS_03060 gene def 457 1098 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB26 protein_id gnl|my_center|LOCUS_03060 1091 1726 gene locus_tag LOCUS_03070 1091 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_03070 2009 2884 gene locus_tag LOCUS_03080 2009 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 3396 2905 gene locus_tag LOCUS_03090 gene purE 3396 2905 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFL8 protein_id gnl|my_center|LOCUS_03090 3563 4351 gene locus_tag LOCUS_03100 3563 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4584 4384 gene locus_tag LOCUS_03110 4584 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_03110 4750 4917 gene locus_tag LOCUS_03120 4750 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6662 5022 gene locus_tag LOCUS_03130 6662 5022 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence036 <1 774 gene locus_tag LOCUS_03140 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXE6:arginine biosynthesis bifunctional protein ArgJ 755 1216 gene locus_tag LOCUS_03150 gene mutT 755 1216 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_03150 1233 2003 gene locus_tag LOCUS_03160 1233 2003 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_03160 2027 2536 gene locus_tag LOCUS_03170 2027 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3250 2564 gene locus_tag LOCUS_03180 3250 2564 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_03180 3329 3415 gene locus_tag LOCUS_t00030 3329 3415 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3862 3449 gene locus_tag LOCUS_03190 3862 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4019 4441 gene locus_tag LOCUS_03200 4019 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4476 5120 gene locus_tag LOCUS_03210 4476 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5356 5961 gene locus_tag LOCUS_03220 5356 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_03220 5961 6479 gene locus_tag LOCUS_03230 5961 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence037 1342 1692 gene locus_tag LOCUS_03240 1342 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1810 2343 gene locus_tag LOCUS_03250 1810 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2359 2907 gene locus_tag LOCUS_03260 gene ppiB 2359 2907 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_03260 4243 2930 gene locus_tag LOCUS_03270 4243 2930 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_03270 <7135 4408 gene locus_tag LOCUS_03280 <7135 4408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6U9N4:alanine--tRNA ligase >Feature sequence038 1000 200 gene locus_tag LOCUS_03290 1000 200 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868856.1 protein_id gnl|my_center|LOCUS_03290 1141 1884 gene locus_tag LOCUS_03300 1141 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 protein_id gnl|my_center|LOCUS_03300 2755 1886 gene locus_tag LOCUS_03310 gene ada 2755 1886 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973869.1 protein_id gnl|my_center|LOCUS_03310 4803 2848 gene locus_tag LOCUS_03320 gene htpG 4803 2848 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYB8 protein_id gnl|my_center|LOCUS_03320 4929 5618 gene locus_tag LOCUS_03330 gene pcm 4929 5618 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_03330 >Feature sequence039 2418 388 gene locus_tag LOCUS_03340 2418 388 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_03340 3823 2462 gene locus_tag LOCUS_03350 3823 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 3982 4671 gene locus_tag LOCUS_03360 gene pyrE 3982 4671 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD8 protein_id gnl|my_center|LOCUS_03360 4687 5256 gene locus_tag LOCUS_03370 4687 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5266 6942 gene locus_tag LOCUS_03380 5266 6942 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence040 3566 558 gene locus_tag LOCUS_03390 gene glnE 3566 558 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 protein_id gnl|my_center|LOCUS_03390 3831 3559 gene locus_tag LOCUS_03400 3831 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 3830 6943 gene locus_tag LOCUS_03410 3830 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence041 1 879 gene locus_tag LOCUS_03420 1 879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388147.1 protein_id gnl|my_center|LOCUS_03420 2666 918 gene locus_tag LOCUS_03430 2666 918 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_03430 2743 4566 gene locus_tag LOCUS_03440 2743 4566 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_03440 4844 5425 gene locus_tag LOCUS_03450 4844 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5422 5817 gene locus_tag LOCUS_03460 5422 5817 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_03460 6035 6652 gene locus_tag LOCUS_03470 6035 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence042 2289 1036 gene locus_tag LOCUS_03480 2289 1036 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_03480 3185 2289 gene locus_tag LOCUS_03490 3185 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03490 4372 3191 gene locus_tag LOCUS_03500 4372 3191 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056830.1 protein_id gnl|my_center|LOCUS_03500 5267 4377 gene locus_tag LOCUS_03510 5267 4377 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_03510 5848 5267 gene locus_tag LOCUS_03520 5848 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 6740 6018 gene locus_tag LOCUS_03530 6740 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence043 1034 489 gene locus_tag LOCUS_03540 1034 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530298.1 protein_id gnl|my_center|LOCUS_03540 1906 1085 gene locus_tag LOCUS_03550 1906 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390709.1 protein_id gnl|my_center|LOCUS_03550 3718 1910 gene locus_tag LOCUS_03560 gene mutL 3718 1910 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ52 protein_id gnl|my_center|LOCUS_03560 5400 3715 gene locus_tag LOCUS_03570 gene pgi 5400 3715 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ51 protein_id gnl|my_center|LOCUS_03570 6834 5488 gene locus_tag LOCUS_03580 6834 5488 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence044 <1 551 gene locus_tag LOCUS_03590 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXU6:inosine-5'-monophosphate dehydrogenase 571 1890 gene locus_tag LOCUS_03600 571 1890 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_03600 2222 2395 gene locus_tag LOCUS_03610 2222 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2509 2631 gene locus_tag LOCUS_03620 2509 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3220 2762 gene locus_tag LOCUS_03630 gene msrA 3220 2762 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747V4 protein_id gnl|my_center|LOCUS_03630 3449 4561 gene locus_tag LOCUS_03640 3449 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_03640 4724 5146 gene locus_tag LOCUS_03650 4724 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5157 5546 gene locus_tag LOCUS_03660 5157 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 5558 5962 gene locus_tag LOCUS_03670 5558 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 6167 5931 gene locus_tag LOCUS_03680 6167 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence045 <1 775 gene locus_tag LOCUS_03690 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RT68:lipoyl synthase 781 1245 gene locus_tag LOCUS_03700 781 1245 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_03700 1250 2008 gene locus_tag LOCUS_03710 1250 2008 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103289.1 protein_id gnl|my_center|LOCUS_03710 2061 2399 gene locus_tag LOCUS_03720 2061 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2901 2413 gene locus_tag LOCUS_03730 2901 2413 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969234.1 protein_id gnl|my_center|LOCUS_03730 3388 2903 gene locus_tag LOCUS_03740 3388 2903 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389622.1 protein_id gnl|my_center|LOCUS_03740 3900 5120 gene locus_tag LOCUS_03750 3900 5120 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_03750 5104 5616 gene locus_tag LOCUS_03760 5104 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 6641 5613 gene locus_tag LOCUS_03770 6641 5613 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_03770 6771 6625 gene locus_tag LOCUS_03780 6771 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence046 1584 2828 gene locus_tag LOCUS_03790 1584 2828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390165.1 protein_id gnl|my_center|LOCUS_03790 2897 4120 gene locus_tag LOCUS_03800 2897 4120 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_03800 4117 5409 gene locus_tag LOCUS_03810 4117 5409 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_03810 5448 6425 gene locus_tag LOCUS_03820 5448 6425 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H0 protein_id gnl|my_center|LOCUS_03820 >Feature sequence047 580 882 gene locus_tag LOCUS_03830 580 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_03830 1729 890 gene locus_tag LOCUS_03840 1729 890 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXT9 protein_id gnl|my_center|LOCUS_03840 2739 1735 gene locus_tag LOCUS_03850 2739 1735 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_03850 4264 2765 gene locus_tag LOCUS_03860 4264 2765 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_03860 4725 4264 gene locus_tag LOCUS_03870 4725 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 5810 4824 gene locus_tag LOCUS_03880 5810 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_03880 6247 5852 gene locus_tag LOCUS_03890 6247 5852 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892844.1 protein_id gnl|my_center|LOCUS_03890 6373 6639 gene locus_tag LOCUS_03900 6373 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence048 793 314 gene locus_tag LOCUS_03910 793 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2297 780 gene locus_tag LOCUS_03920 2297 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03920 3333 2371 gene locus_tag LOCUS_03930 3333 2371 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 protein_id gnl|my_center|LOCUS_03930 4917 3583 gene locus_tag LOCUS_03940 4917 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5583 5843 gene locus_tag LOCUS_03950 5583 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence049 331 951 gene locus_tag LOCUS_03960 331 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1187 1858 gene locus_tag LOCUS_03970 1187 1858 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_03970 1855 2454 gene locus_tag LOCUS_03980 1855 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939177.1 protein_id gnl|my_center|LOCUS_03980 3048 2521 gene locus_tag LOCUS_03990 3048 2521 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_03990 4915 3032 gene locus_tag LOCUS_04000 4915 3032 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_04000 5871 5044 gene locus_tag LOCUS_04010 5871 5044 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence050 555 169 gene locus_tag LOCUS_04020 555 169 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_04020 1040 552 gene locus_tag LOCUS_04030 1040 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 1803 1123 gene locus_tag LOCUS_04040 1803 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_04040 3233 1800 gene locus_tag LOCUS_04050 3233 1800 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_04050 3939 3250 gene locus_tag LOCUS_04060 3939 3250 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04060 5244 4099 gene locus_tag LOCUS_04070 5244 4099 CDS product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CK4 protein_id gnl|my_center|LOCUS_04070 6022 5288 gene locus_tag LOCUS_04080 6022 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence051 48 1133 gene locus_tag LOCUS_04090 48 1133 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_04090 1147 2379 gene locus_tag LOCUS_04100 gene recF 1147 2379 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI7 protein_id gnl|my_center|LOCUS_04100 2415 5018 gene locus_tag LOCUS_04110 gene gyrB 2415 5018 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI6 protein_id gnl|my_center|LOCUS_04110 >Feature sequence052 318 638 gene locus_tag LOCUS_04120 318 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 696 947 gene locus_tag LOCUS_04130 696 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 948 3722 gene locus_tag LOCUS_04140 948 3722 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_04140 5289 3706 gene locus_tag LOCUS_04150 5289 3706 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_04150 5421 5603 gene locus_tag LOCUS_04160 5421 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence053 69 2081 gene locus_tag LOCUS_04170 69 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3670 2108 gene locus_tag LOCUS_04180 3670 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_04180 4573 3680 gene locus_tag LOCUS_04190 4573 3680 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_04190 <6334 4573 gene locus_tag LOCUS_04200 <6334 4573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J4N8:DNA helicase >Feature sequence054 123 1844 gene locus_tag LOCUS_04210 123 1844 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_04210 1841 2977 gene locus_tag LOCUS_04220 1841 2977 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975333.1 protein_id gnl|my_center|LOCUS_04220 3034 3438 gene locus_tag LOCUS_04230 3034 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 3811 5334 gene locus_tag LOCUS_04240 3811 5334 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAZ4 protein_id gnl|my_center|LOCUS_04240 >Feature sequence055 <1 788 gene locus_tag LOCUS_04250 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha 1223 864 gene locus_tag LOCUS_04260 1223 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1461 1306 gene locus_tag LOCUS_04270 1461 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2653 1547 gene locus_tag LOCUS_04280 2653 1547 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 protein_id gnl|my_center|LOCUS_04280 2991 2707 gene locus_tag LOCUS_04290 2991 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3693 3097 gene locus_tag LOCUS_04300 3693 3097 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 protein_id gnl|my_center|LOCUS_04300 <6269 3712 gene locus_tag LOCUS_04310 <6269 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453899.1:formate dehydrogenase >Feature sequence056 198 965 gene locus_tag LOCUS_04320 198 965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_04320 1873 962 gene locus_tag LOCUS_04330 1873 962 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 protein_id gnl|my_center|LOCUS_04330 1956 2927 gene locus_tag LOCUS_04340 1956 2927 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533036.1 protein_id gnl|my_center|LOCUS_04340 3071 3727 gene locus_tag LOCUS_04350 3071 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4458 3790 gene locus_tag LOCUS_04360 4458 3790 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_04360 4693 5664 gene locus_tag LOCUS_04370 gene msrP 4693 5664 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_04370 >Feature sequence057 551 111 gene locus_tag LOCUS_04380 551 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 1964 603 gene locus_tag LOCUS_04390 gene bamB 1964 603 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV98 protein_id gnl|my_center|LOCUS_04390 2657 1989 gene locus_tag LOCUS_04400 2657 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3416 2763 gene locus_tag LOCUS_04410 3416 2763 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_04410 3875 3465 gene locus_tag LOCUS_04420 3875 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4233 4544 gene locus_tag LOCUS_04430 4233 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 4619 5332 gene locus_tag LOCUS_04440 4619 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence058 329 1330 gene locus_tag LOCUS_04450 329 1330 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_04450 1911 1327 gene locus_tag LOCUS_04460 1911 1327 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_04460 3139 1931 gene locus_tag LOCUS_04470 3139 1931 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_04470 5190 3226 gene locus_tag LOCUS_04480 gene acsA2 5190 3226 CDS product acetoacetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R3 protein_id gnl|my_center|LOCUS_04480 5347 5739 gene locus_tag LOCUS_04490 5347 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence059 <1 953 gene locus_tag LOCUS_04500 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMT1:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase note possible pseudo, internal stop codon 950 2002 gene locus_tag LOCUS_04510 950 2002 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527679.1 protein_id gnl|my_center|LOCUS_04510 1989 2561 gene locus_tag LOCUS_04520 gene ybeY 1989 2561 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX09 protein_id gnl|my_center|LOCUS_04520 2690 3511 gene locus_tag LOCUS_04530 2690 3511 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_04530 3511 5145 gene locus_tag LOCUS_04540 gene lnt 3511 5145 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 protein_id gnl|my_center|LOCUS_04540 >Feature sequence060 88 3834 gene locus_tag LOCUS_04550 88 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4145 3891 gene locus_tag LOCUS_04560 4145 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 4780 4142 gene locus_tag LOCUS_04570 4780 4142 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941851.1 protein_id gnl|my_center|LOCUS_04570 5403 4786 gene locus_tag LOCUS_04580 5403 4786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence061 273 1052 gene locus_tag LOCUS_04590 273 1052 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP8 protein_id gnl|my_center|LOCUS_04590 1131 2138 gene locus_tag LOCUS_04600 1131 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2453 3448 gene locus_tag LOCUS_04610 2453 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3494 3805 gene locus_tag LOCUS_04620 3494 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3945 4877 gene locus_tag LOCUS_04630 gene prs 3945 4877 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 protein_id gnl|my_center|LOCUS_04630 >Feature sequence062 2065 830 gene locus_tag LOCUS_04640 2065 830 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_04640 2760 2218 gene locus_tag LOCUS_04650 2760 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389320.1 protein_id gnl|my_center|LOCUS_04650 3139 2966 gene locus_tag LOCUS_04660 3139 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4504 3647 gene locus_tag LOCUS_04670 4504 3647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_04670 5032 4538 gene locus_tag LOCUS_04680 gene omp 5032 4538 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_04680 5434 5081 gene locus_tag LOCUS_04690 5434 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence063 513 2027 gene locus_tag LOCUS_04700 513 2027 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G3 protein_id gnl|my_center|LOCUS_04700 2158 3921 gene locus_tag LOCUS_04710 2158 3921 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_04710 5028 3979 gene locus_tag LOCUS_04720 5028 3979 CDS product signal protein PDZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530631.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence064 1658 720 gene locus_tag LOCUS_04730 1658 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1964 1782 gene locus_tag LOCUS_04740 1964 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2279 2761 gene locus_tag LOCUS_04750 gene ssb 2279 2761 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L50 protein_id gnl|my_center|LOCUS_04750 3001 5052 gene locus_tag LOCUS_04760 3001 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence065 468 1373 gene locus_tag LOCUS_04770 468 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2177 1386 gene locus_tag LOCUS_04780 2177 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2338 3090 gene locus_tag LOCUS_04790 2338 3090 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_04790 4041 3163 gene locus_tag LOCUS_04800 4041 3163 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRP1 protein_id gnl|my_center|LOCUS_04800 4947 4042 gene locus_tag LOCUS_04810 4947 4042 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRP1 protein_id gnl|my_center|LOCUS_04810 <5525 4977 gene locus_tag LOCUS_04820 <5525 4977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RRP5:ribulose bisphosphate carboxylase >Feature sequence066 1541 141 gene locus_tag LOCUS_04830 gene cbiA 1541 141 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI09 protein_id gnl|my_center|LOCUS_04830 2564 1560 gene locus_tag LOCUS_04840 2564 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_04840 3802 2561 gene locus_tag LOCUS_04850 3802 2561 CDS product Hdr menaquinol oxidoreductase integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_04850 4551 3805 gene locus_tag LOCUS_04860 4551 3805 CDS product Hdr menaquinol oxidoreductase iron-sulfur subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_04860 4997 4548 gene locus_tag LOCUS_04870 4997 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 <5524 5005 gene locus_tag LOCUS_04880 <5524 5005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933900.1:glutamate synthase >Feature sequence067 2366 2004 gene locus_tag LOCUS_04890 2366 2004 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_04890 2719 2381 gene locus_tag LOCUS_04900 gene hisE 2719 2381 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA8 protein_id gnl|my_center|LOCUS_04900 3506 2733 gene locus_tag LOCUS_04910 gene hisF 3506 2733 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 protein_id gnl|my_center|LOCUS_04910 4231 3506 gene locus_tag LOCUS_04920 gene hisA 4231 3506 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_04920 4872 4228 gene locus_tag LOCUS_04930 gene hisH 4872 4228 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_04930 5270 4869 gene locus_tag LOCUS_04940 5270 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence068 46 735 gene locus_tag LOCUS_04950 46 735 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN03 protein_id gnl|my_center|LOCUS_04950 1614 925 gene locus_tag LOCUS_04960 gene mtrA 1614 925 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505216.1 protein_id gnl|my_center|LOCUS_04960 1754 2917 gene locus_tag LOCUS_04970 1754 2917 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_04970 3105 4280 gene locus_tag LOCUS_04980 3105 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4308 4808 gene locus_tag LOCUS_04990 4308 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_04990 5484 4795 gene locus_tag LOCUS_05000 5484 4795 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence069 692 42 gene locus_tag LOCUS_05010 692 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 789 1580 gene locus_tag LOCUS_05020 gene kdsB 789 1580 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPI7 protein_id gnl|my_center|LOCUS_05020 1597 2460 gene locus_tag LOCUS_05030 1597 2460 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_05030 3496 2465 gene locus_tag LOCUS_05040 3496 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3641 4156 gene locus_tag LOCUS_05050 3641 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence070 1743 310 gene locus_tag LOCUS_05060 1743 310 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_05060 2906 1740 gene locus_tag LOCUS_05070 gene ntrB 2906 1740 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_05070 3894 2908 gene locus_tag LOCUS_05080 gene dus 3894 2908 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_05080 4813 4010 gene locus_tag LOCUS_05090 4813 4010 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389365.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence071 1205 417 gene locus_tag LOCUS_05100 1205 417 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_05100 1982 1218 gene locus_tag LOCUS_05110 gene purQ 1982 1218 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IB6 protein_id gnl|my_center|LOCUS_05110 2238 1993 gene locus_tag LOCUS_05120 gene purS 2238 1993 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_05120 3005 2235 gene locus_tag LOCUS_05130 gene purC 3005 2235 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI0 protein_id gnl|my_center|LOCUS_05130 3933 3133 gene locus_tag LOCUS_05140 3933 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_05140 4025 4366 gene locus_tag LOCUS_05150 4025 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088474.1 protein_id gnl|my_center|LOCUS_05150 <5397 4477 gene locus_tag LOCUS_05160 <5397 4477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CIJ9:adenylosuccinate lyase >Feature sequence072 677 1435 gene locus_tag LOCUS_05170 677 1435 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_05170 1435 2274 gene locus_tag LOCUS_05180 1435 2274 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 protein_id gnl|my_center|LOCUS_05180 3049 2267 gene locus_tag LOCUS_05190 3049 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205421.1 protein_id gnl|my_center|LOCUS_05190 4110 3121 gene locus_tag LOCUS_05200 4110 3121 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_05200 4251 5225 gene locus_tag LOCUS_05210 gene ispH 4251 5225 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence073 <1 593 gene locus_tag LOCUS_05220 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV10:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 653 1864 gene locus_tag LOCUS_05230 653 1864 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067223.1 protein_id gnl|my_center|LOCUS_05230 1875 3194 gene locus_tag LOCUS_05240 1875 3194 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_05240 3268 4899 gene locus_tag LOCUS_05250 3268 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence074 947 768 gene locus_tag LOCUS_05260 947 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2075 999 gene locus_tag LOCUS_05270 2075 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2462 2085 gene locus_tag LOCUS_05280 2462 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2638 3270 gene locus_tag LOCUS_05290 2638 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4258 3275 gene locus_tag LOCUS_05300 4258 3275 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_05300 4380 4943 gene locus_tag LOCUS_05310 4380 4943 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence075 299 565 gene locus_tag LOCUS_05320 gene dksA 299 565 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338037.1 protein_id gnl|my_center|LOCUS_05320 1186 587 gene locus_tag LOCUS_05330 1186 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1221 1964 gene locus_tag LOCUS_05340 gene sfsA 1221 1964 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF6 protein_id gnl|my_center|LOCUS_05340 1987 2808 gene locus_tag LOCUS_05350 gene map 1987 2808 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_05350 2824 3519 gene locus_tag LOCUS_05360 2824 3519 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_05360 3516 4718 gene locus_tag LOCUS_05370 3516 4718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence076 1124 114 gene locus_tag LOCUS_05380 1124 114 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_05380 2100 1129 gene locus_tag LOCUS_05390 2100 1129 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029017.1 protein_id gnl|my_center|LOCUS_05390 2245 2700 gene locus_tag LOCUS_05400 2245 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2697 3692 gene locus_tag LOCUS_05410 2697 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 4443 3757 gene locus_tag LOCUS_05420 4443 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4652 4461 gene locus_tag LOCUS_05430 4652 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4605 4901 gene locus_tag LOCUS_05440 4605 4901 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence077 202 384 gene locus_tag LOCUS_05450 202 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 595 3012 gene locus_tag LOCUS_05460 595 3012 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_05460 2972 3523 gene locus_tag LOCUS_05470 2972 3523 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_05470 3516 4541 gene locus_tag LOCUS_05480 3516 4541 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence078 288 1619 gene locus_tag LOCUS_05490 288 1619 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_05490 1661 3448 gene locus_tag LOCUS_05500 1661 3448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_05500 3445 4494 gene locus_tag LOCUS_05510 3445 4494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence079 430 1461 gene locus_tag LOCUS_05520 430 1461 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 protein_id gnl|my_center|LOCUS_05520 2110 1514 gene locus_tag LOCUS_05530 2110 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2251 3135 gene locus_tag LOCUS_05540 2251 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_05540 <5235 3196 gene locus_tag LOCUS_05550 <5235 3196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975278.1:aldehyde dehydrogenase >Feature sequence080 783 313 gene locus_tag LOCUS_05560 gene rpsG 783 313 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV6 protein_id gnl|my_center|LOCUS_05560 1167 796 gene locus_tag LOCUS_05570 gene rpsL 1167 796 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 protein_id gnl|my_center|LOCUS_05570 <5232 1548 gene locus_tag LOCUS_05580 <5232 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQV4:DNA-directed RNA polymerase subunit beta' >Feature sequence081 1279 911 gene locus_tag LOCUS_05590 1279 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2303 1272 gene locus_tag LOCUS_05600 2303 1272 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_05600 3493 2294 gene locus_tag LOCUS_05610 gene caiA 3493 2294 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_05610 4272 3505 gene locus_tag LOCUS_05620 4272 3505 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_05620 <5212 4282 gene locus_tag LOCUS_05630 <5212 4282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093598.1:acyl-CoA synthetase >Feature sequence082 <1 1297 gene locus_tag LOCUS_05640 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVV0:cell division protein FtsZ 1541 2383 gene locus_tag LOCUS_05650 gene lpxC 1541 2383 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV1 protein_id gnl|my_center|LOCUS_05650 2525 3331 gene locus_tag LOCUS_05660 gene bamD 2525 3331 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_05660 3416 5101 gene locus_tag LOCUS_05670 3416 5101 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_05670 >Feature sequence083 645 127 gene locus_tag LOCUS_05680 645 127 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_05680 867 4811 gene locus_tag LOCUS_05690 867 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence084 612 1751 gene locus_tag LOCUS_05700 612 1751 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU9 protein_id gnl|my_center|LOCUS_05700 1774 2148 gene locus_tag LOCUS_05710 gene gcvH 1774 2148 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD42 protein_id gnl|my_center|LOCUS_05710 2148 5051 gene locus_tag LOCUS_05720 gene gcvP 2148 5051 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH2 protein_id gnl|my_center|LOCUS_05720 >Feature sequence085 420 1154 gene locus_tag LOCUS_05730 420 1154 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_05730 1159 3063 gene locus_tag LOCUS_05740 1159 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_05740 3079 4113 gene locus_tag LOCUS_05750 3079 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence086 1577 543 gene locus_tag LOCUS_05760 1577 543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709237.1 protein_id gnl|my_center|LOCUS_05760 1680 2912 gene locus_tag LOCUS_05770 1680 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 protein_id gnl|my_center|LOCUS_05770 2928 3719 gene locus_tag LOCUS_05780 2928 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3765 4880 gene locus_tag LOCUS_05790 3765 4880 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence087 1105 233 gene locus_tag LOCUS_05800 1105 233 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XV0 protein_id gnl|my_center|LOCUS_05800 1226 1606 gene locus_tag LOCUS_05810 1226 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 1557 2018 gene locus_tag LOCUS_05820 1557 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 2135 3616 gene locus_tag LOCUS_05830 2135 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3897 4106 gene locus_tag LOCUS_05840 gene cspA 3897 4106 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089994.1 protein_id gnl|my_center|LOCUS_05840 4217 4399 gene locus_tag LOCUS_05850 4217 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4770 4979 gene locus_tag LOCUS_05860 4770 4979 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874821.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence088 515 697 gene locus_tag LOCUS_05870 515 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 752 1951 gene locus_tag LOCUS_05880 752 1951 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088770.1 protein_id gnl|my_center|LOCUS_05880 1948 2388 gene locus_tag LOCUS_05890 1948 2388 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_05890 2782 2393 gene locus_tag LOCUS_05900 2782 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence089 722 156 gene locus_tag LOCUS_05910 722 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 1905 727 gene locus_tag LOCUS_05920 gene dapE 1905 727 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM1 protein_id gnl|my_center|LOCUS_05920 2744 1902 gene locus_tag LOCUS_05930 gene dapD 2744 1902 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM2 protein_id gnl|my_center|LOCUS_05930 3515 2832 gene locus_tag LOCUS_05940 3515 2832 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence090 1994 540 gene locus_tag LOCUS_05950 gene murF 1994 540 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 protein_id gnl|my_center|LOCUS_05950 3421 1991 gene locus_tag LOCUS_05960 gene murE 3421 1991 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT9 protein_id gnl|my_center|LOCUS_05960 <5004 3441 gene locus_tag LOCUS_05970 <5004 3441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388711.1:peptidoglycan glycosyltransferase >Feature sequence091 858 397 gene locus_tag LOCUS_05980 858 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1407 1171 gene locus_tag LOCUS_05990 1407 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2739 1465 gene locus_tag LOCUS_06000 2739 1465 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_06000 3977 3060 gene locus_tag LOCUS_06010 3977 3060 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086311.1 protein_id gnl|my_center|LOCUS_06010 4404 4222 gene locus_tag LOCUS_06020 4404 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 <4991 4418 gene locus_tag LOCUS_06030 <4991 4418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533037.1:aspartate aminotransferase family protein >Feature sequence092 806 144 gene locus_tag LOCUS_06040 gene mobA 806 144 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_06040 1696 803 gene locus_tag LOCUS_06050 gene fdhD 1696 803 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU0 protein_id gnl|my_center|LOCUS_06050 1974 2678 gene locus_tag LOCUS_06060 1974 2678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_06060 2675 3460 gene locus_tag LOCUS_06070 2675 3460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_06070 3457 4275 gene locus_tag LOCUS_06080 3457 4275 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_06080 4582 4295 gene locus_tag LOCUS_06090 4582 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 protein_id gnl|my_center|LOCUS_06090 4853 4629 gene locus_tag LOCUS_06100 4853 4629 CDS product UPF0033 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67103 protein_id gnl|my_center|LOCUS_06100 >Feature sequence093 2117 2983 gene locus_tag LOCUS_06110 2117 2983 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809691.1 protein_id gnl|my_center|LOCUS_06110 2985 4196 gene locus_tag LOCUS_06120 2985 4196 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence094 1219 44 gene locus_tag LOCUS_06130 1219 44 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_06130 2590 1352 gene locus_tag LOCUS_06140 2590 1352 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_06140 2904 3554 gene locus_tag LOCUS_06150 2904 3554 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_06150 4535 3687 gene locus_tag LOCUS_06160 4535 3687 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence095 597 1640 gene locus_tag LOCUS_06170 597 1640 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939223.1 protein_id gnl|my_center|LOCUS_06170 1724 2575 gene locus_tag LOCUS_06180 gene phnC 1724 2575 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_06180 2572 3387 gene locus_tag LOCUS_06190 2572 3387 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939221.1 protein_id gnl|my_center|LOCUS_06190 3384 4196 gene locus_tag LOCUS_06200 3384 4196 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808584.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence096 1273 143 gene locus_tag LOCUS_06210 gene aroB 1273 143 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_06210 1776 1270 gene locus_tag LOCUS_06220 gene aroK 1776 1270 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9G2 protein_id gnl|my_center|LOCUS_06220 2137 4074 gene locus_tag LOCUS_06230 2137 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence097 1802 1044 gene locus_tag LOCUS_06240 gene phnX 1802 1044 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKD4 protein_id gnl|my_center|LOCUS_06240 2944 2054 gene locus_tag LOCUS_06250 2944 2054 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114270.1 protein_id gnl|my_center|LOCUS_06250 3502 4302 gene locus_tag LOCUS_06260 3502 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence098 <1 1072 gene locus_tag LOCUS_06270 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918975.1:monoamine oxidase 2059 1133 gene locus_tag LOCUS_06280 2059 1133 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 protein_id gnl|my_center|LOCUS_06280 2116 3300 gene locus_tag LOCUS_06290 2116 3300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_06290 3410 3628 gene locus_tag LOCUS_06300 3410 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4752 3850 gene locus_tag LOCUS_06310 4752 3850 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence099 1221 154 gene locus_tag LOCUS_06320 gene mdh 1221 154 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV34 protein_id gnl|my_center|LOCUS_06320 2228 1374 gene locus_tag LOCUS_06330 2228 1374 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_06330 3249 2233 gene locus_tag LOCUS_06340 gene nadA 3249 2233 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_06340 4533 3406 gene locus_tag LOCUS_06350 4533 3406 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence100 1026 412 gene locus_tag LOCUS_06360 1026 412 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709135.1 protein_id gnl|my_center|LOCUS_06360 1568 1134 gene locus_tag LOCUS_06370 1568 1134 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_06370 1862 2221 gene locus_tag LOCUS_06380 1862 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2335 2667 gene locus_tag LOCUS_06390 gene bolA 2335 2667 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_06390 3389 2733 gene locus_tag LOCUS_06400 3389 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4072 3641 gene locus_tag LOCUS_06410 4072 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4491 4363 gene locus_tag LOCUS_06420 4491 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4790 4714 gene locus_tag LOCUS_t00040 4790 4714 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 1684 890 gene locus_tag LOCUS_06430 gene lgt 1684 890 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 protein_id gnl|my_center|LOCUS_06430 2717 1731 gene locus_tag LOCUS_06440 gene hldD 2717 1731 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP72 protein_id gnl|my_center|LOCUS_06440 2850 3236 gene locus_tag LOCUS_06450 2850 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3428 3931 gene locus_tag LOCUS_06460 3428 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_06460 3958 4785 gene locus_tag LOCUS_06470 gene proC 3958 4785 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N78 protein_id gnl|my_center|LOCUS_06470 >Feature sequence102 1901 621 gene locus_tag LOCUS_06480 gene dsrA-2 1901 621 CDS product sulfite reductase, dissimilatory-type subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_06480 2133 3077 gene locus_tag LOCUS_06490 2133 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3155 3361 gene locus_tag LOCUS_06500 3155 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3346 3567 gene locus_tag LOCUS_06510 3346 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence103 <1 1261 gene locus_tag LOCUS_06520 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039974.1:5-oxoprolinase 1531 2811 gene locus_tag LOCUS_06530 1531 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3165 2866 gene locus_tag LOCUS_06540 3165 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3636 3238 gene locus_tag LOCUS_06550 3636 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3852 4565 gene locus_tag LOCUS_06560 3852 4565 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence104 3575 3324 gene locus_tag LOCUS_06570 3575 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence105 3 515 gene locus_tag LOCUS_06580 3 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 549 2345 gene locus_tag LOCUS_06590 549 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06590 2355 2579 gene locus_tag LOCUS_06600 2355 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3805 2603 gene locus_tag LOCUS_06610 3805 2603 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVA9 protein_id gnl|my_center|LOCUS_06610 >Feature sequence106 1763 1494 gene locus_tag LOCUS_06620 gene rpsO 1763 1494 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_06620 2704 1778 gene locus_tag LOCUS_06630 gene truB 2704 1778 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR8 protein_id gnl|my_center|LOCUS_06630 3113 2694 gene locus_tag LOCUS_06640 gene rbfA 3113 2694 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ52 protein_id gnl|my_center|LOCUS_06640 <4628 3167 gene locus_tag LOCUS_06650 <4628 3167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMS0:translation initiation factor IF-2 >Feature sequence107 1479 223 gene locus_tag LOCUS_06660 gene umuC 1479 223 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_06660 1969 1517 gene locus_tag LOCUS_06670 gene umuD 1969 1517 CDS product umuD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940167.1 protein_id gnl|my_center|LOCUS_06670 2136 2300 gene locus_tag LOCUS_06680 2136 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2747 2301 gene locus_tag LOCUS_06690 2747 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3387 2842 gene locus_tag LOCUS_06700 3387 2842 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083840.1 protein_id gnl|my_center|LOCUS_06700 4209 3403 gene locus_tag LOCUS_06710 4209 3403 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085496.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence108 2038 95 gene locus_tag LOCUS_06720 2038 95 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 protein_id gnl|my_center|LOCUS_06720 2827 2180 gene locus_tag LOCUS_06730 gene cmk 2827 2180 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_06730 4188 2824 gene locus_tag LOCUS_06740 gene aroA 4188 2824 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP5 protein_id gnl|my_center|LOCUS_06740 >Feature sequence109 1766 1245 gene locus_tag LOCUS_06750 1766 1245 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388428.1 protein_id gnl|my_center|LOCUS_06750 2407 1763 gene locus_tag LOCUS_06760 2407 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3201 2404 gene locus_tag LOCUS_06770 gene cobS 3201 2404 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q75 protein_id gnl|my_center|LOCUS_06770 3328 4371 gene locus_tag LOCUS_06780 gene cobT 3328 4371 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P98 protein_id gnl|my_center|LOCUS_06780 >Feature sequence110 353 90 gene locus_tag LOCUS_06790 353 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1163 366 gene locus_tag LOCUS_06800 1163 366 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 protein_id gnl|my_center|LOCUS_06800 2318 1179 gene locus_tag LOCUS_06810 2318 1179 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_06810 3540 2329 gene locus_tag LOCUS_06820 3540 2329 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971065.1 protein_id gnl|my_center|LOCUS_06820 <4543 3723 gene locus_tag LOCUS_06830 <4543 3723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722552.1:amino acid ABC transporter substrate-binding protein >Feature sequence111 682 2 gene locus_tag LOCUS_06840 682 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1586 846 gene locus_tag LOCUS_06850 1586 846 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941950.1 protein_id gnl|my_center|LOCUS_06850 1832 1683 gene locus_tag LOCUS_06860 1832 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1957 1829 gene locus_tag LOCUS_06870 1957 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2719 2006 gene locus_tag LOCUS_06880 gene lolD1 2719 2006 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_06880 3956 2712 gene locus_tag LOCUS_06890 3956 2712 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_06890 4403 3972 gene locus_tag LOCUS_06900 4403 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence112 519 932 gene locus_tag LOCUS_06910 519 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 964 1227 gene locus_tag LOCUS_06920 964 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1224 3011 gene locus_tag LOCUS_06930 gene yidC 1224 3011 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_06930 3037 3720 gene locus_tag LOCUS_06940 gene engB 3037 3720 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_06940 >Feature sequence113 424 89 gene locus_tag LOCUS_06950 gene grlA 424 89 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 protein_id gnl|my_center|LOCUS_06950 677 438 gene locus_tag LOCUS_06960 677 438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_06960 3025 785 gene locus_tag LOCUS_06970 gene purL 3025 785 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 protein_id gnl|my_center|LOCUS_06970 3148 3555 gene locus_tag LOCUS_06980 3148 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4224 3568 gene locus_tag LOCUS_06990 4224 3568 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088911.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence114 1137 1613 gene locus_tag LOCUS_07000 1137 1613 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_07000 2731 1619 gene locus_tag LOCUS_07010 2731 1619 CDS product oxidoreductase FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_07010 2910 3422 gene locus_tag LOCUS_07020 2910 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 <4496 3441 gene locus_tag LOCUS_07030 <4496 3441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389350.1:peptidase M23 >Feature sequence115 1 1095 gene locus_tag LOCUS_07040 1 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_07040 1287 1090 gene locus_tag LOCUS_07050 1287 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3351 3223 gene locus_tag LOCUS_07060 3351 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3403 3711 gene locus_tag LOCUS_07070 3403 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence116 2147 231 gene locus_tag LOCUS_07080 2147 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2298 2528 gene locus_tag LOCUS_07090 2298 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3386 2538 gene locus_tag LOCUS_07100 3386 2538 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703884.1 protein_id gnl|my_center|LOCUS_07100 4332 3400 gene locus_tag LOCUS_07110 4332 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence117 373 1767 gene locus_tag LOCUS_07120 373 1767 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_07120 2420 1773 gene locus_tag LOCUS_07130 gene pncA 2420 1773 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087320.1 protein_id gnl|my_center|LOCUS_07130 3709 2438 gene locus_tag LOCUS_07140 3709 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence118 973 206 gene locus_tag LOCUS_07150 973 206 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730077.1 protein_id gnl|my_center|LOCUS_07150 1719 973 gene locus_tag LOCUS_07160 1719 973 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808642.1 protein_id gnl|my_center|LOCUS_07160 2723 1956 gene locus_tag LOCUS_07170 2723 1956 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338100.1 protein_id gnl|my_center|LOCUS_07170 4195 2831 gene locus_tag LOCUS_07180 4195 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence119 <1 1002 gene locus_tag LOCUS_07190 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085534.1:C4-dicarboxylate ABC transporter 1114 1584 gene locus_tag LOCUS_07200 1114 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1591 2907 gene locus_tag LOCUS_07210 1591 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence120 1499 2578 gene locus_tag LOCUS_07220 1499 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2634 4133 gene locus_tag LOCUS_07230 2634 4133 CDS product decarboxylase UbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence121 105 923 gene locus_tag LOCUS_07240 gene trpC 105 923 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFA7 protein_id gnl|my_center|LOCUS_07240 926 1402 gene locus_tag LOCUS_07250 gene moaC 926 1402 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI5 protein_id gnl|my_center|LOCUS_07250 1412 2659 gene locus_tag LOCUS_07260 gene moeA 1412 2659 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_07260 2851 3561 gene locus_tag LOCUS_07270 gene lexA 2851 3561 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT47 protein_id gnl|my_center|LOCUS_07270 >Feature sequence122 <1 1653 gene locus_tag LOCUS_07280 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNL4:threonine--tRNA ligase 1808 2242 gene locus_tag LOCUS_07290 gene infC 1808 2242 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_07290 2388 2585 gene locus_tag LOCUS_07300 gene rpmI 2388 2585 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNI0 protein_id gnl|my_center|LOCUS_07300 2600 2965 gene locus_tag LOCUS_07310 gene rplT 2600 2965 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH9 protein_id gnl|my_center|LOCUS_07310 3063 4133 gene locus_tag LOCUS_07320 gene pheS 3063 4133 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_07320 >Feature sequence123 149 952 gene locus_tag LOCUS_07330 149 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2250 1105 gene locus_tag LOCUS_07340 2250 1105 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730158.1 protein_id gnl|my_center|LOCUS_07340 2663 2250 gene locus_tag LOCUS_07350 2663 2250 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_07350 4302 2668 gene locus_tag LOCUS_07360 4302 2668 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730160.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence124 <1 875 gene locus_tag LOCUS_07370 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXD4:DNA repair protein RadA 877 1590 gene locus_tag LOCUS_07380 877 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1568 3025 gene locus_tag LOCUS_07390 gene purF 1568 3025 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 protein_id gnl|my_center|LOCUS_07390 3025 3750 gene locus_tag LOCUS_07400 3025 3750 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence125 271 855 gene locus_tag LOCUS_07410 271 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 877 1893 gene locus_tag LOCUS_07420 877 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07420 1883 2518 gene locus_tag LOCUS_07430 1883 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2522 3121 gene locus_tag LOCUS_07440 2522 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3099 3755 gene locus_tag LOCUS_07450 3099 3755 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_07450 3958 3761 gene locus_tag LOCUS_07460 3958 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence126 2665 1271 gene locus_tag LOCUS_07470 2665 1271 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_07470 4064 2736 gene locus_tag LOCUS_07480 gene glcF 4064 2736 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK25 protein_id gnl|my_center|LOCUS_07480 >Feature sequence127 1709 1005 gene locus_tag LOCUS_07490 gene rlmE 1709 1005 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 protein_id gnl|my_center|LOCUS_07490 2737 1706 gene locus_tag LOCUS_07500 2737 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2893 2967 gene locus_tag LOCUS_t00050 2893 2967 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3131 3322 gene locus_tag LOCUS_07510 3131 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3459 3800 gene locus_tag LOCUS_07520 3459 3800 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390117.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence128 1509 3581 gene locus_tag LOCUS_07530 1509 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_07530 3719 4201 gene locus_tag LOCUS_07540 3719 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence129 <1 823 gene locus_tag LOCUS_07550 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222472.1:2-oxoglutarate ferredoxin oxidoreductase subunit alpha 825 1853 gene locus_tag LOCUS_07560 825 1853 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_07560 1881 3194 gene locus_tag LOCUS_07570 1881 3194 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887141.1 protein_id gnl|my_center|LOCUS_07570 3219 3644 gene locus_tag LOCUS_07580 3219 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401921.1 protein_id gnl|my_center|LOCUS_07580 <4254 3683 gene locus_tag LOCUS_07590 <4254 3683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CKA2:O-succinylhomoserine sulfhydrylase >Feature sequence130 <1 1148 gene locus_tag LOCUS_07600 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXA7:chaperone SurA 1145 2161 gene locus_tag LOCUS_07610 gene pdxA1 1145 2161 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QZ0 protein_id gnl|my_center|LOCUS_07610 2172 2978 gene locus_tag LOCUS_07620 gene rsmA 2172 2978 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA9 protein_id gnl|my_center|LOCUS_07620 3624 2968 gene locus_tag LOCUS_07630 gene gmk 3624 2968 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_07630 >Feature sequence131 <1 503 gene locus_tag LOCUS_07640 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37894:non-motile and phage-resistance protein 1926 883 gene locus_tag LOCUS_07650 1926 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 protein_id gnl|my_center|LOCUS_07650 2266 1946 gene locus_tag LOCUS_07660 2266 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 protein_id gnl|my_center|LOCUS_07660 3632 2367 gene locus_tag LOCUS_07670 gene purD 3632 2367 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHN3 protein_id gnl|my_center|LOCUS_07670 >Feature sequence132 1161 292 gene locus_tag LOCUS_07680 1161 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2671 1220 gene locus_tag LOCUS_07690 2671 1220 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080281.1 protein_id gnl|my_center|LOCUS_07690 3826 2720 gene locus_tag LOCUS_07700 3826 2720 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence133 1026 2279 gene locus_tag LOCUS_07710 1026 2279 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_07710 2415 3710 gene locus_tag LOCUS_07720 2415 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence134 238 528 gene locus_tag LOCUS_07730 238 528 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_07730 539 748 gene locus_tag LOCUS_07740 539 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1534 809 gene locus_tag LOCUS_07750 1534 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC99 protein_id gnl|my_center|LOCUS_07750 1722 1564 gene locus_tag LOCUS_07760 1722 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2179 1769 gene locus_tag LOCUS_07770 2179 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2667 2302 gene locus_tag LOCUS_07780 2667 2302 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083216.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence135 377 54 gene locus_tag LOCUS_07790 377 54 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707132.1 protein_id gnl|my_center|LOCUS_07790 462 989 gene locus_tag LOCUS_07800 462 989 CDS product RemK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728204.1 protein_id gnl|my_center|LOCUS_07800 1285 3150 gene locus_tag LOCUS_07810 1285 3150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_07810 <4193 3275 gene locus_tag LOCUS_07820 <4193 3275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX18:chemotaxis response regulator protein-glutamate methylesterase 1 note possible pseudo, internal stop codon >Feature sequence136 414 1814 gene locus_tag LOCUS_07830 414 1814 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_07830 1830 3149 gene locus_tag LOCUS_07840 1830 3149 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT66 protein_id gnl|my_center|LOCUS_07840 >Feature sequence137 2898 2281 gene locus_tag LOCUS_07850 2898 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3521 3018 gene locus_tag LOCUS_07860 3521 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707138.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence138 797 54 gene locus_tag LOCUS_07870 797 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 882 3110 gene locus_tag LOCUS_07880 gene priA 882 3110 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL6 protein_id gnl|my_center|LOCUS_07880 3299 3859 gene locus_tag LOCUS_07890 gene atpH 3299 3859 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_07890 >Feature sequence139 <1 947 gene locus_tag LOCUS_07900 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391376.1:DNA polymerase III subunit delta 1933 944 gene locus_tag LOCUS_07910 1933 944 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_07910 2742 1930 gene locus_tag LOCUS_07920 2742 1930 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_07920 3370 2729 gene locus_tag LOCUS_07930 gene rsmG 3370 2729 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_07930 <4104 3444 gene locus_tag LOCUS_07940 <4104 3444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN76:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence140 1730 762 gene locus_tag LOCUS_07950 1730 762 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GE9 protein_id gnl|my_center|LOCUS_07950 2565 1765 gene locus_tag LOCUS_07960 2565 1765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393976.1 protein_id gnl|my_center|LOCUS_07960 3586 2555 gene locus_tag LOCUS_07970 3586 2555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812851.1 protein_id gnl|my_center|LOCUS_07970 4057 3722 gene locus_tag LOCUS_07980 4057 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence141 612 82 gene locus_tag LOCUS_07990 612 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1561 719 gene locus_tag LOCUS_08000 1561 719 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529072.1 protein_id gnl|my_center|LOCUS_08000 <4098 1576 gene locus_tag LOCUS_08010 <4098 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTE9:valine--tRNA ligase >Feature sequence142 445 251 gene locus_tag LOCUS_08020 445 251 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_08020 1163 495 gene locus_tag LOCUS_08030 1163 495 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_08030 2230 1160 gene locus_tag LOCUS_08040 2230 1160 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_08040 3776 2349 gene locus_tag LOCUS_08050 gene noeA 3776 2349 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52892 protein_id gnl|my_center|LOCUS_08050 4034 3828 gene locus_tag LOCUS_08060 4034 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence143 <1 2241 gene locus_tag LOCUS_08070 <1 2241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNG2:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence144 1430 555 gene locus_tag LOCUS_08080 1430 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 protein_id gnl|my_center|LOCUS_08080 2050 1427 gene locus_tag LOCUS_08090 2050 1427 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886282.1 protein_id gnl|my_center|LOCUS_08090 2460 2047 gene locus_tag LOCUS_08100 2460 2047 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_08100 3419 2460 gene locus_tag LOCUS_08110 gene rsmI 3419 2460 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN08 protein_id gnl|my_center|LOCUS_08110 3873 3541 gene locus_tag LOCUS_08120 3873 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence145 <1 1285 gene locus_tag LOCUS_08130 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339403.1:ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent 2112 1570 gene locus_tag LOCUS_08140 2112 1570 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP91 protein_id gnl|my_center|LOCUS_08140 2236 3255 gene locus_tag LOCUS_08150 2236 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3302 3946 gene locus_tag LOCUS_08160 3302 3946 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence146 251 838 gene locus_tag LOCUS_08170 251 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1923 898 gene locus_tag LOCUS_08180 1923 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2528 1914 gene locus_tag LOCUS_08190 2528 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2846 3400 gene locus_tag LOCUS_08200 2846 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence147 243 821 gene locus_tag LOCUS_08210 243 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 850 2013 gene locus_tag LOCUS_08220 850 2013 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_08220 2245 2583 gene locus_tag LOCUS_08230 gene glnB 2245 2583 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_08230 >Feature sequence148 328 1479 gene locus_tag LOCUS_08240 328 1479 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_08240 1486 2490 gene locus_tag LOCUS_08250 1486 2490 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_08250 3909 2548 gene locus_tag LOCUS_08260 3909 2548 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence149 27 905 gene locus_tag LOCUS_08270 27 905 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090327.1 protein_id gnl|my_center|LOCUS_08270 995 1849 gene locus_tag LOCUS_08280 995 1849 CDS product glutamate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090326.1 protein_id gnl|my_center|LOCUS_08280 1851 2513 gene locus_tag LOCUS_08290 1851 2513 CDS product glutamate/aspartate transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 protein_id gnl|my_center|LOCUS_08290 2506 3258 gene locus_tag LOCUS_08300 2506 3258 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence150 886 389 gene locus_tag LOCUS_08310 886 389 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q6 protein_id gnl|my_center|LOCUS_08310 946 1299 gene locus_tag LOCUS_08320 946 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2536 1340 gene locus_tag LOCUS_08330 2536 1340 CDS product putative major facilitator superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704032.1 protein_id gnl|my_center|LOCUS_08330 3802 2540 gene locus_tag LOCUS_08340 3802 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808711.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence151 1490 1308 gene locus_tag LOCUS_08350 1490 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1669 2025 gene locus_tag LOCUS_08360 1669 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2127 2041 gene locus_tag LOCUS_t00060 2127 2041 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2322 2903 gene locus_tag LOCUS_08370 2322 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_08370 2905 3441 gene locus_tag LOCUS_08380 2905 3441 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391244.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence152 1409 423 gene locus_tag LOCUS_08390 1409 423 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_08390 2670 1414 gene locus_tag LOCUS_08400 2670 1414 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986414.1 protein_id gnl|my_center|LOCUS_08400 3963 2677 gene locus_tag LOCUS_08410 3963 2677 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence153 1633 458 gene locus_tag LOCUS_08420 gene recA 1633 458 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_08420 1884 2585 gene locus_tag LOCUS_08430 1884 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2813 3505 gene locus_tag LOCUS_08440 2813 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence154 604 86 gene locus_tag LOCUS_08450 604 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2733 604 gene locus_tag LOCUS_08460 2733 604 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390407.1 protein_id gnl|my_center|LOCUS_08460 3416 2730 gene locus_tag LOCUS_08470 3416 2730 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_08470 <3965 3463 gene locus_tag LOCUS_08480 <3965 3463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086528.1:DNA-binding response regulator >Feature sequence155 1968 1063 gene locus_tag LOCUS_08490 1968 1063 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_08490 2304 3380 gene locus_tag LOCUS_08500 gene metX 2304 3380 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP84 protein_id gnl|my_center|LOCUS_08500 >Feature sequence156 <1 1337 gene locus_tag LOCUS_08510 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546166.1:aldehyde ferredoxin oxidoreductase 1377 3632 gene locus_tag LOCUS_08520 1377 3632 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence157 <1 917 gene locus_tag LOCUS_08530 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389968.1:dehydrogenase 914 1759 gene locus_tag LOCUS_08540 914 1759 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_08540 1770 2486 gene locus_tag LOCUS_08550 1770 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_08550 2491 3231 gene locus_tag LOCUS_08560 2491 3231 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence158 <1 1282 gene locus_tag LOCUS_08570 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SID7:cyclic AMP receptor protein 2614 1292 gene locus_tag LOCUS_08580 gene eno 2614 1292 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFL1 protein_id gnl|my_center|LOCUS_08580 3639 2611 gene locus_tag LOCUS_08590 3639 2611 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701066.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence159 1753 761 gene locus_tag LOCUS_08600 1753 761 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 protein_id gnl|my_center|LOCUS_08600 2368 1781 gene locus_tag LOCUS_08610 2368 1781 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085642.1 protein_id gnl|my_center|LOCUS_08610 2891 2379 gene locus_tag LOCUS_08620 2891 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 <3861 2888 gene locus_tag LOCUS_08630 <3861 2888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368539.1:transporter >Feature sequence160 1711 1235 gene locus_tag LOCUS_08640 1711 1235 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_08640 2648 2472 gene locus_tag LOCUS_08650 2648 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2956 2741 gene locus_tag LOCUS_08660 2956 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3583 3209 gene locus_tag LOCUS_08670 3583 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 >Feature sequence161 <1 804 gene locus_tag LOCUS_08680 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMQ4:putative protein kinase UbiB 905 2125 gene locus_tag LOCUS_08690 905 2125 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_08690 2161 2622 gene locus_tag LOCUS_08700 gene dut 2161 2622 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61908 protein_id gnl|my_center|LOCUS_08700 2626 3081 gene locus_tag LOCUS_08710 2626 3081 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence162 611 141 gene locus_tag LOCUS_08720 611 141 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH2 protein_id gnl|my_center|LOCUS_08720 783 1628 gene locus_tag LOCUS_08730 783 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1705 2016 gene locus_tag LOCUS_08740 gene gatC 1705 2016 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK8 protein_id gnl|my_center|LOCUS_08740 2013 3497 gene locus_tag LOCUS_08750 gene gatA 2013 3497 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH4 protein_id gnl|my_center|LOCUS_08750 >Feature sequence163 1930 440 gene locus_tag LOCUS_08760 1930 440 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_08760 2283 1930 gene locus_tag LOCUS_08770 2283 1930 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_08770 3252 2287 gene locus_tag LOCUS_08780 3252 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3614 3264 gene locus_tag LOCUS_08790 3614 3264 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence164 1406 90 gene locus_tag LOCUS_08800 1406 90 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_08800 2597 1521 gene locus_tag LOCUS_08810 2597 1521 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_08810 3537 2602 gene locus_tag LOCUS_08820 3537 2602 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 protein_id gnl|my_center|LOCUS_08820 3808 3560 gene locus_tag LOCUS_08830 3808 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence165 2121 1771 gene locus_tag LOCUS_08840 2121 1771 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_08840 2997 2194 gene locus_tag LOCUS_08850 2997 2194 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_08850 <3800 3015 gene locus_tag LOCUS_08860 <3800 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337624.1:sodium:calcium antiporter >Feature sequence166 31 546 gene locus_tag LOCUS_08870 31 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2130 667 gene locus_tag LOCUS_08880 2130 667 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_08880 2736 2257 gene locus_tag LOCUS_08890 2736 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 <3782 2745 gene locus_tag LOCUS_08900 <3782 2745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816964.1:membrane protein >Feature sequence167 <1 604 gene locus_tag LOCUS_08910 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836211.1:short-chain dehydrogenase/reductase SDR 643 1470 gene locus_tag LOCUS_08920 643 1470 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_08920 2390 1500 gene locus_tag LOCUS_08930 2390 1500 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948214.1 protein_id gnl|my_center|LOCUS_08930 3199 2456 gene locus_tag LOCUS_08940 3199 2456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393975.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence168 1441 569 gene locus_tag LOCUS_08950 1441 569 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXB5 protein_id gnl|my_center|LOCUS_08950 2424 1537 gene locus_tag LOCUS_08960 2424 1537 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261970.1 protein_id gnl|my_center|LOCUS_08960 2534 3586 gene locus_tag LOCUS_08970 2534 3586 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085957.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence169 791 531 gene locus_tag LOCUS_08980 gene hfq 791 531 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR1 protein_id gnl|my_center|LOCUS_08980 1581 931 gene locus_tag LOCUS_08990 1581 931 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_08990 2468 1587 gene locus_tag LOCUS_09000 2468 1587 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 protein_id gnl|my_center|LOCUS_09000 3685 2471 gene locus_tag LOCUS_09010 gene trkA 3685 2471 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence170 1292 981 gene locus_tag LOCUS_09020 1292 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529562.1 protein_id gnl|my_center|LOCUS_09020 2372 1494 gene locus_tag LOCUS_09030 2372 1494 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970364.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence171 1545 535 gene locus_tag LOCUS_09040 gene kbl 1545 535 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIG0 protein_id gnl|my_center|LOCUS_09040 <3693 2303 gene locus_tag LOCUS_09050 <3693 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524300.1:sarcosine oxidase subunit alpha >Feature sequence172 1393 596 gene locus_tag LOCUS_09060 1393 596 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087743.1 protein_id gnl|my_center|LOCUS_09060 1747 1481 gene locus_tag LOCUS_09070 1747 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1935 2129 gene locus_tag LOCUS_09080 1935 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2577 2158 gene locus_tag LOCUS_09090 2577 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3690 2737 gene locus_tag LOCUS_09100 3690 2737 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence173 1546 398 gene locus_tag LOCUS_09110 1546 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1691 2401 gene locus_tag LOCUS_09120 1691 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 <3673 2413 gene locus_tag LOCUS_09130 <3673 2413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXV5:protein translocase subunit SecA >Feature sequence174 296 1483 gene locus_tag LOCUS_09140 296 1483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_09140 1517 1933 gene locus_tag LOCUS_09150 1517 1933 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_09150 2475 1918 gene locus_tag LOCUS_09160 2475 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3671 2496 gene locus_tag LOCUS_09170 gene gatB 3671 2496 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH5 protein_id gnl|my_center|LOCUS_09170 >Feature sequence175 1272 271 gene locus_tag LOCUS_09180 1272 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390397.1 protein_id gnl|my_center|LOCUS_09180 1456 2751 gene locus_tag LOCUS_09190 1456 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence176 >Feature sequence177 1332 808 gene locus_tag LOCUS_09200 gene ilvH 1332 808 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_09200 3150 1387 gene locus_tag LOCUS_09210 3150 1387 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 protein_id gnl|my_center|LOCUS_09210 >Feature sequence178 <1 1121 gene locus_tag LOCUS_09220 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057661.1:acetolactate synthase 1134 2492 gene locus_tag LOCUS_09230 1134 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_09230 2810 2514 gene locus_tag LOCUS_09240 2810 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3604 2891 gene locus_tag LOCUS_09250 3604 2891 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709106.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence179 2421 562 gene locus_tag LOCUS_09260 gene cbiG/cobJ 2421 562 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203935.1 protein_id gnl|my_center|LOCUS_09260 3149 2418 gene locus_tag LOCUS_09270 gene cobI 3149 2418 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence180 1467 571 gene locus_tag LOCUS_09280 1467 571 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461644.1 protein_id gnl|my_center|LOCUS_09280 1783 2862 gene locus_tag LOCUS_09290 1783 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2987 3511 gene locus_tag LOCUS_09300 2987 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence181 2484 1141 gene locus_tag LOCUS_09310 2484 1141 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence182 <1 1391 gene locus_tag LOCUS_09320 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531908.1:ATP-dependent DNA helicase RecG 1507 1388 gene locus_tag LOCUS_09330 1507 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2639 1815 gene locus_tag LOCUS_09340 2639 1815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_09340 3020 2664 gene locus_tag LOCUS_09350 3020 2664 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_09350 3454 3224 gene locus_tag LOCUS_09360 3454 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence183 955 569 gene locus_tag LOCUS_09370 955 569 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_09370 1204 1545 gene locus_tag LOCUS_09380 1204 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1968 1564 gene locus_tag LOCUS_09390 1968 1564 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389897.1 protein_id gnl|my_center|LOCUS_09390 2792 1986 gene locus_tag LOCUS_09400 2792 1986 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence184 1570 224 gene locus_tag LOCUS_09410 1570 224 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence185 2133 913 gene locus_tag LOCUS_09420 2133 913 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09420 2442 2158 gene locus_tag LOCUS_09430 2442 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09430 <3558 2461 gene locus_tag LOCUS_09440 <3558 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072023.1:acriflavin resistance protein >Feature sequence186 451 1317 gene locus_tag LOCUS_09450 451 1317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_09450 1351 2901 gene locus_tag LOCUS_09460 1351 2901 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI0 protein_id gnl|my_center|LOCUS_09460 >Feature sequence187 94 558 gene locus_tag LOCUS_09470 94 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09470 732 2342 gene locus_tag LOCUS_09480 732 2342 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532110.1 protein_id gnl|my_center|LOCUS_09480 2902 2345 gene locus_tag LOCUS_09490 2902 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence188 189 1100 gene locus_tag LOCUS_09500 189 1100 CDS product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529583.1 protein_id gnl|my_center|LOCUS_09500 1113 1502 gene locus_tag LOCUS_09510 1113 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1581 1931 gene locus_tag LOCUS_09520 1581 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2014 2706 gene locus_tag LOCUS_09530 gene pyrF 2014 2706 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_09530 2703 3344 gene locus_tag LOCUS_09540 gene trpF 2703 3344 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 protein_id gnl|my_center|LOCUS_09540 >Feature sequence189 <1 896 gene locus_tag LOCUS_09550 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWV9:tetraacyldisaccharide 4'-kinase 905 1801 gene locus_tag LOCUS_09560 905 1801 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_09560 2094 1909 gene locus_tag LOCUS_09570 2094 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3026 2172 gene locus_tag LOCUS_09580 3026 2172 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence190 38 736 gene locus_tag LOCUS_09590 38 736 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225814.1 protein_id gnl|my_center|LOCUS_09590 1151 2404 gene locus_tag LOCUS_09600 1151 2404 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_09600 2423 3319 gene locus_tag LOCUS_09610 2423 3319 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085465.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence191 <1 2083 gene locus_tag LOCUS_09620 <1 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNJ0:aconitate hydratase 2196 2630 gene locus_tag LOCUS_09630 2196 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence192 1149 838 gene locus_tag LOCUS_09640 gene nuoK1 1149 838 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA67 protein_id gnl|my_center|LOCUS_09640 1760 1149 gene locus_tag LOCUS_09650 gene nuoJ 1760 1149 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531851.1 protein_id gnl|my_center|LOCUS_09650 2284 1796 gene locus_tag LOCUS_09660 gene nuoI 2284 1796 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU32 protein_id gnl|my_center|LOCUS_09660 3314 2298 gene locus_tag LOCUS_09670 gene nuoH 3314 2298 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 protein_id gnl|my_center|LOCUS_09670 >Feature sequence193 152 1081 gene locus_tag LOCUS_09680 152 1081 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_09680 1280 1564 gene locus_tag LOCUS_09690 1280 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1631 2095 gene locus_tag LOCUS_09700 1631 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2098 2493 gene locus_tag LOCUS_09710 2098 2493 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence194 <1 1153 gene locus_tag LOCUS_09720 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258859.1:xanthine dehydrogenase 1137 2792 gene locus_tag LOCUS_09730 1137 2792 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553693.1 protein_id gnl|my_center|LOCUS_09730 2990 2814 gene locus_tag LOCUS_09740 2990 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence195 <1 567 gene locus_tag LOCUS_09750 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731396.1:PadR family transcriptional regulator 564 1655 gene locus_tag LOCUS_09760 564 1655 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence196 1547 1107 gene locus_tag LOCUS_09770 1547 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1737 1489 gene locus_tag LOCUS_09780 1737 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1939 2127 gene locus_tag LOCUS_09790 1939 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence197 1293 547 gene locus_tag LOCUS_09800 1293 547 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_09800 3092 1401 gene locus_tag LOCUS_09810 gene soxB 3092 1401 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence198 2727 1693 gene locus_tag LOCUS_09820 2727 1693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_09820 <3434 2724 gene locus_tag LOCUS_09830 <3434 2724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258124.1:ABC transporter ATP-binding protein >Feature sequence199 >Feature sequence200 758 958 gene locus_tag LOCUS_09840 758 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1536 988 gene locus_tag LOCUS_09850 1536 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_09850 2070 1624 gene locus_tag LOCUS_09860 2070 1624 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_09860 <3417 2208 gene locus_tag LOCUS_09870 <3417 2208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083018.1:membrane protein >Feature sequence201 911 1681 gene locus_tag LOCUS_09880 911 1681 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085930.1 protein_id gnl|my_center|LOCUS_09880 1703 2713 gene locus_tag LOCUS_09890 1703 2713 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEJ2 protein_id gnl|my_center|LOCUS_09890 2894 3229 gene locus_tag LOCUS_09900 2894 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 3247 3384 gene locus_tag LOCUS_09910 3247 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence202 1476 502 gene locus_tag LOCUS_09920 1476 502 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_09920 2158 1547 gene locus_tag LOCUS_09930 2158 1547 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 protein_id gnl|my_center|LOCUS_09930 2332 2832 gene locus_tag LOCUS_09940 2332 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence203 299 81 gene locus_tag LOCUS_09950 gene infA 299 81 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S23 protein_id gnl|my_center|LOCUS_09950 827 381 gene locus_tag LOCUS_09960 827 381 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_09960 1315 842 gene locus_tag LOCUS_09970 1315 842 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM8 protein_id gnl|my_center|LOCUS_09970 2781 1579 gene locus_tag LOCUS_09980 2781 1579 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 protein_id gnl|my_center|LOCUS_09980 2973 3329 gene locus_tag LOCUS_09990 2973 3329 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence204 <1 907 gene locus_tag LOCUS_10000 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401703.1:glyoxylate/hydroxypyruvate reductase A 921 1154 gene locus_tag LOCUS_10010 921 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1528 1151 gene locus_tag LOCUS_10020 1528 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_10020 2359 1556 gene locus_tag LOCUS_10030 gene uppP1 2359 1556 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_10030 >Feature sequence205 <1 656 gene locus_tag LOCUS_10040 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390977.1:DNA-binding response regulator 761 2926 gene locus_tag LOCUS_10050 761 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3266 2931 gene locus_tag LOCUS_10060 3266 2931 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence206 <1 706 gene locus_tag LOCUS_10070 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390690.1:glycine cleavage system protein T 743 1411 gene locus_tag LOCUS_10080 743 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1839 1408 gene locus_tag LOCUS_10090 1839 1408 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_10090 <3357 1880 gene locus_tag LOCUS_10100 <3357 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390706.1:pyruvate, phosphate dikinase >Feature sequence207 346 810 gene locus_tag LOCUS_10110 gene ribH2 346 810 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_10110 807 1313 gene locus_tag LOCUS_10120 gene nusB 807 1313 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I9 protein_id gnl|my_center|LOCUS_10120 1352 2359 gene locus_tag LOCUS_10130 gene thiL 1352 2359 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCM5 protein_id gnl|my_center|LOCUS_10130 2492 2950 gene locus_tag LOCUS_10140 2492 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence208 339 1079 gene locus_tag LOCUS_10150 339 1079 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957710.1 protein_id gnl|my_center|LOCUS_10150 1184 2518 gene locus_tag LOCUS_10160 1184 2518 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266161.1 protein_id gnl|my_center|LOCUS_10160 2522 3052 gene locus_tag LOCUS_10170 2522 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence209 989 1402 gene locus_tag LOCUS_10180 989 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1909 2331 gene locus_tag LOCUS_10190 1909 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2318 3232 gene locus_tag LOCUS_10200 2318 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence210 1252 845 gene locus_tag LOCUS_10210 1252 845 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_10210 1880 1278 gene locus_tag LOCUS_10220 1880 1278 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_10220 2572 1889 gene locus_tag LOCUS_10230 2572 1889 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_10230 <3334 2582 gene locus_tag LOCUS_10240 <3334 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003108823.1:acyl-CoA thiolase >Feature sequence211 1509 820 gene locus_tag LOCUS_10250 1509 820 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085942.1 protein_id gnl|my_center|LOCUS_10250 3233 1719 gene locus_tag LOCUS_10260 3233 1719 CDS product tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088773.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence212 960 154 gene locus_tag LOCUS_10270 960 154 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 protein_id gnl|my_center|LOCUS_10270 1871 957 gene locus_tag LOCUS_10280 1871 957 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_10280 1988 2701 gene locus_tag LOCUS_10290 1988 2701 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence213 1564 1989 gene locus_tag LOCUS_10300 1564 1989 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_10300 2020 2832 gene locus_tag LOCUS_10310 2020 2832 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence214 838 248 gene locus_tag LOCUS_10320 gene pdxH 838 248 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_10320 976 1464 gene locus_tag LOCUS_10330 gene omp 976 1464 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_10330 1510 2370 gene locus_tag LOCUS_10340 1510 2370 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706153.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence215 87 956 gene locus_tag LOCUS_10350 87 956 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_10350 953 1621 gene locus_tag LOCUS_10360 953 1621 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_10360 1625 2656 gene locus_tag LOCUS_10370 gene cas1 1625 2656 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF5 protein_id gnl|my_center|LOCUS_10370 2667 2957 gene locus_tag LOCUS_10380 gene cas2 2667 2957 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDC5 protein_id gnl|my_center|LOCUS_10380 3121 >3289 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctctcctcacggggagcgtggattgaaa >Feature sequence216 1550 1143 gene locus_tag LOCUS_10390 1550 1143 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123008.1 protein_id gnl|my_center|LOCUS_10390 2271 1555 gene locus_tag LOCUS_10400 2271 1555 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531460.1 protein_id gnl|my_center|LOCUS_10400 2358 2948 gene locus_tag LOCUS_10410 2358 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence217 120 872 gene locus_tag LOCUS_10420 120 872 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537472.1 protein_id gnl|my_center|LOCUS_10420 2668 896 gene locus_tag LOCUS_10430 2668 896 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810264.1 protein_id gnl|my_center|LOCUS_10430 2841 3206 gene locus_tag LOCUS_10440 2841 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence218 106 633 gene locus_tag LOCUS_10450 106 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 690 1340 gene locus_tag LOCUS_10460 690 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1579 2337 gene locus_tag LOCUS_10470 1579 2337 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_10470 2462 3040 gene locus_tag LOCUS_10480 2462 3040 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706927.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence219 <1 688 gene locus_tag LOCUS_10490 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186027.1:oxidoreductase 737 1612 gene locus_tag LOCUS_10500 737 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1627 2736 gene locus_tag LOCUS_10510 1627 2736 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence220 546 1976 gene locus_tag LOCUS_10520 546 1976 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 protein_id gnl|my_center|LOCUS_10520 1992 3149 gene locus_tag LOCUS_10530 gene alr 1992 3149 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence221 >Feature sequence222 594 1895 gene locus_tag LOCUS_10540 594 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3046 1943 gene locus_tag LOCUS_10550 3046 1943 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707034.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence223 <3144 2192 gene locus_tag LOCUS_10560 <3144 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390448.1:flagellar biosynthesis protein FlhB >Feature sequence224 611 2284 gene locus_tag LOCUS_10570 gene nadE 611 2284 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence225 1114 167 gene locus_tag LOCUS_10580 1114 167 CDS product branched-chain amino acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_10580 1227 1556 gene locus_tag LOCUS_10590 1227 1556 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTT1 protein_id gnl|my_center|LOCUS_10590 1569 2408 gene locus_tag LOCUS_10600 1569 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2701 2432 gene locus_tag LOCUS_10610 2701 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence226 <1 778 gene locus_tag LOCUS_10620 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391333.1:peptidoglycan-binding protein LysM 863 1546 gene locus_tag LOCUS_10630 gene psd 863 1546 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_10630 1567 2373 gene locus_tag LOCUS_10640 1567 2373 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence227 <1 697 gene locus_tag LOCUS_10650 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D452:Fused isobutyryl-CoA mutase 766 1011 gene locus_tag LOCUS_10660 766 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1430 1008 gene locus_tag LOCUS_10670 1430 1008 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389582.1 protein_id gnl|my_center|LOCUS_10670 1683 2141 gene locus_tag LOCUS_10680 1683 2141 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence228 488 649 gene locus_tag LOCUS_10690 488 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 787 1221 gene locus_tag LOCUS_10700 787 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1436 1843 gene locus_tag LOCUS_10710 1436 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1879 2748 gene locus_tag LOCUS_10720 1879 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence229 709 1191 gene locus_tag LOCUS_10730 709 1191 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_10730 1215 3062 gene locus_tag LOCUS_10740 1215 3062 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence230 1701 454 gene locus_tag LOCUS_10750 gene folC 1701 454 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_10750 2673 1726 gene locus_tag LOCUS_10760 gene accD 2673 1726 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence231 735 1004 gene locus_tag LOCUS_10770 735 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1503 1063 gene locus_tag LOCUS_10780 1503 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1610 2500 gene locus_tag LOCUS_10790 gene ytlA 1610 2500 CDS product putative binding protein YtlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SP84 protein_id gnl|my_center|LOCUS_10790 <3080 2546 gene locus_tag LOCUS_10800 <3080 2546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974776.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence232 <3075 1095 gene locus_tag LOCUS_10810 <3075 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389369.1:PAS domain-containing sensor histidine kinase >Feature sequence233 667 849 gene locus_tag LOCUS_10820 667 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1054 1488 gene locus_tag LOCUS_10830 1054 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1668 3047 gene locus_tag LOCUS_10840 1668 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence234 1628 297 gene locus_tag LOCUS_10850 1628 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088233.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence235 882 523 gene locus_tag LOCUS_10860 882 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1272 1763 gene locus_tag LOCUS_10870 1272 1763 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_10870 2841 1774 gene locus_tag LOCUS_10880 2841 1774 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389203.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence236 838 134 gene locus_tag LOCUS_10890 838 134 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939331.1 protein_id gnl|my_center|LOCUS_10890 1587 835 gene locus_tag LOCUS_10900 gene dpm1 1587 835 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_10900 2477 1671 gene locus_tag LOCUS_10910 2477 1671 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_10910 3061 2474 gene locus_tag LOCUS_10920 3061 2474 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence237 <1 1674 gene locus_tag LOCUS_10930 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391400.1:glycosyl transferase family 1 1868 1677 gene locus_tag LOCUS_10940 1868 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2372 1887 gene locus_tag LOCUS_10950 2372 1887 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence238 <1 651 gene locus_tag LOCUS_10960 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TAY7:glycerol kinase 767 1969 gene locus_tag LOCUS_10970 767 1969 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927097.1 protein_id gnl|my_center|LOCUS_10970 2083 2658 gene locus_tag LOCUS_10980 gene ubiX 2083 2658 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KNK9 protein_id gnl|my_center|LOCUS_10980 >Feature sequence239 3 197 gene locus_tag LOCUS_10990 3 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1124 237 gene locus_tag LOCUS_11000 gene rpoH2 1124 237 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6K8 protein_id gnl|my_center|LOCUS_11000 2467 1571 gene locus_tag LOCUS_11010 2467 1571 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387816.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence240 1345 647 gene locus_tag LOCUS_11020 1345 647 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_11020 <3047 1367 gene locus_tag LOCUS_11030 <3047 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139976.1:membrane protein >Feature sequence241 2015 948 gene locus_tag LOCUS_11040 2015 948 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_11040 2147 2545 gene locus_tag LOCUS_11050 2147 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence242 1607 195 gene locus_tag LOCUS_11060 1607 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2308 1724 gene locus_tag LOCUS_11070 2308 1724 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_11070 <3030 2349 gene locus_tag LOCUS_11080 <3030 2349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088459.1:dimethylhistidine N-methyltransferase >Feature sequence243 3 788 gene locus_tag LOCUS_11090 3 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 813 1871 gene locus_tag LOCUS_11100 813 1871 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886725.1 protein_id gnl|my_center|LOCUS_11100 1896 2735 gene locus_tag LOCUS_11110 gene aroE 1896 2735 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DM7 protein_id gnl|my_center|LOCUS_11110 >Feature sequence244 2838 1450 gene locus_tag LOCUS_11120 2838 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence245 551 183 gene locus_tag LOCUS_11130 551 183 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_11130 964 1326 gene locus_tag LOCUS_11140 964 1326 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_11140 2209 1481 gene locus_tag LOCUS_11150 2209 1481 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_11150 2393 2614 gene locus_tag LOCUS_11160 2393 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence246 76 1443 gene locus_tag LOCUS_11170 76 1443 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385434.1 protein_id gnl|my_center|LOCUS_11170 1524 2444 gene locus_tag LOCUS_11180 1524 2444 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937322.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence247 1737 586 gene locus_tag LOCUS_11190 1737 586 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886711.1 protein_id gnl|my_center|LOCUS_11190 2680 1730 gene locus_tag LOCUS_11200 2680 1730 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118252.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence248 490 1107 gene locus_tag LOCUS_11210 490 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1571 1104 gene locus_tag LOCUS_11220 gene msrB 1571 1104 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 protein_id gnl|my_center|LOCUS_11220 1655 2197 gene locus_tag LOCUS_11230 1655 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2235 2636 gene locus_tag LOCUS_11240 2235 2636 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938107.1 protein_id gnl|my_center|LOCUS_11240 3012 2647 gene locus_tag LOCUS_11250 3012 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence249 1812 520 gene locus_tag LOCUS_11260 1812 520 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 protein_id gnl|my_center|LOCUS_11260 2217 2756 gene locus_tag LOCUS_11270 2217 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence250 298 1248 gene locus_tag LOCUS_11280 298 1248 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118252.1 protein_id gnl|my_center|LOCUS_11280 1241 2392 gene locus_tag LOCUS_11290 1241 2392 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886711.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence251 <1 661 gene locus_tag LOCUS_11300 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388811.1:NAD(P)H quinone oxidoreductase 774 1586 gene locus_tag LOCUS_11310 774 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 <2992 1608 gene locus_tag LOCUS_11320 <2992 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388801.1:propionyl-CoA synthetase >Feature sequence252 1017 352 gene locus_tag LOCUS_11330 1017 352 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF1 protein_id gnl|my_center|LOCUS_11330 1664 1014 gene locus_tag LOCUS_11340 gene ccmA 1664 1014 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 protein_id gnl|my_center|LOCUS_11340 >Feature sequence253 <1 1194 gene locus_tag LOCUS_11350 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV33:succinate--CoA ligase [ADP-forming] subunit beta 1194 2069 gene locus_tag LOCUS_11360 1194 2069 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_11360 >Feature sequence254 <1 591 gene locus_tag LOCUS_11370 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXI0:methylthioribose-1-phosphate isomerase 607 1566 gene locus_tag LOCUS_11380 607 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206832.1 protein_id gnl|my_center|LOCUS_11380 2978 1563 gene locus_tag LOCUS_11390 2978 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence255 <1 717 gene locus_tag LOCUS_11400 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088977.1:carbon monoxide dehydrogenase 771 1277 gene locus_tag LOCUS_11410 771 1277 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 protein_id gnl|my_center|LOCUS_11410 2183 1296 gene locus_tag LOCUS_11420 2183 1296 CDS product 6-chlorohydroxyquinol-1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533090.1 protein_id gnl|my_center|LOCUS_11420 2543 2217 gene locus_tag LOCUS_11430 2543 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence256 1307 615 gene locus_tag LOCUS_11440 1307 615 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 protein_id gnl|my_center|LOCUS_11440 1798 2784 gene locus_tag LOCUS_11450 1798 2784 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence257 1389 553 gene locus_tag LOCUS_11460 1389 553 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_11460 2107 1418 gene locus_tag LOCUS_11470 2107 1418 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_11470 <2954 2107 gene locus_tag LOCUS_11480 <2954 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389530.1:beta-N-acetylhexosaminidase >Feature sequence258 1435 938 gene locus_tag LOCUS_11490 1435 938 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_11490 2334 1459 gene locus_tag LOCUS_11500 2334 1459 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence259 284 1639 gene locus_tag LOCUS_11510 284 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1639 2472 gene locus_tag LOCUS_11520 1639 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2927 2469 gene locus_tag LOCUS_11530 2927 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence260 2426 1029 gene locus_tag LOCUS_11540 2426 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460942.1 protein_id gnl|my_center|LOCUS_11540 2875 2423 gene locus_tag LOCUS_11550 2875 2423 CDS product glutamate mutase sigma subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence261 <1 781 gene locus_tag LOCUS_11560 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389349.1:diguanylate phosphodiesterase 2513 828 gene locus_tag LOCUS_11570 2513 828 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405161.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence262 1 351 gene locus_tag LOCUS_11580 1 351 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 protein_id gnl|my_center|LOCUS_11580 363 704 gene locus_tag LOCUS_11590 363 704 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339082.1 protein_id gnl|my_center|LOCUS_11590 694 1416 gene locus_tag LOCUS_11600 694 1416 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FT1 protein_id gnl|my_center|LOCUS_11600 1435 2310 gene locus_tag LOCUS_11610 1435 2310 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870811.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence263 <2891 1845 gene locus_tag LOCUS_11620 <2891 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225693.1:acyl-CoA dehydrogenase >Feature sequence264 1550 636 gene locus_tag LOCUS_11630 gene atpG 1550 636 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV19 protein_id gnl|my_center|LOCUS_11630 2884 1574 gene locus_tag LOCUS_11640 gene atpA 2884 1574 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 protein_id gnl|my_center|LOCUS_11640 >Feature sequence265 1419 637 gene locus_tag LOCUS_11650 gene ubiE 1419 637 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 protein_id gnl|my_center|LOCUS_11650 1544 2386 gene locus_tag LOCUS_11660 gene mutM 1544 2386 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ2 protein_id gnl|my_center|LOCUS_11660 2401 2817 gene locus_tag LOCUS_11670 2401 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence266 153 710 gene locus_tag LOCUS_11680 153 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 780 980 gene locus_tag LOCUS_11690 780 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1499 1011 gene locus_tag LOCUS_11700 1499 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389286.1 protein_id gnl|my_center|LOCUS_11700 1776 1627 gene locus_tag LOCUS_11710 1776 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2538 1906 gene locus_tag LOCUS_11720 2538 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2780 2535 gene locus_tag LOCUS_11730 2780 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence267 1446 151 gene locus_tag LOCUS_11740 1446 151 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_11740 2165 1443 gene locus_tag LOCUS_11750 2165 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_11750 <2875 2191 gene locus_tag LOCUS_11760 <2875 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390692.1:ABC transporter permease >Feature sequence268 <1 1031 gene locus_tag LOCUS_11770 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087591.1:alpha-hydroxy-acid oxidizing enzyme 1922 1041 gene locus_tag LOCUS_11780 1922 1041 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084202.1 protein_id gnl|my_center|LOCUS_11780 2332 1922 gene locus_tag LOCUS_11790 gene pcaC 2332 1922 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence269 1186 224 gene locus_tag LOCUS_11800 1186 224 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_11800 1666 1208 gene locus_tag LOCUS_11810 gene ytoQ 1666 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_11810 2266 1802 gene locus_tag LOCUS_11820 2266 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence270 <1 1048 gene locus_tag LOCUS_11830 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814996.1:2-aminobenzoate-CoA ligase 1045 1752 gene locus_tag LOCUS_11840 1045 1752 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence271 1 645 gene locus_tag LOCUS_11850 1 645 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_11850 712 1272 gene locus_tag LOCUS_11860 712 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence272 <2854 199 gene locus_tag LOCUS_11870 <2854 199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391261.1:DNA polymerase I >Feature sequence273 <1 976 gene locus_tag LOCUS_11880 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389862.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1002 2138 gene locus_tag LOCUS_11890 1002 2138 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_11890 2643 2146 gene locus_tag LOCUS_11900 2643 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence274 1078 716 gene locus_tag LOCUS_11910 1078 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2088 1093 gene locus_tag LOCUS_11920 gene rsmH 2088 1093 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_11920 2564 2091 gene locus_tag LOCUS_11930 gene mraZ 2564 2091 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence275 337 203 gene locus_tag LOCUS_11940 337 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 448 1005 gene locus_tag LOCUS_11950 448 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1002 1301 gene locus_tag LOCUS_11960 gene rpsR 1002 1301 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVN5 protein_id gnl|my_center|LOCUS_11960 1332 2300 gene locus_tag LOCUS_11970 1332 2300 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence276 959 1924 gene locus_tag LOCUS_11980 gene ctaA 959 1924 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7T3 protein_id gnl|my_center|LOCUS_11980 >Feature sequence277 1885 1010 gene locus_tag LOCUS_11990 1885 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence278 130 1071 gene locus_tag LOCUS_12000 130 1071 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_12000 1457 1131 gene locus_tag LOCUS_12010 1457 1131 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V7 protein_id gnl|my_center|LOCUS_12010 2321 1458 gene locus_tag LOCUS_12020 2321 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence279 2 2698 gene locus_tag LOCUS_12030 gene ileS 2 2698 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 protein_id gnl|my_center|LOCUS_12030 >Feature sequence280 2017 1127 gene locus_tag LOCUS_12040 2017 1127 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_12040 <2814 2070 gene locus_tag LOCUS_12050 <2814 2070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQA0:thioredoxin reductase >Feature sequence281 2311 1055 gene locus_tag LOCUS_12060 2311 1055 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970423.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence282 729 878 gene locus_tag LOCUS_12070 729 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1217 957 gene locus_tag LOCUS_12080 1217 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1141 1374 gene locus_tag LOCUS_12090 1141 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1424 1846 gene locus_tag LOCUS_12100 gene ndk 1424 1846 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC6 protein_id gnl|my_center|LOCUS_12100 2745 1903 gene locus_tag LOCUS_12110 2745 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence283 <1 1214 gene locus_tag LOCUS_12120 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339081.1:fumarate reductase 1290 1772 gene locus_tag LOCUS_12130 1290 1772 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_12130 2659 1769 gene locus_tag LOCUS_12140 2659 1769 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence284 409 185 gene locus_tag LOCUS_12150 409 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2323 707 gene locus_tag LOCUS_12160 2323 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_12160 2746 2408 gene locus_tag LOCUS_12170 2746 2408 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPS6 protein_id gnl|my_center|LOCUS_12170 >Feature sequence285 857 129 gene locus_tag LOCUS_12180 857 129 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_12180 1462 914 gene locus_tag LOCUS_12190 1462 914 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 protein_id gnl|my_center|LOCUS_12190 <2804 1455 gene locus_tag LOCUS_12200 <2804 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTP4:methionine--tRNA ligase >Feature sequence286 1560 997 gene locus_tag LOCUS_12210 1560 997 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_12210 2658 1660 gene locus_tag LOCUS_12220 gene trpS 2658 1660 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_12220 >Feature sequence287 1966 545 gene locus_tag LOCUS_12230 gene gltX2 1966 545 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_12230 2069 2599 gene locus_tag LOCUS_12240 2069 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence288 <1 1019 gene locus_tag LOCUS_12250 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWE2:glutamyl-tRNA reductase 1016 2089 gene locus_tag LOCUS_12260 gene prfA 1016 2089 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence289 1600 1031 gene locus_tag LOCUS_12270 1600 1031 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 protein_id gnl|my_center|LOCUS_12270 2552 1608 gene locus_tag LOCUS_12280 2552 1608 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390300.1 protein_id gnl|my_center|LOCUS_12280 2704 2778 gene locus_tag LOCUS_t00070 2704 2778 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence290 2555 1152 gene locus_tag LOCUS_12290 gene glmU 2555 1152 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_12290 2665 2739 gene locus_tag LOCUS_t00080 2665 2739 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence291 323 1744 gene locus_tag LOCUS_12300 323 1744 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_12300 >Feature sequence292 <1 1449 gene locus_tag LOCUS_12310 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RT58:CTP synthase 1464 2306 gene locus_tag LOCUS_12320 gene kdsA 1464 2306 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5A9 protein_id gnl|my_center|LOCUS_12320 >Feature sequence293 <2762 1811 gene locus_tag LOCUS_12330 <2762 1811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389301.1:ATP-binding protein >Feature sequence294 <1 544 gene locus_tag LOCUS_12340 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188554.1:phosphoenolpyruvate mutase 541 1680 gene locus_tag LOCUS_12350 541 1680 CDS product thiamine pyrophosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_12350 1677 2279 gene locus_tag LOCUS_12360 1677 2279 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence295 221 2050 gene locus_tag LOCUS_12370 221 2050 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence296 779 1702 gene locus_tag LOCUS_12380 779 1702 CDS product ferredoxin-NADP+ reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence297 <1 1329 gene locus_tag LOCUS_12390 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89RF7:pyruvate dehydrogenase E1 component 1760 1374 gene locus_tag LOCUS_12400 1760 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence298 2059 1079 gene locus_tag LOCUS_12410 2059 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_12410 <2698 2132 gene locus_tag LOCUS_12420 <2698 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946904.1:AmmeMemoRadiSam system radical SAM enzyme >Feature sequence299 <1 777 gene locus_tag LOCUS_12430 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207107.1:potassium voltage gated channel, Shab-related subfamily, member 2 2390 783 gene locus_tag LOCUS_12440 gene pckA 2390 783 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43085 protein_id gnl|my_center|LOCUS_12440 >Feature sequence300 416 694 gene locus_tag LOCUS_12450 416 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 798 1511 gene locus_tag LOCUS_12460 798 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1731 2672 gene locus_tag LOCUS_12470 1731 2672 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391000.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence301 <1 1202 gene locus_tag LOCUS_12480 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVE4:phosphoglucosamine mutase 1214 2014 gene locus_tag LOCUS_12490 1214 2014 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence302 880 119 gene locus_tag LOCUS_12500 880 119 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391142.1 protein_id gnl|my_center|LOCUS_12500 1303 1611 gene locus_tag LOCUS_12510 gene ureA 1303 1611 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44393 protein_id gnl|my_center|LOCUS_12510 1634 2158 gene locus_tag LOCUS_12520 1634 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 >Feature sequence303 <1 1129 gene locus_tag LOCUS_12530 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086430.1:acetyltransferase 2317 1688 gene locus_tag LOCUS_12540 2317 1688 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence304 137 60 gene locus_tag LOCUS_t00090 137 60 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 337 1572 gene locus_tag LOCUS_12550 gene pfp 337 1572 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNU4 protein_id gnl|my_center|LOCUS_12550 2027 1569 gene locus_tag LOCUS_12560 2027 1569 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_12560 <2672 2052 gene locus_tag LOCUS_12570 <2672 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390161.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence305 <1 1596 gene locus_tag LOCUS_12580 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389162.1:methyl-accepting chemotaxis protein >Feature sequence306 641 760 gene locus_tag LOCUS_12590 641 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2050 1178 gene locus_tag LOCUS_12600 2050 1178 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence307 >Feature sequence308 287 1117 gene locus_tag LOCUS_12610 gene rplB 287 1117 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW3 protein_id gnl|my_center|LOCUS_12610 1131 1409 gene locus_tag LOCUS_12620 gene rpsS 1131 1409 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_12620 1413 1793 gene locus_tag LOCUS_12630 gene rplV 1413 1793 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW5 protein_id gnl|my_center|LOCUS_12630 1793 2470 gene locus_tag LOCUS_12640 gene rpsC 1793 2470 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_12640 >Feature sequence309 426 911 gene locus_tag LOCUS_12650 426 911 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088978.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence310 <1 717 gene locus_tag LOCUS_12660 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920340.1:non-motile and phage-resistance protein 740 1600 gene locus_tag LOCUS_12670 740 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_12670 1760 2575 gene locus_tag LOCUS_12680 1760 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence311 1367 615 gene locus_tag LOCUS_12690 1367 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1826 2563 gene locus_tag LOCUS_12700 1826 2563 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence312 1315 251 gene locus_tag LOCUS_12710 1315 251 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089456.1 protein_id gnl|my_center|LOCUS_12710 1857 1675 gene locus_tag LOCUS_12720 1857 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence313 344 799 gene locus_tag LOCUS_12730 344 799 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_12730 1308 913 gene locus_tag LOCUS_12740 1308 913 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_12740 1770 1997 gene locus_tag LOCUS_12750 1770 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2169 1987 gene locus_tag LOCUS_12760 2169 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence314 <1 1471 gene locus_tag LOCUS_12770 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TKA4:dihydroxy-acid dehydratase 1499 1804 gene locus_tag LOCUS_12780 1499 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence315 210 695 gene locus_tag LOCUS_12790 210 695 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_12790 724 1206 gene locus_tag LOCUS_12800 724 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_12800 2626 1193 gene locus_tag LOCUS_12810 2626 1193 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709743.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence316 <2625 729 gene locus_tag LOCUS_12820 <2625 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPE8:DNA topoisomerase 1 >Feature sequence317 1270 227 gene locus_tag LOCUS_12830 gene purC2 1270 227 CDS product putative phosphoribosylaminoimidazole-succinocarboxamide synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCE7 protein_id gnl|my_center|LOCUS_12830 1354 2190 gene locus_tag LOCUS_12840 gene panB 1354 2190 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP30 protein_id gnl|my_center|LOCUS_12840 >Feature sequence318 <1 1057 gene locus_tag LOCUS_12850 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89VV9:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 1075 2319 gene locus_tag LOCUS_12860 gene hisS 1075 2319 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_12860 >Feature sequence319 1831 1061 gene locus_tag LOCUS_12870 1831 1061 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_12870 1913 2566 gene locus_tag LOCUS_12880 1913 2566 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence320 502 326 gene locus_tag LOCUS_12890 502 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1183 542 gene locus_tag LOCUS_12900 gene thrH 1183 542 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_12900 1959 1282 gene locus_tag LOCUS_12910 1959 1282 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_12910 2576 1974 gene locus_tag LOCUS_12920 2576 1974 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence321 373 1056 gene locus_tag LOCUS_12930 373 1056 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_12930 1078 2400 gene locus_tag LOCUS_12940 1078 2400 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence322 456 1757 gene locus_tag LOCUS_12950 gene tolB 456 1757 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_12950 1941 2459 gene locus_tag LOCUS_12960 1941 2459 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066845.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence323 3 350 gene locus_tag LOCUS_12970 3 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 347 1285 gene locus_tag LOCUS_12980 347 1285 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022765.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence324 1391 99 gene locus_tag LOCUS_12990 1391 99 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040769.1 protein_id gnl|my_center|LOCUS_12990 2521 1391 gene locus_tag LOCUS_13000 2521 1391 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence325 124 585 gene locus_tag LOCUS_13010 124 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1452 643 gene locus_tag LOCUS_13020 gene coxC 1452 643 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_13020 2116 1472 gene locus_tag LOCUS_13030 gene ctaG 2116 1472 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_13030 >Feature sequence326 521 51 gene locus_tag LOCUS_13040 521 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1254 616 gene locus_tag LOCUS_13050 gene can-2 1254 616 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AP5 protein_id gnl|my_center|LOCUS_13050 1882 1268 gene locus_tag LOCUS_13060 1882 1268 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_13060 2299 1889 gene locus_tag LOCUS_13070 2299 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence327 1130 225 gene locus_tag LOCUS_13080 gene ddl 1130 225 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU7 protein_id gnl|my_center|LOCUS_13080 2083 1127 gene locus_tag LOCUS_13090 gene murB 2083 1127 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_13090 >Feature sequence328 712 269 gene locus_tag LOCUS_13100 712 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 821 1378 gene locus_tag LOCUS_13110 821 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2557 1451 gene locus_tag LOCUS_13120 2557 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence329 363 196 gene locus_tag LOCUS_13130 363 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 394 594 gene locus_tag LOCUS_13140 394 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 651 1649 gene locus_tag LOCUS_13150 651 1649 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_13150 1670 2527 gene locus_tag LOCUS_13160 1670 2527 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089430.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence330 <1 972 gene locus_tag LOCUS_13170 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391410.1:glutamate dehydrogenase 1000 2283 gene locus_tag LOCUS_13180 1000 2283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence331 752 51 gene locus_tag LOCUS_13190 752 51 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 protein_id gnl|my_center|LOCUS_13190 885 1850 gene locus_tag LOCUS_13200 gene oppB 885 1850 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860738.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence332 <1 690 gene locus_tag LOCUS_13210 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTS1:bifunctional enzyme IspD/IspF 1010 687 gene locus_tag LOCUS_13220 1010 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1252 1464 gene locus_tag LOCUS_13230 1252 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1563 1898 gene locus_tag LOCUS_13240 1563 1898 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ91 protein_id gnl|my_center|LOCUS_13240 >Feature sequence333 1049 2044 gene locus_tag LOCUS_13250 1049 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_13250 2231 2506 gene locus_tag LOCUS_13260 2231 2506 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389635.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence334 <2536 1053 gene locus_tag LOCUS_13270 <2536 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086717.1:propionyl-CoA carboxylase subunit beta >Feature sequence335 2 259 gene locus_tag LOCUS_13280 2 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 717 256 gene locus_tag LOCUS_13290 717 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1144 851 gene locus_tag LOCUS_13300 1144 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1574 1155 gene locus_tag LOCUS_13310 1574 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_13310 2308 1580 gene locus_tag LOCUS_13320 2308 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence336 >Feature sequence337 255 833 gene locus_tag LOCUS_13330 255 833 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_13330 954 1703 gene locus_tag LOCUS_13340 954 1703 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence338 <1 769 gene locus_tag LOCUS_13350 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P29363:threonine synthase 771 1985 gene locus_tag LOCUS_13360 771 1985 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_13360 2255 1989 gene locus_tag LOCUS_13370 2255 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence339 1422 850 gene locus_tag LOCUS_13380 1422 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence340 1056 241 gene locus_tag LOCUS_13390 1056 241 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_13390 1550 1062 gene locus_tag LOCUS_13400 1550 1062 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_13400 1806 1555 gene locus_tag LOCUS_13410 gene moaD 1806 1555 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_13410 2523 1813 gene locus_tag LOCUS_13420 2523 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence341 <1 1872 gene locus_tag LOCUS_13430 <1 1872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQT8:DNA topoisomerase 4 subunit B >Feature sequence342 >Feature sequence343 1639 1172 gene locus_tag LOCUS_13440 1639 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_13440 <2515 1636 gene locus_tag LOCUS_13450 <2515 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057816.1:MBL fold metallo-hydrolase >Feature sequence344 177 1418 gene locus_tag LOCUS_13460 177 1418 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387793.1 protein_id gnl|my_center|LOCUS_13460 1481 2167 gene locus_tag LOCUS_13470 1481 2167 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence345 312 1100 gene locus_tag LOCUS_13480 312 1100 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_13480 1176 1442 gene locus_tag LOCUS_13490 gene grxC 1176 1442 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_13490 1450 2286 gene locus_tag LOCUS_13500 1450 2286 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence346 999 379 gene locus_tag LOCUS_13510 999 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2473 1004 gene locus_tag LOCUS_13520 gene hldE 2473 1004 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_13520 >Feature sequence347 121 1581 gene locus_tag LOCUS_13530 121 1581 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090818.1 protein_id gnl|my_center|LOCUS_13530 <2493 1593 gene locus_tag LOCUS_13540 <2493 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814321.1:gamma-glutamyltranspeptidase >Feature sequence348 1311 268 gene locus_tag LOCUS_13550 gene purM 1311 268 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC8 protein_id gnl|my_center|LOCUS_13550 >Feature sequence349 1149 1964 gene locus_tag LOCUS_13560 gene cpdA 1149 1964 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ1 protein_id gnl|my_center|LOCUS_13560 2364 1984 gene locus_tag LOCUS_13570 2364 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence350 1034 540 gene locus_tag LOCUS_13580 1034 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1926 1210 gene locus_tag LOCUS_13590 gene trmB 1926 1210 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_13590 <2470 1923 gene locus_tag LOCUS_13600 <2470 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMS5:S-adenosylmethionine synthase 2 >Feature sequence351 339 1292 gene locus_tag LOCUS_13610 339 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 protein_id gnl|my_center|LOCUS_13610 <2469 1321 gene locus_tag LOCUS_13620 <2469 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931188.1:hydrolase >Feature sequence352 406 1626 gene locus_tag LOCUS_13630 gene iscS 406 1626 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 protein_id gnl|my_center|LOCUS_13630 >Feature sequence353 3 767 gene locus_tag LOCUS_13640 3 767 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_13640 805 1686 gene locus_tag LOCUS_13650 805 1686 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_13650 <2461 1744 gene locus_tag LOCUS_13660 <2461 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPE0:methyltransferase >Feature sequence354 <1 670 gene locus_tag LOCUS_13670 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV18:ATP synthase subunit beta 727 1155 gene locus_tag LOCUS_13680 gene atpC 727 1155 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_13680 1182 1406 gene locus_tag LOCUS_13690 1182 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13690 1443 1655 gene locus_tag LOCUS_13700 1443 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13700 <2460 1720 gene locus_tag LOCUS_13710 <2460 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVB1:UvrABC system protein B >Feature sequence355 <1 1134 gene locus_tag LOCUS_13720 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391123.1:glycosyl transferase 1135 2064 gene locus_tag LOCUS_13730 1135 2064 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence356 >Feature sequence357 1295 639 gene locus_tag LOCUS_13740 1295 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2166 1444 gene locus_tag LOCUS_13750 2166 1444 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIM5 protein_id gnl|my_center|LOCUS_13750 >Feature sequence358 682 314 gene locus_tag LOCUS_13760 682 314 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340730.1 protein_id gnl|my_center|LOCUS_13760 977 2245 gene locus_tag LOCUS_13770 977 2245 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence359 1840 1166 gene locus_tag LOCUS_13780 1840 1166 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088781.1 protein_id gnl|my_center|LOCUS_13780 <2453 1824 gene locus_tag LOCUS_13790 <2453 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088782.1:glycolate oxidase >Feature sequence360 118 43 gene locus_tag LOCUS_t00100 118 43 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1223 198 gene locus_tag LOCUS_13800 1223 198 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_13800 1664 1242 gene locus_tag LOCUS_13810 1664 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_13810 2020 1661 gene locus_tag LOCUS_13820 2020 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence361 1211 726 gene locus_tag LOCUS_13830 1211 726 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_13830 2077 1208 gene locus_tag LOCUS_13840 2077 1208 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence362 290 30 gene locus_tag LOCUS_13850 gene acyP 290 30 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ4 protein_id gnl|my_center|LOCUS_13850 2308 323 gene locus_tag LOCUS_13860 2308 323 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence363 >Feature sequence364 <1 903 gene locus_tag LOCUS_13870 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O53182:2-oxoglutarate oxidoreductase subunit KorA 906 1871 gene locus_tag LOCUS_13880 gene korB 906 1871 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946683.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence365 <1 1204 gene locus_tag LOCUS_13890 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN77:tRNA modification GTPase MnmE 1311 2108 gene locus_tag LOCUS_13900 1311 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence366 112 417 gene locus_tag LOCUS_13910 112 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 448 1914 gene locus_tag LOCUS_13920 448 1914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810841.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13920 <2410 1908 gene locus_tag LOCUS_13930 <2410 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969070.1:4-amino-4-deoxychorismate lyase >Feature sequence367 1158 229 gene locus_tag LOCUS_13940 1158 229 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_13940 2339 1170 gene locus_tag LOCUS_13950 2339 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040164.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence368 1796 282 gene locus_tag LOCUS_13960 1796 282 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_13960 <2405 1801 gene locus_tag LOCUS_13970 <2405 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389441.1:NADH:ubiquinone oxidoreductase subunit L >Feature sequence369 1313 1047 gene locus_tag LOCUS_13980 1313 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 <2401 1313 gene locus_tag LOCUS_13990 <2401 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXE3:argininosuccinate lyase >Feature sequence370 1710 2288 gene locus_tag LOCUS_14000 1710 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence371 490 562 gene locus_tag LOCUS_t00110 490 562 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1482 736 gene locus_tag LOCUS_14010 1482 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence372 82 630 gene locus_tag LOCUS_14020 82 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55616 protein_id gnl|my_center|LOCUS_14020 588 1139 gene locus_tag LOCUS_14030 588 1139 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887099.1 protein_id gnl|my_center|LOCUS_14030 1883 1293 gene locus_tag LOCUS_14040 gene pdxH 1883 1293 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_14040 >Feature sequence373 402 1214 gene locus_tag LOCUS_14050 402 1214 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085602.1 protein_id gnl|my_center|LOCUS_14050 1222 2184 gene locus_tag LOCUS_14060 1222 2184 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433612.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence374 <2384 638 gene locus_tag LOCUS_14070 <2384 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVV5:DNA ligase >Feature sequence375 773 1291 gene locus_tag LOCUS_14080 773 1291 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_14080 1976 1314 gene locus_tag LOCUS_14090 1976 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence376 212 1039 gene locus_tag LOCUS_14100 gene cpdA 212 1039 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7A0 protein_id gnl|my_center|LOCUS_14100 2193 1027 gene locus_tag LOCUS_14110 gene sat 2193 1027 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_14110 >Feature sequence377 949 548 gene locus_tag LOCUS_14120 949 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1219 2274 gene locus_tag LOCUS_14130 1219 2274 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence378 2 307 gene locus_tag LOCUS_14140 2 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1764 304 gene locus_tag LOCUS_14150 1764 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence379 1493 843 gene locus_tag LOCUS_14160 1493 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence380 765 2075 gene locus_tag LOCUS_14170 765 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence381 1182 4 gene locus_tag LOCUS_14180 1182 4 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_14180 2347 1253 gene locus_tag LOCUS_14190 2347 1253 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence382 <2353 832 gene locus_tag LOCUS_14200 <2353 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92UW6:putative sulfoacetaldehyde acetyltransferase >Feature sequence383 497 1144 gene locus_tag LOCUS_14210 497 1144 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_14210 1125 2246 gene locus_tag LOCUS_14220 1125 2246 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence384 1937 1422 gene locus_tag LOCUS_14230 1937 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence385 >Feature sequence386 1213 437 gene locus_tag LOCUS_14240 gene hpaH2 1213 437 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888083.1 protein_id gnl|my_center|LOCUS_14240 1411 1869 gene locus_tag LOCUS_14250 1411 1869 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529636.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence387 405 1247 gene locus_tag LOCUS_14260 405 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_14260 >Feature sequence388 522 7 gene locus_tag LOCUS_14270 522 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1634 573 gene locus_tag LOCUS_14280 1634 573 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213192.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence389 430 717 gene locus_tag LOCUS_14290 430 717 CDS product protein killer gene system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816230.1 protein_id gnl|my_center|LOCUS_14290 724 1005 gene locus_tag LOCUS_14300 gene higA 724 1005 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence390 <1 1571 gene locus_tag LOCUS_14310 <1 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920930.1:diguanylate cyclase note possible pseudo, internal stop codon, frameshifted 1951 1568 gene locus_tag LOCUS_14320 1951 1568 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence391 502 1263 gene locus_tag LOCUS_14330 502 1263 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969288.1 protein_id gnl|my_center|LOCUS_14330 2137 1286 gene locus_tag LOCUS_14340 2137 1286 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence392 192 1106 gene locus_tag LOCUS_14350 gene fmt 192 1106 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_14350 >Feature sequence393 <1 834 gene locus_tag LOCUS_14360 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391181.1:double-strand break repair helicase AddA 901 1218 gene locus_tag LOCUS_14370 901 1218 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_14370 1894 1277 gene locus_tag LOCUS_14380 1894 1277 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence394 455 1468 gene locus_tag LOCUS_14390 455 1468 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_14390 1497 2153 gene locus_tag LOCUS_14400 1497 2153 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEA3 protein_id gnl|my_center|LOCUS_14400 >Feature sequence395 138 1145 gene locus_tag LOCUS_14410 138 1145 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_14410 <2273 1153 gene locus_tag LOCUS_14420 <2273 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B650:transporter >Feature sequence396 <1 777 gene locus_tag LOCUS_14430 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528148.1:sarcosine oxidase subunit beta 790 1077 gene locus_tag LOCUS_14440 790 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence397 2057 1494 gene locus_tag LOCUS_14450 2057 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence398 1234 299 gene locus_tag LOCUS_14460 1234 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14460 <2266 1248 gene locus_tag LOCUS_14470 <2266 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531306.1:protein translocase subunit SecDF note possible pseudo, internal stop codon, frameshifted >Feature sequence399 >Feature sequence400 >Feature sequence401 527 1729 gene locus_tag LOCUS_14480 527 1729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088315.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence402 >Feature sequence403 2233 1175 gene locus_tag LOCUS_14490 2233 1175 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence404 142 1665 gene locus_tag LOCUS_14500 142 1665 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence405 1185 649 gene locus_tag LOCUS_14510 1185 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence406 1 885 gene locus_tag LOCUS_14520 1 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1613 882 gene locus_tag LOCUS_14530 1613 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 <2226 1620 gene locus_tag LOCUS_14540 <2226 1620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89S35:threonylcarbamoyl-AMP synthase >Feature sequence407 <1 1355 gene locus_tag LOCUS_14550 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388453.1:citramalate synthase 1373 2161 gene locus_tag LOCUS_14560 gene trmJ 1373 2161 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_14560 >Feature sequence408 2091 1399 gene locus_tag LOCUS_14570 2091 1399 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence409 1095 1550 gene locus_tag LOCUS_14580 1095 1550 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence410 1694 597 gene locus_tag LOCUS_14590 gene cbiD 1694 597 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8GDE1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence411 <1 697 gene locus_tag LOCUS_14600 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390378.1:iron transporter >Feature sequence412 857 273 gene locus_tag LOCUS_14610 857 273 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_14610 928 1668 gene locus_tag LOCUS_14620 928 1668 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_14620 1855 2124 gene locus_tag LOCUS_14630 1855 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence413 1310 342 gene locus_tag LOCUS_14640 1310 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1491 1564 gene locus_tag LOCUS_t00120 1491 1564 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2013 1825 gene locus_tag LOCUS_14650 2013 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence414 1 708 gene locus_tag LOCUS_14660 1 708 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_14660 724 939 gene locus_tag LOCUS_14670 724 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence415 3 509 gene locus_tag LOCUS_14680 3 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 678 1085 gene locus_tag LOCUS_14690 gene apaG 678 1085 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS0 protein_id gnl|my_center|LOCUS_14690 1137 1811 gene locus_tag LOCUS_14700 gene folE 1137 1811 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9H7 protein_id gnl|my_center|LOCUS_14700 >Feature sequence416 265 723 gene locus_tag LOCUS_14710 gene soxX 265 723 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086295.1 protein_id gnl|my_center|LOCUS_14710 805 1284 gene locus_tag LOCUS_14720 805 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1307 1630 gene locus_tag LOCUS_14730 gene soxZ 1307 1630 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence417 639 142 gene locus_tag LOCUS_14740 639 142 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 protein_id gnl|my_center|LOCUS_14740 816 1373 gene locus_tag LOCUS_14750 816 1373 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_14750 1370 1963 gene locus_tag LOCUS_14760 1370 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence418 <1 740 gene locus_tag LOCUS_14770 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVU7:D-alanine--D-alanine ligase 731 1585 gene locus_tag LOCUS_14780 731 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence419 632 1729 gene locus_tag LOCUS_14790 gene anmK 632 1729 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 protein_id gnl|my_center|LOCUS_14790 >Feature sequence420 >Feature sequence421 <1 1558 gene locus_tag LOCUS_14800 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDQ7:glucose-6-phosphate isomerase 2159 1548 gene locus_tag LOCUS_14810 2159 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence422 318 788 gene locus_tag LOCUS_14820 318 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 885 1298 gene locus_tag LOCUS_14830 885 1298 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_774854.2 protein_id gnl|my_center|LOCUS_14830 >Feature sequence423 421 942 gene locus_tag LOCUS_14840 421 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 945 1535 gene locus_tag LOCUS_14850 945 1535 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085642.1 protein_id gnl|my_center|LOCUS_14850 1697 1822 gene locus_tag LOCUS_14860 1697 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence424 857 57 gene locus_tag LOCUS_14870 857 57 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066944.1 protein_id gnl|my_center|LOCUS_14870 1383 865 gene locus_tag LOCUS_14880 1383 865 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066945.1 protein_id gnl|my_center|LOCUS_14880 1814 2014 gene locus_tag LOCUS_14890 1814 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence425 246 560 gene locus_tag LOCUS_14900 246 560 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH5 protein_id gnl|my_center|LOCUS_14900 557 1468 gene locus_tag LOCUS_14910 gene folD 557 1468 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_14910 >Feature sequence426 325 98 gene locus_tag LOCUS_14920 325 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1375 1794 gene locus_tag LOCUS_14930 1375 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence427 171 1214 gene locus_tag LOCUS_14940 171 1214 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_14940 2061 1324 gene locus_tag LOCUS_14950 2061 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence428 452 1612 gene locus_tag LOCUS_14960 452 1612 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_14960 <2142 1614 gene locus_tag LOCUS_14970 <2142 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975837.1:membrane protein >Feature sequence429 2008 536 gene locus_tag LOCUS_14980 2008 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence430 1872 205 gene locus_tag LOCUS_14990 1872 205 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence431 444 271 gene locus_tag LOCUS_15000 444 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 511 1410 gene locus_tag LOCUS_15010 511 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1561 1412 gene locus_tag LOCUS_15020 1561 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1574 1786 gene locus_tag LOCUS_15030 1574 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence432 1127 153 gene locus_tag LOCUS_15040 1127 153 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_15040 <2131 1172 gene locus_tag LOCUS_15050 <2131 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNE7:chaperone protein DnaJ >Feature sequence433 1080 193 gene locus_tag LOCUS_15060 gene hemF 1080 193 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAT8 protein_id gnl|my_center|LOCUS_15060 1586 1092 gene locus_tag LOCUS_15070 gene trmL 1586 1092 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE3 protein_id gnl|my_center|LOCUS_15070 >Feature sequence434 1529 441 gene locus_tag LOCUS_15080 1529 441 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_15080 2022 1564 gene locus_tag LOCUS_15090 gene nrdR 2022 1564 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_15090 >Feature sequence435 <1 651 gene locus_tag LOCUS_15100 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_108698.2:acetylornithine deacetylase <2126 648 gene locus_tag LOCUS_15110 <2126 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027076.1:oxidoreductase >Feature sequence436 884 2065 gene locus_tag LOCUS_15120 gene sucC 884 2065 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT18 protein_id gnl|my_center|LOCUS_15120 >Feature sequence437 493 86 gene locus_tag LOCUS_15130 493 86 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_15130 1432 548 gene locus_tag LOCUS_15140 1432 548 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_15140 1898 1443 gene locus_tag LOCUS_15150 1898 1443 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence438 339 115 gene locus_tag LOCUS_15160 339 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1046 336 gene locus_tag LOCUS_15170 1046 336 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_15170 2108 1050 gene locus_tag LOCUS_15180 2108 1050 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence439 >Feature sequence440 <1 501 gene locus_tag LOCUS_15190 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQV0:50S ribosomal protein L1 866 1384 gene locus_tag LOCUS_15200 gene rplJ 866 1384 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_15200 1442 1816 gene locus_tag LOCUS_15210 gene rplL 1442 1816 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 protein_id gnl|my_center|LOCUS_15210 >Feature sequence441 193 47 gene locus_tag LOCUS_15220 193 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 882 394 gene locus_tag LOCUS_15230 gene atpF1 882 394 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA7 protein_id gnl|my_center|LOCUS_15230 1389 898 gene locus_tag LOCUS_15240 gene atpF2 1389 898 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ14 protein_id gnl|my_center|LOCUS_15240 1677 1453 gene locus_tag LOCUS_15250 gene atpE 1677 1453 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA5 protein_id gnl|my_center|LOCUS_15250 >Feature sequence442 >Feature sequence443 182 1735 gene locus_tag LOCUS_15260 182 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence444 1781 405 gene locus_tag LOCUS_15270 gene tilS 1781 405 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE7 protein_id gnl|my_center|LOCUS_15270 >Feature sequence445 1291 359 gene locus_tag LOCUS_15280 1291 359 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence446 94 651 gene locus_tag LOCUS_15290 94 651 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence447 1 615 gene locus_tag LOCUS_15300 1 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1575 685 gene locus_tag LOCUS_15310 1575 685 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence448 448 798 gene locus_tag LOCUS_15320 448 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15320 965 1528 gene locus_tag LOCUS_15330 965 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence449 251 1045 gene locus_tag LOCUS_15340 gene thyA 251 1045 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ5 protein_id gnl|my_center|LOCUS_15340 1057 1575 gene locus_tag LOCUS_15350 1057 1575 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM58 protein_id gnl|my_center|LOCUS_15350 >Feature sequence450 1101 103 gene locus_tag LOCUS_15360 gene thiG 1101 103 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_15360 1265 1717 gene locus_tag LOCUS_15370 gene aroQ 1265 1717 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_15370 >Feature sequence451 331 1080 gene locus_tag LOCUS_15380 331 1080 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_15380 1096 1959 gene locus_tag LOCUS_15390 gene phnE 1096 1959 CDS product phosphonate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence452 1314 430 gene locus_tag LOCUS_15400 1314 430 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728061.1 protein_id gnl|my_center|LOCUS_15400 1786 1325 gene locus_tag LOCUS_15410 gene tadA 1786 1325 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J463 protein_id gnl|my_center|LOCUS_15410 >Feature sequence453 1066 605 gene locus_tag LOCUS_15420 gene rlmH 1066 605 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV09 protein_id gnl|my_center|LOCUS_15420 1442 1077 gene locus_tag LOCUS_15430 gene rsfS 1442 1077 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV08 protein_id gnl|my_center|LOCUS_15430 <2047 1522 gene locus_tag LOCUS_15440 <2047 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV07:putative nicotinate-nucleotide adenylyltransferase >Feature sequence454 1 858 gene locus_tag LOCUS_15450 1 858 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973849.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence455 1527 241 gene locus_tag LOCUS_15460 gene murA 1527 241 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ67 protein_id gnl|my_center|LOCUS_15460 1812 1633 gene locus_tag LOCUS_15470 1812 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence456 1023 244 gene locus_tag LOCUS_15480 1023 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1825 1028 gene locus_tag LOCUS_15490 1825 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence457 <1 976 gene locus_tag LOCUS_15500 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTG6:arginine--tRNA ligase 1107 1373 gene locus_tag LOCUS_15510 1107 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1530 1880 gene locus_tag LOCUS_15520 1530 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15520 >Feature sequence458 >Feature sequence459 1251 379 gene locus_tag LOCUS_15530 1251 379 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence460 <1 1143 gene locus_tag LOCUS_15540 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TN21:D-3-phosphoglycerate dehydrogenase >Feature sequence461 191 928 gene locus_tag LOCUS_15550 191 928 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_15550 1093 1872 gene locus_tag LOCUS_15560 gene flgG 1093 1872 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06172 protein_id gnl|my_center|LOCUS_15560 >Feature sequence462 807 1652 gene locus_tag LOCUS_15570 807 1652 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence463 <1 825 gene locus_tag LOCUS_15580 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389997.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence464 <1 763 gene locus_tag LOCUS_15590 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390034.1:indolepyruvate ferredoxin oxidoreductase 1639 764 gene locus_tag LOCUS_15600 1639 764 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence465 >Feature sequence466 <1 525 gene locus_tag LOCUS_15610 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RRE2:hydroxypyruvate isomerase 650 1111 gene locus_tag LOCUS_15620 650 1111 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388478.1 protein_id gnl|my_center|LOCUS_15620 1813 1118 gene locus_tag LOCUS_15630 1813 1118 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530075.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence467 464 2002 gene locus_tag LOCUS_15640 464 2002 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence468 1592 531 gene locus_tag LOCUS_15650 1592 531 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence469 <1 759 gene locus_tag LOCUS_15660 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706368.1:thiamine pyrophosphate protein 774 1694 gene locus_tag LOCUS_15670 774 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence470 122 1609 gene locus_tag LOCUS_15680 122 1609 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence471 489 1613 gene locus_tag LOCUS_15690 489 1613 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403941.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence472 87 1040 gene locus_tag LOCUS_15700 87 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15700 1045 1725 gene locus_tag LOCUS_15710 1045 1725 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence473 <1 621 gene locus_tag LOCUS_15720 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQM6:ATP phosphoribosyltransferase 605 1921 gene locus_tag LOCUS_15730 gene hisD 605 1921 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_15730 >Feature sequence474 126 746 gene locus_tag LOCUS_15740 126 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 814 1605 gene locus_tag LOCUS_15750 814 1605 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence475 1001 396 gene locus_tag LOCUS_15760 1001 396 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_15760 1094 1819 gene locus_tag LOCUS_15770 1094 1819 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence476 211 843 gene locus_tag LOCUS_15780 211 843 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533656.1 protein_id gnl|my_center|LOCUS_15780 1980 868 gene locus_tag LOCUS_15790 1980 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence477 <1 573 gene locus_tag LOCUS_15800 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086294.1:thioredoxin 1701 598 gene locus_tag LOCUS_15810 1701 598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085683.1 protein_id gnl|my_center|LOCUS_15810 1978 1703 gene locus_tag LOCUS_15820 1978 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence478 695 1486 gene locus_tag LOCUS_15830 gene ubiG 695 1486 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE9 protein_id gnl|my_center|LOCUS_15830 >Feature sequence479 766 1554 gene locus_tag LOCUS_15840 766 1554 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence480 1426 1782 gene locus_tag LOCUS_15850 1426 1782 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence481 696 82 gene locus_tag LOCUS_15860 696 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1627 722 gene locus_tag LOCUS_15870 1627 722 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence482 1268 294 gene locus_tag LOCUS_15880 gene qor 1268 294 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_15880 1822 1370 gene locus_tag LOCUS_15890 1822 1370 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN80 protein_id gnl|my_center|LOCUS_15890 >Feature sequence483 >Feature sequence484 457 20 gene locus_tag LOCUS_15900 457 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389917.1 protein_id gnl|my_center|LOCUS_15900 1362 454 gene locus_tag LOCUS_15910 1362 454 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence485 143 1594 gene locus_tag LOCUS_15920 143 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence486 <1 651 gene locus_tag LOCUS_15930 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812137.1:ABC transporter substrate-binding protein 656 1183 gene locus_tag LOCUS_15940 656 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence487 <1 1218 gene locus_tag LOCUS_15950 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPA2:chromosome partition protein Smc 1235 1612 gene locus_tag LOCUS_15960 1235 1612 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA3 protein_id gnl|my_center|LOCUS_15960 >Feature sequence488 909 778 gene locus_tag LOCUS_15970 909 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence489 <1 1108 gene locus_tag LOCUS_15980 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU27:NADH-quinone oxidoreductase subunit N 1123 1887 gene locus_tag LOCUS_15990 1123 1887 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389444.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence490 4 1716 gene locus_tag LOCUS_16000 4 1716 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence491 600 1766 gene locus_tag LOCUS_16010 600 1766 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence492 >Feature sequence493 288 1328 gene locus_tag LOCUS_16020 288 1328 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_16020 1333 1869 gene locus_tag LOCUS_16030 1333 1869 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX9 protein_id gnl|my_center|LOCUS_16030 >Feature sequence494 1163 903 gene locus_tag LOCUS_16040 1163 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1796 1263 gene locus_tag LOCUS_16050 1796 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence495 297 818 gene locus_tag LOCUS_16060 gene rimM 297 818 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 protein_id gnl|my_center|LOCUS_16060 821 1537 gene locus_tag LOCUS_16070 gene trmD 821 1537 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV57 protein_id gnl|my_center|LOCUS_16070 >Feature sequence496 <1 1681 gene locus_tag LOCUS_16080 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPE7:ribonuclease R >Feature sequence497 >Feature sequence498 1459 143 gene locus_tag LOCUS_16090 1459 143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383447.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence499 <1 1357 gene locus_tag LOCUS_16100 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930200.1:malic enzyme note possible pseudo, internal stop codon >Feature sequence500 565 993 gene locus_tag LOCUS_16110 gene hisI 565 993 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_16110 1361 1011 gene locus_tag LOCUS_16120 1361 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence501 655 804 gene locus_tag LOCUS_16130 655 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_16130 818 1810 gene locus_tag LOCUS_16140 818 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence502 291 464 gene locus_tag LOCUS_16150 291 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 480 1760 gene locus_tag LOCUS_16160 480 1760 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085520.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence503 370 1284 gene locus_tag LOCUS_16170 gene prpB 370 1284 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRX5 protein_id gnl|my_center|LOCUS_16170 >Feature sequence504 239 832 gene locus_tag LOCUS_16180 239 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence505 >Feature sequence506 <1 572 gene locus_tag LOCUS_16190 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389782.1:serine acetyltransferase 634 1107 gene locus_tag LOCUS_16200 634 1107 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence507 402 944 gene locus_tag LOCUS_16210 402 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 961 1800 gene locus_tag LOCUS_16220 961 1800 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence508 697 314 gene locus_tag LOCUS_16230 697 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 813 953 gene locus_tag LOCUS_16240 813 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1366 986 gene locus_tag LOCUS_16250 1366 986 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390519.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence509 291 1589 gene locus_tag LOCUS_16260 gene glgC 291 1589 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6V3 protein_id gnl|my_center|LOCUS_16260 >Feature sequence510 843 649 gene locus_tag LOCUS_16270 843 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1632 934 gene locus_tag LOCUS_16280 1632 934 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088228.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence511 1257 298 gene locus_tag LOCUS_16290 1257 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 <1870 1286 gene locus_tag LOCUS_16300 <1870 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001081268.1:NadC family protein >Feature sequence512 534 232 gene locus_tag LOCUS_16310 gene ureA 534 232 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42887 protein_id gnl|my_center|LOCUS_16310 1412 555 gene locus_tag LOCUS_16320 gene ureD 1412 555 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J149 protein_id gnl|my_center|LOCUS_16320 >Feature sequence513 698 826 gene locus_tag LOCUS_16330 698 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1389 991 gene locus_tag LOCUS_16340 1389 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1751 1386 gene locus_tag LOCUS_16350 1751 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence514 1781 414 gene locus_tag LOCUS_16360 1781 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence515 1 945 gene locus_tag LOCUS_16370 gene mexH 1 945 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence516 >Feature sequence517 669 4 gene locus_tag LOCUS_16380 669 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1464 730 gene locus_tag LOCUS_16390 1464 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence518 395 958 gene locus_tag LOCUS_16400 395 958 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DM6 protein_id gnl|my_center|LOCUS_16400 962 1714 gene locus_tag LOCUS_16410 962 1714 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DM4 protein_id gnl|my_center|LOCUS_16410 >Feature sequence519 92 583 gene locus_tag LOCUS_16420 92 583 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_16420 743 1228 gene locus_tag LOCUS_16430 743 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence520 136 62 gene locus_tag LOCUS_t00130 136 62 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 335 1345 gene locus_tag LOCUS_16440 335 1345 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_16440 1433 1618 gene locus_tag LOCUS_16450 1433 1618 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Z9 protein_id gnl|my_center|LOCUS_16450 >Feature sequence521 902 54 gene locus_tag LOCUS_16460 902 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 <1841 918 gene locus_tag LOCUS_16470 <1841 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521274.1:fatty acid degradation protein >Feature sequence522 <1840 834 gene locus_tag LOCUS_16480 <1840 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388526.1:iron ABC transporter permease >Feature sequence523 1738 458 gene locus_tag LOCUS_16490 1738 458 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084588.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence524 511 137 gene locus_tag LOCUS_16500 511 137 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_16500 1618 518 gene locus_tag LOCUS_16510 1618 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16510 >Feature sequence525 <1832 1092 gene locus_tag LOCUS_16520 <1832 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A734:aspartate--tRNA(Asp/Asn) ligase >Feature sequence526 891 1340 gene locus_tag LOCUS_16530 891 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence527 >Feature sequence528 <1 997 gene locus_tag LOCUS_16540 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66855:succinate dehydrogenase flavoprotein subunit >Feature sequence529 1152 1445 gene locus_tag LOCUS_16550 gene groS 1152 1445 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV5 protein_id gnl|my_center|LOCUS_16550 >Feature sequence530 1566 1120 gene locus_tag LOCUS_16560 1566 1120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence531 210 31 gene locus_tag LOCUS_16570 210 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 406 720 gene locus_tag LOCUS_16580 406 720 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143846.1 protein_id gnl|my_center|LOCUS_16580 717 1580 gene locus_tag LOCUS_16590 717 1580 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143847.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence532 284 766 gene locus_tag LOCUS_16600 284 766 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence533 >Feature sequence534 386 715 gene locus_tag LOCUS_16610 386 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 839 708 gene locus_tag LOCUS_16620 839 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 1453 1073 gene locus_tag LOCUS_16630 1453 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16630 >Feature sequence535 224 574 gene locus_tag LOCUS_16640 224 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 568 1068 gene locus_tag LOCUS_16650 568 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_16650 1283 1639 gene locus_tag LOCUS_16660 1283 1639 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708275.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence536 242 1372 gene locus_tag LOCUS_16670 242 1372 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence537 1388 120 gene locus_tag LOCUS_16680 1388 120 CDS product transposase for insertion sequence element IS256 in transposon Tn4001 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59787 protein_id gnl|my_center|LOCUS_16680 >Feature sequence538 138 1556 gene locus_tag LOCUS_16690 138 1556 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence539 <1 1226 gene locus_tag LOCUS_16700 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896022.1:2-oxoglutarate ferredoxin oxidoreductase subunit alpha >Feature sequence540 195 935 gene locus_tag LOCUS_16710 195 935 CDS product pyridoxal 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529873.1 protein_id gnl|my_center|LOCUS_16710 1070 1510 gene locus_tag LOCUS_16720 1070 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1707 1555 gene locus_tag LOCUS_16730 1707 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence541 640 1545 gene locus_tag LOCUS_16740 gene ispE 640 1545 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS7 protein_id gnl|my_center|LOCUS_16740 1616 1692 gene locus_tag LOCUS_t00140 1616 1692 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence542 >Feature sequence543 <1 1092 gene locus_tag LOCUS_16750 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXR0:queuine tRNA-ribosyltransferase >Feature sequence544 477 1136 gene locus_tag LOCUS_16760 477 1136 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence545 428 793 gene locus_tag LOCUS_16770 428 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1519 827 gene locus_tag LOCUS_16780 1519 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence546 725 1609 gene locus_tag LOCUS_16790 725 1609 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061788.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence547 1538 636 gene locus_tag LOCUS_16800 1538 636 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083811.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence548 655 885 gene locus_tag LOCUS_16810 655 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 969 1553 gene locus_tag LOCUS_16820 969 1553 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence549 <1757 857 gene locus_tag LOCUS_16830 <1757 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:nicotinate dehydrogenase medium molybdopterin subunit >Feature sequence550 1555 293 gene locus_tag LOCUS_16840 1555 293 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence551 >Feature sequence552 782 87 gene locus_tag LOCUS_16850 782 87 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_16850 <1754 873 gene locus_tag LOCUS_16860 <1754 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390412.1:serine protease >Feature sequence553 383 114 gene locus_tag LOCUS_16870 383 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 996 511 gene locus_tag LOCUS_16880 996 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence554 <1753 636 gene locus_tag LOCUS_16890 <1753 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083393.1:membrane protein >Feature sequence555 >Feature sequence556 569 363 gene locus_tag LOCUS_16900 569 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 691 1443 gene locus_tag LOCUS_16910 691 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence557 >Feature sequence558 1634 489 gene locus_tag LOCUS_16920 gene murG 1634 489 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_16920 >Feature sequence559 <1 747 gene locus_tag LOCUS_16930 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89FY1:putative L-aspartate dehydrogenase 749 1204 gene locus_tag LOCUS_16940 749 1204 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840937.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence560 756 73 gene locus_tag LOCUS_16950 756 73 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_16950 <1722 856 gene locus_tag LOCUS_16960 <1722 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMV3:ribosome-binding ATPase YchF >Feature sequence561 1221 421 gene locus_tag LOCUS_16970 gene dapB 1221 421 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_16970 >Feature sequence562 648 301 gene locus_tag LOCUS_16980 648 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 <1718 659 gene locus_tag LOCUS_16990 <1718 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118365.1:cation:proton antiporter >Feature sequence563 >Feature sequence564 <1714 1038 gene locus_tag LOCUS_17000 <1714 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889312.1:acetyl-CoA acetyltransferase >Feature sequence565 569 1327 gene locus_tag LOCUS_17010 569 1327 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 protein_id gnl|my_center|LOCUS_17010 1622 1338 gene locus_tag LOCUS_17020 1622 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391512.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence566 <1704 960 gene locus_tag LOCUS_17030 <1704 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087942.1:ABC transporter permease >Feature sequence567 <1693 734 gene locus_tag LOCUS_17040 <1693 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388442.1:nicotinate phosphoribosyltransferase >Feature sequence568 <1 1194 gene locus_tag LOCUS_17050 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387827.1:PAS domain-containing sensor histidine kinase >Feature sequence569 211 1161 gene locus_tag LOCUS_17060 gene argC 211 1161 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H555 protein_id gnl|my_center|LOCUS_17060 1386 1213 gene locus_tag LOCUS_17070 1386 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence570 1112 99 gene locus_tag LOCUS_17080 1112 99 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418263.1 protein_id gnl|my_center|LOCUS_17080 1573 1109 gene locus_tag LOCUS_17090 1573 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence571 <1 1032 gene locus_tag LOCUS_17100 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390942.1:DNA processing protein DprA >Feature sequence572 1469 321 gene locus_tag LOCUS_17110 1469 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence573 <1 996 gene locus_tag LOCUS_17120 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176659.1:glycosyl transferase family 1 >Feature sequence574 >Feature sequence575 1262 666 gene locus_tag LOCUS_17130 1262 666 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEF4 protein_id gnl|my_center|LOCUS_17130 >Feature sequence576 634 302 gene locus_tag LOCUS_17140 634 302 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_17140 1004 651 gene locus_tag LOCUS_17150 1004 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_17150 1373 1035 gene locus_tag LOCUS_17160 1373 1035 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_17160 1670 1380 gene locus_tag LOCUS_17170 1670 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence577 1211 333 gene locus_tag LOCUS_17180 gene bcpA 1211 333 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence578 1 795 gene locus_tag LOCUS_17190 1 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1040 804 gene locus_tag LOCUS_17200 1040 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1581 1357 gene locus_tag LOCUS_17210 1581 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence579 >Feature sequence580 <1 1007 gene locus_tag LOCUS_17220 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390194.1:ribonucleotide-diphosphate reductase subunit alpha >Feature sequence581 <1 558 gene locus_tag LOCUS_17230 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085107.1:transcriptional regulator >Feature sequence582 43 951 gene locus_tag LOCUS_17240 43 951 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_17240 971 1630 gene locus_tag LOCUS_17250 971 1630 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence583 <1 1200 gene locus_tag LOCUS_17260 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337301.1:methylmalonyl-CoA mutase >Feature sequence584 349 1164 gene locus_tag LOCUS_17270 349 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence585 <1655 866 gene locus_tag LOCUS_17280 <1655 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289362.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence586 <1650 846 gene locus_tag LOCUS_17290 <1650 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RN85:uroporphyrinogen decarboxylase >Feature sequence587 1270 641 gene locus_tag LOCUS_17300 1270 641 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387817.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence588 342 842 gene locus_tag LOCUS_17310 342 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence589 785 144 gene locus_tag LOCUS_17320 785 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_17320 <1648 785 gene locus_tag LOCUS_17330 <1648 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391003.1:cell division protein >Feature sequence590 1205 246 gene locus_tag LOCUS_17340 1205 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence591 11 844 gene locus_tag LOCUS_17350 11 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1151 849 gene locus_tag LOCUS_17360 1151 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1443 1153 gene locus_tag LOCUS_17370 1443 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence592 259 633 gene locus_tag LOCUS_17380 259 633 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531853.1 protein_id gnl|my_center|LOCUS_17380 672 1226 gene locus_tag LOCUS_17390 672 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence593 <1 1486 gene locus_tag LOCUS_17400 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039380.1:acyl-CoA dehydrogenase >Feature sequence594 <1637 581 gene locus_tag LOCUS_17410 <1637 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CTN1:microcystinase C >Feature sequence595 470 27 gene locus_tag LOCUS_17420 gene rnhA 470 27 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_17420 1459 485 gene locus_tag LOCUS_17430 gene thrB 1459 485 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU7 protein_id gnl|my_center|LOCUS_17430 >Feature sequence596 >Feature sequence597 <1 624 gene locus_tag LOCUS_17440 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RS75:UvrABC system protein C 665 1294 gene locus_tag LOCUS_17450 gene pgsA 665 1294 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence598 >Feature sequence599 125 325 gene locus_tag LOCUS_17460 125 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 337 1038 gene locus_tag LOCUS_17470 337 1038 CDS product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence600 >Feature sequence601 72 950 gene locus_tag LOCUS_17480 72 950 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_17480 >Feature sequence602 422 282 gene locus_tag LOCUS_17490 422 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence603 <1 520 gene locus_tag LOCUS_17500 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVD3:pseudouridine synthase 637 1521 gene locus_tag LOCUS_17510 gene rpoH 637 1521 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD4 protein_id gnl|my_center|LOCUS_17510 >Feature sequence604 323 102 gene locus_tag LOCUS_17520 323 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 536 1033 gene locus_tag LOCUS_17530 536 1033 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB16 protein_id gnl|my_center|LOCUS_17530 >Feature sequence605 >Feature sequence606 1063 74 gene locus_tag LOCUS_17540 1063 74 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090354.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence607 826 278 gene locus_tag LOCUS_17550 826 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 <1594 950 gene locus_tag LOCUS_17560 <1594 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208519.1:deferrochelatase/peroxidase YfeX >Feature sequence608 <1 578 gene locus_tag LOCUS_17570 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391005.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence609 717 1112 gene locus_tag LOCUS_17580 717 1112 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731409.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence610 1393 539 gene locus_tag LOCUS_17590 1393 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence611 1355 921 gene locus_tag LOCUS_17600 1355 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence612 143 1216 gene locus_tag LOCUS_17610 gene ruvB 143 1216 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 protein_id gnl|my_center|LOCUS_17610 >Feature sequence613 1525 740 gene locus_tag LOCUS_17620 1525 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence614 81 272 gene locus_tag LOCUS_17630 81 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1074 316 gene locus_tag LOCUS_17640 1074 316 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence615 <1 1129 gene locus_tag LOCUS_17650 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707630.1:benzoate transporter >Feature sequence616 360 1046 gene locus_tag LOCUS_17660 gene pcaI 360 1046 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence617 >Feature sequence618 896 186 gene locus_tag LOCUS_17670 896 186 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389365.1 protein_id gnl|my_center|LOCUS_17670 <1570 934 gene locus_tag LOCUS_17680 <1570 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224347.1:LuxR family transcriptional regulator >Feature sequence619 730 128 gene locus_tag LOCUS_17690 730 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1377 745 gene locus_tag LOCUS_17700 1377 745 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence620 1131 409 gene locus_tag LOCUS_17710 gene catI 1131 409 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence621 1270 89 gene locus_tag LOCUS_17720 1270 89 CDS product branched-chain amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064393.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence622 1521 634 gene locus_tag LOCUS_17730 1521 634 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence623 640 32 gene locus_tag LOCUS_17740 gene leuD 640 32 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THU7 protein_id gnl|my_center|LOCUS_17740 1563 649 gene locus_tag LOCUS_17750 1563 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence624 793 1263 gene locus_tag LOCUS_17760 793 1263 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_17760 1275 1511 gene locus_tag LOCUS_17770 1275 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence625 >Feature sequence626 <1 933 gene locus_tag LOCUS_17780 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RTR0:GTPase HflX 1029 1151 gene locus_tag LOCUS_17790 1029 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence627 812 1267 gene locus_tag LOCUS_17800 812 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1264 1503 gene locus_tag LOCUS_17810 1264 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence628 70 1083 gene locus_tag LOCUS_17820 gene gpsA 70 1083 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E8 protein_id gnl|my_center|LOCUS_17820 >Feature sequence629 >Feature sequence630 1539 1273 gene locus_tag LOCUS_17830 1539 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence631 >Feature sequence632 143 1090 gene locus_tag LOCUS_17840 143 1090 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ5 protein_id gnl|my_center|LOCUS_17840 >Feature sequence633 86 1087 gene locus_tag LOCUS_17850 86 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390660.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence634 >Feature sequence635 705 289 gene locus_tag LOCUS_17860 705 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064846.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence636 726 505 gene locus_tag LOCUS_17870 726 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 927 742 gene locus_tag LOCUS_17880 927 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence637 574 239 gene locus_tag LOCUS_17890 574 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence638 554 417 gene locus_tag LOCUS_17900 554 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 818 624 gene locus_tag LOCUS_17910 818 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 998 879 gene locus_tag LOCUS_17920 998 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1295 1065 gene locus_tag LOCUS_17930 1295 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence639 484 41 gene locus_tag LOCUS_17940 484 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence640 909 52 gene locus_tag LOCUS_17950 gene dapF 909 52 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_17950 1362 961 gene locus_tag LOCUS_17960 1362 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence641 659 33 gene locus_tag LOCUS_17970 659 33 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence642 502 777 gene locus_tag LOCUS_17980 502 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence643 >Feature sequence644 <1521 208 gene locus_tag LOCUS_17990 <1521 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931323.1:asparagine synthetase B >Feature sequence645 112 783 gene locus_tag LOCUS_18000 112 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 protein_id gnl|my_center|LOCUS_18000 822 1421 gene locus_tag LOCUS_18010 822 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence646 5 1219 gene locus_tag LOCUS_18020 5 1219 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence647 1080 469 gene locus_tag LOCUS_18030 1080 469 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391438.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence648 1237 308 gene locus_tag LOCUS_18040 1237 308 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence649 322 642 gene locus_tag LOCUS_18050 322 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1087 692 gene locus_tag LOCUS_18060 1087 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence650 <1 1223 gene locus_tag LOCUS_18070 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391251.1:phenylacetate--CoA ligase >Feature sequence651