>Feature sequence01 <1 1042 gene locus_tag LOCUS_00010 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWK8:phospho-2-dehydro-3-deoxyheptonate aldolase 1080 2243 gene locus_tag LOCUS_00020 1080 2243 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 protein_id gnl|my_center|LOCUS_00020 2383 3498 gene locus_tag LOCUS_00030 2383 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_00030 3564 4697 gene locus_tag LOCUS_00040 3564 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4806 6467 gene locus_tag LOCUS_00050 gene nadE 4806 6467 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_00050 6467 7861 gene locus_tag LOCUS_00060 gene cysS 6467 7861 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_00060 8583 7960 gene locus_tag LOCUS_00070 8583 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8768 11158 gene locus_tag LOCUS_00080 8768 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11675 11184 gene locus_tag LOCUS_00090 11675 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_00090 11986 13587 gene locus_tag LOCUS_00100 11986 13587 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_00100 13595 14380 gene locus_tag LOCUS_00110 gene trmJ 13595 14380 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_00110 14944 14408 gene locus_tag LOCUS_00120 14944 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16039 14993 gene locus_tag LOCUS_00130 16039 14993 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_00130 16682 16095 gene locus_tag LOCUS_00140 gene coq7 16682 16095 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_00140 17210 16710 gene locus_tag LOCUS_00150 17210 16710 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391244.1 protein_id gnl|my_center|LOCUS_00150 17801 17220 gene locus_tag LOCUS_00160 17801 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_00160 18007 18990 gene locus_tag LOCUS_00170 18007 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19202 19288 gene locus_tag LOCUS_t00010 19202 19288 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21645 19303 gene locus_tag LOCUS_00180 21645 19303 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RF7 protein_id gnl|my_center|LOCUS_00180 21791 22264 gene locus_tag LOCUS_00190 21791 22264 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 protein_id gnl|my_center|LOCUS_00190 22597 22268 gene locus_tag LOCUS_00200 22597 22268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22910 22695 gene locus_tag LOCUS_00210 22910 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 protein_id gnl|my_center|LOCUS_00210 23253 22990 gene locus_tag LOCUS_00220 23253 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24322 23246 gene locus_tag LOCUS_00230 gene ttuC 24322 23246 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886777.1 protein_id gnl|my_center|LOCUS_00230 24471 24920 gene locus_tag LOCUS_00240 24471 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25980 24943 gene locus_tag LOCUS_00250 25980 24943 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_00250 26142 26597 gene locus_tag LOCUS_00260 gene phaJ 26142 26597 CDS product (R)-specific enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ36 protein_id gnl|my_center|LOCUS_00260 26629 27627 gene locus_tag LOCUS_00270 26629 27627 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_00270 27624 30524 gene locus_tag LOCUS_00280 gene ileS 27624 30524 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6I9 protein_id gnl|my_center|LOCUS_00280 30532 31023 gene locus_tag LOCUS_00290 gene lspA 30532 31023 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 protein_id gnl|my_center|LOCUS_00290 31112 31666 gene locus_tag LOCUS_00300 31112 31666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_00300 31832 33220 gene locus_tag LOCUS_00310 31832 33220 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_00310 33228 34568 gene locus_tag LOCUS_00320 33228 34568 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_00320 34646 36244 gene locus_tag LOCUS_00330 gene pgi 34646 36244 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTL8 protein_id gnl|my_center|LOCUS_00330 36241 38082 gene locus_tag LOCUS_00340 gene mutL 36241 38082 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ52 protein_id gnl|my_center|LOCUS_00340 38120 38878 gene locus_tag LOCUS_00350 38120 38878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971058.1 protein_id gnl|my_center|LOCUS_00350 39437 38868 gene locus_tag LOCUS_00360 39437 38868 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 protein_id gnl|my_center|LOCUS_00360 40276 39488 gene locus_tag LOCUS_00370 40276 39488 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWN9 protein_id gnl|my_center|LOCUS_00370 40352 40813 gene locus_tag LOCUS_00380 gene tadA 40352 40813 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGU8 protein_id gnl|my_center|LOCUS_00380 41857 40832 gene locus_tag LOCUS_00390 41857 40832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 protein_id gnl|my_center|LOCUS_00390 42240 41923 gene locus_tag LOCUS_00400 42240 41923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 protein_id gnl|my_center|LOCUS_00400 43621 42350 gene locus_tag LOCUS_00410 gene purD 43621 42350 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHN3 protein_id gnl|my_center|LOCUS_00410 43723 45216 gene locus_tag LOCUS_00420 gene xseA 43723 45216 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY31 protein_id gnl|my_center|LOCUS_00420 45213 46043 gene locus_tag LOCUS_00430 45213 46043 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_00430 46958 46053 gene locus_tag LOCUS_00440 46958 46053 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598029.1 protein_id gnl|my_center|LOCUS_00440 47964 46975 gene locus_tag LOCUS_00450 gene lpxK 47964 46975 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV9 protein_id gnl|my_center|LOCUS_00450 49055 47961 gene locus_tag LOCUS_00460 49055 47961 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_00460 49945 49238 gene locus_tag LOCUS_00470 49945 49238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_00470 51805 49964 gene locus_tag LOCUS_00480 51805 49964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_00480 52923 51922 gene locus_tag LOCUS_00490 52923 51922 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_00490 53720 52851 gene locus_tag LOCUS_00500 53720 52851 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_00500 53886 54806 gene locus_tag LOCUS_00510 53886 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_00510 54884 55375 gene locus_tag LOCUS_00520 54884 55375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_00520 56404 55379 gene locus_tag LOCUS_00530 56404 55379 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_00530 57760 56417 gene locus_tag LOCUS_00540 57760 56417 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_00540 58031 59905 gene locus_tag LOCUS_00550 58031 59905 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896022.1 protein_id gnl|my_center|LOCUS_00550 59907 60929 gene locus_tag LOCUS_00560 59907 60929 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_00560 60961 62283 gene locus_tag LOCUS_00570 60961 62283 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_00570 62349 62771 gene locus_tag LOCUS_00580 62349 62771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401921.1 protein_id gnl|my_center|LOCUS_00580 64005 62800 gene locus_tag LOCUS_00590 gene metZ 64005 62800 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE2 protein_id gnl|my_center|LOCUS_00590 65529 64225 gene locus_tag LOCUS_00600 65529 64225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_00600 65637 67070 gene locus_tag LOCUS_00610 65637 67070 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_00610 68685 67096 gene locus_tag LOCUS_00620 gene lysS 68685 67096 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX38 protein_id gnl|my_center|LOCUS_00620 70263 68896 gene locus_tag LOCUS_00630 70263 68896 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_00630 71052 70327 gene locus_tag LOCUS_00640 71052 70327 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWX0 protein_id gnl|my_center|LOCUS_00640 71104 72033 gene locus_tag LOCUS_00650 gene ubiA 71104 72033 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 protein_id gnl|my_center|LOCUS_00650 72406 71999 gene locus_tag LOCUS_00660 72406 71999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72765 72403 gene locus_tag LOCUS_00670 72765 72403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72995 73627 gene locus_tag LOCUS_00680 72995 73627 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706748.1 protein_id gnl|my_center|LOCUS_00680 75464 73938 gene locus_tag LOCUS_00690 75464 73938 CDS product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_00690 75749 77536 gene locus_tag LOCUS_00700 75749 77536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77529 78299 gene locus_tag LOCUS_00710 77529 78299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00710 78389 79756 gene locus_tag LOCUS_00720 78389 79756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 79899 80963 gene locus_tag LOCUS_00730 79899 80963 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_00730 80869 81624 gene locus_tag LOCUS_00740 gene cobH 80869 81624 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 protein_id gnl|my_center|LOCUS_00740 81635 82831 gene locus_tag LOCUS_00750 81635 82831 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_00750 82828 83550 gene locus_tag LOCUS_00760 82828 83550 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_00760 83547 85367 gene locus_tag LOCUS_00770 gene cbiG/cobJ 83547 85367 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203935.1 protein_id gnl|my_center|LOCUS_00770 85364 86134 gene locus_tag LOCUS_00780 85364 86134 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_00780 86871 86131 gene locus_tag LOCUS_00790 86871 86131 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_00790 87943 86864 gene locus_tag LOCUS_00800 gene cbiD 87943 86864 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBQ6 protein_id gnl|my_center|LOCUS_00800 88040 88900 gene locus_tag LOCUS_00810 88040 88900 CDS product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868907.1 protein_id gnl|my_center|LOCUS_00810 88988 89623 gene locus_tag LOCUS_00820 88988 89623 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_00820 89620 90978 gene locus_tag LOCUS_00830 89620 90978 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_00830 91027 91494 gene locus_tag LOCUS_00840 91027 91494 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_00840 91548 92480 gene locus_tag LOCUS_00850 91548 92480 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086663.1 protein_id gnl|my_center|LOCUS_00850 92482 93234 gene locus_tag LOCUS_00860 92482 93234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_00860 93306 94373 gene locus_tag LOCUS_00870 gene ada 93306 94373 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_00870 94831 94370 gene locus_tag LOCUS_00880 94831 94370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_00880 94922 95341 gene locus_tag LOCUS_00890 94922 95341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_00890 95352 95708 gene locus_tag LOCUS_00900 95352 95708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 95705 97465 gene locus_tag LOCUS_00910 95705 97465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 97572 98201 gene locus_tag LOCUS_00920 97572 98201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 98226 99467 gene locus_tag LOCUS_00930 98226 99467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 99483 100976 gene locus_tag LOCUS_00940 99483 100976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 101017 102978 gene locus_tag LOCUS_00950 101017 102978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 102965 103117 gene locus_tag LOCUS_00960 102965 103117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 103121 103891 gene locus_tag LOCUS_00970 103121 103891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 103939 104949 gene locus_tag LOCUS_00980 103939 104949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 104946 105899 gene locus_tag LOCUS_00990 104946 105899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 106562 105945 gene locus_tag LOCUS_01000 106562 105945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 109205 106992 gene locus_tag LOCUS_01010 109205 106992 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390584.1 protein_id gnl|my_center|LOCUS_01010 109544 109233 gene locus_tag LOCUS_01020 109544 109233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109709 109575 gene locus_tag LOCUS_01030 109709 109575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 111042 109729 gene locus_tag LOCUS_01040 111042 109729 CDS product tripartite transporter large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_01040 111568 111077 gene locus_tag LOCUS_01050 111568 111077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 112693 111659 gene locus_tag LOCUS_01060 112693 111659 CDS product lactate-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK82 protein_id gnl|my_center|LOCUS_01060 113396 112788 gene locus_tag LOCUS_01070 gene ttdB 113396 112788 CDS product L+-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077020.1 protein_id gnl|my_center|LOCUS_01070 114265 113393 gene locus_tag LOCUS_01080 gene ttdA 114265 113393 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206174.1 protein_id gnl|my_center|LOCUS_01080 114480 115391 gene locus_tag LOCUS_01090 114480 115391 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089308.1 protein_id gnl|my_center|LOCUS_01090 115806 116213 gene locus_tag LOCUS_01100 115806 116213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 116252 117142 gene locus_tag LOCUS_01110 116252 117142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 117233 117157 gene locus_tag LOCUS_t00020 117233 117157 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 118459 117302 gene locus_tag LOCUS_01120 118459 117302 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339633.1 protein_id gnl|my_center|LOCUS_01120 118995 118471 gene locus_tag LOCUS_01130 118995 118471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 120790 120179 gene locus_tag LOCUS_01140 120790 120179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 121535 120861 gene locus_tag LOCUS_01150 121535 120861 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531680.1 protein_id gnl|my_center|LOCUS_01150 122130 121750 gene locus_tag LOCUS_01160 122130 121750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 122511 122146 gene locus_tag LOCUS_01170 122511 122146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 122665 122901 gene locus_tag LOCUS_01180 122665 122901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 123338 124417 gene locus_tag LOCUS_01190 123338 124417 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_01190 124404 126068 gene locus_tag LOCUS_01200 124404 126068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 127686 128678 gene locus_tag LOCUS_01210 127686 128678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 129657 128683 gene locus_tag LOCUS_01220 129657 128683 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_01220 130724 129705 gene locus_tag LOCUS_01230 130724 129705 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_01230 130865 131053 gene locus_tag LOCUS_01240 130865 131053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 133119 131050 gene locus_tag LOCUS_01250 133119 131050 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387827.1 protein_id gnl|my_center|LOCUS_01250 133355 136129 gene locus_tag LOCUS_01260 133355 136129 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_01260 136242 136763 gene locus_tag LOCUS_01270 136242 136763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 136960 137913 gene locus_tag LOCUS_01280 136960 137913 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_01280 138562 137927 gene locus_tag LOCUS_01290 gene msrQ 138562 137927 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU7 protein_id gnl|my_center|LOCUS_01290 139621 138626 gene locus_tag LOCUS_01300 gene msrP 139621 138626 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q46 protein_id gnl|my_center|LOCUS_01300 139848 140516 gene locus_tag LOCUS_01310 139848 140516 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_01310 141421 140513 gene locus_tag LOCUS_01320 141421 140513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 141454 142335 gene locus_tag LOCUS_01330 141454 142335 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 protein_id gnl|my_center|LOCUS_01330 142547 143587 gene locus_tag LOCUS_01340 142547 143587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 143606 143767 gene locus_tag LOCUS_01350 143606 143767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 143780 143998 gene locus_tag LOCUS_01360 143780 143998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 144000 144446 gene locus_tag LOCUS_01370 144000 144446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 144443 144838 gene locus_tag LOCUS_01380 144443 144838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144896 145597 gene locus_tag LOCUS_01390 144896 145597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 145609 146013 gene locus_tag LOCUS_01400 145609 146013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 146013 147227 gene locus_tag LOCUS_01410 146013 147227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 147193 147897 gene locus_tag LOCUS_01420 147193 147897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 147891 148586 gene locus_tag LOCUS_01430 147891 148586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 148586 149998 gene locus_tag LOCUS_01440 148586 149998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 149991 150590 gene locus_tag LOCUS_01450 149991 150590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 150635 152158 gene locus_tag LOCUS_01460 150635 152158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 152155 152583 gene locus_tag LOCUS_01470 152155 152583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 154455 152599 gene locus_tag LOCUS_01480 154455 152599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 154673 155989 gene locus_tag LOCUS_01490 154673 155989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 156682 156005 gene locus_tag LOCUS_01500 156682 156005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 156829 157791 gene locus_tag LOCUS_01510 156829 157791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 157801 158070 gene locus_tag LOCUS_01520 157801 158070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 158171 158740 gene locus_tag LOCUS_01530 158171 158740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 158740 160641 gene locus_tag LOCUS_01540 158740 160641 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039462.1 protein_id gnl|my_center|LOCUS_01540 160683 161141 gene locus_tag LOCUS_01550 160683 161141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 161138 161440 gene locus_tag LOCUS_01560 161138 161440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 161492 161716 gene locus_tag LOCUS_01570 161492 161716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 161719 163317 gene locus_tag LOCUS_01580 161719 163317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939873.1 protein_id gnl|my_center|LOCUS_01580 163317 163616 gene locus_tag LOCUS_01590 163317 163616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 163613 164359 gene locus_tag LOCUS_01600 163613 164359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 164529 164885 gene locus_tag LOCUS_01610 164529 164885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 165334 164918 gene locus_tag LOCUS_01620 165334 164918 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532281.1 protein_id gnl|my_center|LOCUS_01620 166217 165432 gene locus_tag LOCUS_01630 166217 165432 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_01630 166233 167474 gene locus_tag LOCUS_01640 166233 167474 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391123.1 protein_id gnl|my_center|LOCUS_01640 167479 168435 gene locus_tag LOCUS_01650 167479 168435 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_01650 168454 170451 gene locus_tag LOCUS_01660 gene thrS 168454 170451 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_01660 170575 171099 gene locus_tag LOCUS_01670 gene infC 170575 171099 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_01670 171122 171607 gene locus_tag LOCUS_01680 171122 171607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 171662 171967 gene locus_tag LOCUS_01690 171662 171967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 171951 172262 gene locus_tag LOCUS_01700 171951 172262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 174547 172397 gene locus_tag LOCUS_01710 gene mcmA 174547 172397 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_01710 174893 175273 gene locus_tag LOCUS_01720 174893 175273 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_01720 175570 175926 gene locus_tag LOCUS_01730 175570 175926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 175948 176802 gene locus_tag LOCUS_01740 175948 176802 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_01740 176847 177338 gene locus_tag LOCUS_01750 gene ytoQ 176847 177338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_01750 177404 178384 gene locus_tag LOCUS_01760 177404 178384 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_01760 178487 179008 gene locus_tag LOCUS_01770 178487 179008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 179100 179176 gene locus_tag LOCUS_t00030 179100 179176 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 179995 179198 gene locus_tag LOCUS_01780 179995 179198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 180858 179992 gene locus_tag LOCUS_01790 180858 179992 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_01790 181216 180947 gene locus_tag LOCUS_01800 181216 180947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 181939 181388 gene locus_tag LOCUS_01810 181939 181388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970359.1 protein_id gnl|my_center|LOCUS_01810 181970 182956 gene locus_tag LOCUS_01820 181970 182956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 183007 183798 gene locus_tag LOCUS_01830 183007 183798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 185006 183795 gene locus_tag LOCUS_01840 185006 183795 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_01840 186247 185069 gene locus_tag LOCUS_01850 186247 185069 CDS product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088780.1 protein_id gnl|my_center|LOCUS_01850 186499 189492 gene locus_tag LOCUS_01860 186499 189492 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 protein_id gnl|my_center|LOCUS_01860 189588 190277 gene locus_tag LOCUS_01870 189588 190277 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087140.1 protein_id gnl|my_center|LOCUS_01870 190418 191740 gene locus_tag LOCUS_01880 190418 191740 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 protein_id gnl|my_center|LOCUS_01880 192694 191888 gene locus_tag LOCUS_01890 192694 191888 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_01890 195099 192694 gene locus_tag LOCUS_01900 gene pheT 195099 192694 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH7 protein_id gnl|my_center|LOCUS_01900 196178 195096 gene locus_tag LOCUS_01910 gene pheS 196178 195096 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_01910 196626 196267 gene locus_tag LOCUS_01920 gene rplT 196626 196267 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH9 protein_id gnl|my_center|LOCUS_01920 196858 196661 gene locus_tag LOCUS_01930 gene rpmI 196858 196661 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNI0 protein_id gnl|my_center|LOCUS_01930 198939 197038 gene locus_tag LOCUS_01940 198939 197038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 199746 198985 gene locus_tag LOCUS_01950 199746 198985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 199879 200949 gene locus_tag LOCUS_01960 gene cobD 199879 200949 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNW9 protein_id gnl|my_center|LOCUS_01960 201053 203023 gene locus_tag LOCUS_01970 201053 203023 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_01970 203941 203024 gene locus_tag LOCUS_01980 203941 203024 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 protein_id gnl|my_center|LOCUS_01980 204064 204852 gene locus_tag LOCUS_01990 204064 204852 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532431.1 protein_id gnl|my_center|LOCUS_01990 204873 205310 gene locus_tag LOCUS_02000 204873 205310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_02000 205746 205330 gene locus_tag LOCUS_02010 205746 205330 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_02010 206687 205800 gene locus_tag LOCUS_02020 gene gcvA 206687 205800 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_02020 206960 207223 gene locus_tag LOCUS_02030 206960 207223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 207341 208264 gene locus_tag LOCUS_02040 207341 208264 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266785.1 protein_id gnl|my_center|LOCUS_02040 208309 209538 gene locus_tag LOCUS_02050 208309 209538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 protein_id gnl|my_center|LOCUS_02050 209691 211028 gene locus_tag LOCUS_02060 209691 211028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 212022 211021 gene locus_tag LOCUS_02070 212022 211021 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_02070 212156 212734 gene locus_tag LOCUS_02080 212156 212734 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_02080 213405 212794 gene locus_tag LOCUS_02090 gene gst 213405 212794 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_02090 214548 213463 gene locus_tag LOCUS_02100 214548 213463 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 protein_id gnl|my_center|LOCUS_02100 214712 215074 gene locus_tag LOCUS_02110 214712 215074 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265884.1 protein_id gnl|my_center|LOCUS_02110 216141 215071 gene locus_tag LOCUS_02120 216141 215071 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_02120 216240 216746 gene locus_tag LOCUS_02130 216240 216746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_02130 216802 217950 gene locus_tag LOCUS_02140 gene rlmN 216802 217950 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP22 protein_id gnl|my_center|LOCUS_02140 217943 218335 gene locus_tag LOCUS_02150 217943 218335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_02150 218332 220047 gene locus_tag LOCUS_02160 218332 220047 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_02160 220044 220712 gene locus_tag LOCUS_02170 220044 220712 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388158.1 protein_id gnl|my_center|LOCUS_02170 220796 222355 gene locus_tag LOCUS_02180 220796 222355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 222486 223694 gene locus_tag LOCUS_02190 gene argG 222486 223694 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV0 protein_id gnl|my_center|LOCUS_02190 224608 223745 gene locus_tag LOCUS_02200 gene tauD 224608 223745 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_02200 224921 224628 gene locus_tag LOCUS_02210 224921 224628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 225812 224949 gene locus_tag LOCUS_02220 225812 224949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_02220 225947 226846 gene locus_tag LOCUS_02230 225947 226846 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 protein_id gnl|my_center|LOCUS_02230 228335 226848 gene locus_tag LOCUS_02240 228335 226848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 228998 228405 gene locus_tag LOCUS_02250 228998 228405 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_02250 229179 230030 gene locus_tag LOCUS_02260 229179 230030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 230797 230042 gene locus_tag LOCUS_02270 gene cobB 230797 230042 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN56 protein_id gnl|my_center|LOCUS_02270 230837 231361 gene locus_tag LOCUS_02280 gene ptpA 230837 231361 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_02280 231456 232109 gene locus_tag LOCUS_02290 231456 232109 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_02290 232696 232106 gene locus_tag LOCUS_02300 232696 232106 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX9 protein_id gnl|my_center|LOCUS_02300 234101 232986 gene locus_tag LOCUS_02310 234101 232986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 234799 234098 gene locus_tag LOCUS_02320 234799 234098 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_02320 234798 235529 gene locus_tag LOCUS_02330 234798 235529 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 protein_id gnl|my_center|LOCUS_02330 235536 238079 gene locus_tag LOCUS_02340 235536 238079 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_02340 238241 238975 gene locus_tag LOCUS_02350 238241 238975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970505.1 protein_id gnl|my_center|LOCUS_02350 240082 239105 gene locus_tag LOCUS_02360 240082 239105 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_02360 240859 240119 gene locus_tag LOCUS_02370 240859 240119 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_02370 241731 241063 gene locus_tag LOCUS_02380 241731 241063 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 protein_id gnl|my_center|LOCUS_02380 242452 242285 gene locus_tag LOCUS_02390 242452 242285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 242421 243155 gene locus_tag LOCUS_02400 242421 243155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 243297 243503 gene locus_tag LOCUS_02410 243297 243503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 245520 243718 gene locus_tag LOCUS_02420 245520 243718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 245709 245634 gene locus_tag LOCUS_t00040 245709 245634 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 247245 245860 gene locus_tag LOCUS_02430 247245 245860 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385401.1 protein_id gnl|my_center|LOCUS_02430 248616 247255 gene locus_tag LOCUS_02440 248616 247255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 249430 248747 gene locus_tag LOCUS_02450 249430 248747 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083395.1 protein_id gnl|my_center|LOCUS_02450 250444 249473 gene locus_tag LOCUS_02460 gene hemC 250444 249473 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_02460 250540 251595 gene locus_tag LOCUS_02470 gene tsaD 250540 251595 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_02470 251646 252635 gene locus_tag LOCUS_02480 gene gpsA 251646 252635 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_02480 252676 252960 gene locus_tag LOCUS_02490 252676 252960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_02490 252960 253313 gene locus_tag LOCUS_02500 252960 253313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 253628 255574 gene locus_tag LOCUS_02510 gene acsA 253628 255574 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL16 protein_id gnl|my_center|LOCUS_02510 255702 256568 gene locus_tag LOCUS_02520 255702 256568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 257188 256946 gene locus_tag LOCUS_02530 257188 256946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 257165 257998 gene locus_tag LOCUS_02540 257165 257998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 257995 258504 gene locus_tag LOCUS_02550 gene idnK 257995 258504 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930C7 protein_id gnl|my_center|LOCUS_02550 260700 258526 gene locus_tag LOCUS_02560 260700 258526 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_02560 261183 260728 gene locus_tag LOCUS_02570 261183 260728 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 protein_id gnl|my_center|LOCUS_02570 262709 261297 gene locus_tag LOCUS_02580 262709 261297 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_02580 262921 263973 gene locus_tag LOCUS_02590 262921 263973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 264181 264909 gene locus_tag LOCUS_02600 264181 264909 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 protein_id gnl|my_center|LOCUS_02600 264976 265776 gene locus_tag LOCUS_02610 264976 265776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence02 <1 918 gene locus_tag LOCUS_02620 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081919.1:B12-binding domain-containing radical SAM protein 1029 1697 gene locus_tag LOCUS_02630 1029 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957830.1 protein_id gnl|my_center|LOCUS_02630 1694 2185 gene locus_tag LOCUS_02640 gene rfaH 1694 2185 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DB2 protein_id gnl|my_center|LOCUS_02640 2314 3027 gene locus_tag LOCUS_02650 2314 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_02650 3024 4034 gene locus_tag LOCUS_02660 3024 4034 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942619.1 protein_id gnl|my_center|LOCUS_02660 4027 5244 gene locus_tag LOCUS_02670 4027 5244 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088731.1 protein_id gnl|my_center|LOCUS_02670 5248 7497 gene locus_tag LOCUS_02680 5248 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 7494 8129 gene locus_tag LOCUS_02690 7494 8129 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_02690 8129 9187 gene locus_tag LOCUS_02700 8129 9187 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_02700 9208 10134 gene locus_tag LOCUS_02710 9208 10134 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082140.1 protein_id gnl|my_center|LOCUS_02710 10131 11093 gene locus_tag LOCUS_02720 10131 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11096 12007 gene locus_tag LOCUS_02730 11096 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 12042 12944 gene locus_tag LOCUS_02740 12042 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 12976 13734 gene locus_tag LOCUS_02750 gene hisF 12976 13734 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946486.1 protein_id gnl|my_center|LOCUS_02750 13731 14363 gene locus_tag LOCUS_02760 gene hisH 13731 14363 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF56 protein_id gnl|my_center|LOCUS_02760 14417 15577 gene locus_tag LOCUS_02770 14417 15577 CDS product LPS biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946485.1 protein_id gnl|my_center|LOCUS_02770 15538 16893 gene locus_tag LOCUS_02780 15538 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 16921 17919 gene locus_tag LOCUS_02790 gene pseB 16921 17919 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25511 protein_id gnl|my_center|LOCUS_02790 17916 19103 gene locus_tag LOCUS_02800 17916 19103 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639919.1 protein_id gnl|my_center|LOCUS_02800 19100 20854 gene locus_tag LOCUS_02810 gene sunT 19100 20854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834715.1 protein_id gnl|my_center|LOCUS_02810 20873 21457 gene locus_tag LOCUS_02820 20873 21457 CDS product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_02820 21503 21742 gene locus_tag LOCUS_02830 21503 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 21739 22848 gene locus_tag LOCUS_02840 21739 22848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 22833 24485 gene locus_tag LOCUS_02850 22833 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 24469 25377 gene locus_tag LOCUS_02860 24469 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 25374 26705 gene locus_tag LOCUS_02870 25374 26705 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_02870 26760 27632 gene locus_tag LOCUS_02880 26760 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 27700 28062 gene locus_tag LOCUS_02890 27700 28062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 28815 28072 gene locus_tag LOCUS_02900 28815 28072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 29762 29055 gene locus_tag LOCUS_02910 29762 29055 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525084.1 protein_id gnl|my_center|LOCUS_02910 29842 30825 gene locus_tag LOCUS_02920 gene wcaA 29842 30825 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124535.1 protein_id gnl|my_center|LOCUS_02920 30850 31662 gene locus_tag LOCUS_02930 30850 31662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 31655 32626 gene locus_tag LOCUS_02940 gene rfbB 31655 32626 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065329.1 protein_id gnl|my_center|LOCUS_02940 32766 33281 gene locus_tag LOCUS_02950 32766 33281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 33419 35281 gene locus_tag LOCUS_02960 33419 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 35511 36104 gene locus_tag LOCUS_02970 35511 36104 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DM6 protein_id gnl|my_center|LOCUS_02970 36088 36831 gene locus_tag LOCUS_02980 36088 36831 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DM4 protein_id gnl|my_center|LOCUS_02980 36858 37871 gene locus_tag LOCUS_02990 36858 37871 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_02990 37868 38875 gene locus_tag LOCUS_03000 37868 38875 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_03000 38872 40428 gene locus_tag LOCUS_03010 38872 40428 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7G1 protein_id gnl|my_center|LOCUS_03010 40425 41390 gene locus_tag LOCUS_03020 40425 41390 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957732.1 protein_id gnl|my_center|LOCUS_03020 41387 42694 gene locus_tag LOCUS_03030 41387 42694 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957733.1 protein_id gnl|my_center|LOCUS_03030 42687 43574 gene locus_tag LOCUS_03040 42687 43574 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 protein_id gnl|my_center|LOCUS_03040 43574 44224 gene locus_tag LOCUS_03050 43574 44224 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 protein_id gnl|my_center|LOCUS_03050 44253 45143 gene locus_tag LOCUS_03060 44253 45143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 45202 46023 gene locus_tag LOCUS_03070 45202 46023 CDS product transketolase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228762.1 protein_id gnl|my_center|LOCUS_03070 46020 46937 gene locus_tag LOCUS_03080 46020 46937 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_03080 46995 47507 gene locus_tag LOCUS_03090 46995 47507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202524.1 protein_id gnl|my_center|LOCUS_03090 47504 48490 gene locus_tag LOCUS_03100 47504 48490 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_03100 48522 49733 gene locus_tag LOCUS_03110 48522 49733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 49773 50594 gene locus_tag LOCUS_03120 49773 50594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 50591 52597 gene locus_tag LOCUS_03130 50591 52597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 52732 53769 gene locus_tag LOCUS_03140 52732 53769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 53811 54518 gene locus_tag LOCUS_03150 53811 54518 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_03150 54518 56518 gene locus_tag LOCUS_03160 54518 56518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 56814 57998 gene locus_tag LOCUS_03170 56814 57998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 57995 59065 gene locus_tag LOCUS_03180 57995 59065 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_03180 59110 60144 gene locus_tag LOCUS_03190 59110 60144 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_03190 60150 60950 gene locus_tag LOCUS_03200 60150 60950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 60947 62044 gene locus_tag LOCUS_03210 gene hisC 60947 62044 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL03 protein_id gnl|my_center|LOCUS_03210 62056 63060 gene locus_tag LOCUS_03220 62056 63060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 63074 64189 gene locus_tag LOCUS_03230 gene wlbA 63074 64189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927319.1 protein_id gnl|my_center|LOCUS_03230 64202 64969 gene locus_tag LOCUS_03240 gene kdsB 64202 64969 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848238.1 protein_id gnl|my_center|LOCUS_03240 64992 65711 gene locus_tag LOCUS_03250 gene fabG 64992 65711 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813819.1 protein_id gnl|my_center|LOCUS_03250 65704 66783 gene locus_tag LOCUS_03260 gene aroB 65704 66783 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCL4 protein_id gnl|my_center|LOCUS_03260 66780 67742 gene locus_tag LOCUS_03270 66780 67742 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_03270 67820 69622 gene locus_tag LOCUS_03280 67820 69622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 69619 70407 gene locus_tag LOCUS_03290 69619 70407 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_03290 70412 71476 gene locus_tag LOCUS_03300 70412 71476 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088720.1 protein_id gnl|my_center|LOCUS_03300 71473 71916 gene locus_tag LOCUS_03310 71473 71916 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_03310 71913 72890 gene locus_tag LOCUS_03320 71913 72890 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_03320 72887 73789 gene locus_tag LOCUS_03330 72887 73789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 73824 74828 gene locus_tag LOCUS_03340 73824 74828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 74836 76776 gene locus_tag LOCUS_03350 74836 76776 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_03350 76773 77888 gene locus_tag LOCUS_03360 76773 77888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 78034 79827 gene locus_tag LOCUS_03370 gene wbmC 78034 79827 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_03370 80755 79784 gene locus_tag LOCUS_03380 80755 79784 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_03380 80947 81783 gene locus_tag LOCUS_03390 80947 81783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 81823 83385 gene locus_tag LOCUS_03400 81823 83385 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_03400 83382 84521 gene locus_tag LOCUS_03410 83382 84521 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088658.1 protein_id gnl|my_center|LOCUS_03410 84518 85561 gene locus_tag LOCUS_03420 gene bplD 84518 85561 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929613.1 protein_id gnl|my_center|LOCUS_03420 85558 86700 gene locus_tag LOCUS_03430 85558 86700 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_03430 87533 86697 gene locus_tag LOCUS_03440 87533 86697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 87671 89005 gene locus_tag LOCUS_03450 87671 89005 CDS product polysaccharide export related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709180.1 protein_id gnl|my_center|LOCUS_03450 89002 90366 gene locus_tag LOCUS_03460 89002 90366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 91289 90363 gene locus_tag LOCUS_03470 91289 90363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 91408 92694 gene locus_tag LOCUS_03480 gene capL 91408 92694 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_03480 92720 93892 gene locus_tag LOCUS_03490 92720 93892 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_03490 93889 94908 gene locus_tag LOCUS_03500 93889 94908 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_03500 94980 96929 gene locus_tag LOCUS_03510 94980 96929 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_03510 96926 98497 gene locus_tag LOCUS_03520 gene purH 96926 98497 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 protein_id gnl|my_center|LOCUS_03520 99188 98568 gene locus_tag LOCUS_03530 99188 98568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 104169 99310 gene locus_tag LOCUS_03540 104169 99310 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_03540 104448 105926 gene locus_tag LOCUS_03550 104448 105926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 106062 105988 gene locus_tag LOCUS_t00050 106062 105988 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 106340 107293 gene locus_tag LOCUS_03560 106340 107293 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_03560 107361 108002 gene locus_tag LOCUS_03570 107361 108002 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_03570 108046 108249 gene locus_tag LOCUS_03580 108046 108249 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW2 protein_id gnl|my_center|LOCUS_03580 108246 108665 gene locus_tag LOCUS_03590 108246 108665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708243.1 protein_id gnl|my_center|LOCUS_03590 109317 108682 gene locus_tag LOCUS_03600 109317 108682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 109529 110476 gene locus_tag LOCUS_03610 109529 110476 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707318.1 protein_id gnl|my_center|LOCUS_03610 111238 110492 gene locus_tag LOCUS_03620 111238 110492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 113225 111273 gene locus_tag LOCUS_03630 113225 111273 CDS product putative succinate dehydrogenase, flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705146.1 protein_id gnl|my_center|LOCUS_03630 114016 113342 gene locus_tag LOCUS_03640 114016 113342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 115361 114156 gene locus_tag LOCUS_03650 115361 114156 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_03650 115760 116098 gene locus_tag LOCUS_03660 gene glnK 115760 116098 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_03660 116110 117471 gene locus_tag LOCUS_03670 gene amt-2 116110 117471 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_03670 117590 118780 gene locus_tag LOCUS_03680 117590 118780 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336784.1 protein_id gnl|my_center|LOCUS_03680 118805 121234 gene locus_tag LOCUS_03690 118805 121234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 121242 121940 gene locus_tag LOCUS_03700 121242 121940 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6K0 protein_id gnl|my_center|LOCUS_03700 122404 121964 gene locus_tag LOCUS_03710 122404 121964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 122394 123215 gene locus_tag LOCUS_03720 122394 123215 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391443.1 protein_id gnl|my_center|LOCUS_03720 123368 124351 gene locus_tag LOCUS_03730 123368 124351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 124493 125002 gene locus_tag LOCUS_03740 124493 125002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 125720 125031 gene locus_tag LOCUS_03750 125720 125031 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_03750 125902 127083 gene locus_tag LOCUS_03760 125902 127083 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_03760 127517 128809 gene locus_tag LOCUS_03770 127517 128809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 128862 129374 gene locus_tag LOCUS_03780 128862 129374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_03780 130088 129381 gene locus_tag LOCUS_03790 130088 129381 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 protein_id gnl|my_center|LOCUS_03790 130192 130785 gene locus_tag LOCUS_03800 130192 130785 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_03800 130820 131359 gene locus_tag LOCUS_03810 130820 131359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 131444 134008 gene locus_tag LOCUS_03820 gene leuS 131444 134008 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 protein_id gnl|my_center|LOCUS_03820 133995 134543 gene locus_tag LOCUS_03830 133995 134543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970580.1 protein_id gnl|my_center|LOCUS_03830 134571 135584 gene locus_tag LOCUS_03840 gene holA 134571 135584 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_03840 136590 135715 gene locus_tag LOCUS_03850 136590 135715 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_03850 137483 136587 gene locus_tag LOCUS_03860 137483 136587 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_03860 138150 137476 gene locus_tag LOCUS_03870 gene rsmG 138150 137476 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_03870 140068 138182 gene locus_tag LOCUS_03880 gene mnmG 140068 138182 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 protein_id gnl|my_center|LOCUS_03880 141872 140517 gene locus_tag LOCUS_03890 gene mnmE 141872 140517 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 protein_id gnl|my_center|LOCUS_03890 142281 141904 gene locus_tag LOCUS_03900 142281 141904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 142556 142278 gene locus_tag LOCUS_03910 142556 142278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_03910 142729 143190 gene locus_tag LOCUS_03920 142729 143190 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN80 protein_id gnl|my_center|LOCUS_03920 143477 144451 gene locus_tag LOCUS_03930 gene qor 143477 144451 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_03930 145858 144602 gene locus_tag LOCUS_03940 gene rho 145858 144602 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 protein_id gnl|my_center|LOCUS_03940 146645 146199 gene locus_tag LOCUS_03950 146645 146199 CDS product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53229 protein_id gnl|my_center|LOCUS_03950 147708 146659 gene locus_tag LOCUS_03960 gene hemH 147708 146659 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN84 protein_id gnl|my_center|LOCUS_03960 148739 147714 gene locus_tag LOCUS_03970 gene hemE 148739 147714 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_03970 149205 150035 gene locus_tag LOCUS_03980 149205 150035 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 protein_id gnl|my_center|LOCUS_03980 150032 150658 gene locus_tag LOCUS_03990 150032 150658 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU7 protein_id gnl|my_center|LOCUS_03990 150676 151527 gene locus_tag LOCUS_04000 gene aroE 150676 151527 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_04000 151543 152166 gene locus_tag LOCUS_04010 gene coaE 151543 152166 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I0 protein_id gnl|my_center|LOCUS_04010 152189 152854 gene locus_tag LOCUS_04020 152189 152854 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_04020 153374 152883 gene locus_tag LOCUS_04030 gene secB 153374 152883 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN91 protein_id gnl|my_center|LOCUS_04030 153995 153459 gene locus_tag LOCUS_04040 gene fxsA 153995 153459 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_04040 154268 154963 gene locus_tag LOCUS_04050 154268 154963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_04050 154971 156203 gene locus_tag LOCUS_04060 154971 156203 CDS product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CK4 protein_id gnl|my_center|LOCUS_04060 156267 157058 gene locus_tag LOCUS_04070 156267 157058 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_04070 157058 158500 gene locus_tag LOCUS_04080 157058 158500 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_04080 158497 159192 gene locus_tag LOCUS_04090 158497 159192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_04090 159185 159784 gene locus_tag LOCUS_04100 159185 159784 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_04100 159781 160167 gene locus_tag LOCUS_04110 159781 160167 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391348.1 protein_id gnl|my_center|LOCUS_04110 161660 160287 gene locus_tag LOCUS_04120 gene hslU 161660 160287 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA1 protein_id gnl|my_center|LOCUS_04120 162202 161657 gene locus_tag LOCUS_04130 gene hslV 162202 161657 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA2 protein_id gnl|my_center|LOCUS_04130 162426 163025 gene locus_tag LOCUS_04140 gene hisB 162426 163025 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 protein_id gnl|my_center|LOCUS_04140 163080 163481 gene locus_tag LOCUS_04150 163080 163481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 163492 164139 gene locus_tag LOCUS_04160 gene hisH 163492 164139 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_04160 164314 165054 gene locus_tag LOCUS_04170 gene hisA 164314 165054 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_04170 165054 165854 gene locus_tag LOCUS_04180 gene hisF 165054 165854 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG5 protein_id gnl|my_center|LOCUS_04180 165879 166196 gene locus_tag LOCUS_04190 gene hisE 165879 166196 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA8 protein_id gnl|my_center|LOCUS_04190 166213 166575 gene locus_tag LOCUS_04200 166213 166575 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_04200 166699 167133 gene locus_tag LOCUS_04210 166699 167133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 168656 167130 gene locus_tag LOCUS_04220 168656 167130 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_04220 168901 169542 gene locus_tag LOCUS_04230 168901 169542 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_04230 170124 169585 gene locus_tag LOCUS_04240 170124 169585 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_04240 170890 170129 gene locus_tag LOCUS_04250 170890 170129 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_04250 171861 170923 gene locus_tag LOCUS_04260 gene gshB 171861 170923 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_04260 172767 171919 gene locus_tag LOCUS_04270 172767 171919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 protein_id gnl|my_center|LOCUS_04270 173406 172771 gene locus_tag LOCUS_04280 173406 172771 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391438.1 protein_id gnl|my_center|LOCUS_04280 173934 173554 gene locus_tag LOCUS_04290 173934 173554 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_04290 174845 173931 gene locus_tag LOCUS_04300 gene rsmI 174845 173931 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN08 protein_id gnl|my_center|LOCUS_04300 174995 176269 gene locus_tag LOCUS_04310 174995 176269 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 protein_id gnl|my_center|LOCUS_04310 177508 176312 gene locus_tag LOCUS_04320 177508 176312 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968537.1 protein_id gnl|my_center|LOCUS_04320 178160 177552 gene locus_tag LOCUS_04330 178160 177552 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_04330 178884 178165 gene locus_tag LOCUS_04340 gene rph 178884 178165 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN60 protein_id gnl|my_center|LOCUS_04340 179134 180189 gene locus_tag LOCUS_04350 gene hrcA 179134 180189 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_04350 180231 180986 gene locus_tag LOCUS_04360 180231 180986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence03 <1 517 gene locus_tag LOCUS_04370 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529745.1:aspartate aminotransferase 794 1132 gene locus_tag LOCUS_04380 gene glnB 794 1132 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_04380 1236 2657 gene locus_tag LOCUS_04390 1236 2657 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 protein_id gnl|my_center|LOCUS_04390 3658 2807 gene locus_tag LOCUS_04400 3658 2807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941883.1 protein_id gnl|my_center|LOCUS_04400 4664 3675 gene locus_tag LOCUS_04410 4664 3675 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_04410 4867 6708 gene locus_tag LOCUS_04420 4867 6708 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090889.1 protein_id gnl|my_center|LOCUS_04420 6835 8562 gene locus_tag LOCUS_04430 6835 8562 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_04430 9147 8590 gene locus_tag LOCUS_04440 9147 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 9833 9438 gene locus_tag LOCUS_04450 9833 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 10568 10110 gene locus_tag LOCUS_04460 10568 10110 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390519.1 protein_id gnl|my_center|LOCUS_04460 10675 12777 gene locus_tag LOCUS_04470 gene parE 10675 12777 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQT8 protein_id gnl|my_center|LOCUS_04470 13764 12793 gene locus_tag LOCUS_04480 gene argC 13764 12793 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 protein_id gnl|my_center|LOCUS_04480 13920 14945 gene locus_tag LOCUS_04490 gene metX 13920 14945 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP84 protein_id gnl|my_center|LOCUS_04490 15530 14952 gene locus_tag LOCUS_04500 gene soxW 15530 14952 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086294.1 protein_id gnl|my_center|LOCUS_04500 16137 15655 gene locus_tag LOCUS_04510 gene rpsI 16137 15655 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KE5 protein_id gnl|my_center|LOCUS_04510 16605 16141 gene locus_tag LOCUS_04520 gene rplM 16605 16141 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z4 protein_id gnl|my_center|LOCUS_04520 17218 16784 gene locus_tag LOCUS_04530 17218 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_04530 17363 18196 gene locus_tag LOCUS_04540 17363 18196 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_04540 18193 18708 gene locus_tag LOCUS_04550 18193 18708 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_04550 18713 20020 gene locus_tag LOCUS_04560 18713 20020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04560 20169 20375 gene locus_tag LOCUS_04570 20169 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 20785 20381 gene locus_tag LOCUS_04580 20785 20381 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532588.1 protein_id gnl|my_center|LOCUS_04580 21784 20852 gene locus_tag LOCUS_04590 21784 20852 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_04590 21977 22360 gene locus_tag LOCUS_04600 21977 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 23428 22379 gene locus_tag LOCUS_04610 gene fbp 23428 22379 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LZ0 protein_id gnl|my_center|LOCUS_04610 24070 23534 gene locus_tag LOCUS_04620 24070 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 24245 24168 gene locus_tag LOCUS_t00060 24245 24168 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 26043 24322 gene locus_tag LOCUS_04630 26043 24322 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_04630 27136 26159 gene locus_tag LOCUS_04640 gene gplX 27136 26159 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEJ8 protein_id gnl|my_center|LOCUS_04640 28457 27165 gene locus_tag LOCUS_04650 28457 27165 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_04650 29683 28454 gene locus_tag LOCUS_04660 29683 28454 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_04660 31014 29800 gene locus_tag LOCUS_04670 31014 29800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 31277 33097 gene locus_tag LOCUS_04680 31277 33097 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_04680 34614 33094 gene locus_tag LOCUS_04690 34614 33094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 protein_id gnl|my_center|LOCUS_04690 34731 35408 gene locus_tag LOCUS_04700 34731 35408 CDS product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530752.1 protein_id gnl|my_center|LOCUS_04700 35427 36149 gene locus_tag LOCUS_04710 35427 36149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967724.1 protein_id gnl|my_center|LOCUS_04710 37173 36166 gene locus_tag LOCUS_04720 37173 36166 CDS product LAO/AO ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969975.1 protein_id gnl|my_center|LOCUS_04720 37774 37187 gene locus_tag LOCUS_04730 37774 37187 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_04730 38363 37815 gene locus_tag LOCUS_04740 38363 37815 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_04740 39075 38374 gene locus_tag LOCUS_04750 39075 38374 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_04750 39278 40831 gene locus_tag LOCUS_04760 39278 40831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 40999 41709 gene locus_tag LOCUS_04770 40999 41709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 41838 42023 gene locus_tag LOCUS_04780 41838 42023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 43118 42123 gene locus_tag LOCUS_04790 gene thiG 43118 42123 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_04790 43302 43748 gene locus_tag LOCUS_04800 gene aroQ 43302 43748 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_04800 43755 44195 gene locus_tag LOCUS_04810 43755 44195 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_04810 44206 45561 gene locus_tag LOCUS_04820 44206 45561 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_04820 45580 46251 gene locus_tag LOCUS_04830 gene aat 45580 46251 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFR8 protein_id gnl|my_center|LOCUS_04830 46418 47017 gene locus_tag LOCUS_04840 46418 47017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 47058 47501 gene locus_tag LOCUS_04850 47058 47501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932687.1 protein_id gnl|my_center|LOCUS_04850 47732 48934 gene locus_tag LOCUS_04860 47732 48934 CDS product potassium transporter CPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404081.1 protein_id gnl|my_center|LOCUS_04860 49141 48959 gene locus_tag LOCUS_04870 49141 48959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 51024 49366 gene locus_tag LOCUS_04880 51024 49366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 51451 51059 gene locus_tag LOCUS_04890 51451 51059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 51907 51458 gene locus_tag LOCUS_04900 51907 51458 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_04900 52425 51928 gene locus_tag LOCUS_04910 52425 51928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 52827 52471 gene locus_tag LOCUS_04920 52827 52471 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_04920 53249 56965 gene locus_tag LOCUS_04930 53249 56965 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_04930 57330 58568 gene locus_tag LOCUS_04940 57330 58568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 58626 59093 gene locus_tag LOCUS_04950 58626 59093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_04950 59967 59101 gene locus_tag LOCUS_04960 59967 59101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 60011 60904 gene locus_tag LOCUS_04970 60011 60904 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_04970 60908 62074 gene locus_tag LOCUS_04980 60908 62074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390211.1 protein_id gnl|my_center|LOCUS_04980 62166 62810 gene locus_tag LOCUS_04990 62166 62810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 63946 62807 gene locus_tag LOCUS_05000 63946 62807 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_05000 66286 63974 gene locus_tag LOCUS_05010 66286 63974 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_05010 66655 66287 gene locus_tag LOCUS_05020 gene clpS 66655 66287 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 protein_id gnl|my_center|LOCUS_05020 67572 66994 gene locus_tag LOCUS_05030 67572 66994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 68017 69261 gene locus_tag LOCUS_05040 68017 69261 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707093.1 protein_id gnl|my_center|LOCUS_05040 71206 69821 gene locus_tag LOCUS_05050 71206 69821 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_05050 72569 71247 gene locus_tag LOCUS_05060 72569 71247 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_05060 73452 72583 gene locus_tag LOCUS_05070 73452 72583 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_05070 74404 73664 gene locus_tag LOCUS_05080 74404 73664 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_05080 75136 74408 gene locus_tag LOCUS_05090 75136 74408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_05090 76030 75206 gene locus_tag LOCUS_05100 76030 75206 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_05100 78066 76012 gene locus_tag LOCUS_05110 78066 76012 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389968.1 protein_id gnl|my_center|LOCUS_05110 78251 79354 gene locus_tag LOCUS_05120 78251 79354 CDS product alpha-1,4-polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390399.1 protein_id gnl|my_center|LOCUS_05120 79375 81093 gene locus_tag LOCUS_05130 79375 81093 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709182.1 protein_id gnl|my_center|LOCUS_05130 81362 81129 gene locus_tag LOCUS_05140 81362 81129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 81648 82265 gene locus_tag LOCUS_05150 81648 82265 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFG2 protein_id gnl|my_center|LOCUS_05150 82425 82715 gene locus_tag LOCUS_05160 82425 82715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 82771 82974 gene locus_tag LOCUS_05170 82771 82974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 83458 83003 gene locus_tag LOCUS_05180 83458 83003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 83600 84169 gene locus_tag LOCUS_05190 83600 84169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 84251 85309 gene locus_tag LOCUS_05200 84251 85309 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_05200 85319 85825 gene locus_tag LOCUS_05210 85319 85825 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 protein_id gnl|my_center|LOCUS_05210 86504 85815 gene locus_tag LOCUS_05220 86504 85815 CDS product aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708268.1 protein_id gnl|my_center|LOCUS_05220 86802 86542 gene locus_tag LOCUS_05230 86802 86542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 87593 86871 gene locus_tag LOCUS_05240 87593 86871 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_05240 89496 87760 gene locus_tag LOCUS_05250 89496 87760 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969652.1 protein_id gnl|my_center|LOCUS_05250 89678 89517 gene locus_tag LOCUS_05260 89678 89517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 91728 89695 gene locus_tag LOCUS_05270 91728 89695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 92849 91818 gene locus_tag LOCUS_05280 92849 91818 CDS product lactate-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK82 protein_id gnl|my_center|LOCUS_05280 93012 93719 gene locus_tag LOCUS_05290 93012 93719 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_05290 93765 94664 gene locus_tag LOCUS_05300 93765 94664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 94711 95691 gene locus_tag LOCUS_05310 94711 95691 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087329.1 protein_id gnl|my_center|LOCUS_05310 95717 97093 gene locus_tag LOCUS_05320 95717 97093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 protein_id gnl|my_center|LOCUS_05320 97090 97464 gene locus_tag LOCUS_05330 97090 97464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810633.1 protein_id gnl|my_center|LOCUS_05330 98432 97473 gene locus_tag LOCUS_05340 98432 97473 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040213.1 protein_id gnl|my_center|LOCUS_05340 99510 98464 gene locus_tag LOCUS_05350 99510 98464 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729583.1 protein_id gnl|my_center|LOCUS_05350 100938 99625 gene locus_tag LOCUS_05360 100938 99625 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338850.1 protein_id gnl|my_center|LOCUS_05360 101700 101002 gene locus_tag LOCUS_05370 101700 101002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 protein_id gnl|my_center|LOCUS_05370 102445 101693 gene locus_tag LOCUS_05380 102445 101693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809845.1 protein_id gnl|my_center|LOCUS_05380 103455 102442 gene locus_tag LOCUS_05390 103455 102442 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085969.1 protein_id gnl|my_center|LOCUS_05390 104309 103452 gene locus_tag LOCUS_05400 104309 103452 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338849.1 protein_id gnl|my_center|LOCUS_05400 104692 104916 gene locus_tag LOCUS_05410 104692 104916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 105032 104957 gene locus_tag LOCUS_t00070 105032 104957 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 105682 105161 gene locus_tag LOCUS_05420 gene coaD 105682 105161 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK2 protein_id gnl|my_center|LOCUS_05420 108534 105682 gene locus_tag LOCUS_05430 gene gyrA 108534 105682 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_05430 110654 108708 gene locus_tag LOCUS_05440 110654 108708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 111253 110762 gene locus_tag LOCUS_05450 gene ssb 111253 110762 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L50 protein_id gnl|my_center|LOCUS_05450 111584 111348 gene locus_tag LOCUS_05460 111584 111348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 112147 115059 gene locus_tag LOCUS_05470 gene uvrA 112147 115059 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTJ3 protein_id gnl|my_center|LOCUS_05470 115797 115069 gene locus_tag LOCUS_05480 115797 115069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 116224 115880 gene locus_tag LOCUS_05490 116224 115880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 116344 117048 gene locus_tag LOCUS_05500 116344 117048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709720.1 protein_id gnl|my_center|LOCUS_05500 117081 117623 gene locus_tag LOCUS_05510 117081 117623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 118818 117628 gene locus_tag LOCUS_05520 118818 117628 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_05520 119982 118822 gene locus_tag LOCUS_05530 119982 118822 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_05530 120580 120278 gene locus_tag LOCUS_05540 120580 120278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 121563 120814 gene locus_tag LOCUS_05550 121563 120814 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_05550 122387 121560 gene locus_tag LOCUS_05560 gene gctA 122387 121560 CDS product CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_05560 122921 122478 gene locus_tag LOCUS_05570 122921 122478 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929909.1 protein_id gnl|my_center|LOCUS_05570 124324 122954 gene locus_tag LOCUS_05580 124324 122954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_05580 124493 125896 gene locus_tag LOCUS_05590 gene trmFO 124493 125896 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_05590 127430 125868 gene locus_tag LOCUS_05600 127430 125868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_05600 128342 127461 gene locus_tag LOCUS_05610 128342 127461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 128572 129177 gene locus_tag LOCUS_05620 128572 129177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_05620 129376 129771 gene locus_tag LOCUS_05630 129376 129771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 130542 129847 gene locus_tag LOCUS_05640 130542 129847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 131072 130674 gene locus_tag LOCUS_05650 131072 130674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_05650 132022 131087 gene locus_tag LOCUS_05660 132022 131087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05660 133624 132041 gene locus_tag LOCUS_05670 133624 132041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05670 134103 133678 gene locus_tag LOCUS_05680 134103 133678 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389518.1 protein_id gnl|my_center|LOCUS_05680 134303 135160 gene locus_tag LOCUS_05690 134303 135160 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_05690 135305 135496 gene locus_tag LOCUS_05700 135305 135496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 136551 135499 gene locus_tag LOCUS_05710 136551 135499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 137254 136580 gene locus_tag LOCUS_05720 gene pcm 137254 136580 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_05720 138033 137251 gene locus_tag LOCUS_05730 gene surE 138033 137251 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH6 protein_id gnl|my_center|LOCUS_05730 139304 138030 gene locus_tag LOCUS_05740 gene serS 139304 138030 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q22 protein_id gnl|my_center|LOCUS_05740 140349 139450 gene locus_tag LOCUS_05750 gene tatC 140349 139450 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_05750 140808 140359 gene locus_tag LOCUS_05760 140808 140359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 141129 140887 gene locus_tag LOCUS_05770 gene tatA 141129 140887 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB6 protein_id gnl|my_center|LOCUS_05770 142028 141327 gene locus_tag LOCUS_05780 142028 141327 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH1 protein_id gnl|my_center|LOCUS_05780 142883 142032 gene locus_tag LOCUS_05790 142883 142032 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_05790 143641 142940 gene locus_tag LOCUS_05800 143641 142940 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_05800 144639 143638 gene locus_tag LOCUS_05810 144639 143638 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 protein_id gnl|my_center|LOCUS_05810 145640 144636 gene locus_tag LOCUS_05820 145640 144636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 146892 145681 gene locus_tag LOCUS_05830 146892 145681 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 protein_id gnl|my_center|LOCUS_05830 146976 147410 gene locus_tag LOCUS_05840 146976 147410 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383119.1 protein_id gnl|my_center|LOCUS_05840 147457 147621 gene locus_tag LOCUS_05850 147457 147621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 147733 148089 gene locus_tag LOCUS_05860 147733 148089 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_05860 148162 148962 gene locus_tag LOCUS_05870 148162 148962 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_05870 149378 148959 gene locus_tag LOCUS_05880 149378 148959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 150781 149390 gene locus_tag LOCUS_05890 150781 149390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 151688 150786 gene locus_tag LOCUS_05900 151688 150786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 152373 151804 gene locus_tag LOCUS_05910 152373 151804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 152830 152423 gene locus_tag LOCUS_05920 152830 152423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 153174 152935 gene locus_tag LOCUS_05930 153174 152935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 153718 153119 gene locus_tag LOCUS_05940 gene tag 153718 153119 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence04 576 746 gene locus_tag LOCUS_05950 576 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 743 1300 gene locus_tag LOCUS_05960 gene mraZ 743 1300 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NL3 protein_id gnl|my_center|LOCUS_05960 1293 2267 gene locus_tag LOCUS_05970 gene rsmH 1293 2267 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_05970 2282 2716 gene locus_tag LOCUS_05980 2282 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2713 4509 gene locus_tag LOCUS_05990 2713 4509 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_05990 4496 5959 gene locus_tag LOCUS_06000 gene murE 4496 5959 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT9 protein_id gnl|my_center|LOCUS_06000 5964 7433 gene locus_tag LOCUS_06010 gene murF 5964 7433 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 protein_id gnl|my_center|LOCUS_06010 7444 8532 gene locus_tag LOCUS_06020 gene mraY 7444 8532 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_06020 8540 9979 gene locus_tag LOCUS_06030 gene murD 8540 9979 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU2 protein_id gnl|my_center|LOCUS_06030 9980 11104 gene locus_tag LOCUS_06040 9980 11104 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_06040 11101 12240 gene locus_tag LOCUS_06050 gene murG 11101 12240 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_06050 12237 13697 gene locus_tag LOCUS_06060 gene murC 12237 13697 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 protein_id gnl|my_center|LOCUS_06060 13697 14638 gene locus_tag LOCUS_06070 gene murB 13697 14638 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_06070 14635 15537 gene locus_tag LOCUS_06080 gene ddl 14635 15537 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU7 protein_id gnl|my_center|LOCUS_06080 15537 16415 gene locus_tag LOCUS_06090 15537 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 16463 17743 gene locus_tag LOCUS_06100 gene ftsA 16463 17743 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_06100 17851 19683 gene locus_tag LOCUS_06110 17851 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 19883 20869 gene locus_tag LOCUS_06120 gene envA 19883 20869 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L4 protein_id gnl|my_center|LOCUS_06120 21097 21915 gene locus_tag LOCUS_06130 gene bamD 21097 21915 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_06130 21923 23614 gene locus_tag LOCUS_06140 21923 23614 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_06140 23614 25734 gene locus_tag LOCUS_06150 gene ligA 23614 25734 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV5 protein_id gnl|my_center|LOCUS_06150 26201 25731 gene locus_tag LOCUS_06160 26201 25731 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_06160 26972 26628 gene locus_tag LOCUS_06170 26972 26628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 26856 27809 gene locus_tag LOCUS_06180 26856 27809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 27806 28852 gene locus_tag LOCUS_06190 27806 28852 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59650 protein_id gnl|my_center|LOCUS_06190 28868 29776 gene locus_tag LOCUS_06200 28868 29776 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_06200 30360 29866 gene locus_tag LOCUS_06210 gene atpF1 30360 29866 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA7 protein_id gnl|my_center|LOCUS_06210 30869 30375 gene locus_tag LOCUS_06220 gene atpF2 30869 30375 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA6 protein_id gnl|my_center|LOCUS_06220 31201 30977 gene locus_tag LOCUS_06230 31201 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 32022 31291 gene locus_tag LOCUS_06240 gene atpB 32022 31291 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 protein_id gnl|my_center|LOCUS_06240 32424 32068 gene locus_tag LOCUS_06250 32424 32068 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA3 protein_id gnl|my_center|LOCUS_06250 35971 32495 gene locus_tag LOCUS_06260 gene smc 35971 32495 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA2 protein_id gnl|my_center|LOCUS_06260 36628 36011 gene locus_tag LOCUS_06270 36628 36011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 37249 36731 gene locus_tag LOCUS_06280 37249 36731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 protein_id gnl|my_center|LOCUS_06280 37410 38465 gene locus_tag LOCUS_06290 37410 38465 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_06290 38920 38462 gene locus_tag LOCUS_06300 gene ysnE 38920 38462 CDS product putative N-acetyltransferase YsnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94562 protein_id gnl|my_center|LOCUS_06300 39447 38932 gene locus_tag LOCUS_06310 gene apt 39447 38932 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT4 protein_id gnl|my_center|LOCUS_06310 39560 40897 gene locus_tag LOCUS_06320 39560 40897 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190374.1 protein_id gnl|my_center|LOCUS_06320 41010 41951 gene locus_tag LOCUS_06330 41010 41951 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_06330 42427 43410 gene locus_tag LOCUS_06340 42427 43410 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_06340 43513 46104 gene locus_tag LOCUS_06350 43513 46104 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_06350 46121 46543 gene locus_tag LOCUS_06360 46121 46543 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339636.1 protein_id gnl|my_center|LOCUS_06360 46694 47647 gene locus_tag LOCUS_06370 46694 47647 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_06370 48079 47684 gene locus_tag LOCUS_06380 48079 47684 CDS product cytochrome C protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709065.1 protein_id gnl|my_center|LOCUS_06380 48319 49479 gene locus_tag LOCUS_06390 48319 49479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_06390 50709 49483 gene locus_tag LOCUS_06400 50709 49483 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_06400 51019 50798 gene locus_tag LOCUS_06410 51019 50798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 51940 51200 gene locus_tag LOCUS_06420 51940 51200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 52374 52658 gene locus_tag LOCUS_06430 52374 52658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 52914 52838 gene locus_tag LOCUS_t00080 52914 52838 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 53311 54951 gene locus_tag LOCUS_06440 53311 54951 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_06440 54982 55608 gene locus_tag LOCUS_06450 54982 55608 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_06450 55636 55887 gene locus_tag LOCUS_06460 55636 55887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06460 56929 55913 gene locus_tag LOCUS_06470 56929 55913 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_06470 57082 57315 gene locus_tag LOCUS_06480 57082 57315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390701.1 protein_id gnl|my_center|LOCUS_06480 57324 58088 gene locus_tag LOCUS_06490 57324 58088 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 protein_id gnl|my_center|LOCUS_06490 58230 58661 gene locus_tag LOCUS_06500 58230 58661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 58665 59540 gene locus_tag LOCUS_06510 gene sohB 58665 59540 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_06510 59650 59904 gene locus_tag LOCUS_06520 59650 59904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 60199 61101 gene locus_tag LOCUS_06530 gene glyQ 60199 61101 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_06530 61101 63152 gene locus_tag LOCUS_06540 gene glyS 61101 63152 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ43 protein_id gnl|my_center|LOCUS_06540 63160 65820 gene locus_tag LOCUS_06550 63160 65820 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_06550 65894 66964 gene locus_tag LOCUS_06560 gene gmd 65894 66964 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Y5 protein_id gnl|my_center|LOCUS_06560 66969 67916 gene locus_tag LOCUS_06570 gene fcl 66969 67916 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5H3 protein_id gnl|my_center|LOCUS_06570 67909 69339 gene locus_tag LOCUS_06580 67909 69339 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_06580 70374 69349 gene locus_tag LOCUS_06590 70374 69349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 70497 71312 gene locus_tag LOCUS_06600 70497 71312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 71334 72224 gene locus_tag LOCUS_06610 71334 72224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 72569 73927 gene locus_tag LOCUS_06620 72569 73927 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 protein_id gnl|my_center|LOCUS_06620 74681 73932 gene locus_tag LOCUS_06630 74681 73932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_06630 75411 74761 gene locus_tag LOCUS_06640 75411 74761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 76363 75455 gene locus_tag LOCUS_06650 76363 75455 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_06650 76557 77519 gene locus_tag LOCUS_06660 76557 77519 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_06660 77516 78316 gene locus_tag LOCUS_06670 77516 78316 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_06670 78317 79351 gene locus_tag LOCUS_06680 78317 79351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 79348 80382 gene locus_tag LOCUS_06690 79348 80382 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_06690 80397 82175 gene locus_tag LOCUS_06700 80397 82175 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_06700 82179 83225 gene locus_tag LOCUS_06710 gene pyrC 82179 83225 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ9 protein_id gnl|my_center|LOCUS_06710 83314 84309 gene locus_tag LOCUS_06720 gene yhdH 83314 84309 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416807.1 protein_id gnl|my_center|LOCUS_06720 84406 84933 gene locus_tag LOCUS_06730 84406 84933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 85150 85350 gene locus_tag LOCUS_06740 85150 85350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 85535 85611 gene locus_tag LOCUS_t00090 85535 85611 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 85671 85901 gene locus_tag LOCUS_06750 85671 85901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 86094 87653 gene locus_tag LOCUS_06760 86094 87653 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_06760 89733 87673 gene locus_tag LOCUS_06770 89733 87673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 90162 91007 gene locus_tag LOCUS_06780 90162 91007 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_06780 91036 92244 gene locus_tag LOCUS_06790 91036 92244 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_06790 92261 93394 gene locus_tag LOCUS_06800 92261 93394 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_06800 93391 94005 gene locus_tag LOCUS_06810 93391 94005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_06810 94076 94321 gene locus_tag LOCUS_06820 94076 94321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 94429 95568 gene locus_tag LOCUS_06830 94429 95568 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 protein_id gnl|my_center|LOCUS_06830 96360 95659 gene locus_tag LOCUS_06840 96360 95659 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086579.1 protein_id gnl|my_center|LOCUS_06840 97240 96395 gene locus_tag LOCUS_06850 97240 96395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 97467 98666 gene locus_tag LOCUS_06860 97467 98666 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_06860 98750 99364 gene locus_tag LOCUS_06870 98750 99364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 99410 100462 gene locus_tag LOCUS_06880 99410 100462 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_06880 101864 100479 gene locus_tag LOCUS_06890 101864 100479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 102040 102606 gene locus_tag LOCUS_06900 102040 102606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 103232 102972 gene locus_tag LOCUS_06910 103232 102972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 103554 103345 gene locus_tag LOCUS_06920 103554 103345 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389667.1 protein_id gnl|my_center|LOCUS_06920 105142 103919 gene locus_tag LOCUS_06930 105142 103919 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_06930 105357 107009 gene locus_tag LOCUS_06940 105357 107009 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_06940 107084 108748 gene locus_tag LOCUS_06950 107084 108748 CDS product acetolactate synthase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195870.1 protein_id gnl|my_center|LOCUS_06950 108779 110878 gene locus_tag LOCUS_06960 108779 110878 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_06960 110900 112081 gene locus_tag LOCUS_06970 110900 112081 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808070.1 protein_id gnl|my_center|LOCUS_06970 114065 112095 gene locus_tag LOCUS_06980 114065 112095 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090708.1 protein_id gnl|my_center|LOCUS_06980 114356 115051 gene locus_tag LOCUS_06990 114356 115051 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_06990 115266 115712 gene locus_tag LOCUS_07000 115266 115712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 115766 116389 gene locus_tag LOCUS_07010 115766 116389 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS19 protein_id gnl|my_center|LOCUS_07010 116715 118064 gene locus_tag LOCUS_07020 116715 118064 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389668.1 protein_id gnl|my_center|LOCUS_07020 118124 119002 gene locus_tag LOCUS_07030 118124 119002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 119820 118999 gene locus_tag LOCUS_07040 119820 118999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 120633 119824 gene locus_tag LOCUS_07050 120633 119824 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971637.1 protein_id gnl|my_center|LOCUS_07050 121446 120655 gene locus_tag LOCUS_07060 121446 120655 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_07060 121675 122745 gene locus_tag LOCUS_07070 121675 122745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 122852 123460 gene locus_tag LOCUS_07080 122852 123460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 123541 124137 gene locus_tag LOCUS_07090 gene phnN 123541 124137 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCF6 protein_id gnl|my_center|LOCUS_07090 124655 124155 gene locus_tag LOCUS_07100 124655 124155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 125439 124777 gene locus_tag LOCUS_07110 125439 124777 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_07110 125768 125523 gene locus_tag LOCUS_07120 125768 125523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 126219 125860 gene locus_tag LOCUS_07130 126219 125860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064546.1 protein_id gnl|my_center|LOCUS_07130 126677 126273 gene locus_tag LOCUS_07140 126677 126273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_07140 126871 127872 gene locus_tag LOCUS_07150 126871 127872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 128123 127887 gene locus_tag LOCUS_07160 128123 127887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 128336 128707 gene locus_tag LOCUS_07170 128336 128707 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533616.1 protein_id gnl|my_center|LOCUS_07170 128708 129769 gene locus_tag LOCUS_07180 gene pyrD 128708 129769 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_07180 130924 129776 gene locus_tag LOCUS_07190 130924 129776 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706256.1 protein_id gnl|my_center|LOCUS_07190 131700 130921 gene locus_tag LOCUS_07200 gene nadK 131700 130921 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_07200 131790 132398 gene locus_tag LOCUS_07210 131790 132398 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_07210 133685 132456 gene locus_tag LOCUS_07220 133685 132456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_07220 134602 133727 gene locus_tag LOCUS_07230 134602 133727 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816037.1 protein_id gnl|my_center|LOCUS_07230 134784 135572 gene locus_tag LOCUS_07240 gene pcaR 134784 135572 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385634.1 protein_id gnl|my_center|LOCUS_07240 135944 135594 gene locus_tag LOCUS_07250 135944 135594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 137071 136073 gene locus_tag LOCUS_07260 gene moaA 137071 136073 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_07260 139365 137266 gene locus_tag LOCUS_07270 139365 137266 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088232.1 protein_id gnl|my_center|LOCUS_07270 139542 139883 gene locus_tag LOCUS_07280 139542 139883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 139907 140536 gene locus_tag LOCUS_07290 139907 140536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_07290 140670 141323 gene locus_tag LOCUS_07300 140670 141323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263874.1 protein_id gnl|my_center|LOCUS_07300 141366 141656 gene locus_tag LOCUS_07310 141366 141656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 142298 141681 gene locus_tag LOCUS_07320 142298 141681 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919228.1 protein_id gnl|my_center|LOCUS_07320 142555 143490 gene locus_tag LOCUS_07330 gene fdhD 142555 143490 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU0 protein_id gnl|my_center|LOCUS_07330 143487 144113 gene locus_tag LOCUS_07340 gene mobA 143487 144113 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_07340 144110 144637 gene locus_tag LOCUS_07350 144110 144637 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970357.1 protein_id gnl|my_center|LOCUS_07350 144634 145419 gene locus_tag LOCUS_07360 144634 145419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 145699 146364 gene locus_tag LOCUS_07370 145699 146364 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970355.1 protein_id gnl|my_center|LOCUS_07370 146542 146739 gene locus_tag LOCUS_07380 146542 146739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence05 455 2080 gene locus_tag LOCUS_07390 455 2080 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390917.1 protein_id gnl|my_center|LOCUS_07390 2080 3030 gene locus_tag LOCUS_07400 2080 3030 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 protein_id gnl|my_center|LOCUS_07400 3852 3037 gene locus_tag LOCUS_07410 gene uppP1 3852 3037 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_07410 4072 8697 gene locus_tag LOCUS_07420 gene gltB 4072 8697 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_07420 8701 10146 gene locus_tag LOCUS_07430 8701 10146 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815767.1 protein_id gnl|my_center|LOCUS_07430 10738 10154 gene locus_tag LOCUS_07440 10738 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11366 10830 gene locus_tag LOCUS_07450 11366 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 11468 12181 gene locus_tag LOCUS_07460 11468 12181 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_07460 12178 13011 gene locus_tag LOCUS_07470 12178 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 13008 13388 gene locus_tag LOCUS_07480 gene ygdD 13008 13388 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_07480 13962 13336 gene locus_tag LOCUS_07490 13962 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 14626 14108 gene locus_tag LOCUS_07500 14626 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 16478 14748 gene locus_tag LOCUS_07510 gene pckA1 16478 14748 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_07510 17373 16639 gene locus_tag LOCUS_07520 17373 16639 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391167.1 protein_id gnl|my_center|LOCUS_07520 18236 17481 gene locus_tag LOCUS_07530 18236 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251636.2 protein_id gnl|my_center|LOCUS_07530 18425 18249 gene locus_tag LOCUS_07540 gene cbtB 18425 18249 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708714.1 protein_id gnl|my_center|LOCUS_07540 18887 19669 gene locus_tag LOCUS_07550 18887 19669 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_07550 19671 21440 gene locus_tag LOCUS_07560 19671 21440 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_07560 22371 21442 gene locus_tag LOCUS_07570 22371 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 23195 22404 gene locus_tag LOCUS_07580 23195 22404 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728686.1 protein_id gnl|my_center|LOCUS_07580 23413 23910 gene locus_tag LOCUS_07590 23413 23910 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_07590 23907 24806 gene locus_tag LOCUS_07600 23907 24806 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_07600 24930 25337 gene locus_tag LOCUS_07610 24930 25337 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_07610 25358 25651 gene locus_tag LOCUS_07620 25358 25651 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_07620 25674 27413 gene locus_tag LOCUS_07630 25674 27413 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ6 protein_id gnl|my_center|LOCUS_07630 28138 27410 gene locus_tag LOCUS_07640 gene bioH 28138 27410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 protein_id gnl|my_center|LOCUS_07640 28939 28232 gene locus_tag LOCUS_07650 28939 28232 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815479.1 protein_id gnl|my_center|LOCUS_07650 29241 30635 gene locus_tag LOCUS_07660 gene ahcY 29241 30635 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ7 protein_id gnl|my_center|LOCUS_07660 30727 32379 gene locus_tag LOCUS_07670 30727 32379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 32479 32808 gene locus_tag LOCUS_07680 32479 32808 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390117.1 protein_id gnl|my_center|LOCUS_07680 33483 32830 gene locus_tag LOCUS_07690 33483 32830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 34290 33520 gene locus_tag LOCUS_07700 34290 33520 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089900.1 protein_id gnl|my_center|LOCUS_07700 35331 34294 gene locus_tag LOCUS_07710 35331 34294 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR2 protein_id gnl|my_center|LOCUS_07710 35489 35989 gene locus_tag LOCUS_07720 35489 35989 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_07720 35982 37004 gene locus_tag LOCUS_07730 35982 37004 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_07730 37001 37744 gene locus_tag LOCUS_07740 37001 37744 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_07740 37741 40722 gene locus_tag LOCUS_07750 37741 40722 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_07750 40719 44177 gene locus_tag LOCUS_07760 40719 44177 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_07760 44373 44690 gene locus_tag LOCUS_07770 44373 44690 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_07770 44724 45494 gene locus_tag LOCUS_07780 gene gloB 44724 45494 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_07780 46155 45508 gene locus_tag LOCUS_07790 46155 45508 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_07790 46531 46160 gene locus_tag LOCUS_07800 46531 46160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 47888 46563 gene locus_tag LOCUS_07810 47888 46563 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_07810 48886 47921 gene locus_tag LOCUS_07820 gene accD 48886 47921 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07820 49761 48916 gene locus_tag LOCUS_07830 gene trpA 49761 48916 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_07830 50974 49766 gene locus_tag LOCUS_07840 gene trpB 50974 49766 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E5 protein_id gnl|my_center|LOCUS_07840 51755 51117 gene locus_tag LOCUS_07850 gene trpF 51755 51117 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C5 protein_id gnl|my_center|LOCUS_07850 52497 51757 gene locus_tag LOCUS_07860 gene pyrF 52497 51757 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_07860 52991 52596 gene locus_tag LOCUS_07870 52991 52596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 53322 53041 gene locus_tag LOCUS_07880 gene ihfB 53322 53041 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 protein_id gnl|my_center|LOCUS_07880 54304 53390 gene locus_tag LOCUS_07890 54304 53390 CDS product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529583.1 protein_id gnl|my_center|LOCUS_07890 56224 54422 gene locus_tag LOCUS_07900 56224 54422 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 protein_id gnl|my_center|LOCUS_07900 57009 56380 gene locus_tag LOCUS_07910 gene cmk 57009 56380 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_07910 58364 57024 gene locus_tag LOCUS_07920 gene aroA 58364 57024 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP5 protein_id gnl|my_center|LOCUS_07920 58595 58975 gene locus_tag LOCUS_07930 58595 58975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_07930 60412 59048 gene locus_tag LOCUS_07940 60412 59048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 59159 59234 gene locus_tag LOCUS_t00100 59159 59234 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 60933 61361 gene locus_tag LOCUS_07950 60933 61361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 62771 61506 gene locus_tag LOCUS_07960 gene umuC 62771 61506 CDS product umuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940166.1 protein_id gnl|my_center|LOCUS_07960 63268 62759 gene locus_tag LOCUS_07970 gene umuD 63268 62759 CDS product umuD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403083.1 protein_id gnl|my_center|LOCUS_07970 67019 63642 gene locus_tag LOCUS_07980 67019 63642 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BR0 protein_id gnl|my_center|LOCUS_07980 69688 67019 gene locus_tag LOCUS_07990 69688 67019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090810.1 protein_id gnl|my_center|LOCUS_07990 70698 70024 gene locus_tag LOCUS_08000 70698 70024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_08000 71150 70695 gene locus_tag LOCUS_08010 71150 70695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390640.1 protein_id gnl|my_center|LOCUS_08010 74060 71376 gene locus_tag LOCUS_08020 74060 71376 CDS product type III restriction protein res subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_08020 76246 74060 gene locus_tag LOCUS_08030 76246 74060 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_08030 76766 76518 gene locus_tag LOCUS_08040 76766 76518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 77036 76788 gene locus_tag LOCUS_08050 77036 76788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 78138 77641 gene locus_tag LOCUS_08060 78138 77641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 78940 78332 gene locus_tag LOCUS_08070 78940 78332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_08070 79197 78937 gene locus_tag LOCUS_08080 79197 78937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 80449 79805 gene locus_tag LOCUS_08090 80449 79805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 81634 80474 gene locus_tag LOCUS_08100 81634 80474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 82303 81704 gene locus_tag LOCUS_08110 82303 81704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 83487 82543 gene locus_tag LOCUS_08120 83487 82543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_08120 83694 84338 gene locus_tag LOCUS_08130 83694 84338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083863.1 protein_id gnl|my_center|LOCUS_08130 86127 84346 gene locus_tag LOCUS_08140 86127 84346 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706454.1 protein_id gnl|my_center|LOCUS_08140 87914 86145 gene locus_tag LOCUS_08150 87914 86145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 protein_id gnl|my_center|LOCUS_08150 88851 87931 gene locus_tag LOCUS_08160 88851 87931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_08160 89947 88919 gene locus_tag LOCUS_08170 89947 88919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_08170 91575 89953 gene locus_tag LOCUS_08180 91575 89953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090343.1 protein_id gnl|my_center|LOCUS_08180 91968 92936 gene locus_tag LOCUS_08190 91968 92936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 95468 92958 gene locus_tag LOCUS_08200 95468 92958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 96479 95595 gene locus_tag LOCUS_08210 96479 95595 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 protein_id gnl|my_center|LOCUS_08210 97471 96476 gene locus_tag LOCUS_08220 97471 96476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_08220 98463 97468 gene locus_tag LOCUS_08230 98463 97468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_08230 99406 98480 gene locus_tag LOCUS_08240 99406 98480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040797.1 protein_id gnl|my_center|LOCUS_08240 100380 99403 gene locus_tag LOCUS_08250 100380 99403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040798.1 protein_id gnl|my_center|LOCUS_08250 102033 100447 gene locus_tag LOCUS_08260 102033 100447 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815318.1 protein_id gnl|my_center|LOCUS_08260 102203 103159 gene locus_tag LOCUS_08270 102203 103159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 protein_id gnl|my_center|LOCUS_08270 103282 103743 gene locus_tag LOCUS_08280 103282 103743 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_08280 103880 104116 gene locus_tag LOCUS_08290 103880 104116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 104294 104530 gene locus_tag LOCUS_08300 104294 104530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 105072 104608 gene locus_tag LOCUS_08310 105072 104608 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_08310 105705 105124 gene locus_tag LOCUS_08320 105705 105124 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385412.1 protein_id gnl|my_center|LOCUS_08320 107547 106012 gene locus_tag LOCUS_08330 107547 106012 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI0 protein_id gnl|my_center|LOCUS_08330 108384 107602 gene locus_tag LOCUS_08340 108384 107602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_08340 109263 108427 gene locus_tag LOCUS_08350 109263 108427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_08350 109871 109263 gene locus_tag LOCUS_08360 109871 109263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08360 110887 109877 gene locus_tag LOCUS_08370 110887 109877 CDS product KpsF/GutQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387775.1 protein_id gnl|my_center|LOCUS_08370 111746 111108 gene locus_tag LOCUS_08380 gene rnd1 111746 111108 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_08380 111901 111815 gene locus_tag LOCUS_t00110 111901 111815 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 112204 113166 gene locus_tag LOCUS_08390 112204 113166 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387777.1 protein_id gnl|my_center|LOCUS_08390 113712 113338 gene locus_tag LOCUS_08400 113712 113338 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_08400 115268 113856 gene locus_tag LOCUS_08410 115268 113856 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_08410 116375 115287 gene locus_tag LOCUS_08420 116375 115287 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_08420 117071 116409 gene locus_tag LOCUS_08430 117071 116409 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809168.1 protein_id gnl|my_center|LOCUS_08430 120036 117193 gene locus_tag LOCUS_08440 120036 117193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 120988 120155 gene locus_tag LOCUS_08450 120988 120155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 121759 121070 gene locus_tag LOCUS_08460 121759 121070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 122357 121836 gene locus_tag LOCUS_08470 122357 121836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 122950 122456 gene locus_tag LOCUS_08480 122950 122456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 124119 123388 gene locus_tag LOCUS_08490 124119 123388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 124409 124672 gene locus_tag LOCUS_08500 124409 124672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 124826 126145 gene locus_tag LOCUS_08510 124826 126145 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_08510 126151 127119 gene locus_tag LOCUS_08520 126151 127119 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_08520 127166 127714 gene locus_tag LOCUS_08530 127166 127714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 128395 127739 gene locus_tag LOCUS_08540 128395 127739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 129635 128622 gene locus_tag LOCUS_08550 129635 128622 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531405.1 protein_id gnl|my_center|LOCUS_08550 130693 129653 gene locus_tag LOCUS_08560 130693 129653 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_08560 131718 130807 gene locus_tag LOCUS_08570 131718 130807 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228724.1 protein_id gnl|my_center|LOCUS_08570 132203 131715 gene locus_tag LOCUS_08580 132203 131715 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522021.1 protein_id gnl|my_center|LOCUS_08580 133125 132238 gene locus_tag LOCUS_08590 133125 132238 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N85 protein_id gnl|my_center|LOCUS_08590 133819 133247 gene locus_tag LOCUS_08600 133819 133247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 134639 133899 gene locus_tag LOCUS_08610 134639 133899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 134886 134797 gene locus_tag LOCUS_t00120 134886 134797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 135060 135599 gene locus_tag LOCUS_08620 135060 135599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 135900 135616 gene locus_tag LOCUS_08630 135900 135616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 137776 135923 gene locus_tag LOCUS_08640 gene lepA 137776 135923 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNY6 protein_id gnl|my_center|LOCUS_08640 137855 138478 gene locus_tag LOCUS_08650 137855 138478 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_08650 138735 138520 gene locus_tag LOCUS_08660 138735 138520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 139109 138900 gene locus_tag LOCUS_08670 139109 138900 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_08670 140287 139388 gene locus_tag LOCUS_08680 gene folD 140287 139388 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_08680 140652 140284 gene locus_tag LOCUS_08690 140652 140284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 140932 140633 gene locus_tag LOCUS_08700 140932 140633 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_08700 141132 141207 gene locus_tag LOCUS_t00130 141132 141207 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 142351 141275 gene locus_tag LOCUS_08710 142351 141275 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945917.1 protein_id gnl|my_center|LOCUS_08710 142526 142927 gene locus_tag LOCUS_08720 142526 142927 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087050.1 protein_id gnl|my_center|LOCUS_08720 143846 142950 gene locus_tag LOCUS_08730 143846 142950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 144353 143946 gene locus_tag LOCUS_08740 144353 143946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_08740 144408 144698 gene locus_tag LOCUS_08750 144408 144698 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_08750 145562 144801 gene locus_tag LOCUS_08760 145562 144801 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence06 341 1084 gene locus_tag LOCUS_08770 341 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1094 1744 gene locus_tag LOCUS_08780 1094 1744 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_08780 1704 2204 gene locus_tag LOCUS_08790 1704 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3797 2157 gene locus_tag LOCUS_08800 3797 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4401 3838 gene locus_tag LOCUS_08810 4401 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 5201 5782 gene locus_tag LOCUS_08820 5201 5782 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085258.1 protein_id gnl|my_center|LOCUS_08820 6524 5790 gene locus_tag LOCUS_08830 6524 5790 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_08830 8015 6534 gene locus_tag LOCUS_08840 8015 6534 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707191.1 protein_id gnl|my_center|LOCUS_08840 8459 8040 gene locus_tag LOCUS_08850 8459 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 9107 8499 gene locus_tag LOCUS_08860 9107 8499 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267478.1 protein_id gnl|my_center|LOCUS_08860 9644 9123 gene locus_tag LOCUS_08870 9644 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 11696 9741 gene locus_tag LOCUS_08880 11696 9741 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869125.1 protein_id gnl|my_center|LOCUS_08880 12800 11781 gene locus_tag LOCUS_08890 12800 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878488.1 protein_id gnl|my_center|LOCUS_08890 13094 14914 gene locus_tag LOCUS_08900 gene ggt 13094 14914 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_08900 15024 15536 gene locus_tag LOCUS_08910 15024 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 15549 15917 gene locus_tag LOCUS_08920 15549 15917 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389807.1 protein_id gnl|my_center|LOCUS_08920 17403 15937 gene locus_tag LOCUS_08930 17403 15937 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_08930 18053 17718 gene locus_tag LOCUS_08940 18053 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 protein_id gnl|my_center|LOCUS_08940 19007 18126 gene locus_tag LOCUS_08950 19007 18126 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533547.1 protein_id gnl|my_center|LOCUS_08950 20146 19046 gene locus_tag LOCUS_08960 20146 19046 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 protein_id gnl|my_center|LOCUS_08960 20801 20148 gene locus_tag LOCUS_08970 20801 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 21095 20859 gene locus_tag LOCUS_08980 21095 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 22460 21228 gene locus_tag LOCUS_08990 22460 21228 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_08990 22503 23123 gene locus_tag LOCUS_09000 22503 23123 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920499.1 protein_id gnl|my_center|LOCUS_09000 23146 24015 gene locus_tag LOCUS_09010 23146 24015 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_09010 24020 24673 gene locus_tag LOCUS_09020 24020 24673 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_09020 25264 24656 gene locus_tag LOCUS_09030 25264 24656 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_09030 25421 26167 gene locus_tag LOCUS_09040 25421 26167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 27406 26177 gene locus_tag LOCUS_09050 27406 26177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 protein_id gnl|my_center|LOCUS_09050 27582 28391 gene locus_tag LOCUS_09060 27582 28391 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_09060 28404 29321 gene locus_tag LOCUS_09070 28404 29321 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 protein_id gnl|my_center|LOCUS_09070 29353 30747 gene locus_tag LOCUS_09080 29353 30747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_09080 30753 31625 gene locus_tag LOCUS_09090 30753 31625 CDS product phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085067.1 protein_id gnl|my_center|LOCUS_09090 31643 31894 gene locus_tag LOCUS_09100 31643 31894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 32958 31891 gene locus_tag LOCUS_09110 32958 31891 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927167.1 protein_id gnl|my_center|LOCUS_09110 33699 32995 gene locus_tag LOCUS_09120 33699 32995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 35083 34010 gene locus_tag LOCUS_09130 35083 34010 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF76 protein_id gnl|my_center|LOCUS_09130 36157 35093 gene locus_tag LOCUS_09140 36157 35093 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085526.1 protein_id gnl|my_center|LOCUS_09140 37811 36201 gene locus_tag LOCUS_09150 37811 36201 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 protein_id gnl|my_center|LOCUS_09150 38311 37814 gene locus_tag LOCUS_09160 38311 37814 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_09160 39592 38330 gene locus_tag LOCUS_09170 39592 38330 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 protein_id gnl|my_center|LOCUS_09170 40827 39646 gene locus_tag LOCUS_09180 40827 39646 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_09180 42005 40836 gene locus_tag LOCUS_09190 42005 40836 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_09190 42551 42033 gene locus_tag LOCUS_09200 42551 42033 CDS product molybdenum cofactor biosynthesis protein MoeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_09200 43940 42555 gene locus_tag LOCUS_09210 43940 42555 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_09210 44079 44975 gene locus_tag LOCUS_09220 44079 44975 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064624.1 protein_id gnl|my_center|LOCUS_09220 45408 44989 gene locus_tag LOCUS_09230 45408 44989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 45627 45421 gene locus_tag LOCUS_09240 45627 45421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 46491 45688 gene locus_tag LOCUS_09250 gene hyi 46491 45688 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UZ3 protein_id gnl|my_center|LOCUS_09250 46878 46540 gene locus_tag LOCUS_09260 46878 46540 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340730.1 protein_id gnl|my_center|LOCUS_09260 48280 46958 gene locus_tag LOCUS_09270 gene amt-1 48280 46958 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_09270 49351 48494 gene locus_tag LOCUS_09280 gene bcpA 49351 48494 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_09280 50229 49450 gene locus_tag LOCUS_09290 50229 49450 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930717.1 protein_id gnl|my_center|LOCUS_09290 51211 50249 gene locus_tag LOCUS_09300 gene serA 51211 50249 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224591.1 protein_id gnl|my_center|LOCUS_09300 51434 52375 gene locus_tag LOCUS_09310 51434 52375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 53443 52412 gene locus_tag LOCUS_09320 53443 52412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_09320 53645 54556 gene locus_tag LOCUS_09330 gene prpB 53645 54556 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRX5 protein_id gnl|my_center|LOCUS_09330 56498 54579 gene locus_tag LOCUS_09340 56498 54579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 56817 56515 gene locus_tag LOCUS_09350 56817 56515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 59277 56860 gene locus_tag LOCUS_09360 59277 56860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 59754 59996 gene locus_tag LOCUS_09370 59754 59996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 60732 60016 gene locus_tag LOCUS_09380 60732 60016 CDS product dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552063.1 protein_id gnl|my_center|LOCUS_09380 60829 61290 gene locus_tag LOCUS_09390 60829 61290 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 protein_id gnl|my_center|LOCUS_09390 61318 62133 gene locus_tag LOCUS_09400 61318 62133 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085614.1 protein_id gnl|my_center|LOCUS_09400 62197 63210 gene locus_tag LOCUS_09410 gene fldW 62197 63210 CDS product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_09410 63248 63925 gene locus_tag LOCUS_09420 gene menG 63248 63925 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085070.1 protein_id gnl|my_center|LOCUS_09420 64059 64814 gene locus_tag LOCUS_09430 gene fabG 64059 64814 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_09430 65017 64811 gene locus_tag LOCUS_09440 65017 64811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 66127 65258 gene locus_tag LOCUS_09450 66127 65258 CDS product citrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_09450 66417 66181 gene locus_tag LOCUS_09460 66417 66181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 68005 66470 gene locus_tag LOCUS_09470 68005 66470 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7V1 protein_id gnl|my_center|LOCUS_09470 68987 68082 gene locus_tag LOCUS_09480 68987 68082 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083811.1 protein_id gnl|my_center|LOCUS_09480 69968 68997 gene locus_tag LOCUS_09490 69968 68997 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 protein_id gnl|my_center|LOCUS_09490 71670 70054 gene locus_tag LOCUS_09500 71670 70054 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_09500 72788 71754 gene locus_tag LOCUS_09510 72788 71754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_09510 73777 72785 gene locus_tag LOCUS_09520 73777 72785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_09520 74036 74458 gene locus_tag LOCUS_09530 gene pcaC 74036 74458 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567285.1 protein_id gnl|my_center|LOCUS_09530 74462 75346 gene locus_tag LOCUS_09540 74462 75346 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084202.1 protein_id gnl|my_center|LOCUS_09540 76548 75442 gene locus_tag LOCUS_09550 gene lldA 76548 75442 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 protein_id gnl|my_center|LOCUS_09550 77029 76541 gene locus_tag LOCUS_09560 77029 76541 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q6 protein_id gnl|my_center|LOCUS_09560 77176 77472 gene locus_tag LOCUS_09570 77176 77472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 77735 77544 gene locus_tag LOCUS_09580 77735 77544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 77655 78050 gene locus_tag LOCUS_09590 77655 78050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 79311 78058 gene locus_tag LOCUS_09600 79311 78058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_09600 80611 79346 gene locus_tag LOCUS_09610 80611 79346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808711.1 protein_id gnl|my_center|LOCUS_09610 81152 80784 gene locus_tag LOCUS_09620 81152 80784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_09620 83337 81262 gene locus_tag LOCUS_09630 gene bioW 83337 81262 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225692.1 protein_id gnl|my_center|LOCUS_09630 84496 83339 gene locus_tag LOCUS_09640 84496 83339 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_09640 84963 85703 gene locus_tag LOCUS_09650 84963 85703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 86294 85806 gene locus_tag LOCUS_09660 86294 85806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184771.1 protein_id gnl|my_center|LOCUS_09660 87097 86324 gene locus_tag LOCUS_09670 87097 86324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 87889 87116 gene locus_tag LOCUS_09680 87889 87116 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_09680 89118 87901 gene locus_tag LOCUS_09690 gene hemA 89118 87901 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08262 protein_id gnl|my_center|LOCUS_09690 89397 90779 gene locus_tag LOCUS_09700 89397 90779 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_09700 90830 92215 gene locus_tag LOCUS_09710 gene rimO 90830 92215 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS95 protein_id gnl|my_center|LOCUS_09710 92617 92243 gene locus_tag LOCUS_09720 92617 92243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 93186 92779 gene locus_tag LOCUS_09730 93186 92779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 93346 94002 gene locus_tag LOCUS_09740 93346 94002 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_09740 94024 94728 gene locus_tag LOCUS_09750 94024 94728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 94915 95343 gene locus_tag LOCUS_09760 94915 95343 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_09760 95964 95380 gene locus_tag LOCUS_09770 95964 95380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 96528 95968 gene locus_tag LOCUS_09780 96528 95968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 96772 96563 gene locus_tag LOCUS_09790 96772 96563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_09790 97570 96911 gene locus_tag LOCUS_09800 97570 96911 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720123.1 protein_id gnl|my_center|LOCUS_09800 99258 97567 gene locus_tag LOCUS_09810 99258 97567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 100600 99317 gene locus_tag LOCUS_09820 100600 99317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085877.1 protein_id gnl|my_center|LOCUS_09820 100852 101046 gene locus_tag LOCUS_09830 100852 101046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 101171 102070 gene locus_tag LOCUS_09840 101171 102070 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_09840 102723 102088 gene locus_tag LOCUS_09850 102723 102088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 103382 102744 gene locus_tag LOCUS_09860 gene ubiX 103382 102744 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNP2 protein_id gnl|my_center|LOCUS_09860 104810 103431 gene locus_tag LOCUS_09870 104810 103431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 105025 106701 gene locus_tag LOCUS_09880 gene mdlC 105025 106701 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_09880 107318 106698 gene locus_tag LOCUS_09890 107318 106698 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103690.1 protein_id gnl|my_center|LOCUS_09890 108438 107380 gene locus_tag LOCUS_09900 108438 107380 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 protein_id gnl|my_center|LOCUS_09900 108329 108538 gene locus_tag LOCUS_09910 108329 108538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 109442 108561 gene locus_tag LOCUS_09920 109442 108561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087853.1 protein_id gnl|my_center|LOCUS_09920 109636 110919 gene locus_tag LOCUS_09930 109636 110919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388809.1 protein_id gnl|my_center|LOCUS_09930 110927 111418 gene locus_tag LOCUS_09940 110927 111418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 111514 112791 gene locus_tag LOCUS_09950 111514 112791 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968505.1 protein_id gnl|my_center|LOCUS_09950 112896 114407 gene locus_tag LOCUS_09960 112896 114407 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336822.1 protein_id gnl|my_center|LOCUS_09960 114422 115465 gene locus_tag LOCUS_09970 114422 115465 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336821.1 protein_id gnl|my_center|LOCUS_09970 115468 116604 gene locus_tag LOCUS_09980 115468 116604 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809978.1 protein_id gnl|my_center|LOCUS_09980 118148 116601 gene locus_tag LOCUS_09990 118148 116601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 118545 118766 gene locus_tag LOCUS_10000 118545 118766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 118768 118941 gene locus_tag LOCUS_10010 118768 118941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 119401 118967 gene locus_tag LOCUS_10020 119401 118967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 120380 119514 gene locus_tag LOCUS_10030 120380 119514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 120738 120472 gene locus_tag LOCUS_10040 120738 120472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 121119 122288 gene locus_tag LOCUS_10050 121119 122288 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_10050 123434 122886 gene locus_tag LOCUS_10060 123434 122886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence07 203 279 gene locus_tag LOCUS_t00140 203 279 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1531 617 gene locus_tag LOCUS_10070 1531 617 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_10070 1805 2254 gene locus_tag LOCUS_10080 1805 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2771 2262 gene locus_tag LOCUS_10090 2771 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4354 2768 gene locus_tag LOCUS_10100 4354 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4736 4395 gene locus_tag LOCUS_10110 4736 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7265 4830 gene locus_tag LOCUS_10120 7265 4830 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528966.1 protein_id gnl|my_center|LOCUS_10120 8419 7457 gene locus_tag LOCUS_10130 8419 7457 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_10130 9064 8537 gene locus_tag LOCUS_10140 9064 8537 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_10140 9313 9735 gene locus_tag LOCUS_10150 9313 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 9806 10351 gene locus_tag LOCUS_10160 9806 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087646.1 protein_id gnl|my_center|LOCUS_10160 10432 12510 gene locus_tag LOCUS_10170 10432 12510 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921329.1 protein_id gnl|my_center|LOCUS_10170 12629 13066 gene locus_tag LOCUS_10180 12629 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 13204 13950 gene locus_tag LOCUS_10190 13204 13950 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_10190 13904 14329 gene locus_tag LOCUS_10200 13904 14329 CDS product biopolymer transporter protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_10200 14326 14739 gene locus_tag LOCUS_10210 14326 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14739 15560 gene locus_tag LOCUS_10220 14739 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 15688 16224 gene locus_tag LOCUS_10230 15688 16224 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_10230 16307 17302 gene locus_tag LOCUS_10240 16307 17302 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_10240 17449 19962 gene locus_tag LOCUS_10250 gene femA 17449 19962 CDS product ferric-mycobactin receptor FemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 protein_id gnl|my_center|LOCUS_10250 20094 20405 gene locus_tag LOCUS_10260 20094 20405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20402 21985 gene locus_tag LOCUS_10270 20402 21985 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_10270 21982 22263 gene locus_tag LOCUS_10280 21982 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 23006 22386 gene locus_tag LOCUS_10290 23006 22386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 24193 23081 gene locus_tag LOCUS_10300 24193 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 24885 24190 gene locus_tag LOCUS_10310 gene modB 24885 24190 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089690.1 protein_id gnl|my_center|LOCUS_10310 25660 24878 gene locus_tag LOCUS_10320 gene modA 25660 24878 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_10320 26108 25743 gene locus_tag LOCUS_10330 26108 25743 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_10330 26245 27036 gene locus_tag LOCUS_10340 26245 27036 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 protein_id gnl|my_center|LOCUS_10340 27859 27221 gene locus_tag LOCUS_10350 27859 27221 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085711.1 protein_id gnl|my_center|LOCUS_10350 29157 27856 gene locus_tag LOCUS_10360 29157 27856 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194989.1 protein_id gnl|my_center|LOCUS_10360 29614 29267 gene locus_tag LOCUS_10370 29614 29267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 30083 29730 gene locus_tag LOCUS_10380 30083 29730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 31111 30080 gene locus_tag LOCUS_10390 31111 30080 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_10390 32301 31102 gene locus_tag LOCUS_10400 gene caiA 32301 31102 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_10400 32525 32845 gene locus_tag LOCUS_10410 32525 32845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 33751 32861 gene locus_tag LOCUS_10420 33751 32861 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084218.1 protein_id gnl|my_center|LOCUS_10420 34542 33766 gene locus_tag LOCUS_10430 34542 33766 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_10430 36209 34542 gene locus_tag LOCUS_10440 36209 34542 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_10440 36401 37309 gene locus_tag LOCUS_10450 36401 37309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 protein_id gnl|my_center|LOCUS_10450 37682 38074 gene locus_tag LOCUS_10460 37682 38074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 38995 38333 gene locus_tag LOCUS_10470 38995 38333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 39807 38992 gene locus_tag LOCUS_10480 gene kdsB 39807 38992 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 protein_id gnl|my_center|LOCUS_10480 40137 40481 gene locus_tag LOCUS_10490 40137 40481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 43280 40527 gene locus_tag LOCUS_10500 43280 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 43495 44217 gene locus_tag LOCUS_10510 43495 44217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 44333 45034 gene locus_tag LOCUS_10520 44333 45034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_10520 45044 46465 gene locus_tag LOCUS_10530 45044 46465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 46901 46473 gene locus_tag LOCUS_10540 46901 46473 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708295.1 protein_id gnl|my_center|LOCUS_10540 47697 46894 gene locus_tag LOCUS_10550 gene znuB 47697 46894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969555.1 protein_id gnl|my_center|LOCUS_10550 48625 47687 gene locus_tag LOCUS_10560 gene znuC 48625 47687 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P76 protein_id gnl|my_center|LOCUS_10560 48732 49697 gene locus_tag LOCUS_10570 gene znuA 48732 49697 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969557.1 protein_id gnl|my_center|LOCUS_10570 49866 51242 gene locus_tag LOCUS_10580 49866 51242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 52044 51250 gene locus_tag LOCUS_10590 52044 51250 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085496.1 protein_id gnl|my_center|LOCUS_10590 52784 52101 gene locus_tag LOCUS_10600 52784 52101 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312614.1 protein_id gnl|my_center|LOCUS_10600 52943 53854 gene locus_tag LOCUS_10610 52943 53854 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970359.1 protein_id gnl|my_center|LOCUS_10610 53948 54388 gene locus_tag LOCUS_10620 53948 54388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 55256 54396 gene locus_tag LOCUS_10630 55256 54396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107935.1 protein_id gnl|my_center|LOCUS_10630 58527 55393 gene locus_tag LOCUS_10640 58527 55393 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337325.1 protein_id gnl|my_center|LOCUS_10640 59670 58528 gene locus_tag LOCUS_10650 59670 58528 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337326.1 protein_id gnl|my_center|LOCUS_10650 59877 60164 gene locus_tag LOCUS_10660 59877 60164 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707193.1 protein_id gnl|my_center|LOCUS_10660 60610 60161 gene locus_tag LOCUS_10670 60610 60161 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_10670 60967 61329 gene locus_tag LOCUS_10680 60967 61329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 61431 62594 gene locus_tag LOCUS_10690 61431 62594 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083611.1 protein_id gnl|my_center|LOCUS_10690 62597 62998 gene locus_tag LOCUS_10700 62597 62998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 63355 63008 gene locus_tag LOCUS_10710 63355 63008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 64530 63721 gene locus_tag LOCUS_10720 64530 63721 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926648.1 protein_id gnl|my_center|LOCUS_10720 66064 64535 gene locus_tag LOCUS_10730 66064 64535 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_10730 66630 66106 gene locus_tag LOCUS_10740 66630 66106 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_10740 66751 66933 gene locus_tag LOCUS_10750 66751 66933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 67909 66947 gene locus_tag LOCUS_10760 67909 66947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 69052 67940 gene locus_tag LOCUS_10770 69052 67940 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_10770 69741 69049 gene locus_tag LOCUS_10780 69741 69049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085107.1 protein_id gnl|my_center|LOCUS_10780 70194 69742 gene locus_tag LOCUS_10790 70194 69742 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_10790 70372 71436 gene locus_tag LOCUS_10800 70372 71436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_10800 71449 72759 gene locus_tag LOCUS_10810 71449 72759 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_10810 72750 74009 gene locus_tag LOCUS_10820 72750 74009 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_10820 74510 74046 gene locus_tag LOCUS_10830 74510 74046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 74839 75132 gene locus_tag LOCUS_10840 74839 75132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 76647 75172 gene locus_tag LOCUS_10850 76647 75172 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_10850 78406 76652 gene locus_tag LOCUS_10860 78406 76652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence08 <1 643 gene locus_tag LOCUS_10870 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3C893:acetyltransferase component of pyruvate dehydrogenase complex 662 2068 gene locus_tag LOCUS_10880 662 2068 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KX2 protein_id gnl|my_center|LOCUS_10880 2072 3010 gene locus_tag LOCUS_10890 gene lipA 2072 3010 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT68 protein_id gnl|my_center|LOCUS_10890 3016 3489 gene locus_tag LOCUS_10900 3016 3489 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_10900 4068 3505 gene locus_tag LOCUS_10910 4068 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4765 4277 gene locus_tag LOCUS_10920 4765 4277 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 protein_id gnl|my_center|LOCUS_10920 5219 4770 gene locus_tag LOCUS_10930 5219 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5582 6907 gene locus_tag LOCUS_10940 5582 6907 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_10940 6888 7340 gene locus_tag LOCUS_10950 6888 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389620.1 protein_id gnl|my_center|LOCUS_10950 8381 7377 gene locus_tag LOCUS_10960 8381 7377 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_10960 9234 8359 gene locus_tag LOCUS_10970 9234 8359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_10970 9945 9256 gene locus_tag LOCUS_10980 9945 9256 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_10980 12080 10104 gene locus_tag LOCUS_10990 12080 10104 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_10990 12346 13221 gene locus_tag LOCUS_11000 gene dapA 12346 13221 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT80 protein_id gnl|my_center|LOCUS_11000 13269 13748 gene locus_tag LOCUS_11010 gene smpB 13269 13748 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7A0 protein_id gnl|my_center|LOCUS_11010 13753 14493 gene locus_tag LOCUS_11020 13753 14493 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_11020 16020 14635 gene locus_tag LOCUS_11030 16020 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 16825 16127 gene locus_tag LOCUS_11040 16825 16127 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811309.1 protein_id gnl|my_center|LOCUS_11040 17054 17284 gene locus_tag LOCUS_11050 17054 17284 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_11050 17535 17335 gene locus_tag LOCUS_11060 17535 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 18287 17643 gene locus_tag LOCUS_11070 18287 17643 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_11070 18920 18294 gene locus_tag LOCUS_11080 18920 18294 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_11080 19042 19584 gene locus_tag LOCUS_11090 19042 19584 CDS product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_11090 19688 20107 gene locus_tag LOCUS_11100 gene rpoZ 19688 20107 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT88 protein_id gnl|my_center|LOCUS_11100 20211 22370 gene locus_tag LOCUS_11110 20211 22370 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_11110 22392 23147 gene locus_tag LOCUS_11120 gene pdxJ 22392 23147 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_11120 23185 23595 gene locus_tag LOCUS_11130 gene acpS 23185 23595 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ6 protein_id gnl|my_center|LOCUS_11130 23687 24418 gene locus_tag LOCUS_11140 23687 24418 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_11140 24415 25107 gene locus_tag LOCUS_11150 gene rnc 24415 25107 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_11150 25104 26009 gene locus_tag LOCUS_11160 gene era 25104 26009 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT94 protein_id gnl|my_center|LOCUS_11160 26070 26789 gene locus_tag LOCUS_11170 gene recO 26070 26789 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT96 protein_id gnl|my_center|LOCUS_11170 26920 29163 gene locus_tag LOCUS_11180 gene parC 26920 29163 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_11180 29375 29160 gene locus_tag LOCUS_11190 29375 29160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 29295 31973 gene locus_tag LOCUS_11200 29295 31973 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_11200 32715 31990 gene locus_tag LOCUS_11210 gene ate 32715 31990 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA0 protein_id gnl|my_center|LOCUS_11210 33892 32768 gene locus_tag LOCUS_11220 33892 32768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_11220 34844 33984 gene locus_tag LOCUS_11230 34844 33984 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_11230 35118 35603 gene locus_tag LOCUS_11240 35118 35603 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_11240 35614 36369 gene locus_tag LOCUS_11250 35614 36369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 37590 36373 gene locus_tag LOCUS_11260 37590 36373 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_11260 39986 37656 gene locus_tag LOCUS_11270 39986 37656 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 protein_id gnl|my_center|LOCUS_11270 40161 41378 gene locus_tag LOCUS_11280 40161 41378 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_11280 41413 42255 gene locus_tag LOCUS_11290 41413 42255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_11290 42388 42912 gene locus_tag LOCUS_11300 42388 42912 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_11300 43921 42935 gene locus_tag LOCUS_11310 43921 42935 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA8 protein_id gnl|my_center|LOCUS_11310 44115 47393 gene locus_tag LOCUS_11320 gene mcm 44115 47393 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_11320 47442 47687 gene locus_tag LOCUS_11330 47442 47687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 48605 47700 gene locus_tag LOCUS_11340 48605 47700 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 protein_id gnl|my_center|LOCUS_11340 48763 49389 gene locus_tag LOCUS_11350 48763 49389 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_11350 49638 50090 gene locus_tag LOCUS_11360 49638 50090 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_11360 50174 51487 gene locus_tag LOCUS_11370 gene glyA2 50174 51487 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB8 protein_id gnl|my_center|LOCUS_11370 51589 52011 gene locus_tag LOCUS_11380 gene nrdR 51589 52011 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_11380 52040 53155 gene locus_tag LOCUS_11390 52040 53155 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_11390 53165 53764 gene locus_tag LOCUS_11400 53165 53764 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_11400 53761 54897 gene locus_tag LOCUS_11410 53761 54897 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_11410 54894 55343 gene locus_tag LOCUS_11420 gene ribH 54894 55343 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC3 protein_id gnl|my_center|LOCUS_11420 55348 55836 gene locus_tag LOCUS_11430 gene nusB 55348 55836 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K81 protein_id gnl|my_center|LOCUS_11430 55891 56889 gene locus_tag LOCUS_11440 gene thiL 55891 56889 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 protein_id gnl|my_center|LOCUS_11440 57011 57469 gene locus_tag LOCUS_11450 57011 57469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 57683 59773 gene locus_tag LOCUS_11460 gene hppA 57683 59773 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68460 protein_id gnl|my_center|LOCUS_11460 60285 59893 gene locus_tag LOCUS_11470 60285 59893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 60583 61074 gene locus_tag LOCUS_11480 60583 61074 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_11480 61071 61616 gene locus_tag LOCUS_11490 61071 61616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_11490 61722 61907 gene locus_tag LOCUS_11500 gene rpmF 61722 61907 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_11500 61958 63070 gene locus_tag LOCUS_11510 gene plsX 61958 63070 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 protein_id gnl|my_center|LOCUS_11510 63073 64071 gene locus_tag LOCUS_11520 gene fabH 63073 64071 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K89 protein_id gnl|my_center|LOCUS_11520 64178 64483 gene locus_tag LOCUS_11530 gene ihfA 64178 64483 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 protein_id gnl|my_center|LOCUS_11530 64497 64904 gene locus_tag LOCUS_11540 64497 64904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 65095 65171 gene locus_tag LOCUS_t00150 65095 65171 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65912 65532 gene locus_tag LOCUS_11550 65912 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 66517 66206 gene locus_tag LOCUS_11560 66517 66206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 66626 66943 gene locus_tag LOCUS_11570 66626 66943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 67906 66974 gene locus_tag LOCUS_11580 67906 66974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 69192 68020 gene locus_tag LOCUS_11590 gene ispDF 69192 68020 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS1 protein_id gnl|my_center|LOCUS_11590 69376 70191 gene locus_tag LOCUS_11600 69376 70191 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389365.1 protein_id gnl|my_center|LOCUS_11600 70247 71260 gene locus_tag LOCUS_11610 gene dus 70247 71260 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_11610 71260 72390 gene locus_tag LOCUS_11620 gene ntrB 71260 72390 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_11620 72387 73820 gene locus_tag LOCUS_11630 72387 73820 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_11630 73817 76111 gene locus_tag LOCUS_11640 73817 76111 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_11640 76119 77501 gene locus_tag LOCUS_11650 76119 77501 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_11650 77545 78921 gene locus_tag LOCUS_11660 gene trkA 77545 78921 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_11660 78926 79600 gene locus_tag LOCUS_11670 78926 79600 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_11670 79743 79997 gene locus_tag LOCUS_11680 gene hfq 79743 79997 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR1 protein_id gnl|my_center|LOCUS_11680 80075 81346 gene locus_tag LOCUS_11690 gene hflX 80075 81346 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBM1 protein_id gnl|my_center|LOCUS_11690 81461 81730 gene locus_tag LOCUS_11700 81461 81730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389376.1 protein_id gnl|my_center|LOCUS_11700 81767 82588 gene locus_tag LOCUS_11710 81767 82588 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 protein_id gnl|my_center|LOCUS_11710 82705 83574 gene locus_tag LOCUS_11720 82705 83574 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_11720 83571 83936 gene locus_tag LOCUS_11730 83571 83936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_11730 84564 83947 gene locus_tag LOCUS_11740 84564 83947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 85470 84643 gene locus_tag LOCUS_11750 85470 84643 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_11750 86755 85490 gene locus_tag LOCUS_11760 86755 85490 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_11760 86886 87272 gene locus_tag LOCUS_11770 86886 87272 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 protein_id gnl|my_center|LOCUS_11770 88205 87423 gene locus_tag LOCUS_11780 88205 87423 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_11780 89052 88216 gene locus_tag LOCUS_11790 89052 88216 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_11790 90613 89057 gene locus_tag LOCUS_11800 gene metG 90613 89057 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_11800 91811 90660 gene locus_tag LOCUS_11810 91811 90660 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_11810 92458 91808 gene locus_tag LOCUS_11820 gene tmk 92458 91808 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP2 protein_id gnl|my_center|LOCUS_11820 93720 92530 gene locus_tag LOCUS_11830 93720 92530 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_11830 94793 93825 gene locus_tag LOCUS_11840 94793 93825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_11840 96162 94927 gene locus_tag LOCUS_11850 96162 94927 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389396.1 protein_id gnl|my_center|LOCUS_11850 97054 96263 gene locus_tag LOCUS_11860 97054 96263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087743.1 protein_id gnl|my_center|LOCUS_11860 97510 97193 gene locus_tag LOCUS_11870 97510 97193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 97805 97978 gene locus_tag LOCUS_11880 97805 97978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 98068 98157 gene locus_tag LOCUS_t00160 98068 98157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 98481 98837 gene locus_tag LOCUS_11890 98481 98837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 98987 99367 gene locus_tag LOCUS_11900 98987 99367 CDS product cytochrome C protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434074.1 protein_id gnl|my_center|LOCUS_11900 99440 100447 gene locus_tag LOCUS_11910 99440 100447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268266.1 protein_id gnl|my_center|LOCUS_11910 101166 100444 gene locus_tag LOCUS_11920 101166 100444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336840.1 protein_id gnl|my_center|LOCUS_11920 102760 101186 gene locus_tag LOCUS_11930 gene nirN 102760 101186 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_11930 103952 102747 gene locus_tag LOCUS_11940 gene nirJ 103952 102747 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 protein_id gnl|my_center|LOCUS_11940 104455 103961 gene locus_tag LOCUS_11950 gene nirH 104455 103961 CDS product protein NirH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95415 protein_id gnl|my_center|LOCUS_11950 >Feature sequence09 3009 343 gene locus_tag LOCUS_11960 gene alaS 3009 343 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI0 protein_id gnl|my_center|LOCUS_11960 4493 3387 gene locus_tag LOCUS_11970 gene recA 4493 3387 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_11970 4884 5102 gene locus_tag LOCUS_11980 4884 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5259 5918 gene locus_tag LOCUS_11990 5259 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8582 6003 gene locus_tag LOCUS_12000 8582 6003 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_12000 9808 8738 gene locus_tag LOCUS_12010 gene flhB 9808 8738 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_12010 10591 9833 gene locus_tag LOCUS_12020 gene fliR 10591 9833 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 protein_id gnl|my_center|LOCUS_12020 10873 10610 gene locus_tag LOCUS_12030 gene fliQ 10873 10610 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706883.1 protein_id gnl|my_center|LOCUS_12030 11237 10905 gene locus_tag LOCUS_12040 11237 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 11720 11304 gene locus_tag LOCUS_12050 11720 11304 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH3 protein_id gnl|my_center|LOCUS_12050 12275 11880 gene locus_tag LOCUS_12060 12275 11880 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH2 protein_id gnl|my_center|LOCUS_12060 12570 12959 gene locus_tag LOCUS_12070 12570 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390454.1 protein_id gnl|my_center|LOCUS_12070 12956 13267 gene locus_tag LOCUS_12080 12956 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 13272 13625 gene locus_tag LOCUS_12090 13272 13625 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG9 protein_id gnl|my_center|LOCUS_12090 13622 14446 gene locus_tag LOCUS_12100 gene fliP 13622 14446 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG8 protein_id gnl|my_center|LOCUS_12100 14793 14443 gene locus_tag LOCUS_12110 14793 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 14777 15379 gene locus_tag LOCUS_12120 14777 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 16172 15429 gene locus_tag LOCUS_12130 gene attO 16172 15429 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974404.1 protein_id gnl|my_center|LOCUS_12130 16309 16845 gene locus_tag LOCUS_12140 16309 16845 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_12140 20230 16943 gene locus_tag LOCUS_12150 20230 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 20949 20227 gene locus_tag LOCUS_12160 gene ytxE 20949 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39064 protein_id gnl|my_center|LOCUS_12160 21660 20959 gene locus_tag LOCUS_12170 21660 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 22382 21717 gene locus_tag LOCUS_12180 22382 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 22779 22393 gene locus_tag LOCUS_12190 22779 22393 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_12190 23667 22906 gene locus_tag LOCUS_12200 23667 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_12200 24277 23741 gene locus_tag LOCUS_12210 24277 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 25531 24413 gene locus_tag LOCUS_12220 25531 24413 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF8 protein_id gnl|my_center|LOCUS_12220 26149 25589 gene locus_tag LOCUS_12230 26149 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 26244 27317 gene locus_tag LOCUS_12240 26244 27317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 27489 28274 gene locus_tag LOCUS_12250 27489 28274 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF5 protein_id gnl|my_center|LOCUS_12250 28363 29385 gene locus_tag LOCUS_12260 28363 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 29434 30207 gene locus_tag LOCUS_12270 gene flgH 29434 30207 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF3 protein_id gnl|my_center|LOCUS_12270 30608 31135 gene locus_tag LOCUS_12280 30608 31135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 32377 33066 gene locus_tag LOCUS_12290 32377 33066 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_12290 33761 33345 gene locus_tag LOCUS_12300 gene dksA 33761 33345 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF1 protein_id gnl|my_center|LOCUS_12300 34352 33924 gene locus_tag LOCUS_12310 gene fliX 34352 33924 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 protein_id gnl|my_center|LOCUS_12310 34752 35816 gene locus_tag LOCUS_12320 34752 35816 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_12320 35915 37621 gene locus_tag LOCUS_12330 35915 37621 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_12330 37618 38718 gene locus_tag LOCUS_12340 37618 38718 CDS product spermidine/putrescine ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 protein_id gnl|my_center|LOCUS_12340 38936 40585 gene locus_tag LOCUS_12350 38936 40585 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL4 protein_id gnl|my_center|LOCUS_12350 40879 42039 gene locus_tag LOCUS_12360 gene flgI 40879 42039 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE9 protein_id gnl|my_center|LOCUS_12360 42039 42368 gene locus_tag LOCUS_12370 42039 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 42397 42840 gene locus_tag LOCUS_12380 42397 42840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 42877 45195 gene locus_tag LOCUS_12390 42877 45195 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390479.1 protein_id gnl|my_center|LOCUS_12390 45206 47626 gene locus_tag LOCUS_12400 45206 47626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 47790 48269 gene locus_tag LOCUS_12410 47790 48269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 48398 50365 gene locus_tag LOCUS_12420 48398 50365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12420 51227 50406 gene locus_tag LOCUS_12430 51227 50406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 51501 53663 gene locus_tag LOCUS_12440 51501 53663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 55043 53670 gene locus_tag LOCUS_12450 55043 53670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 56495 55197 gene locus_tag LOCUS_12460 56495 55197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 58033 56735 gene locus_tag LOCUS_12470 58033 56735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 58346 58786 gene locus_tag LOCUS_12480 gene flbT 58346 58786 CDS product putative flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5S2 protein_id gnl|my_center|LOCUS_12480 58944 59672 gene locus_tag LOCUS_12490 58944 59672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 60530 59733 gene locus_tag LOCUS_12500 60530 59733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 61657 60560 gene locus_tag LOCUS_12510 61657 60560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 62528 61725 gene locus_tag LOCUS_12520 62528 61725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 62916 62656 gene locus_tag LOCUS_12530 62916 62656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 64193 62955 gene locus_tag LOCUS_12540 64193 62955 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_12540 65777 64215 gene locus_tag LOCUS_12550 65777 64215 CDS product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_12550 66829 65774 gene locus_tag LOCUS_12560 66829 65774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_12560 68588 67185 gene locus_tag LOCUS_12570 68588 67185 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_12570 68780 69781 gene locus_tag LOCUS_12580 68780 69781 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_12580 69786 70499 gene locus_tag LOCUS_12590 69786 70499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 70496 71413 gene locus_tag LOCUS_12600 70496 71413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 71427 73277 gene locus_tag LOCUS_12610 gene wbmC 71427 73277 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_12610 73312 74046 gene locus_tag LOCUS_12620 73312 74046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 74043 75050 gene locus_tag LOCUS_12630 74043 75050 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120800.1 protein_id gnl|my_center|LOCUS_12630 75047 76195 gene locus_tag LOCUS_12640 75047 76195 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_12640 77307 76192 gene locus_tag LOCUS_12650 77307 76192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 77608 78696 gene locus_tag LOCUS_12660 77608 78696 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_12660 78751 79368 gene locus_tag LOCUS_12670 gene hisH2 78751 79368 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_12670 79368 80120 gene locus_tag LOCUS_12680 gene hisF 79368 80120 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60715 protein_id gnl|my_center|LOCUS_12680 80191 81300 gene locus_tag LOCUS_12690 gene pseA 80191 81300 CDS product flagellin modification protein, PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_12690 81336 82235 gene locus_tag LOCUS_12700 81336 82235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 82232 82990 gene locus_tag LOCUS_12710 82232 82990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 82987 83706 gene locus_tag LOCUS_12720 82987 83706 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767820.1 protein_id gnl|my_center|LOCUS_12720 83703 84995 gene locus_tag LOCUS_12730 83703 84995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 85000 85767 gene locus_tag LOCUS_12740 85000 85767 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987012.1 protein_id gnl|my_center|LOCUS_12740 85764 86786 gene locus_tag LOCUS_12750 85764 86786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 86791 88473 gene locus_tag LOCUS_12760 86791 88473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 88671 90494 gene locus_tag LOCUS_12770 88671 90494 CDS product flagellar hook-length control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 protein_id gnl|my_center|LOCUS_12770 90540 91277 gene locus_tag LOCUS_12780 90540 91277 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 protein_id gnl|my_center|LOCUS_12780 91383 93809 gene locus_tag LOCUS_12790 91383 93809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 94042 94398 gene locus_tag LOCUS_12800 94042 94398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 94635 96209 gene locus_tag LOCUS_12810 94635 96209 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ6 protein_id gnl|my_center|LOCUS_12810 >Feature sequence10 327 3638 gene locus_tag LOCUS_12820 327 3638 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383340.1 protein_id gnl|my_center|LOCUS_12820 3732 6344 gene locus_tag LOCUS_12830 3732 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_12830 6355 7242 gene locus_tag LOCUS_12840 6355 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_12840 7310 7726 gene locus_tag LOCUS_12850 7310 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9206 7740 gene locus_tag LOCUS_12860 9206 7740 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461336.1 protein_id gnl|my_center|LOCUS_12860 11655 9325 gene locus_tag LOCUS_12870 11655 9325 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_12870 12038 13081 gene locus_tag LOCUS_12880 12038 13081 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 protein_id gnl|my_center|LOCUS_12880 13084 13932 gene locus_tag LOCUS_12890 13084 13932 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723689.1 protein_id gnl|my_center|LOCUS_12890 13935 14834 gene locus_tag LOCUS_12900 13935 14834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083211.1 protein_id gnl|my_center|LOCUS_12900 14831 15718 gene locus_tag LOCUS_12910 14831 15718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083211.1 protein_id gnl|my_center|LOCUS_12910 15735 16595 gene locus_tag LOCUS_12920 15735 16595 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105361.1 protein_id gnl|my_center|LOCUS_12920 16707 17390 gene locus_tag LOCUS_12930 16707 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 19697 17397 gene locus_tag LOCUS_12940 19697 17397 CDS product dimethylsulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103704.1 protein_id gnl|my_center|LOCUS_12940 20592 19783 gene locus_tag LOCUS_12950 20592 19783 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_12950 22068 20608 gene locus_tag LOCUS_12960 22068 20608 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_12960 22264 23049 gene locus_tag LOCUS_12970 22264 23049 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931598.1 protein_id gnl|my_center|LOCUS_12970 23974 23051 gene locus_tag LOCUS_12980 23974 23051 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808741.1 protein_id gnl|my_center|LOCUS_12980 24125 24994 gene locus_tag LOCUS_12990 24125 24994 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105361.1 protein_id gnl|my_center|LOCUS_12990 25020 25853 gene locus_tag LOCUS_13000 25020 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 25866 28805 gene locus_tag LOCUS_13010 25866 28805 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031207.1 protein_id gnl|my_center|LOCUS_13010 28926 28851 gene locus_tag LOCUS_t00170 28926 28851 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29301 29092 gene locus_tag LOCUS_13020 29301 29092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 30709 29306 gene locus_tag LOCUS_13030 gene cafA 30709 29306 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_13030 31256 30714 gene locus_tag LOCUS_13040 31256 30714 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL87 protein_id gnl|my_center|LOCUS_13040 31541 31323 gene locus_tag LOCUS_13050 gene infA 31541 31323 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Z0 protein_id gnl|my_center|LOCUS_13050 32504 31641 gene locus_tag LOCUS_13060 32504 31641 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970252.1 protein_id gnl|my_center|LOCUS_13060 32661 32933 gene locus_tag LOCUS_13070 32661 32933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 32941 33147 gene locus_tag LOCUS_13080 32941 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 33278 33439 gene locus_tag LOCUS_13090 33278 33439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 33476 35410 gene locus_tag LOCUS_13100 33476 35410 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_13100 35998 35429 gene locus_tag LOCUS_13110 35998 35429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 36198 36803 gene locus_tag LOCUS_13120 36198 36803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 37276 36830 gene locus_tag LOCUS_13130 37276 36830 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_13130 37769 37290 gene locus_tag LOCUS_13140 37769 37290 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM8 protein_id gnl|my_center|LOCUS_13140 39090 37786 gene locus_tag LOCUS_13150 gene hisD 39090 37786 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_13150 39754 39074 gene locus_tag LOCUS_13160 gene hisG 39754 39074 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_13160 40651 39851 gene locus_tag LOCUS_13170 40651 39851 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888042.1 protein_id gnl|my_center|LOCUS_13170 40847 41926 gene locus_tag LOCUS_13180 40847 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 42778 41942 gene locus_tag LOCUS_13190 42778 41942 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_13190 44070 42820 gene locus_tag LOCUS_13200 gene murA 44070 42820 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ67 protein_id gnl|my_center|LOCUS_13200 44346 44182 gene locus_tag LOCUS_13210 44346 44182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 45892 44396 gene locus_tag LOCUS_13220 gene argH 45892 44396 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVC5 protein_id gnl|my_center|LOCUS_13220 46139 46213 gene locus_tag LOCUS_t00180 46139 46213 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 46685 46242 gene locus_tag LOCUS_13230 46685 46242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 47055 47402 gene locus_tag LOCUS_13240 47055 47402 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_13240 48556 47474 gene locus_tag LOCUS_13250 48556 47474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 49865 48540 gene locus_tag LOCUS_13260 gene soxC 49865 48540 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_13260 50583 49996 gene locus_tag LOCUS_13270 gene soxW 50583 49996 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086294.1 protein_id gnl|my_center|LOCUS_13270 50743 51474 gene locus_tag LOCUS_13280 50743 51474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 52218 51481 gene locus_tag LOCUS_13290 52218 51481 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707992.1 protein_id gnl|my_center|LOCUS_13290 53948 52260 gene locus_tag LOCUS_13300 gene soxB 53948 52260 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_13300 54870 54058 gene locus_tag LOCUS_13310 gene soxA 54870 54058 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PG6 protein_id gnl|my_center|LOCUS_13310 55245 54919 gene locus_tag LOCUS_13320 gene soxZ 55245 54919 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_13320 55738 55268 gene locus_tag LOCUS_13330 gene soxY 55738 55268 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_13330 56307 55834 gene locus_tag LOCUS_13340 gene soxX 56307 55834 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086295.1 protein_id gnl|my_center|LOCUS_13340 57837 56557 gene locus_tag LOCUS_13350 gene fccB-2 57837 56557 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_13350 58153 57848 gene locus_tag LOCUS_13360 gene fccA 58153 57848 CDS product cytochrome subunit of sulfide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAS5 protein_id gnl|my_center|LOCUS_13360 58656 58282 gene locus_tag LOCUS_13370 58656 58282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_13370 58795 60063 gene locus_tag LOCUS_13380 58795 60063 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085520.1 protein_id gnl|my_center|LOCUS_13380 60213 60656 gene locus_tag LOCUS_13390 60213 60656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089488.1 protein_id gnl|my_center|LOCUS_13390 62286 60754 gene locus_tag LOCUS_13400 62286 60754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_13400 62544 63629 gene locus_tag LOCUS_13410 62544 63629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085683.1 protein_id gnl|my_center|LOCUS_13410 64904 63639 gene locus_tag LOCUS_13420 64904 63639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_13420 65012 65431 gene locus_tag LOCUS_13430 65012 65431 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_13430 65704 65459 gene locus_tag LOCUS_13440 65704 65459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 66671 65766 gene locus_tag LOCUS_13450 66671 65766 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_13450 67090 66668 gene locus_tag LOCUS_13460 67090 66668 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530449.1 protein_id gnl|my_center|LOCUS_13460 67202 68017 gene locus_tag LOCUS_13470 67202 68017 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_13470 68019 69164 gene locus_tag LOCUS_13480 68019 69164 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_13480 69171 69599 gene locus_tag LOCUS_13490 69171 69599 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_13490 70710 69616 gene locus_tag LOCUS_13500 70710 69616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 70903 71151 gene locus_tag LOCUS_13510 70903 71151 CDS product UPF0335 protein R02793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M59 protein_id gnl|my_center|LOCUS_13510 72422 71163 gene locus_tag LOCUS_13520 72422 71163 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919203.1 protein_id gnl|my_center|LOCUS_13520 73128 72523 gene locus_tag LOCUS_13530 73128 72523 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390661.1 protein_id gnl|my_center|LOCUS_13530 74123 73125 gene locus_tag LOCUS_13540 74123 73125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390660.1 protein_id gnl|my_center|LOCUS_13540 74988 74149 gene locus_tag LOCUS_13550 74988 74149 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_13550 75817 75002 gene locus_tag LOCUS_13560 75817 75002 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390658.1 protein_id gnl|my_center|LOCUS_13560 76174 75854 gene locus_tag LOCUS_13570 76174 75854 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ91 protein_id gnl|my_center|LOCUS_13570 77940 76186 gene locus_tag LOCUS_13580 77940 76186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 78237 79988 gene locus_tag LOCUS_13590 78237 79988 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968945.1 protein_id gnl|my_center|LOCUS_13590 81859 80009 gene locus_tag LOCUS_13600 81859 80009 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_13600 82031 83428 gene locus_tag LOCUS_13610 82031 83428 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_13610 83440 83649 gene locus_tag LOCUS_13620 83440 83649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 84073 83663 gene locus_tag LOCUS_13630 84073 83663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 84705 84298 gene locus_tag LOCUS_13640 84705 84298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968910.1 protein_id gnl|my_center|LOCUS_13640 85668 84856 gene locus_tag LOCUS_13650 gene coxIII 85668 84856 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 protein_id gnl|my_center|LOCUS_13650 86347 85736 gene locus_tag LOCUS_13660 gene ctaG 86347 85736 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_13660 <87183 86385 gene locus_tag LOCUS_13670 <87183 86385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A300:cytochrome c oxidase subunit 1 >Feature sequence11 384 620 gene locus_tag LOCUS_13680 384 620 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532600.1 protein_id gnl|my_center|LOCUS_13680 696 1457 gene locus_tag LOCUS_13690 696 1457 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064562.1 protein_id gnl|my_center|LOCUS_13690 1631 2497 gene locus_tag LOCUS_13700 gene tauD 1631 2497 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_13700 2588 3058 gene locus_tag LOCUS_13710 2588 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3549 3055 gene locus_tag LOCUS_13720 3549 3055 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_13720 3911 3546 gene locus_tag LOCUS_13730 3911 3546 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_13730 4067 5155 gene locus_tag LOCUS_13740 4067 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 5264 6625 gene locus_tag LOCUS_13750 5264 6625 CDS product 3-methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817377.1 protein_id gnl|my_center|LOCUS_13750 6699 7583 gene locus_tag LOCUS_13760 6699 7583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_13760 7708 8019 gene locus_tag LOCUS_13770 7708 8019 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808129.1 protein_id gnl|my_center|LOCUS_13770 8240 9340 gene locus_tag LOCUS_13780 8240 9340 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_13780 9446 10486 gene locus_tag LOCUS_13790 9446 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 10507 13170 gene locus_tag LOCUS_13800 10507 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 13223 14044 gene locus_tag LOCUS_13810 13223 14044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809826.1 protein_id gnl|my_center|LOCUS_13810 14173 14421 gene locus_tag LOCUS_13820 14173 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 15372 14434 gene locus_tag LOCUS_13830 15372 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 protein_id gnl|my_center|LOCUS_13830 17101 15389 gene locus_tag LOCUS_13840 gene aor 17101 15389 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938476.1 protein_id gnl|my_center|LOCUS_13840 19235 17253 gene locus_tag LOCUS_13850 19235 17253 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_13850 21773 19272 gene locus_tag LOCUS_13860 21773 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 22605 21862 gene locus_tag LOCUS_13870 22605 21862 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_13870 23247 22696 gene locus_tag LOCUS_13880 23247 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 23721 23401 gene locus_tag LOCUS_13890 23721 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 24717 23827 gene locus_tag LOCUS_13900 gene tfdA 24717 23827 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_13900 24980 25756 gene locus_tag LOCUS_13910 24980 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 26494 25766 gene locus_tag LOCUS_13920 26494 25766 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 protein_id gnl|my_center|LOCUS_13920 27403 26648 gene locus_tag LOCUS_13930 27403 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 28659 27400 gene locus_tag LOCUS_13940 28659 27400 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_13940 28838 30514 gene locus_tag LOCUS_13950 28838 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 30532 31680 gene locus_tag LOCUS_13960 30532 31680 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390176.1 protein_id gnl|my_center|LOCUS_13960 34235 31740 gene locus_tag LOCUS_13970 34235 31740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 34888 36216 gene locus_tag LOCUS_13980 34888 36216 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_13980 36335 38794 gene locus_tag LOCUS_13990 36335 38794 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_13990 39034 39993 gene locus_tag LOCUS_14000 39034 39993 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ5 protein_id gnl|my_center|LOCUS_14000 40033 40362 gene locus_tag LOCUS_14010 40033 40362 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8Q1 protein_id gnl|my_center|LOCUS_14010 41004 40402 gene locus_tag LOCUS_14020 41004 40402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 41607 41143 gene locus_tag LOCUS_14030 41607 41143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 44641 41633 gene locus_tag LOCUS_14040 gene glnE 44641 41633 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 protein_id gnl|my_center|LOCUS_14040 44723 48052 gene locus_tag LOCUS_14050 44723 48052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_14050 48049 49593 gene locus_tag LOCUS_14060 48049 49593 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969004.1 protein_id gnl|my_center|LOCUS_14060 51142 49601 gene locus_tag LOCUS_14070 51142 49601 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389677.1 protein_id gnl|my_center|LOCUS_14070 52401 51151 gene locus_tag LOCUS_14080 gene tyrS 52401 51151 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 protein_id gnl|my_center|LOCUS_14080 52525 53628 gene locus_tag LOCUS_14090 gene anmK 52525 53628 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 protein_id gnl|my_center|LOCUS_14090 54338 53688 gene locus_tag LOCUS_14100 54338 53688 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_14100 54553 55296 gene locus_tag LOCUS_14110 gene cysE 54553 55296 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_14110 55362 55844 gene locus_tag LOCUS_14120 55362 55844 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_14120 55869 57008 gene locus_tag LOCUS_14130 55869 57008 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_14130 57051 58316 gene locus_tag LOCUS_14140 gene iscS 57051 58316 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 protein_id gnl|my_center|LOCUS_14140 58380 58763 gene locus_tag LOCUS_14150 gene iscU 58380 58763 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57074 protein_id gnl|my_center|LOCUS_14150 58849 59190 gene locus_tag LOCUS_14160 58849 59190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_14160 59491 59925 gene locus_tag LOCUS_14170 gene hscB 59491 59925 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX9 protein_id gnl|my_center|LOCUS_14170 59929 61872 gene locus_tag LOCUS_14180 gene hscA 59929 61872 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU5 protein_id gnl|my_center|LOCUS_14180 61896 62246 gene locus_tag LOCUS_14190 gene fdxB 61896 62246 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDW6 protein_id gnl|my_center|LOCUS_14190 62261 62461 gene locus_tag LOCUS_14200 62261 62461 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_14200 64099 62498 gene locus_tag LOCUS_14210 64099 62498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 64268 65032 gene locus_tag LOCUS_14220 64268 65032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_14220 65088 66215 gene locus_tag LOCUS_14230 gene mnmA 65088 66215 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_14230 66358 66894 gene locus_tag LOCUS_14240 66358 66894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 67654 66914 gene locus_tag LOCUS_14250 67654 66914 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FT1 protein_id gnl|my_center|LOCUS_14250 69634 67763 gene locus_tag LOCUS_14260 69634 67763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930067.1 protein_id gnl|my_center|LOCUS_14260 69927 70424 gene locus_tag LOCUS_14270 69927 70424 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_14270 70434 70916 gene locus_tag LOCUS_14280 70434 70916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 71232 70939 gene locus_tag LOCUS_14290 71232 70939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 72098 71511 gene locus_tag LOCUS_14300 72098 71511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 73146 72118 gene locus_tag LOCUS_14310 73146 72118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 74281 73157 gene locus_tag LOCUS_14320 74281 73157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 74511 75482 gene locus_tag LOCUS_14330 74511 75482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 75469 76911 gene locus_tag LOCUS_14340 75469 76911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 78502 76931 gene locus_tag LOCUS_14350 78502 76931 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_14350 80144 78555 gene locus_tag LOCUS_14360 gene guaA 80144 78555 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 protein_id gnl|my_center|LOCUS_14360 80708 80232 gene locus_tag LOCUS_14370 80708 80232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 80939 81892 gene locus_tag LOCUS_14380 80939 81892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 82332 81913 gene locus_tag LOCUS_14390 82332 81913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 82438 82959 gene locus_tag LOCUS_14400 82438 82959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 83080 83661 gene locus_tag LOCUS_14410 83080 83661 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085642.1 protein_id gnl|my_center|LOCUS_14410 84244 83672 gene locus_tag LOCUS_14420 84244 83672 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NM1 protein_id gnl|my_center|LOCUS_14420 84608 84892 gene locus_tag LOCUS_14430 84608 84892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 84895 85329 gene locus_tag LOCUS_14440 84895 85329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 <86582 85482 gene locus_tag LOCUS_14450 <86582 85482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UCC9:phosphomethylpyrimidine synthase >Feature sequence12 1786 2676 gene locus_tag LOCUS_14460 gene ispE 1786 2676 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS7 protein_id gnl|my_center|LOCUS_14460 2773 2849 gene locus_tag LOCUS_t00190 2773 2849 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4147 3227 gene locus_tag LOCUS_14470 4147 3227 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_14470 4414 5538 gene locus_tag LOCUS_14480 4414 5538 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384164.1 protein_id gnl|my_center|LOCUS_14480 6880 5507 gene locus_tag LOCUS_14490 gene pyrC 6880 5507 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 protein_id gnl|my_center|LOCUS_14490 7584 6877 gene locus_tag LOCUS_14500 7584 6877 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969269.1 protein_id gnl|my_center|LOCUS_14500 8176 7673 gene locus_tag LOCUS_14510 gene hisI 8176 7673 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW3 protein_id gnl|my_center|LOCUS_14510 8267 8773 gene locus_tag LOCUS_14520 gene np20 8267 8773 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_14520 8796 9977 gene locus_tag LOCUS_14530 8796 9977 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_14530 10003 10563 gene locus_tag LOCUS_14540 10003 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099663.1 protein_id gnl|my_center|LOCUS_14540 10742 11485 gene locus_tag LOCUS_14550 10742 11485 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267626.1 protein_id gnl|my_center|LOCUS_14550 11485 12363 gene locus_tag LOCUS_14560 11485 12363 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 protein_id gnl|my_center|LOCUS_14560 12386 13417 gene locus_tag LOCUS_14570 12386 13417 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064717.1 protein_id gnl|my_center|LOCUS_14570 13609 14298 gene locus_tag LOCUS_14580 13609 14298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703175.1 protein_id gnl|my_center|LOCUS_14580 14289 15293 gene locus_tag LOCUS_14590 14289 15293 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKP8 protein_id gnl|my_center|LOCUS_14590 17029 15833 gene locus_tag LOCUS_14600 17029 15833 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_14600 17265 17026 gene locus_tag LOCUS_14610 17265 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 18065 17367 gene locus_tag LOCUS_14620 gene nnrR 18065 17367 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089821.1 protein_id gnl|my_center|LOCUS_14620 18196 18828 gene locus_tag LOCUS_14630 18196 18828 CDS product protein NnrU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390538.1 protein_id gnl|my_center|LOCUS_14630 18943 21237 gene locus_tag LOCUS_14640 18943 21237 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_14640 21469 22485 gene locus_tag LOCUS_14650 21469 22485 CDS product nitrite reductase, copper-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_14650 23379 22630 gene locus_tag LOCUS_14660 23379 22630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 protein_id gnl|my_center|LOCUS_14660 24185 23376 gene locus_tag LOCUS_14670 24185 23376 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392936.1 protein_id gnl|my_center|LOCUS_14670 25216 24176 gene locus_tag LOCUS_14680 25216 24176 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_14680 26280 25213 gene locus_tag LOCUS_14690 26280 25213 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 protein_id gnl|my_center|LOCUS_14690 26367 26615 gene locus_tag LOCUS_14700 26367 26615 CDS product putative molybdenum-pterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45183 protein_id gnl|my_center|LOCUS_14700 27772 26624 gene locus_tag LOCUS_14710 27772 26624 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073847.1 protein_id gnl|my_center|LOCUS_14710 28404 27976 gene locus_tag LOCUS_14720 28404 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 29087 28446 gene locus_tag LOCUS_14730 29087 28446 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531257.1 protein_id gnl|my_center|LOCUS_14730 31000 29318 gene locus_tag LOCUS_14740 31000 29318 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389831.1 protein_id gnl|my_center|LOCUS_14740 31617 31018 gene locus_tag LOCUS_14750 31617 31018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 protein_id gnl|my_center|LOCUS_14750 39405 32095 gene locus_tag LOCUS_14760 39405 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 41223 39571 gene locus_tag LOCUS_14770 41223 39571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 41623 41279 gene locus_tag LOCUS_14780 41623 41279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 41987 41613 gene locus_tag LOCUS_14790 41987 41613 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_14790 42996 42358 gene locus_tag LOCUS_14800 42996 42358 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_14800 44445 43117 gene locus_tag LOCUS_14810 44445 43117 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090688.1 protein_id gnl|my_center|LOCUS_14810 44614 44769 gene locus_tag LOCUS_14820 44614 44769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 44814 45125 gene locus_tag LOCUS_14830 44814 45125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 45122 47638 gene locus_tag LOCUS_14840 gene napA 45122 47638 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P019 protein_id gnl|my_center|LOCUS_14840 47611 48099 gene locus_tag LOCUS_14850 gene napB 47611 48099 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G4 protein_id gnl|my_center|LOCUS_14850 48103 48693 gene locus_tag LOCUS_14860 gene napC 48103 48693 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_14860 48797 49645 gene locus_tag LOCUS_14870 48797 49645 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090335.1 protein_id gnl|my_center|LOCUS_14870 49759 50283 gene locus_tag LOCUS_14880 49759 50283 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXB4 protein_id gnl|my_center|LOCUS_14880 51113 50334 gene locus_tag LOCUS_14890 51113 50334 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_14890 51201 51704 gene locus_tag LOCUS_14900 51201 51704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 51957 51724 gene locus_tag LOCUS_14910 51957 51724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 53169 52096 gene locus_tag LOCUS_14920 53169 52096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 53517 53188 gene locus_tag LOCUS_14930 53517 53188 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_14930 53751 54305 gene locus_tag LOCUS_14940 53751 54305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 55209 54337 gene locus_tag LOCUS_14950 gene tauD 55209 54337 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_14950 55748 55206 gene locus_tag LOCUS_14960 55748 55206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 55800 56423 gene locus_tag LOCUS_14970 55800 56423 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_14970 56529 56966 gene locus_tag LOCUS_14980 56529 56966 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_14980 57001 57783 gene locus_tag LOCUS_14990 57001 57783 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921397.1 protein_id gnl|my_center|LOCUS_14990 59268 57784 gene locus_tag LOCUS_15000 59268 57784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_15000 60371 59268 gene locus_tag LOCUS_15010 60371 59268 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_15010 60987 60562 gene locus_tag LOCUS_15020 gene msrB 60987 60562 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_15020 62262 61051 gene locus_tag LOCUS_15030 62262 61051 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_15030 63513 62275 gene locus_tag LOCUS_15040 63513 62275 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_15040 64466 63612 gene locus_tag LOCUS_15050 64466 63612 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_15050 67971 64648 gene locus_tag LOCUS_15060 67971 64648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 68632 69741 gene locus_tag LOCUS_15070 68632 69741 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_15070 69738 70364 gene locus_tag LOCUS_15080 69738 70364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 70520 70987 gene locus_tag LOCUS_15090 70520 70987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_15090 71013 71903 gene locus_tag LOCUS_15100 71013 71903 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND10 protein_id gnl|my_center|LOCUS_15100 72357 72283 gene locus_tag LOCUS_t00200 72357 72283 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 72597 73559 gene locus_tag LOCUS_15110 72597 73559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 73564 74451 gene locus_tag LOCUS_15120 73564 74451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 74943 74470 gene locus_tag LOCUS_15130 gene greA 74943 74470 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8F7 protein_id gnl|my_center|LOCUS_15130 78315 75049 gene locus_tag LOCUS_15140 78315 75049 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_15140 78756 78370 gene locus_tag LOCUS_15150 78756 78370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_15150 79974 78790 gene locus_tag LOCUS_15160 gene carA 79974 78790 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_15160 80200 80655 gene locus_tag LOCUS_15170 80200 80655 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_15170 80838 82688 gene locus_tag LOCUS_15180 gene dnaG 80838 82688 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB5 protein_id gnl|my_center|LOCUS_15180 >Feature sequence13 1366 2922 gene locus_tag LOCUS_15190 1366 2922 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 protein_id gnl|my_center|LOCUS_15190 2956 4383 gene locus_tag LOCUS_15200 2956 4383 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389423.1 protein_id gnl|my_center|LOCUS_15200 4493 4578 gene locus_tag LOCUS_t00210 4493 4578 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4764 6287 gene locus_tag LOCUS_15210 gene tig 4764 6287 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_15210 6380 7030 gene locus_tag LOCUS_15220 gene clpP 6380 7030 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 protein_id gnl|my_center|LOCUS_15220 7218 8483 gene locus_tag LOCUS_15230 gene clpX 7218 8483 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 protein_id gnl|my_center|LOCUS_15230 8611 11031 gene locus_tag LOCUS_15240 gene lon 8611 11031 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 protein_id gnl|my_center|LOCUS_15240 11340 11612 gene locus_tag LOCUS_15250 11340 11612 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_15250 11751 11826 gene locus_tag LOCUS_t00220 11751 11826 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12024 12100 gene locus_tag LOCUS_t00230 12024 12100 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12369 12199 gene locus_tag LOCUS_15260 12369 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 12296 12661 gene locus_tag LOCUS_15270 gene nuoA 12296 12661 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 protein_id gnl|my_center|LOCUS_15270 12680 13240 gene locus_tag LOCUS_15280 gene nuoB 12680 13240 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 protein_id gnl|my_center|LOCUS_15280 13287 13913 gene locus_tag LOCUS_15290 gene nuoC1 13287 13913 CDS product NADH-quinone oxidoreductase subunit C 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68854 protein_id gnl|my_center|LOCUS_15290 13917 14825 gene locus_tag LOCUS_15300 gene nuoD 13917 14825 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU37 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15300 14829 15098 gene locus_tag LOCUS_15310 14829 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15310 15104 15724 gene locus_tag LOCUS_15320 15104 15724 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_15320 15724 17010 gene locus_tag LOCUS_15330 15724 17010 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_15330 17036 19096 gene locus_tag LOCUS_15340 17036 19096 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 protein_id gnl|my_center|LOCUS_15340 19089 20111 gene locus_tag LOCUS_15350 gene nuoH 19089 20111 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 protein_id gnl|my_center|LOCUS_15350 20127 20615 gene locus_tag LOCUS_15360 gene nuoI 20127 20615 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU32 protein_id gnl|my_center|LOCUS_15360 20730 21341 gene locus_tag LOCUS_15370 20730 21341 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 protein_id gnl|my_center|LOCUS_15370 21344 21655 gene locus_tag LOCUS_15380 gene nuoK1 21344 21655 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA67 protein_id gnl|my_center|LOCUS_15380 21666 23627 gene locus_tag LOCUS_15390 21666 23627 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_15390 23635 25137 gene locus_tag LOCUS_15400 23635 25137 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_15400 25154 26614 gene locus_tag LOCUS_15410 gene nuoN 25154 26614 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_15410 26630 27406 gene locus_tag LOCUS_15420 26630 27406 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389444.1 protein_id gnl|my_center|LOCUS_15420 27421 28194 gene locus_tag LOCUS_15430 gene coaX 27421 28194 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 protein_id gnl|my_center|LOCUS_15430 28191 29873 gene locus_tag LOCUS_15440 28191 29873 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_15440 29929 30333 gene locus_tag LOCUS_15450 29929 30333 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_15450 30338 30577 gene locus_tag LOCUS_15460 30338 30577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087667.1 protein_id gnl|my_center|LOCUS_15460 31029 32342 gene locus_tag LOCUS_15470 gene proS 31029 32342 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU19 protein_id gnl|my_center|LOCUS_15470 32448 33710 gene locus_tag LOCUS_15480 32448 33710 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_15480 33703 34395 gene locus_tag LOCUS_15490 gene lolD1 33703 34395 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_15490 34552 35025 gene locus_tag LOCUS_15500 34552 35025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 35124 35516 gene locus_tag LOCUS_15510 35124 35516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 35698 35513 gene locus_tag LOCUS_15520 35698 35513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 36141 35785 gene locus_tag LOCUS_15530 36141 35785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 36554 36168 gene locus_tag LOCUS_15540 36554 36168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_15540 36952 36626 gene locus_tag LOCUS_15550 36952 36626 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087267.1 protein_id gnl|my_center|LOCUS_15550 37611 36949 gene locus_tag LOCUS_15560 gene nthB 37611 36949 CDS product nitrile hydratase subunit beta protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969705.1 protein_id gnl|my_center|LOCUS_15560 38258 37608 gene locus_tag LOCUS_15570 gene nthA 38258 37608 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533852.1 protein_id gnl|my_center|LOCUS_15570 38464 41955 gene locus_tag LOCUS_15580 38464 41955 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_15580 42137 42994 gene locus_tag LOCUS_15590 gene rpsB 42137 42994 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU09 protein_id gnl|my_center|LOCUS_15590 43046 43972 gene locus_tag LOCUS_15600 gene tsf 43046 43972 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_15600 44119 44844 gene locus_tag LOCUS_15610 gene pyrH 44119 44844 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 protein_id gnl|my_center|LOCUS_15610 44902 45471 gene locus_tag LOCUS_15620 gene frr 44902 45471 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU06 protein_id gnl|my_center|LOCUS_15620 45475 46215 gene locus_tag LOCUS_15630 45475 46215 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 protein_id gnl|my_center|LOCUS_15630 46166 46870 gene locus_tag LOCUS_15640 46166 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 46887 48092 gene locus_tag LOCUS_15650 gene dxr 46887 48092 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_15650 48154 49290 gene locus_tag LOCUS_15660 48154 49290 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_15660 49345 51642 gene locus_tag LOCUS_15670 gene bamA 49345 51642 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 protein_id gnl|my_center|LOCUS_15670 51652 52260 gene locus_tag LOCUS_15680 51652 52260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 52267 53289 gene locus_tag LOCUS_15690 gene lpxD 52267 53289 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z4 protein_id gnl|my_center|LOCUS_15690 53295 53759 gene locus_tag LOCUS_15700 gene fabZ 53295 53759 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_15700 53756 54556 gene locus_tag LOCUS_15710 gene lpxA 53756 54556 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_15710 54546 55373 gene locus_tag LOCUS_15720 54546 55373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969262.1 protein_id gnl|my_center|LOCUS_15720 55370 56554 gene locus_tag LOCUS_15730 55370 56554 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_15730 57924 56611 gene locus_tag LOCUS_15740 57924 56611 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ5 protein_id gnl|my_center|LOCUS_15740 59441 58020 gene locus_tag LOCUS_15750 gene gltX2 59441 58020 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_15750 59680 59516 gene locus_tag LOCUS_15760 59680 59516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 59679 61730 gene locus_tag LOCUS_15770 59679 61730 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_15770 62461 61742 gene locus_tag LOCUS_15780 gene lexA 62461 61742 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Y6 protein_id gnl|my_center|LOCUS_15780 63912 62698 gene locus_tag LOCUS_15790 gene moeA 63912 62698 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_15790 64414 63935 gene locus_tag LOCUS_15800 gene moaC 64414 63935 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI5 protein_id gnl|my_center|LOCUS_15800 65258 64443 gene locus_tag LOCUS_15810 gene trpC 65258 64443 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_15810 66282 65260 gene locus_tag LOCUS_15820 gene trpD 66282 65260 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_15820 66863 66279 gene locus_tag LOCUS_15830 66863 66279 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_15830 67304 68398 gene locus_tag LOCUS_15840 67304 68398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 69923 68409 gene locus_tag LOCUS_15850 69923 68409 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_15850 71876 69948 gene locus_tag LOCUS_15860 71876 69948 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU2 protein_id gnl|my_center|LOCUS_15860 72059 72826 gene locus_tag LOCUS_15870 gene tpiA 72059 72826 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_15870 72934 73260 gene locus_tag LOCUS_15880 72934 73260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 73365 74993 gene locus_tag LOCUS_15890 gene pyrG 73365 74993 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT58 protein_id gnl|my_center|LOCUS_15890 75027 75863 gene locus_tag LOCUS_15900 gene kdsA 75027 75863 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT59 protein_id gnl|my_center|LOCUS_15900 75817 77199 gene locus_tag LOCUS_15910 gene eno 75817 77199 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 protein_id gnl|my_center|LOCUS_15910 77342 77668 gene locus_tag LOCUS_15920 77342 77668 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389635.1 protein_id gnl|my_center|LOCUS_15920 77673 78074 gene locus_tag LOCUS_15930 gene yqjZ 77673 78074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_15930 78074 78457 gene locus_tag LOCUS_15940 78074 78457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 78661 79701 gene locus_tag LOCUS_15950 gene pdhA 78661 79701 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT64 protein_id gnl|my_center|LOCUS_15950 79735 81099 gene locus_tag LOCUS_15960 79735 81099 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531482.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence14 <1 603 gene locus_tag LOCUS_15970 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084292.1:sulfate adenylyltransferase 603 2519 gene locus_tag LOCUS_15980 gene nodQ 603 2519 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_15980 4045 2516 gene locus_tag LOCUS_15990 4045 2516 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_15990 4974 4045 gene locus_tag LOCUS_16000 4974 4045 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_16000 6140 5082 gene locus_tag LOCUS_16010 gene ctaA 6140 5082 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H9 protein_id gnl|my_center|LOCUS_16010 6306 7106 gene locus_tag LOCUS_16020 6306 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 11260 7130 gene locus_tag LOCUS_16030 11260 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 12385 11441 gene locus_tag LOCUS_16040 12385 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085091.1 protein_id gnl|my_center|LOCUS_16040 13258 12482 gene locus_tag LOCUS_16050 13258 12482 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_16050 13326 13901 gene locus_tag LOCUS_16060 gene yoqW 13326 13901 CDS product putative SOS response-associated peptidase YoqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31916 protein_id gnl|my_center|LOCUS_16060 14356 13898 gene locus_tag LOCUS_16070 14356 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 16039 14456 gene locus_tag LOCUS_16080 16039 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_16080 17010 16036 gene locus_tag LOCUS_16090 17010 16036 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_16090 17627 17007 gene locus_tag LOCUS_16100 gene pdxH 17627 17007 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_16100 17801 18277 gene locus_tag LOCUS_16110 gene omp 17801 18277 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_16110 18320 19186 gene locus_tag LOCUS_16120 18320 19186 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706153.1 protein_id gnl|my_center|LOCUS_16120 20550 19228 gene locus_tag LOCUS_16130 20550 19228 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR23 protein_id gnl|my_center|LOCUS_16130 20749 21516 gene locus_tag LOCUS_16140 gene fabI-2 20749 21516 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U2 protein_id gnl|my_center|LOCUS_16140 21807 21541 gene locus_tag LOCUS_16150 21807 21541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887084.1 protein_id gnl|my_center|LOCUS_16150 22093 21791 gene locus_tag LOCUS_16160 22093 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_16160 22210 23280 gene locus_tag LOCUS_16170 gene aroC 22210 23280 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY1 protein_id gnl|my_center|LOCUS_16170 23346 24509 gene locus_tag LOCUS_16180 23346 24509 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339264.1 protein_id gnl|my_center|LOCUS_16180 24543 25268 gene locus_tag LOCUS_16190 24543 25268 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_16190 25829 25275 gene locus_tag LOCUS_16200 25829 25275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721261.1 protein_id gnl|my_center|LOCUS_16200 27172 25847 gene locus_tag LOCUS_16210 27172 25847 CDS product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038934.1 protein_id gnl|my_center|LOCUS_16210 27283 27606 gene locus_tag LOCUS_16220 27283 27606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 28326 27613 gene locus_tag LOCUS_16230 28326 27613 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_16230 30300 28375 gene locus_tag LOCUS_16240 gene dxs 30300 28375 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T825 protein_id gnl|my_center|LOCUS_16240 31277 30378 gene locus_tag LOCUS_16250 31277 30378 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_16250 31574 31296 gene locus_tag LOCUS_16260 31574 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 32598 31669 gene locus_tag LOCUS_16270 32598 31669 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_16270 33871 32642 gene locus_tag LOCUS_16280 33871 32642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088233.1 protein_id gnl|my_center|LOCUS_16280 33752 34159 gene locus_tag LOCUS_16290 33752 34159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 34238 35443 gene locus_tag LOCUS_16300 34238 35443 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969954.1 protein_id gnl|my_center|LOCUS_16300 35460 38663 gene locus_tag LOCUS_16310 35460 38663 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_16310 38863 39189 gene locus_tag LOCUS_16320 38863 39189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 40147 39260 gene locus_tag LOCUS_16330 40147 39260 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 protein_id gnl|my_center|LOCUS_16330 40318 41352 gene locus_tag LOCUS_16340 40318 41352 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204300.1 protein_id gnl|my_center|LOCUS_16340 41392 41991 gene locus_tag LOCUS_16350 41392 41991 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_16350 43019 41973 gene locus_tag LOCUS_16360 43019 41973 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_16360 43663 43103 gene locus_tag LOCUS_16370 43663 43103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 43883 43653 gene locus_tag LOCUS_16380 43883 43653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 44707 44102 gene locus_tag LOCUS_16390 44707 44102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 45337 44783 gene locus_tag LOCUS_16400 45337 44783 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTP9 protein_id gnl|my_center|LOCUS_16400 45528 46100 gene locus_tag LOCUS_16410 45528 46100 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_16410 46892 46140 gene locus_tag LOCUS_16420 46892 46140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 47432 46965 gene locus_tag LOCUS_16430 47432 46965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 47586 48488 gene locus_tag LOCUS_16440 47586 48488 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_16440 48588 48842 gene locus_tag LOCUS_16450 48588 48842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 49744 48869 gene locus_tag LOCUS_16460 49744 48869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 50193 50729 gene locus_tag LOCUS_16470 50193 50729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 51766 50816 gene locus_tag LOCUS_16480 51766 50816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 53773 51971 gene locus_tag LOCUS_16490 gene aspS 53773 51971 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 protein_id gnl|my_center|LOCUS_16490 54062 54583 gene locus_tag LOCUS_16500 54062 54583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 55832 54603 gene locus_tag LOCUS_16510 55832 54603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 56640 55906 gene locus_tag LOCUS_16520 56640 55906 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_16520 57486 56692 gene locus_tag LOCUS_16530 57486 56692 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086727.1 protein_id gnl|my_center|LOCUS_16530 57608 57919 gene locus_tag LOCUS_16540 57608 57919 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974482.1 protein_id gnl|my_center|LOCUS_16540 57916 59079 gene locus_tag LOCUS_16550 gene rnd 57916 59079 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_16550 59109 59729 gene locus_tag LOCUS_16560 59109 59729 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_16560 61273 59726 gene locus_tag LOCUS_16570 61273 59726 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_16570 63538 61334 gene locus_tag LOCUS_16580 gene ppk 63538 61334 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 protein_id gnl|my_center|LOCUS_16580 63994 63617 gene locus_tag LOCUS_16590 63994 63617 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083216.1 protein_id gnl|my_center|LOCUS_16590 64811 64032 gene locus_tag LOCUS_16600 64811 64032 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090612.1 protein_id gnl|my_center|LOCUS_16600 64998 66056 gene locus_tag LOCUS_16610 64998 66056 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387894.1 protein_id gnl|my_center|LOCUS_16610 66675 65986 gene locus_tag LOCUS_16620 66675 65986 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_16620 67751 66672 gene locus_tag LOCUS_16630 67751 66672 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_16630 68929 67748 gene locus_tag LOCUS_16640 68929 67748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 69096 70085 gene locus_tag LOCUS_16650 gene purM 69096 70085 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG8 protein_id gnl|my_center|LOCUS_16650 70082 70735 gene locus_tag LOCUS_16660 gene purN 70082 70735 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 protein_id gnl|my_center|LOCUS_16660 71154 70732 gene locus_tag LOCUS_16670 gene ndk 71154 70732 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC6 protein_id gnl|my_center|LOCUS_16670 72333 71365 gene locus_tag LOCUS_16680 72333 71365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_16680 72790 74688 gene locus_tag LOCUS_16690 72790 74688 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_16690 74685 75524 gene locus_tag LOCUS_16700 74685 75524 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_16700 75521 76690 gene locus_tag LOCUS_16710 75521 76690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_16710 76874 77416 gene locus_tag LOCUS_16720 76874 77416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 78242 77463 gene locus_tag LOCUS_16730 78242 77463 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_16730 79616 78297 gene locus_tag LOCUS_16740 79616 78297 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707214.1 protein_id gnl|my_center|LOCUS_16740 80233 79619 gene locus_tag LOCUS_16750 80233 79619 CDS product transporter DctQ-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707213.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence15 1513 1235 gene locus_tag LOCUS_16760 1513 1235 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_16760 1597 2289 gene locus_tag LOCUS_16770 1597 2289 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_16770 2309 2956 gene locus_tag LOCUS_16780 2309 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_16780 3887 2994 gene locus_tag LOCUS_16790 3887 2994 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_16790 4897 3884 gene locus_tag LOCUS_16800 4897 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5665 4940 gene locus_tag LOCUS_16810 5665 4940 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 protein_id gnl|my_center|LOCUS_16810 6914 5739 gene locus_tag LOCUS_16820 6914 5739 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_16820 8174 7131 gene locus_tag LOCUS_16830 8174 7131 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_16830 8673 8191 gene locus_tag LOCUS_16840 8673 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8799 9389 gene locus_tag LOCUS_16850 8799 9389 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_16850 10281 9412 gene locus_tag LOCUS_16860 10281 9412 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_16860 10372 11349 gene locus_tag LOCUS_16870 10372 11349 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_16870 12425 11346 gene locus_tag LOCUS_16880 gene queG 12425 11346 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 protein_id gnl|my_center|LOCUS_16880 12501 13232 gene locus_tag LOCUS_16890 gene queC 12501 13232 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_16890 13507 14136 gene locus_tag LOCUS_16900 gene queE 13507 14136 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P3 protein_id gnl|my_center|LOCUS_16900 14237 16492 gene locus_tag LOCUS_16910 gene cyaA 14237 16492 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947053.1 protein_id gnl|my_center|LOCUS_16910 16652 17110 gene locus_tag LOCUS_16920 16652 17110 CDS product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525768.1 protein_id gnl|my_center|LOCUS_16920 17113 19320 gene locus_tag LOCUS_16930 17113 19320 CDS product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888272.1 protein_id gnl|my_center|LOCUS_16930 19707 19390 gene locus_tag LOCUS_16940 19707 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 19903 20265 gene locus_tag LOCUS_16950 gene ygcM 19903 20265 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WBS3 protein_id gnl|my_center|LOCUS_16950 20262 20639 gene locus_tag LOCUS_16960 gene queD 20262 20639 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65871 protein_id gnl|my_center|LOCUS_16960 20802 21080 gene locus_tag LOCUS_16970 20802 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 21549 21085 gene locus_tag LOCUS_16980 gene queF 21549 21085 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU5 protein_id gnl|my_center|LOCUS_16980 22724 21552 gene locus_tag LOCUS_16990 gene tgt 22724 21552 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR0 protein_id gnl|my_center|LOCUS_16990 24246 22789 gene locus_tag LOCUS_17000 24246 22789 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 protein_id gnl|my_center|LOCUS_17000 24611 24249 gene locus_tag LOCUS_17010 24611 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 25816 24746 gene locus_tag LOCUS_17020 gene queA 25816 24746 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ9 protein_id gnl|my_center|LOCUS_17020 25934 26149 gene locus_tag LOCUS_17030 25934 26149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566084.1 protein_id gnl|my_center|LOCUS_17030 26456 26169 gene locus_tag LOCUS_17040 26456 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 27484 26489 gene locus_tag LOCUS_17050 27484 26489 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_17050 27581 28522 gene locus_tag LOCUS_17060 27581 28522 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_17060 29942 28536 gene locus_tag LOCUS_17070 29942 28536 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085814.1 protein_id gnl|my_center|LOCUS_17070 30465 32000 gene locus_tag LOCUS_17080 30465 32000 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_17080 32039 33025 gene locus_tag LOCUS_17090 gene appB 32039 33025 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383488.1 protein_id gnl|my_center|LOCUS_17090 33072 33929 gene locus_tag LOCUS_17100 33072 33929 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 protein_id gnl|my_center|LOCUS_17100 33945 34955 gene locus_tag LOCUS_17110 33945 34955 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762885.1 protein_id gnl|my_center|LOCUS_17110 34957 35958 gene locus_tag LOCUS_17120 34957 35958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267551.1 protein_id gnl|my_center|LOCUS_17120 35978 37396 gene locus_tag LOCUS_17130 35978 37396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267550.1 protein_id gnl|my_center|LOCUS_17130 37393 38787 gene locus_tag LOCUS_17140 37393 38787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267550.1 protein_id gnl|my_center|LOCUS_17140 38784 40217 gene locus_tag LOCUS_17150 38784 40217 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_17150 40214 41677 gene locus_tag LOCUS_17160 40214 41677 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_17160 41687 43183 gene locus_tag LOCUS_17170 41687 43183 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUQ1 protein_id gnl|my_center|LOCUS_17170 43644 43180 gene locus_tag LOCUS_17180 gene blrB 43644 43180 CDS product blue-light sensor BLUF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338827.1 protein_id gnl|my_center|LOCUS_17180 44304 43684 gene locus_tag LOCUS_17190 44304 43684 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_17190 45308 44313 gene locus_tag LOCUS_17200 45308 44313 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_17200 45444 46220 gene locus_tag LOCUS_17210 45444 46220 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_17210 46575 48350 gene locus_tag LOCUS_17220 46575 48350 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_17220 48382 50112 gene locus_tag LOCUS_17230 48382 50112 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389741.1 protein_id gnl|my_center|LOCUS_17230 50122 51261 gene locus_tag LOCUS_17240 50122 51261 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969301.1 protein_id gnl|my_center|LOCUS_17240 51347 52954 gene locus_tag LOCUS_17250 51347 52954 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_17250 53237 54655 gene locus_tag LOCUS_17260 gene cysG 53237 54655 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_17260 54679 55035 gene locus_tag LOCUS_17270 54679 55035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315350.1 protein_id gnl|my_center|LOCUS_17270 55074 56735 gene locus_tag LOCUS_17280 55074 56735 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529563.1 protein_id gnl|my_center|LOCUS_17280 56719 57234 gene locus_tag LOCUS_17290 56719 57234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_17290 59163 57259 gene locus_tag LOCUS_17300 59163 57259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 59372 60709 gene locus_tag LOCUS_17310 59372 60709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 61869 60724 gene locus_tag LOCUS_17320 61869 60724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 62052 62522 gene locus_tag LOCUS_17330 62052 62522 CDS product glutamate mutase sigma subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_17330 62519 63973 gene locus_tag LOCUS_17340 62519 63973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460942.1 protein_id gnl|my_center|LOCUS_17340 63948 65447 gene locus_tag LOCUS_17350 63948 65447 CDS product glutamate mutase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_17350 65460 66308 gene locus_tag LOCUS_17360 65460 66308 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_17360 66305 67198 gene locus_tag LOCUS_17370 66305 67198 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_17370 67253 68683 gene locus_tag LOCUS_17380 67253 68683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_17380 68839 69975 gene locus_tag LOCUS_17390 gene sucC 68839 69975 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV5 protein_id gnl|my_center|LOCUS_17390 69972 70862 gene locus_tag LOCUS_17400 69972 70862 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_17400 70911 71693 gene locus_tag LOCUS_17410 70911 71693 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 protein_id gnl|my_center|LOCUS_17410 72222 72614 gene locus_tag LOCUS_17420 72222 72614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 72629 73045 gene locus_tag LOCUS_17430 72629 73045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 73109 74914 gene locus_tag LOCUS_17440 gene kefB 73109 74914 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112454.1 protein_id gnl|my_center|LOCUS_17440 75529 74921 gene locus_tag LOCUS_17450 75529 74921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 77280 75643 gene locus_tag LOCUS_17460 77280 75643 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089435.1 protein_id gnl|my_center|LOCUS_17460 77438 78799 gene locus_tag LOCUS_17470 77438 78799 CDS product AgaE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338095.1 protein_id gnl|my_center|LOCUS_17470 <79472 78804 gene locus_tag LOCUS_17480 <79472 78804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968124.1:oxidoreductase >Feature sequence16 1033 47 gene locus_tag LOCUS_17490 1033 47 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_17490 2022 1033 gene locus_tag LOCUS_17500 2022 1033 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_17500 2519 4858 gene locus_tag LOCUS_17510 2519 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5503 4883 gene locus_tag LOCUS_17520 5503 4883 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 protein_id gnl|my_center|LOCUS_17520 6692 5514 gene locus_tag LOCUS_17530 6692 5514 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708668.1 protein_id gnl|my_center|LOCUS_17530 7393 6764 gene locus_tag LOCUS_17540 7393 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 7614 8660 gene locus_tag LOCUS_17550 gene cobC 7614 8660 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_17550 8653 10419 gene locus_tag LOCUS_17560 8653 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008992010.1 protein_id gnl|my_center|LOCUS_17560 10566 11999 gene locus_tag LOCUS_17570 10566 11999 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_17570 12130 13092 gene locus_tag LOCUS_17580 12130 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 14309 13116 gene locus_tag LOCUS_17590 14309 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 protein_id gnl|my_center|LOCUS_17590 15042 14311 gene locus_tag LOCUS_17600 15042 14311 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_17600 16468 15047 gene locus_tag LOCUS_17610 gene purF 16468 15047 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 protein_id gnl|my_center|LOCUS_17610 17308 16610 gene locus_tag LOCUS_17620 17308 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 18758 17334 gene locus_tag LOCUS_17630 gene radA 18758 17334 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_17630 18916 19464 gene locus_tag LOCUS_17640 18916 19464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 19461 19625 gene locus_tag LOCUS_17650 19461 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 19686 20102 gene locus_tag LOCUS_17660 19686 20102 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_17660 20888 20106 gene locus_tag LOCUS_17670 20888 20106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_17670 21681 20908 gene locus_tag LOCUS_17680 21681 20908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_17680 22820 21687 gene locus_tag LOCUS_17690 gene alr 22820 21687 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD1 protein_id gnl|my_center|LOCUS_17690 24459 22810 gene locus_tag LOCUS_17700 24459 22810 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 protein_id gnl|my_center|LOCUS_17700 25801 24557 gene locus_tag LOCUS_17710 25801 24557 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_17710 26754 26008 gene locus_tag LOCUS_17720 26754 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 27720 26770 gene locus_tag LOCUS_17730 27720 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 28033 27773 gene locus_tag LOCUS_17740 gene rpsR 28033 27773 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q2 protein_id gnl|my_center|LOCUS_17740 28482 28030 gene locus_tag LOCUS_17750 28482 28030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 29173 28655 gene locus_tag LOCUS_17760 29173 28655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 29367 30326 gene locus_tag LOCUS_17770 29367 30326 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_17770 30365 31102 gene locus_tag LOCUS_17780 30365 31102 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388175.1 protein_id gnl|my_center|LOCUS_17780 31286 31519 gene locus_tag LOCUS_17790 gene acpP 31286 31519 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_17790 31598 32863 gene locus_tag LOCUS_17800 gene fabF 31598 32863 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 protein_id gnl|my_center|LOCUS_17800 32878 33861 gene locus_tag LOCUS_17810 32878 33861 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_17810 34210 33884 gene locus_tag LOCUS_17820 34210 33884 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_17820 35044 34280 gene locus_tag LOCUS_17830 35044 34280 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085699.1 protein_id gnl|my_center|LOCUS_17830 35854 35198 gene locus_tag LOCUS_17840 35854 35198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 36183 35863 gene locus_tag LOCUS_17850 36183 35863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 37142 36369 gene locus_tag LOCUS_17860 37142 36369 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_17860 37259 38152 gene locus_tag LOCUS_17870 37259 38152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_17870 38172 38804 gene locus_tag LOCUS_17880 gene gmk 38172 38804 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXB1 protein_id gnl|my_center|LOCUS_17880 39628 38801 gene locus_tag LOCUS_17890 gene rsmA 39628 38801 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA9 protein_id gnl|my_center|LOCUS_17890 40655 39636 gene locus_tag LOCUS_17900 gene pdxA 40655 39636 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA8 protein_id gnl|my_center|LOCUS_17900 41938 40658 gene locus_tag LOCUS_17910 41938 40658 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA7 protein_id gnl|my_center|LOCUS_17910 44071 41978 gene locus_tag LOCUS_17920 gene lptD 44071 41978 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 protein_id gnl|my_center|LOCUS_17920 45432 44332 gene locus_tag LOCUS_17930 45432 44332 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_17930 46561 45446 gene locus_tag LOCUS_17940 46561 45446 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_17940 48451 46664 gene locus_tag LOCUS_17950 48451 46664 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_17950 48597 50066 gene locus_tag LOCUS_17960 48597 50066 CDS product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 protein_id gnl|my_center|LOCUS_17960 50306 50073 gene locus_tag LOCUS_17970 50306 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918044.1 protein_id gnl|my_center|LOCUS_17970 51371 50541 gene locus_tag LOCUS_17980 51371 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 52657 51533 gene locus_tag LOCUS_17990 52657 51533 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_17990 54086 52755 gene locus_tag LOCUS_18000 54086 52755 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_18000 55033 54245 gene locus_tag LOCUS_18010 55033 54245 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_18010 55167 55517 gene locus_tag LOCUS_18020 55167 55517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 55532 57076 gene locus_tag LOCUS_18030 55532 57076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879798.1 protein_id gnl|my_center|LOCUS_18030 57036 57836 gene locus_tag LOCUS_18040 57036 57836 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M69 protein_id gnl|my_center|LOCUS_18040 58669 57833 gene locus_tag LOCUS_18050 58669 57833 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528003.1 protein_id gnl|my_center|LOCUS_18050 59467 58805 gene locus_tag LOCUS_18060 59467 58805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 59895 59464 gene locus_tag LOCUS_18070 59895 59464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 60824 60024 gene locus_tag LOCUS_18080 60824 60024 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390243.1 protein_id gnl|my_center|LOCUS_18080 60971 62185 gene locus_tag LOCUS_18090 60971 62185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_18090 62768 62193 gene locus_tag LOCUS_18100 62768 62193 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973484.1 protein_id gnl|my_center|LOCUS_18100 63754 62765 gene locus_tag LOCUS_18110 63754 62765 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX96 protein_id gnl|my_center|LOCUS_18110 64529 63744 gene locus_tag LOCUS_18120 64529 63744 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_18120 66089 64623 gene locus_tag LOCUS_18130 66089 64623 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWB6 protein_id gnl|my_center|LOCUS_18130 66165 67325 gene locus_tag LOCUS_18140 66165 67325 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 protein_id gnl|my_center|LOCUS_18140 67403 68176 gene locus_tag LOCUS_18150 67403 68176 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085849.1 protein_id gnl|my_center|LOCUS_18150 68363 69868 gene locus_tag LOCUS_18160 gene pepA 68363 69868 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_18160 69900 70403 gene locus_tag LOCUS_18170 69900 70403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 70454 70903 gene locus_tag LOCUS_18180 70454 70903 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_18180 70970 71992 gene locus_tag LOCUS_18190 70970 71992 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807666.1 protein_id gnl|my_center|LOCUS_18190 72007 73296 gene locus_tag LOCUS_18200 72007 73296 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523407.1 protein_id gnl|my_center|LOCUS_18200 73293 74213 gene locus_tag LOCUS_18210 73293 74213 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_18210 74854 74228 gene locus_tag LOCUS_18220 74854 74228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971969.1 protein_id gnl|my_center|LOCUS_18220 76545 74920 gene locus_tag LOCUS_18230 76545 74920 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970328.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence17 1003 716 gene locus_tag LOCUS_18240 gene groS 1003 716 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGU0 protein_id gnl|my_center|LOCUS_18240 1986 1174 gene locus_tag LOCUS_18250 1986 1174 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924398.1 protein_id gnl|my_center|LOCUS_18250 3185 1983 gene locus_tag LOCUS_18260 3185 1983 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 protein_id gnl|my_center|LOCUS_18260 3925 3224 gene locus_tag LOCUS_18270 3925 3224 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939331.1 protein_id gnl|my_center|LOCUS_18270 4704 3922 gene locus_tag LOCUS_18280 gene dpm1 4704 3922 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_18280 4893 5414 gene locus_tag LOCUS_18290 4893 5414 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551411.1 protein_id gnl|my_center|LOCUS_18290 5536 6606 gene locus_tag LOCUS_18300 5536 6606 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_18300 6773 7882 gene locus_tag LOCUS_18310 6773 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7993 9465 gene locus_tag LOCUS_18320 7993 9465 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G3 protein_id gnl|my_center|LOCUS_18320 9725 10765 gene locus_tag LOCUS_18330 9725 10765 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_18330 10913 12298 gene locus_tag LOCUS_18340 10913 12298 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_18340 12291 13619 gene locus_tag LOCUS_18350 12291 13619 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_18350 13633 14454 gene locus_tag LOCUS_18360 gene pstB 13633 14454 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q2 protein_id gnl|my_center|LOCUS_18360 14489 15205 gene locus_tag LOCUS_18370 14489 15205 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_18370 15225 15917 gene locus_tag LOCUS_18380 15225 15917 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_18380 15997 17775 gene locus_tag LOCUS_18390 15997 17775 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_18390 18862 17801 gene locus_tag LOCUS_18400 18862 17801 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_18400 18943 21219 gene locus_tag LOCUS_18410 18943 21219 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU59 protein_id gnl|my_center|LOCUS_18410 21216 22100 gene locus_tag LOCUS_18420 21216 22100 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_18420 23458 22097 gene locus_tag LOCUS_18430 23458 22097 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_18430 23675 25180 gene locus_tag LOCUS_18440 23675 25180 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 protein_id gnl|my_center|LOCUS_18440 25392 27284 gene locus_tag LOCUS_18450 25392 27284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 27295 28203 gene locus_tag LOCUS_18460 27295 28203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 29202 28237 gene locus_tag LOCUS_18470 29202 28237 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 protein_id gnl|my_center|LOCUS_18470 29536 31563 gene locus_tag LOCUS_18480 29536 31563 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 protein_id gnl|my_center|LOCUS_18480 31691 32854 gene locus_tag LOCUS_18490 31691 32854 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_18490 32851 33936 gene locus_tag LOCUS_18500 32851 33936 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 protein_id gnl|my_center|LOCUS_18500 33939 34745 gene locus_tag LOCUS_18510 33939 34745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 protein_id gnl|my_center|LOCUS_18510 34748 35080 gene locus_tag LOCUS_18520 34748 35080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_18520 35111 35986 gene locus_tag LOCUS_18530 35111 35986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 37541 35994 gene locus_tag LOCUS_18540 37541 35994 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 protein_id gnl|my_center|LOCUS_18540 37618 38124 gene locus_tag LOCUS_18550 37618 38124 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_18550 38114 39229 gene locus_tag LOCUS_18560 38114 39229 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088998.1 protein_id gnl|my_center|LOCUS_18560 39349 40092 gene locus_tag LOCUS_18570 39349 40092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18570 40089 40853 gene locus_tag LOCUS_18580 40089 40853 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_18580 40850 41269 gene locus_tag LOCUS_18590 40850 41269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_18590 41765 41220 gene locus_tag LOCUS_18600 41765 41220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_18600 43145 41787 gene locus_tag LOCUS_18610 43145 41787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_18610 44389 43142 gene locus_tag LOCUS_18620 44389 43142 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_18620 45195 44410 gene locus_tag LOCUS_18630 45195 44410 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_18630 46547 45192 gene locus_tag LOCUS_18640 46547 45192 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_18640 46801 47373 gene locus_tag LOCUS_18650 46801 47373 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_18650 47370 48035 gene locus_tag LOCUS_18660 gene chrR 47370 48035 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_18660 48502 48050 gene locus_tag LOCUS_18670 48502 48050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 49579 48617 gene locus_tag LOCUS_18680 49579 48617 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064867.1 protein_id gnl|my_center|LOCUS_18680 49764 50588 gene locus_tag LOCUS_18690 49764 50588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_18690 50762 50688 gene locus_tag LOCUS_t00240 50762 50688 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51000 52646 gene locus_tag LOCUS_18700 51000 52646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 53372 52656 gene locus_tag LOCUS_18710 gene cbbZ 53372 52656 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYC6 protein_id gnl|my_center|LOCUS_18710 53549 54889 gene locus_tag LOCUS_18720 gene glmU 53549 54889 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_18720 54896 56719 gene locus_tag LOCUS_18730 gene glmS 54896 56719 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 protein_id gnl|my_center|LOCUS_18730 57972 56851 gene locus_tag LOCUS_18740 57972 56851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 58372 59757 gene locus_tag LOCUS_18750 58372 59757 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_18750 61096 59903 gene locus_tag LOCUS_18760 61096 59903 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088770.1 protein_id gnl|my_center|LOCUS_18760 62486 61233 gene locus_tag LOCUS_18770 62486 61233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 protein_id gnl|my_center|LOCUS_18770 62939 62580 gene locus_tag LOCUS_18780 62939 62580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 64333 62936 gene locus_tag LOCUS_18790 64333 62936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 64412 65557 gene locus_tag LOCUS_18800 64412 65557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 65706 65630 gene locus_tag LOCUS_t00250 65706 65630 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65973 67139 gene locus_tag LOCUS_18810 65973 67139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_18810 67268 67792 gene locus_tag LOCUS_18820 gene gpt 67268 67792 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IM4 protein_id gnl|my_center|LOCUS_18820 67789 68913 gene locus_tag LOCUS_18830 67789 68913 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_18830 69141 68938 gene locus_tag LOCUS_18840 69141 68938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 70156 69347 gene locus_tag LOCUS_18850 70156 69347 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_18850 70293 71111 gene locus_tag LOCUS_18860 70293 71111 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065001.1 protein_id gnl|my_center|LOCUS_18860 71114 71914 gene locus_tag LOCUS_18870 71114 71914 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065001.1 protein_id gnl|my_center|LOCUS_18870 71904 73103 gene locus_tag LOCUS_18880 71904 73103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083316.1 protein_id gnl|my_center|LOCUS_18880 73217 74476 gene locus_tag LOCUS_18890 gene dadA 73217 74476 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_18890 74507 75520 gene locus_tag LOCUS_18900 74507 75520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence18 2 661 gene locus_tag LOCUS_18910 gene rplY 2 661 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV5 protein_id gnl|my_center|LOCUS_18910 710 1336 gene locus_tag LOCUS_18920 gene pth 710 1336 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN0 protein_id gnl|my_center|LOCUS_18920 1338 2438 gene locus_tag LOCUS_18930 gene ychF 1338 2438 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV3 protein_id gnl|my_center|LOCUS_18930 3785 2451 gene locus_tag LOCUS_18940 3785 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3990 4664 gene locus_tag LOCUS_18950 3990 4664 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_18950 4671 5555 gene locus_tag LOCUS_18960 gene mtnP 4671 5555 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH9 protein_id gnl|my_center|LOCUS_18960 5580 6194 gene locus_tag LOCUS_18970 5580 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6207 7304 gene locus_tag LOCUS_18980 gene mtnA 6207 7304 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_18980 7301 7924 gene locus_tag LOCUS_18990 7301 7924 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707287.1 protein_id gnl|my_center|LOCUS_18990 7937 8926 gene locus_tag LOCUS_19000 7937 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_19000 9987 9145 gene locus_tag LOCUS_19010 gene fbcC 9987 9145 CDS product ribosomal protein P2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969491.1 protein_id gnl|my_center|LOCUS_19010 11270 9993 gene locus_tag LOCUS_19020 11270 9993 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH7 protein_id gnl|my_center|LOCUS_19020 11836 11282 gene locus_tag LOCUS_19030 11836 11282 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_19030 12115 12594 gene locus_tag LOCUS_19040 gene trmL 12115 12594 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH5 protein_id gnl|my_center|LOCUS_19040 12591 13487 gene locus_tag LOCUS_19050 gene hemF 12591 13487 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZX1 protein_id gnl|my_center|LOCUS_19050 13579 13935 gene locus_tag LOCUS_19060 13579 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701103.1 protein_id gnl|my_center|LOCUS_19060 14798 13950 gene locus_tag LOCUS_19070 14798 13950 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 protein_id gnl|my_center|LOCUS_19070 14797 15042 gene locus_tag LOCUS_19080 14797 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 15777 14977 gene locus_tag LOCUS_19090 15777 14977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 16653 15787 gene locus_tag LOCUS_19100 16653 15787 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 protein_id gnl|my_center|LOCUS_19100 17443 16682 gene locus_tag LOCUS_19110 gene phnC 17443 16682 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_19110 18613 17834 gene locus_tag LOCUS_19120 18613 17834 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF5 protein_id gnl|my_center|LOCUS_19120 18921 19919 gene locus_tag LOCUS_19130 18921 19919 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_19130 19919 20305 gene locus_tag LOCUS_19140 19919 20305 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968175.1 protein_id gnl|my_center|LOCUS_19140 21036 20332 gene locus_tag LOCUS_19150 21036 20332 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_19150 21674 21057 gene locus_tag LOCUS_19160 gene azoR 21674 21057 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL54 protein_id gnl|my_center|LOCUS_19160 21828 22739 gene locus_tag LOCUS_19170 21828 22739 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_19170 24369 22750 gene locus_tag LOCUS_19180 24369 22750 CDS product thiamine pyrophosphate-requiring enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339087.1 protein_id gnl|my_center|LOCUS_19180 25314 24472 gene locus_tag LOCUS_19190 25314 24472 CDS product taurine catabolism dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808787.1 protein_id gnl|my_center|LOCUS_19190 25468 26004 gene locus_tag LOCUS_19200 25468 26004 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_19200 28111 26015 gene locus_tag LOCUS_19210 28111 26015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 protein_id gnl|my_center|LOCUS_19210 30882 28108 gene locus_tag LOCUS_19220 30882 28108 CDS product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_19220 31789 30902 gene locus_tag LOCUS_19230 31789 30902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_19230 32846 31824 gene locus_tag LOCUS_19240 32846 31824 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388122.1 protein_id gnl|my_center|LOCUS_19240 32940 33524 gene locus_tag LOCUS_19250 32940 33524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388121.1 protein_id gnl|my_center|LOCUS_19250 33547 34209 gene locus_tag LOCUS_19260 33547 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 34206 34484 gene locus_tag LOCUS_19270 34206 34484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 34532 35836 gene locus_tag LOCUS_19280 34532 35836 CDS product polynucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388119.1 protein_id gnl|my_center|LOCUS_19280 35833 36468 gene locus_tag LOCUS_19290 35833 36468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 36794 37201 gene locus_tag LOCUS_19300 36794 37201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 38043 37198 gene locus_tag LOCUS_19310 gene tauD 38043 37198 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_19310 39464 38133 gene locus_tag LOCUS_19320 39464 38133 CDS product peptidase S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387893.1 protein_id gnl|my_center|LOCUS_19320 39376 39618 gene locus_tag LOCUS_19330 39376 39618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 39688 40086 gene locus_tag LOCUS_19340 39688 40086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 40473 40120 gene locus_tag LOCUS_19350 40473 40120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 41227 40478 gene locus_tag LOCUS_19360 41227 40478 CDS product dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552063.1 protein_id gnl|my_center|LOCUS_19360 41408 42211 gene locus_tag LOCUS_19370 41408 42211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531154.1 protein_id gnl|my_center|LOCUS_19370 42227 43033 gene locus_tag LOCUS_19380 42227 43033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 protein_id gnl|my_center|LOCUS_19380 43923 43030 gene locus_tag LOCUS_19390 43923 43030 CDS product phenazine antibiotic biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709313.1 protein_id gnl|my_center|LOCUS_19390 44239 44763 gene locus_tag LOCUS_19400 44239 44763 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_19400 44827 45993 gene locus_tag LOCUS_19410 44827 45993 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 protein_id gnl|my_center|LOCUS_19410 49006 46142 gene locus_tag LOCUS_19420 gene gcvP 49006 46142 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q11 protein_id gnl|my_center|LOCUS_19420 49413 49039 gene locus_tag LOCUS_19430 gene gcvH 49413 49039 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8Q4 protein_id gnl|my_center|LOCUS_19430 50546 49437 gene locus_tag LOCUS_19440 50546 49437 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU9 protein_id gnl|my_center|LOCUS_19440 51545 50958 gene locus_tag LOCUS_19450 51545 50958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390800.1 protein_id gnl|my_center|LOCUS_19450 53507 51717 gene locus_tag LOCUS_19460 53507 51717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 53648 54616 gene locus_tag LOCUS_19470 gene thrB 53648 54616 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU4 protein_id gnl|my_center|LOCUS_19470 54618 55079 gene locus_tag LOCUS_19480 gene rnhA 54618 55079 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU6 protein_id gnl|my_center|LOCUS_19480 55208 56443 gene locus_tag LOCUS_19490 55208 56443 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_19490 57337 56453 gene locus_tag LOCUS_19500 57337 56453 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193481.1 protein_id gnl|my_center|LOCUS_19500 57436 58104 gene locus_tag LOCUS_19510 57436 58104 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088140.1 protein_id gnl|my_center|LOCUS_19510 58284 59633 gene locus_tag LOCUS_19520 58284 59633 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_19520 59725 61446 gene locus_tag LOCUS_19530 59725 61446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_19530 61449 62543 gene locus_tag LOCUS_19540 61449 62543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_19540 63079 62597 gene locus_tag LOCUS_19550 63079 62597 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_19550 65306 63222 gene locus_tag LOCUS_19560 65306 63222 CDS product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_19560 65664 66278 gene locus_tag LOCUS_19570 65664 66278 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_19570 66305 66586 gene locus_tag LOCUS_19580 66305 66586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 66754 67260 gene locus_tag LOCUS_19590 66754 67260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 68546 67287 gene locus_tag LOCUS_19600 68546 67287 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_19600 69962 68562 gene locus_tag LOCUS_19610 69962 68562 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_19610 70098 71288 gene locus_tag LOCUS_19620 70098 71288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 72819 71305 gene locus_tag LOCUS_19630 72819 71305 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_19630 73144 72851 gene locus_tag LOCUS_19640 73144 72851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence19 1499 999 gene locus_tag LOCUS_19650 1499 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1798 2796 gene locus_tag LOCUS_19660 1798 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2889 4112 gene locus_tag LOCUS_19670 2889 4112 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_19670 4125 4865 gene locus_tag LOCUS_19680 4125 4865 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_19680 4880 5944 gene locus_tag LOCUS_19690 4880 5944 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAP0 protein_id gnl|my_center|LOCUS_19690 5971 7191 gene locus_tag LOCUS_19700 5971 7191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 protein_id gnl|my_center|LOCUS_19700 8190 7216 gene locus_tag LOCUS_19710 8190 7216 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389120.1 protein_id gnl|my_center|LOCUS_19710 9166 8288 gene locus_tag LOCUS_19720 9166 8288 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_19720 10502 9195 gene locus_tag LOCUS_19730 gene mgtE 10502 9195 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B32 protein_id gnl|my_center|LOCUS_19730 11353 10499 gene locus_tag LOCUS_19740 11353 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 12185 11346 gene locus_tag LOCUS_19750 12185 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 14006 12366 gene locus_tag LOCUS_19760 gene groL2 14006 12366 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 protein_id gnl|my_center|LOCUS_19760 14392 14075 gene locus_tag LOCUS_19770 gene groS1 14392 14075 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35473 protein_id gnl|my_center|LOCUS_19770 14689 14949 gene locus_tag LOCUS_19780 14689 14949 CDS product Usg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975444.1 protein_id gnl|my_center|LOCUS_19780 16706 14958 gene locus_tag LOCUS_19790 16706 14958 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_19790 16839 17216 gene locus_tag LOCUS_19800 16839 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 17216 17482 gene locus_tag LOCUS_19810 17216 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 17484 20231 gene locus_tag LOCUS_19820 17484 20231 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_19820 20401 22062 gene locus_tag LOCUS_19830 20401 22062 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_19830 22648 23355 gene locus_tag LOCUS_19840 22648 23355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_19840 23348 24133 gene locus_tag LOCUS_19850 23348 24133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_19850 24190 25029 gene locus_tag LOCUS_19860 24190 25029 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_19860 25318 26283 gene locus_tag LOCUS_19870 25318 26283 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_19870 27274 26354 gene locus_tag LOCUS_19880 27274 26354 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970364.1 protein_id gnl|my_center|LOCUS_19880 28785 27367 gene locus_tag LOCUS_19890 28785 27367 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_19890 29666 28905 gene locus_tag LOCUS_19900 29666 28905 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088549.1 protein_id gnl|my_center|LOCUS_19900 29961 30740 gene locus_tag LOCUS_19910 29961 30740 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388462.1 protein_id gnl|my_center|LOCUS_19910 30801 31490 gene locus_tag LOCUS_19920 30801 31490 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_19920 31501 32190 gene locus_tag LOCUS_19930 31501 32190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 32207 32548 gene locus_tag LOCUS_19940 32207 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 32535 32861 gene locus_tag LOCUS_19950 32535 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 32858 33472 gene locus_tag LOCUS_19960 gene nthA 32858 33472 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087269.1 protein_id gnl|my_center|LOCUS_19960 33659 34642 gene locus_tag LOCUS_19970 33659 34642 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088546.1 protein_id gnl|my_center|LOCUS_19970 34644 35462 gene locus_tag LOCUS_19980 34644 35462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088547.1 protein_id gnl|my_center|LOCUS_19980 35453 36310 gene locus_tag LOCUS_19990 35453 36310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088548.1 protein_id gnl|my_center|LOCUS_19990 36952 36329 gene locus_tag LOCUS_20000 36952 36329 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 protein_id gnl|my_center|LOCUS_20000 37374 37661 gene locus_tag LOCUS_20010 37374 37661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 37658 37858 gene locus_tag LOCUS_20020 37658 37858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 37948 38124 gene locus_tag LOCUS_20030 37948 38124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 38141 38410 gene locus_tag LOCUS_20040 38141 38410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530531.1 protein_id gnl|my_center|LOCUS_20040 38469 39215 gene locus_tag LOCUS_20050 38469 39215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 39263 39946 gene locus_tag LOCUS_20060 39263 39946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 40659 39958 gene locus_tag LOCUS_20070 40659 39958 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710107.1 protein_id gnl|my_center|LOCUS_20070 40860 41921 gene locus_tag LOCUS_20080 40860 41921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 41926 44253 gene locus_tag LOCUS_20090 41926 44253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 45154 44264 gene locus_tag LOCUS_20100 gene ytlA 45154 44264 CDS product putative binding protein YtlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SP84 protein_id gnl|my_center|LOCUS_20100 46744 45248 gene locus_tag LOCUS_20110 46744 45248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 48169 46844 gene locus_tag LOCUS_20120 48169 46844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 49224 48334 gene locus_tag LOCUS_20130 gene hmgL 49224 48334 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975575.1 protein_id gnl|my_center|LOCUS_20130 51155 49221 gene locus_tag LOCUS_20140 gene mccB 51155 49221 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975574.1 protein_id gnl|my_center|LOCUS_20140 52834 51227 gene locus_tag LOCUS_20150 52834 51227 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532608.1 protein_id gnl|my_center|LOCUS_20150 54170 53007 gene locus_tag LOCUS_20160 54170 53007 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_20160 54408 54752 gene locus_tag LOCUS_20170 54408 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_20170 54987 54781 gene locus_tag LOCUS_20180 54987 54781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 55156 55860 gene locus_tag LOCUS_20190 55156 55860 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707571.1 protein_id gnl|my_center|LOCUS_20190 56988 55882 gene locus_tag LOCUS_20200 56988 55882 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707194.1 protein_id gnl|my_center|LOCUS_20200 57032 58432 gene locus_tag LOCUS_20210 57032 58432 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_20210 58425 59252 gene locus_tag LOCUS_20220 58425 59252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 59276 59686 gene locus_tag LOCUS_20230 59276 59686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 61324 59831 gene locus_tag LOCUS_20240 61324 59831 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3U9 protein_id gnl|my_center|LOCUS_20240 61516 61725 gene locus_tag LOCUS_20250 61516 61725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 62744 61722 gene locus_tag LOCUS_20260 62744 61722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 63030 63476 gene locus_tag LOCUS_20270 63030 63476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 64806 63634 gene locus_tag LOCUS_20280 64806 63634 CDS product thiamine pyrophosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_20280 66729 65053 gene locus_tag LOCUS_20290 gene pepM 66729 65053 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188554.1 protein_id gnl|my_center|LOCUS_20290 67129 68418 gene locus_tag LOCUS_20300 67129 68418 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 protein_id gnl|my_center|LOCUS_20300 68577 70157 gene locus_tag LOCUS_20310 68577 70157 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972307.1 protein_id gnl|my_center|LOCUS_20310 70154 71296 gene locus_tag LOCUS_20320 70154 71296 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531847.1 protein_id gnl|my_center|LOCUS_20320 71301 72047 gene locus_tag LOCUS_20330 71301 72047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence20 <1 572 gene locus_tag LOCUS_20340 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX73:acetolactate synthase 681 1196 gene locus_tag LOCUS_20350 gene ilvH 681 1196 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_20350 1247 2266 gene locus_tag LOCUS_20360 gene ilvC 1247 2266 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 protein_id gnl|my_center|LOCUS_20360 3202 2360 gene locus_tag LOCUS_20370 3202 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3336 3476 gene locus_tag LOCUS_20380 3336 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3655 5217 gene locus_tag LOCUS_20390 gene leuA 3655 5217 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A823 protein_id gnl|my_center|LOCUS_20390 5443 6483 gene locus_tag LOCUS_20400 5443 6483 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_20400 7920 6484 gene locus_tag LOCUS_20410 gene norM 7920 6484 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W72 protein_id gnl|my_center|LOCUS_20410 9376 8207 gene locus_tag LOCUS_20420 9376 8207 CDS product response regulator receiver modulated metal-depenent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_20420 10523 9378 gene locus_tag LOCUS_20430 10523 9378 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_20430 12589 10649 gene locus_tag LOCUS_20440 12589 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 13449 12574 gene locus_tag LOCUS_20450 13449 12574 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_20450 13615 14613 gene locus_tag LOCUS_20460 13615 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 14724 15173 gene locus_tag LOCUS_20470 14724 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 15990 15160 gene locus_tag LOCUS_20480 gene cpdA 15990 15160 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ1 protein_id gnl|my_center|LOCUS_20480 16280 17182 gene locus_tag LOCUS_20490 16280 17182 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 protein_id gnl|my_center|LOCUS_20490 17179 17694 gene locus_tag LOCUS_20500 17179 17694 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 protein_id gnl|my_center|LOCUS_20500 17700 19631 gene locus_tag LOCUS_20510 17700 19631 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_20510 19643 20797 gene locus_tag LOCUS_20520 19643 20797 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886254.1 protein_id gnl|my_center|LOCUS_20520 20922 20997 gene locus_tag LOCUS_t00260 20922 20997 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22664 21570 gene locus_tag LOCUS_20530 22664 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 22990 23943 gene locus_tag LOCUS_20540 22990 23943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 23940 24608 gene locus_tag LOCUS_20550 23940 24608 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727426.1 protein_id gnl|my_center|LOCUS_20550 24709 25275 gene locus_tag LOCUS_20560 24709 25275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 25311 26171 gene locus_tag LOCUS_20570 25311 26171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20570 26220 27155 gene locus_tag LOCUS_20580 26220 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20580 27580 27176 gene locus_tag LOCUS_20590 27580 27176 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918483.1 protein_id gnl|my_center|LOCUS_20590 32936 27792 gene locus_tag LOCUS_20600 32936 27792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 33232 34098 gene locus_tag LOCUS_20610 gene phnC2 33232 34098 CDS product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL7 protein_id gnl|my_center|LOCUS_20610 34172 35194 gene locus_tag LOCUS_20620 34172 35194 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_20620 35273 36088 gene locus_tag LOCUS_20630 gene phnE 35273 36088 CDS product phosphonate transporter PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_20630 36256 36588 gene locus_tag LOCUS_20640 36256 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 37794 36655 gene locus_tag LOCUS_20650 37794 36655 CDS product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_20650 38710 37973 gene locus_tag LOCUS_20660 38710 37973 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 protein_id gnl|my_center|LOCUS_20660 38948 39451 gene locus_tag LOCUS_20670 38948 39451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 protein_id gnl|my_center|LOCUS_20670 39448 40071 gene locus_tag LOCUS_20680 gene phnH 39448 40071 CDS product carbon-phosphorus lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084040.1 protein_id gnl|my_center|LOCUS_20680 40074 41174 gene locus_tag LOCUS_20690 gene phnI 40074 41174 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084041.1 protein_id gnl|my_center|LOCUS_20690 41171 42046 gene locus_tag LOCUS_20700 41171 42046 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYM4 protein_id gnl|my_center|LOCUS_20700 42046 42837 gene locus_tag LOCUS_20710 gene phnK 42046 42837 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003524419.1 protein_id gnl|my_center|LOCUS_20710 42846 43553 gene locus_tag LOCUS_20720 42846 43553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098702.1 protein_id gnl|my_center|LOCUS_20720 43572 44285 gene locus_tag LOCUS_20730 43572 44285 CDS product phosphonate metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337861.1 protein_id gnl|my_center|LOCUS_20730 44663 45652 gene locus_tag LOCUS_20740 44663 45652 CDS product tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088775.1 protein_id gnl|my_center|LOCUS_20740 45732 46196 gene locus_tag LOCUS_20750 45732 46196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 46332 47849 gene locus_tag LOCUS_20760 46332 47849 CDS product tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088773.1 protein_id gnl|my_center|LOCUS_20760 48054 48782 gene locus_tag LOCUS_20770 48054 48782 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085942.1 protein_id gnl|my_center|LOCUS_20770 48870 50609 gene locus_tag LOCUS_20780 gene oxc 48870 50609 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085941.1 protein_id gnl|my_center|LOCUS_20780 50650 51894 gene locus_tag LOCUS_20790 gene frc 50650 51894 CDS product formyl-CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QH2 protein_id gnl|my_center|LOCUS_20790 51942 52865 gene locus_tag LOCUS_20800 gene fmt 51942 52865 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK24 protein_id gnl|my_center|LOCUS_20800 52941 54614 gene locus_tag LOCUS_20810 gene fhs 52941 54614 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_20810 54693 55547 gene locus_tag LOCUS_20820 54693 55547 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_20820 55745 56518 gene locus_tag LOCUS_20830 55745 56518 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085930.1 protein_id gnl|my_center|LOCUS_20830 56615 57634 gene locus_tag LOCUS_20840 56615 57634 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEJ2 protein_id gnl|my_center|LOCUS_20840 57760 58512 gene locus_tag LOCUS_20850 57760 58512 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_20850 58602 58874 gene locus_tag LOCUS_20860 58602 58874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 58924 59232 gene locus_tag LOCUS_20870 58924 59232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 60243 59251 gene locus_tag LOCUS_20880 gene ilvA 60243 59251 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229835.1 protein_id gnl|my_center|LOCUS_20880 61621 60302 gene locus_tag LOCUS_20890 61621 60302 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_20890 65392 61778 gene locus_tag LOCUS_20900 gene oplaH 65392 61778 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 protein_id gnl|my_center|LOCUS_20900 65513 66556 gene locus_tag LOCUS_20910 65513 66556 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085957.1 protein_id gnl|my_center|LOCUS_20910 67699 66572 gene locus_tag LOCUS_20920 67699 66572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_20920 67816 68769 gene locus_tag LOCUS_20930 67816 68769 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087056.1 protein_id gnl|my_center|LOCUS_20930 68843 69547 gene locus_tag LOCUS_20940 68843 69547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 69618 70376 gene locus_tag LOCUS_20950 69618 70376 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_20950 70424 71125 gene locus_tag LOCUS_20960 70424 71125 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence21 <1 1108 gene locus_tag LOCUS_20970 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525002.1:cytochrome c oxidase, cbb3-type subunit I 1132 1857 gene locus_tag LOCUS_20980 gene fixO 1132 1857 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085549.1 protein_id gnl|my_center|LOCUS_20980 1870 2034 gene locus_tag LOCUS_20990 1870 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2037 2909 gene locus_tag LOCUS_21000 gene fixP 2037 2909 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIY8 protein_id gnl|my_center|LOCUS_21000 2967 4469 gene locus_tag LOCUS_21010 2967 4469 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524998.1 protein_id gnl|my_center|LOCUS_21010 4466 4978 gene locus_tag LOCUS_21020 gene fixH 4466 4978 CDS product nitrogen fixation protein FixH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085553.1 protein_id gnl|my_center|LOCUS_21020 4975 7173 gene locus_tag LOCUS_21030 4975 7173 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_21030 7184 7366 gene locus_tag LOCUS_21040 7184 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7489 8187 gene locus_tag LOCUS_21050 7489 8187 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640231.1 protein_id gnl|my_center|LOCUS_21050 9275 8268 gene locus_tag LOCUS_21060 9275 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_21060 9728 9282 gene locus_tag LOCUS_21070 9728 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 10921 9725 gene locus_tag LOCUS_21080 10921 9725 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A766 protein_id gnl|my_center|LOCUS_21080 11979 10936 gene locus_tag LOCUS_21090 11979 10936 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_21090 12605 11991 gene locus_tag LOCUS_21100 12605 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 13313 12693 gene locus_tag LOCUS_21110 13313 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 13446 13913 gene locus_tag LOCUS_21120 13446 13913 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388720.1 protein_id gnl|my_center|LOCUS_21120 13924 14724 gene locus_tag LOCUS_21130 13924 14724 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_21130 14739 17099 gene locus_tag LOCUS_21140 14739 17099 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 protein_id gnl|my_center|LOCUS_21140 17343 18683 gene locus_tag LOCUS_21150 17343 18683 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974558.1 protein_id gnl|my_center|LOCUS_21150 19077 18739 gene locus_tag LOCUS_21160 19077 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_21160 19142 19921 gene locus_tag LOCUS_21170 19142 19921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_21170 20435 20058 gene locus_tag LOCUS_21180 20435 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_21180 20353 20547 gene locus_tag LOCUS_21190 20353 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 20623 22884 gene locus_tag LOCUS_21200 20623 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 22967 24688 gene locus_tag LOCUS_21210 gene glnS 22967 24688 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR6 protein_id gnl|my_center|LOCUS_21210 24696 25379 gene locus_tag LOCUS_21220 24696 25379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 25405 25992 gene locus_tag LOCUS_21230 25405 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190386.1 protein_id gnl|my_center|LOCUS_21230 26062 26916 gene locus_tag LOCUS_21240 26062 26916 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_21240 26930 28144 gene locus_tag LOCUS_21250 26930 28144 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038924.1 protein_id gnl|my_center|LOCUS_21250 28163 29020 gene locus_tag LOCUS_21260 28163 29020 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083250.1 protein_id gnl|my_center|LOCUS_21260 29695 29027 gene locus_tag LOCUS_21270 29695 29027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 30607 29711 gene locus_tag LOCUS_21280 30607 29711 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064624.1 protein_id gnl|my_center|LOCUS_21280 30721 31836 gene locus_tag LOCUS_21290 30721 31836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 33529 31859 gene locus_tag LOCUS_21300 33529 31859 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064121.1 protein_id gnl|my_center|LOCUS_21300 35024 33609 gene locus_tag LOCUS_21310 35024 33609 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 protein_id gnl|my_center|LOCUS_21310 35344 35021 gene locus_tag LOCUS_21320 35344 35021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040456.1 protein_id gnl|my_center|LOCUS_21320 36437 35334 gene locus_tag LOCUS_21330 36437 35334 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089928.1 protein_id gnl|my_center|LOCUS_21330 37542 36487 gene locus_tag LOCUS_21340 37542 36487 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056814.1 protein_id gnl|my_center|LOCUS_21340 38606 37542 gene locus_tag LOCUS_21350 38606 37542 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057276.1 protein_id gnl|my_center|LOCUS_21350 39639 38644 gene locus_tag LOCUS_21360 39639 38644 CDS product 4,5-dihydroxyphthalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_21360 39716 40156 gene locus_tag LOCUS_21370 39716 40156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_21370 41662 40160 gene locus_tag LOCUS_21380 41662 40160 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387976.1 protein_id gnl|my_center|LOCUS_21380 42498 41695 gene locus_tag LOCUS_21390 42498 41695 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810895.1 protein_id gnl|my_center|LOCUS_21390 42597 43325 gene locus_tag LOCUS_21400 42597 43325 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_21400 43568 43732 gene locus_tag LOCUS_21410 43568 43732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 44040 44339 gene locus_tag LOCUS_21420 44040 44339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 45617 44457 gene locus_tag LOCUS_21430 gene citB 45617 44457 CDS product citrate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065186.1 protein_id gnl|my_center|LOCUS_21430 46956 45604 gene locus_tag LOCUS_21440 46956 45604 CDS product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085108.1 protein_id gnl|my_center|LOCUS_21440 48764 47046 gene locus_tag LOCUS_21450 48764 47046 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_21450 49294 48830 gene locus_tag LOCUS_21460 49294 48830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 49528 51810 gene locus_tag LOCUS_21470 49528 51810 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939285.1 protein_id gnl|my_center|LOCUS_21470 51944 51870 gene locus_tag LOCUS_t00270 51944 51870 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 52116 53090 gene locus_tag LOCUS_21480 52116 53090 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390300.1 protein_id gnl|my_center|LOCUS_21480 53112 53651 gene locus_tag LOCUS_21490 53112 53651 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929688.1 protein_id gnl|my_center|LOCUS_21490 54104 54973 gene locus_tag LOCUS_21500 54104 54973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 55452 55039 gene locus_tag LOCUS_21510 55452 55039 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087335.1 protein_id gnl|my_center|LOCUS_21510 55681 56517 gene locus_tag LOCUS_21520 55681 56517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 57165 56527 gene locus_tag LOCUS_21530 57165 56527 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974773.1 protein_id gnl|my_center|LOCUS_21530 58248 57235 gene locus_tag LOCUS_21540 gene acdS 58248 57235 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XR6 protein_id gnl|my_center|LOCUS_21540 58387 58866 gene locus_tag LOCUS_21550 58387 58866 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083072.1 protein_id gnl|my_center|LOCUS_21550 60157 58940 gene locus_tag LOCUS_21560 60157 58940 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390303.1 protein_id gnl|my_center|LOCUS_21560 61050 60160 gene locus_tag LOCUS_21570 61050 60160 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_21570 62234 61074 gene locus_tag LOCUS_21580 62234 61074 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_21580 62376 63329 gene locus_tag LOCUS_21590 62376 63329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 63451 65193 gene locus_tag LOCUS_21600 63451 65193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 65599 65273 gene locus_tag LOCUS_21610 65599 65273 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967294.1 protein_id gnl|my_center|LOCUS_21610 65826 65596 gene locus_tag LOCUS_21620 65826 65596 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706289.1 protein_id gnl|my_center|LOCUS_21620 66019 66960 gene locus_tag LOCUS_21630 66019 66960 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188126.1 protein_id gnl|my_center|LOCUS_21630 67042 67581 gene locus_tag LOCUS_21640 gene pecS 67042 67581 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970782.1 protein_id gnl|my_center|LOCUS_21640 67578 68132 gene locus_tag LOCUS_21650 67578 68132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence22 3010 1955 gene locus_tag LOCUS_21660 3010 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4138 3152 gene locus_tag LOCUS_21670 gene miaA 4138 3152 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX74 protein_id gnl|my_center|LOCUS_21670 4183 5085 gene locus_tag LOCUS_21680 4183 5085 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_21680 6676 5153 gene locus_tag LOCUS_21690 6676 5153 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_21690 7100 6915 gene locus_tag LOCUS_21700 7100 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_21700 8029 7148 gene locus_tag LOCUS_21710 8029 7148 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_21710 9000 8026 gene locus_tag LOCUS_21720 9000 8026 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_21720 9370 10521 gene locus_tag LOCUS_21730 9370 10521 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGX2 protein_id gnl|my_center|LOCUS_21730 10943 10533 gene locus_tag LOCUS_21740 10943 10533 CDS product MxaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140838.1 protein_id gnl|my_center|LOCUS_21740 11504 10968 gene locus_tag LOCUS_21750 gene folA 11504 10968 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEC3 protein_id gnl|my_center|LOCUS_21750 11799 12338 gene locus_tag LOCUS_21760 11799 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 13138 12344 gene locus_tag LOCUS_21770 gene thyA 13138 12344 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NQ5 protein_id gnl|my_center|LOCUS_21770 13281 14336 gene locus_tag LOCUS_21780 gene mdh 13281 14336 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709102.1 protein_id gnl|my_center|LOCUS_21780 14772 15269 gene locus_tag LOCUS_21790 14772 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 protein_id gnl|my_center|LOCUS_21790 15345 16970 gene locus_tag LOCUS_21800 15345 16970 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_21800 17004 18407 gene locus_tag LOCUS_21810 gene fumC 17004 18407 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9T7 protein_id gnl|my_center|LOCUS_21810 18404 19141 gene locus_tag LOCUS_21820 18404 19141 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_21820 19138 19584 gene locus_tag LOCUS_21830 19138 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 19581 20210 gene locus_tag LOCUS_21840 19581 20210 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_21840 20224 20640 gene locus_tag LOCUS_21850 20224 20640 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_21850 21122 20637 gene locus_tag LOCUS_21860 21122 20637 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530129.1 protein_id gnl|my_center|LOCUS_21860 21846 21211 gene locus_tag LOCUS_21870 21846 21211 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919946.1 protein_id gnl|my_center|LOCUS_21870 21940 22089 gene locus_tag LOCUS_21880 21940 22089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 22086 22334 gene locus_tag LOCUS_21890 22086 22334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 22525 22331 gene locus_tag LOCUS_21900 22525 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 23733 22522 gene locus_tag LOCUS_21910 23733 22522 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389898.1 protein_id gnl|my_center|LOCUS_21910 27330 23785 gene locus_tag LOCUS_21920 27330 23785 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389864.1 protein_id gnl|my_center|LOCUS_21920 30156 27436 gene locus_tag LOCUS_21930 30156 27436 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967604.1 protein_id gnl|my_center|LOCUS_21930 31485 30220 gene locus_tag LOCUS_21940 31485 30220 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_21940 31665 32675 gene locus_tag LOCUS_21950 31665 32675 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975246.1 protein_id gnl|my_center|LOCUS_21950 32675 33919 gene locus_tag LOCUS_21960 32675 33919 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_21960 33916 34620 gene locus_tag LOCUS_21970 33916 34620 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975248.1 protein_id gnl|my_center|LOCUS_21970 35991 34636 gene locus_tag LOCUS_21980 35991 34636 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_21980 36612 36052 gene locus_tag LOCUS_21990 36612 36052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090279.1 protein_id gnl|my_center|LOCUS_21990 37253 36672 gene locus_tag LOCUS_22000 37253 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 38759 37458 gene locus_tag LOCUS_22010 38759 37458 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGS6 protein_id gnl|my_center|LOCUS_22010 40004 38778 gene locus_tag LOCUS_22020 40004 38778 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_22020 41503 40016 gene locus_tag LOCUS_22030 41503 40016 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_22030 42489 41605 gene locus_tag LOCUS_22040 42489 41605 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888107.1 protein_id gnl|my_center|LOCUS_22040 43406 42612 gene locus_tag LOCUS_22050 43406 42612 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLG7 protein_id gnl|my_center|LOCUS_22050 45344 43521 gene locus_tag LOCUS_22060 gene gcl 45344 43521 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085950.1 protein_id gnl|my_center|LOCUS_22060 46407 45580 gene locus_tag LOCUS_22070 46407 45580 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 protein_id gnl|my_center|LOCUS_22070 47347 46523 gene locus_tag LOCUS_22080 47347 46523 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_22080 47541 48758 gene locus_tag LOCUS_22090 47541 48758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 49290 50219 gene locus_tag LOCUS_22100 49290 50219 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_22100 50224 51369 gene locus_tag LOCUS_22110 50224 51369 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_22110 51779 51396 gene locus_tag LOCUS_22120 51779 51396 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_22120 52002 57299 gene locus_tag LOCUS_22130 52002 57299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 57406 58302 gene locus_tag LOCUS_22140 57406 58302 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_22140 59439 58318 gene locus_tag LOCUS_22150 59439 58318 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705945.1 protein_id gnl|my_center|LOCUS_22150 59831 61096 gene locus_tag LOCUS_22160 59831 61096 CDS product agglutination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence23 1014 232 gene locus_tag LOCUS_22170 1014 232 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_22170 1238 2263 gene locus_tag LOCUS_22180 1238 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_22180 2275 3708 gene locus_tag LOCUS_22190 gene prpD 2275 3708 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_22190 3791 4117 gene locus_tag LOCUS_22200 3791 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5566 4121 gene locus_tag LOCUS_22210 5566 4121 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_22210 6323 5622 gene locus_tag LOCUS_22220 gene purQ 6323 5622 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFC6 protein_id gnl|my_center|LOCUS_22220 6579 6334 gene locus_tag LOCUS_22230 gene purS 6579 6334 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI1 protein_id gnl|my_center|LOCUS_22230 7348 6581 gene locus_tag LOCUS_22240 gene purC 7348 6581 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI0 protein_id gnl|my_center|LOCUS_22240 8229 7471 gene locus_tag LOCUS_22250 8229 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_22250 8371 8694 gene locus_tag LOCUS_22260 8371 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_22260 8997 8722 gene locus_tag LOCUS_22270 8997 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 10407 9016 gene locus_tag LOCUS_22280 10407 9016 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFB8 protein_id gnl|my_center|LOCUS_22280 10545 11561 gene locus_tag LOCUS_22290 10545 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 11919 11572 gene locus_tag LOCUS_22300 11919 11572 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065119.1 protein_id gnl|my_center|LOCUS_22300 12245 11916 gene locus_tag LOCUS_22310 12245 11916 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707131.1 protein_id gnl|my_center|LOCUS_22310 12386 13753 gene locus_tag LOCUS_22320 12386 13753 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807718.1 protein_id gnl|my_center|LOCUS_22320 13825 14316 gene locus_tag LOCUS_22330 13825 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 14759 14322 gene locus_tag LOCUS_22340 14759 14322 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 protein_id gnl|my_center|LOCUS_22340 14920 18165 gene locus_tag LOCUS_22350 gene putA 14920 18165 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G7 protein_id gnl|my_center|LOCUS_22350 18823 18179 gene locus_tag LOCUS_22360 18823 18179 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 protein_id gnl|my_center|LOCUS_22360 20057 18852 gene locus_tag LOCUS_22370 20057 18852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_22370 20161 21411 gene locus_tag LOCUS_22380 20161 21411 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887328.1 protein_id gnl|my_center|LOCUS_22380 21493 22038 gene locus_tag LOCUS_22390 21493 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 23210 22035 gene locus_tag LOCUS_22400 23210 22035 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088493.1 protein_id gnl|my_center|LOCUS_22400 24015 23293 gene locus_tag LOCUS_22410 24015 23293 CDS product UPF0758 protein R01728 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PL6 protein_id gnl|my_center|LOCUS_22410 24851 24030 gene locus_tag LOCUS_22420 gene map 24851 24030 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_22420 25672 24965 gene locus_tag LOCUS_22430 gene sfsA 25672 24965 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF6 protein_id gnl|my_center|LOCUS_22430 25917 28193 gene locus_tag LOCUS_22440 25917 28193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 29142 28207 gene locus_tag LOCUS_22450 29142 28207 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_22450 29185 29985 gene locus_tag LOCUS_22460 29185 29985 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_22460 30050 30334 gene locus_tag LOCUS_22470 gene grxC 30050 30334 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164717.1 protein_id gnl|my_center|LOCUS_22470 30343 31185 gene locus_tag LOCUS_22480 30343 31185 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_22480 31295 32356 gene locus_tag LOCUS_22490 31295 32356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_22490 32952 32407 gene locus_tag LOCUS_22500 32952 32407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 32873 33121 gene locus_tag LOCUS_22510 32873 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 34027 33137 gene locus_tag LOCUS_22520 gene tfdA 34027 33137 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_22520 34178 35074 gene locus_tag LOCUS_22530 gene nocR 34178 35074 CDS product regulatory protein NocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00678 protein_id gnl|my_center|LOCUS_22530 35701 35090 gene locus_tag LOCUS_22540 35701 35090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_22540 35870 36304 gene locus_tag LOCUS_22550 35870 36304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_22550 37206 36328 gene locus_tag LOCUS_22560 37206 36328 CDS product tartronate semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_22560 38887 37373 gene locus_tag LOCUS_22570 38887 37373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 39745 38972 gene locus_tag LOCUS_22580 gene ubiG 39745 38972 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAL7 protein_id gnl|my_center|LOCUS_22580 39898 41118 gene locus_tag LOCUS_22590 39898 41118 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_22590 41283 43643 gene locus_tag LOCUS_22600 41283 43643 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_22600 43862 45166 gene locus_tag LOCUS_22610 43862 45166 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388504.1 protein_id gnl|my_center|LOCUS_22610 46814 45177 gene locus_tag LOCUS_22620 46814 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 47017 48306 gene locus_tag LOCUS_22630 gene ispG 47017 48306 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VV9 protein_id gnl|my_center|LOCUS_22630 48318 49562 gene locus_tag LOCUS_22640 gene hisS 48318 49562 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_22640 49575 50876 gene locus_tag LOCUS_22650 gene hemA 49575 50876 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE2 protein_id gnl|my_center|LOCUS_22650 50877 51947 gene locus_tag LOCUS_22660 gene prfA 50877 51947 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_22660 52016 52876 gene locus_tag LOCUS_22670 gene prmC 52016 52876 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE0 protein_id gnl|my_center|LOCUS_22670 53180 53824 gene locus_tag LOCUS_22680 53180 53824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 54636 53872 gene locus_tag LOCUS_22690 54636 53872 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_22690 54874 57468 gene locus_tag LOCUS_22700 gene clpB 54874 57468 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWD8 protein_id gnl|my_center|LOCUS_22700 57468 58214 gene locus_tag LOCUS_22710 57468 58214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 58293 59129 gene locus_tag LOCUS_22720 58293 59129 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE0 protein_id gnl|my_center|LOCUS_22720 59129 59509 gene locus_tag LOCUS_22730 59129 59509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 59827 59516 gene locus_tag LOCUS_22740 59827 59516 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707132.1 protein_id gnl|my_center|LOCUS_22740 60639 59854 gene locus_tag LOCUS_22750 60639 59854 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_22750 62133 60679 gene locus_tag LOCUS_22760 62133 60679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence24 655 1476 gene locus_tag LOCUS_22770 655 1476 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 protein_id gnl|my_center|LOCUS_22770 1550 2935 gene locus_tag LOCUS_22780 1550 2935 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE1 protein_id gnl|my_center|LOCUS_22780 3148 4128 gene locus_tag LOCUS_22790 3148 4128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_22790 4121 4855 gene locus_tag LOCUS_22800 4121 4855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_22800 4874 6784 gene locus_tag LOCUS_22810 4874 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_22810 6801 7874 gene locus_tag LOCUS_22820 6801 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 8018 9778 gene locus_tag LOCUS_22830 8018 9778 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_22830 10022 9783 gene locus_tag LOCUS_22840 10022 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214913.1 protein_id gnl|my_center|LOCUS_22840 12049 10148 gene locus_tag LOCUS_22850 12049 10148 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391207.1 protein_id gnl|my_center|LOCUS_22850 12254 13108 gene locus_tag LOCUS_22860 12254 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 14571 13117 gene locus_tag LOCUS_22870 14571 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_22870 15131 14793 gene locus_tag LOCUS_22880 15131 14793 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH6 protein_id gnl|my_center|LOCUS_22880 16332 15178 gene locus_tag LOCUS_22890 16332 15178 CDS product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 protein_id gnl|my_center|LOCUS_22890 16532 16329 gene locus_tag LOCUS_22900 16532 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 16447 17133 gene locus_tag LOCUS_22910 16447 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 17752 17144 gene locus_tag LOCUS_22920 17752 17144 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_22920 17779 18615 gene locus_tag LOCUS_22930 17779 18615 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_22930 18776 19972 gene locus_tag LOCUS_22940 gene argD 18776 19972 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP73 protein_id gnl|my_center|LOCUS_22940 19969 20886 gene locus_tag LOCUS_22950 gene argF 19969 20886 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP74 protein_id gnl|my_center|LOCUS_22950 20920 21711 gene locus_tag LOCUS_22960 20920 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 21704 22612 gene locus_tag LOCUS_22970 21704 22612 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP75 protein_id gnl|my_center|LOCUS_22970 22728 23324 gene locus_tag LOCUS_22980 22728 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 23379 23969 gene locus_tag LOCUS_22990 23379 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 24111 24374 gene locus_tag LOCUS_23000 24111 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 24374 24994 gene locus_tag LOCUS_23010 24374 24994 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920760.1 protein_id gnl|my_center|LOCUS_23010 24991 25518 gene locus_tag LOCUS_23020 24991 25518 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920759.1 protein_id gnl|my_center|LOCUS_23020 26238 25531 gene locus_tag LOCUS_23030 26238 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085977.1 protein_id gnl|my_center|LOCUS_23030 27438 26422 gene locus_tag LOCUS_23040 27438 26422 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_23040 28335 27499 gene locus_tag LOCUS_23050 gene tauC 28335 27499 CDS product taurine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_23050 29651 28353 gene locus_tag LOCUS_23060 29651 28353 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405503.1 protein_id gnl|my_center|LOCUS_23060 31391 29943 gene locus_tag LOCUS_23070 31391 29943 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_23070 32105 31476 gene locus_tag LOCUS_23080 gene folE 32105 31476 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_23080 32552 32142 gene locus_tag LOCUS_23090 gene apaG 32552 32142 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS7 protein_id gnl|my_center|LOCUS_23090 32824 34851 gene locus_tag LOCUS_23100 gene fusA 32824 34851 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140130.1 protein_id gnl|my_center|LOCUS_23100 36109 35219 gene locus_tag LOCUS_23110 36109 35219 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_23110 37156 36176 gene locus_tag LOCUS_23120 37156 36176 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQA0 protein_id gnl|my_center|LOCUS_23120 37366 37860 gene locus_tag LOCUS_23130 37366 37860 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_23130 38720 37878 gene locus_tag LOCUS_23140 38720 37878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 40255 38717 gene locus_tag LOCUS_23150 40255 38717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 41522 40320 gene locus_tag LOCUS_23160 gene aatA 41522 40320 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090151.1 protein_id gnl|my_center|LOCUS_23160 43019 41718 gene locus_tag LOCUS_23170 43019 41718 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_23170 43908 43072 gene locus_tag LOCUS_23180 43908 43072 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 protein_id gnl|my_center|LOCUS_23180 44271 46274 gene locus_tag LOCUS_23190 44271 46274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 46463 48826 gene locus_tag LOCUS_23200 46463 48826 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_23200 48868 49446 gene locus_tag LOCUS_23210 48868 49446 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_23210 49535 50887 gene locus_tag LOCUS_23220 gene pcaB 49535 50887 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_23220 50931 53117 gene locus_tag LOCUS_23230 gene uvrB 50931 53117 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB1 protein_id gnl|my_center|LOCUS_23230 53334 53125 gene locus_tag LOCUS_23240 53334 53125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 53596 53402 gene locus_tag LOCUS_23250 53596 53402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 54075 53593 gene locus_tag LOCUS_23260 gene sixA 54075 53593 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957380.1 protein_id gnl|my_center|LOCUS_23260 56336 54174 gene locus_tag LOCUS_23270 56336 54174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 57665 56595 gene locus_tag LOCUS_23280 57665 56595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 57907 59589 gene locus_tag LOCUS_23290 57907 59589 CDS product polypeptide-transport-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067718.1 protein_id gnl|my_center|LOCUS_23290 60067 59666 gene locus_tag LOCUS_23300 gene atpC 60067 59666 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_23300 <60818 60099 gene locus_tag LOCUS_23310 <60818 60099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV18:ATP synthase subunit beta >Feature sequence25 2335 1118 gene locus_tag LOCUS_23320 2335 1118 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_23320 4049 2523 gene locus_tag LOCUS_23330 4049 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 5852 4134 gene locus_tag LOCUS_23340 5852 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 8020 6650 gene locus_tag LOCUS_23350 8020 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 8334 8516 gene locus_tag LOCUS_23360 gene pilA1 8334 8516 CDS product PilA pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709934.1 protein_id gnl|my_center|LOCUS_23360 8812 9339 gene locus_tag LOCUS_23370 8812 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 9349 10341 gene locus_tag LOCUS_23380 gene cpaB 9349 10341 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920783.1 protein_id gnl|my_center|LOCUS_23380 10350 11846 gene locus_tag LOCUS_23390 gene rhcC2 10350 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084648.1 protein_id gnl|my_center|LOCUS_23390 11872 12774 gene locus_tag LOCUS_23400 11872 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 12771 14000 gene locus_tag LOCUS_23410 12771 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 14011 15669 gene locus_tag LOCUS_23420 14011 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 15678 16649 gene locus_tag LOCUS_23430 15678 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 16646 17626 gene locus_tag LOCUS_23440 16646 17626 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067559.1 protein_id gnl|my_center|LOCUS_23440 18576 17770 gene locus_tag LOCUS_23450 18576 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533677.1 protein_id gnl|my_center|LOCUS_23450 18524 18703 gene locus_tag LOCUS_23460 18524 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 18745 19197 gene locus_tag LOCUS_23470 18745 19197 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388478.1 protein_id gnl|my_center|LOCUS_23470 19896 19219 gene locus_tag LOCUS_23480 19896 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 21141 19918 gene locus_tag LOCUS_23490 21141 19918 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_23490 22036 21278 gene locus_tag LOCUS_23500 22036 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 22252 22821 gene locus_tag LOCUS_23510 22252 22821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 22856 23704 gene locus_tag LOCUS_23520 22856 23704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_23520 23872 24300 gene locus_tag LOCUS_23530 23872 24300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 24354 25064 gene locus_tag LOCUS_23540 24354 25064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 25289 26527 gene locus_tag LOCUS_23550 25289 26527 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_23550 26684 27586 gene locus_tag LOCUS_23560 26684 27586 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_23560 27629 28660 gene locus_tag LOCUS_23570 27629 28660 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085708.1 protein_id gnl|my_center|LOCUS_23570 28657 29406 gene locus_tag LOCUS_23580 28657 29406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869436.1 protein_id gnl|my_center|LOCUS_23580 29409 30314 gene locus_tag LOCUS_23590 29409 30314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_23590 30395 30844 gene locus_tag LOCUS_23600 30395 30844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 32802 31090 gene locus_tag LOCUS_23610 gene ilvD 32802 31090 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_23610 33248 32835 gene locus_tag LOCUS_23620 33248 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 33386 34837 gene locus_tag LOCUS_23630 33386 34837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391137.1 protein_id gnl|my_center|LOCUS_23630 34854 35798 gene locus_tag LOCUS_23640 34854 35798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_23640 35806 36609 gene locus_tag LOCUS_23650 35806 36609 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 protein_id gnl|my_center|LOCUS_23650 38320 36614 gene locus_tag LOCUS_23660 38320 36614 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_23660 38579 38304 gene locus_tag LOCUS_23670 38579 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 40156 38582 gene locus_tag LOCUS_23680 40156 38582 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_23680 41691 40153 gene locus_tag LOCUS_23690 41691 40153 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_23690 42119 41688 gene locus_tag LOCUS_23700 42119 41688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 42548 42123 gene locus_tag LOCUS_23710 42548 42123 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_23710 43105 42545 gene locus_tag LOCUS_23720 43105 42545 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_23720 43485 43129 gene locus_tag LOCUS_23730 43485 43129 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_23730 43784 43488 gene locus_tag LOCUS_23740 43784 43488 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_23740 44277 43789 gene locus_tag LOCUS_23750 44277 43789 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_23750 44566 45006 gene locus_tag LOCUS_23760 44566 45006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_23760 45054 45130 gene locus_tag LOCUS_t00280 45054 45130 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45262 45570 gene locus_tag LOCUS_23770 45262 45570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 45616 45692 gene locus_tag LOCUS_t00290 45616 45692 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45792 46151 gene locus_tag LOCUS_23780 45792 46151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140494.1 protein_id gnl|my_center|LOCUS_23780 46148 46513 gene locus_tag LOCUS_23790 46148 46513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 46886 46599 gene locus_tag LOCUS_23800 46886 46599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 47687 47031 gene locus_tag LOCUS_23810 gene msrA1 47687 47031 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9I6 protein_id gnl|my_center|LOCUS_23810 47835 47993 gene locus_tag LOCUS_23820 47835 47993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 48042 48680 gene locus_tag LOCUS_23830 48042 48680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 49306 48971 gene locus_tag LOCUS_23840 49306 48971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 49362 50294 gene locus_tag LOCUS_23850 49362 50294 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_23850 50942 50307 gene locus_tag LOCUS_23860 50942 50307 CDS product UPF0056 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRY9 protein_id gnl|my_center|LOCUS_23860 51605 51003 gene locus_tag LOCUS_23870 51605 51003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_23870 52769 51642 gene locus_tag LOCUS_23880 52769 51642 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_23880 53157 52753 gene locus_tag LOCUS_23890 gene hisI 53157 52753 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_23890 54363 53173 gene locus_tag LOCUS_23900 54363 53173 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_23900 54612 55631 gene locus_tag LOCUS_23910 gene bztA 54612 55631 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_23910 55814 57022 gene locus_tag LOCUS_23920 55814 57022 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence26 1436 3349 gene locus_tag LOCUS_23930 1436 3349 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_23930 3493 4926 gene locus_tag LOCUS_23940 3493 4926 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_23940 4949 6244 gene locus_tag LOCUS_23950 4949 6244 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_23950 6952 6257 gene locus_tag LOCUS_23960 6952 6257 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087140.1 protein_id gnl|my_center|LOCUS_23960 7089 8300 gene locus_tag LOCUS_23970 7089 8300 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_23970 8297 9226 gene locus_tag LOCUS_23980 8297 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 9207 9992 gene locus_tag LOCUS_23990 gene yngF 9207 9992 CDS product putative enoyl-CoA hydratase/isomerase YngF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34893 protein_id gnl|my_center|LOCUS_23990 10676 10011 gene locus_tag LOCUS_24000 10676 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_24000 11820 10819 gene locus_tag LOCUS_24010 11820 10819 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_24010 11905 12093 gene locus_tag LOCUS_24020 11905 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 12346 12083 gene locus_tag LOCUS_24030 12346 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 12752 13204 gene locus_tag LOCUS_24040 12752 13204 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_24040 13201 13647 gene locus_tag LOCUS_24050 13201 13647 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_24050 14190 13735 gene locus_tag LOCUS_24060 14190 13735 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_24060 16283 14412 gene locus_tag LOCUS_24070 16283 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 16822 16595 gene locus_tag LOCUS_24080 gene rpmE 16822 16595 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 protein_id gnl|my_center|LOCUS_24080 16945 17268 gene locus_tag LOCUS_24090 gene cyaY 16945 17268 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDK5 protein_id gnl|my_center|LOCUS_24090 20865 17254 gene locus_tag LOCUS_24100 20865 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 22203 20983 gene locus_tag LOCUS_24110 22203 20983 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_24110 23470 22214 gene locus_tag LOCUS_24120 23470 22214 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_24120 24642 23536 gene locus_tag LOCUS_24130 24642 23536 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 protein_id gnl|my_center|LOCUS_24130 25681 24704 gene locus_tag LOCUS_24140 25681 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 26763 25960 gene locus_tag LOCUS_24150 26763 25960 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_24150 27405 26818 gene locus_tag LOCUS_24160 gene efp 27405 26818 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_24160 28133 27477 gene locus_tag LOCUS_24170 gene thiE 28133 27477 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_24170 28578 28126 gene locus_tag LOCUS_24180 28578 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 29507 28593 gene locus_tag LOCUS_24190 29507 28593 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW8 protein_id gnl|my_center|LOCUS_24190 29879 30076 gene locus_tag LOCUS_24200 29879 30076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 30089 30424 gene locus_tag LOCUS_24210 30089 30424 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 protein_id gnl|my_center|LOCUS_24210 30773 30540 gene locus_tag LOCUS_24220 30773 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 30810 31247 gene locus_tag LOCUS_24230 30810 31247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 31285 32112 gene locus_tag LOCUS_24240 31285 32112 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_24240 32280 33023 gene locus_tag LOCUS_24250 32280 33023 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_24250 33086 33595 gene locus_tag LOCUS_24260 gene ruvC 33086 33595 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 protein_id gnl|my_center|LOCUS_24260 33592 34248 gene locus_tag LOCUS_24270 gene ruvA 33592 34248 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF6 protein_id gnl|my_center|LOCUS_24270 34254 35309 gene locus_tag LOCUS_24280 gene ruvB 34254 35309 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 protein_id gnl|my_center|LOCUS_24280 35306 35749 gene locus_tag LOCUS_24290 35306 35749 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_24290 35810 36520 gene locus_tag LOCUS_24300 35810 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 36538 36996 gene locus_tag LOCUS_24310 36538 36996 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_24310 37007 37957 gene locus_tag LOCUS_24320 37007 37957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 37978 39354 gene locus_tag LOCUS_24330 gene tolB 37978 39354 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_24330 39574 40086 gene locus_tag LOCUS_24340 39574 40086 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_24340 40267 41391 gene locus_tag LOCUS_24350 40267 41391 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_24350 41452 42765 gene locus_tag LOCUS_24360 gene tilS 41452 42765 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE7 protein_id gnl|my_center|LOCUS_24360 42875 44812 gene locus_tag LOCUS_24370 gene ftsH 42875 44812 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE6 protein_id gnl|my_center|LOCUS_24370 44809 45660 gene locus_tag LOCUS_24380 44809 45660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 45698 47050 gene locus_tag LOCUS_24390 gene glmM 45698 47050 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L9 protein_id gnl|my_center|LOCUS_24390 47054 47869 gene locus_tag LOCUS_24400 47054 47869 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_24400 49336 47882 gene locus_tag LOCUS_24410 49336 47882 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969337.1 protein_id gnl|my_center|LOCUS_24410 49468 50442 gene locus_tag LOCUS_24420 49468 50442 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_24420 50495 51565 gene locus_tag LOCUS_24430 50495 51565 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_24430 51579 52049 gene locus_tag LOCUS_24440 51579 52049 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_24440 52294 53640 gene locus_tag LOCUS_24450 52294 53640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 54377 53649 gene locus_tag LOCUS_24460 54377 53649 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204423.1 protein_id gnl|my_center|LOCUS_24460 54471 55034 gene locus_tag LOCUS_24470 gene greB 54471 55034 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFI0 protein_id gnl|my_center|LOCUS_24470 56189 55047 gene locus_tag LOCUS_24480 56189 55047 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence27 327 1742 gene locus_tag LOCUS_24490 327 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24490 1739 2413 gene locus_tag LOCUS_24500 1739 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3171 2590 gene locus_tag LOCUS_24510 3171 2590 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_24510 3910 3215 gene locus_tag LOCUS_24520 3910 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4801 4025 gene locus_tag LOCUS_24530 4801 4025 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_24530 5349 4828 gene locus_tag LOCUS_24540 5349 4828 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763732.1 protein_id gnl|my_center|LOCUS_24540 5534 5932 gene locus_tag LOCUS_24550 5534 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 6015 7637 gene locus_tag LOCUS_24560 6015 7637 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067082.1 protein_id gnl|my_center|LOCUS_24560 7825 10776 gene locus_tag LOCUS_24570 7825 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 11426 10794 gene locus_tag LOCUS_24580 11426 10794 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 protein_id gnl|my_center|LOCUS_24580 13503 11494 gene locus_tag LOCUS_24590 13503 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 14254 13754 gene locus_tag LOCUS_24600 14254 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 14456 14259 gene locus_tag LOCUS_24610 14456 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 14900 14538 gene locus_tag LOCUS_24620 14900 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 15301 15116 gene locus_tag LOCUS_24630 15301 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 15542 17887 gene locus_tag LOCUS_24640 15542 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 18796 18101 gene locus_tag LOCUS_24650 18796 18101 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_24650 19203 20888 gene locus_tag LOCUS_24660 19203 20888 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 protein_id gnl|my_center|LOCUS_24660 21016 22209 gene locus_tag LOCUS_24670 21016 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 23165 22215 gene locus_tag LOCUS_24680 23165 22215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 24496 23201 gene locus_tag LOCUS_24690 24496 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_24690 25458 24493 gene locus_tag LOCUS_24700 25458 24493 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085595.1 protein_id gnl|my_center|LOCUS_24700 26107 25475 gene locus_tag LOCUS_24710 gene ugpQ 26107 25475 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 protein_id gnl|my_center|LOCUS_24710 26048 26332 gene locus_tag LOCUS_24720 26048 26332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 26325 28604 gene locus_tag LOCUS_24730 gene dme 26325 28604 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708222.1 protein_id gnl|my_center|LOCUS_24730 29055 28624 gene locus_tag LOCUS_24740 29055 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 29098 29409 gene locus_tag LOCUS_24750 29098 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 31758 29347 gene locus_tag LOCUS_24760 31758 29347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 32044 33873 gene locus_tag LOCUS_24770 32044 33873 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_24770 33887 34147 gene locus_tag LOCUS_24780 33887 34147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 34690 34151 gene locus_tag LOCUS_24790 34690 34151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 35678 34812 gene locus_tag LOCUS_24800 35678 34812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_24800 36955 35774 gene locus_tag LOCUS_24810 36955 35774 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812102.1 protein_id gnl|my_center|LOCUS_24810 37046 37795 gene locus_tag LOCUS_24820 37046 37795 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229037.1 protein_id gnl|my_center|LOCUS_24820 37908 38885 gene locus_tag LOCUS_24830 37908 38885 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 protein_id gnl|my_center|LOCUS_24830 38959 40467 gene locus_tag LOCUS_24840 38959 40467 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339266.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 40457 40930 gene locus_tag LOCUS_24850 40457 40930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 42027 40933 gene locus_tag LOCUS_24860 42027 40933 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_24860 42944 42096 gene locus_tag LOCUS_24870 gene phnE 42944 42096 CDS product phosphonate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_24870 43757 42954 gene locus_tag LOCUS_24880 43757 42954 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_24880 44547 43795 gene locus_tag LOCUS_24890 gene phnC 44547 43795 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_24890 45619 44678 gene locus_tag LOCUS_24900 gene phoD 45619 44678 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090669.1 protein_id gnl|my_center|LOCUS_24900 45935 46822 gene locus_tag LOCUS_24910 45935 46822 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114270.1 protein_id gnl|my_center|LOCUS_24910 48202 46826 gene locus_tag LOCUS_24920 48202 46826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_24920 49093 48251 gene locus_tag LOCUS_24930 49093 48251 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970341.1 protein_id gnl|my_center|LOCUS_24930 49261 50418 gene locus_tag LOCUS_24940 49261 50418 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 protein_id gnl|my_center|LOCUS_24940 50418 51212 gene locus_tag LOCUS_24950 gene fadB 50418 51212 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089105.1 protein_id gnl|my_center|LOCUS_24950 51242 52186 gene locus_tag LOCUS_24960 gene hmgCl 51242 52186 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence28 1833 715 gene locus_tag LOCUS_24970 1833 715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_24970 3736 1898 gene locus_tag LOCUS_24980 3736 1898 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_24980 4632 3841 gene locus_tag LOCUS_24990 4632 3841 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_24990 5183 4671 gene locus_tag LOCUS_25000 gene cycM 5183 4671 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ37 protein_id gnl|my_center|LOCUS_25000 5379 6236 gene locus_tag LOCUS_25010 5379 6236 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_25010 6242 6616 gene locus_tag LOCUS_25020 6242 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 6964 6626 gene locus_tag LOCUS_25030 6964 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088462.1 protein_id gnl|my_center|LOCUS_25030 7441 7046 gene locus_tag LOCUS_25040 7441 7046 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_25040 8157 7435 gene locus_tag LOCUS_25050 8157 7435 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_25050 9162 8230 gene locus_tag LOCUS_25060 9162 8230 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_25060 9479 11311 gene locus_tag LOCUS_25070 9479 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 12630 11332 gene locus_tag LOCUS_25080 12630 11332 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 protein_id gnl|my_center|LOCUS_25080 13542 12745 gene locus_tag LOCUS_25090 13542 12745 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686851.1 protein_id gnl|my_center|LOCUS_25090 13573 13971 gene locus_tag LOCUS_25100 13573 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 13989 14591 gene locus_tag LOCUS_25110 gene recR 13989 14591 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNN0 protein_id gnl|my_center|LOCUS_25110 15732 14608 gene locus_tag LOCUS_25120 15732 14608 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_25120 15842 17293 gene locus_tag LOCUS_25130 15842 17293 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_25130 18572 17298 gene locus_tag LOCUS_25140 18572 17298 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_25140 18701 19231 gene locus_tag LOCUS_25150 gene def 18701 19231 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP01 protein_id gnl|my_center|LOCUS_25150 19299 19580 gene locus_tag LOCUS_25160 19299 19580 CDS product killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_25160 19590 19868 gene locus_tag LOCUS_25170 19590 19868 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085795.1 protein_id gnl|my_center|LOCUS_25170 19868 20815 gene locus_tag LOCUS_25180 gene fmt 19868 20815 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP00 protein_id gnl|my_center|LOCUS_25180 21451 20816 gene locus_tag LOCUS_25190 21451 20816 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_25190 21516 21785 gene locus_tag LOCUS_25200 21516 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 21972 21793 gene locus_tag LOCUS_25210 21972 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 22246 22094 gene locus_tag LOCUS_25220 22246 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 22570 22361 gene locus_tag LOCUS_25230 gene cspA 22570 22361 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084262.1 protein_id gnl|my_center|LOCUS_25230 23864 22851 gene locus_tag LOCUS_25240 gene ywcH 23864 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_25240 24972 23902 gene locus_tag LOCUS_25250 24972 23902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_25250 26091 24994 gene locus_tag LOCUS_25260 26091 24994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_25260 26210 26995 gene locus_tag LOCUS_25270 gene truA 26210 26995 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF0 protein_id gnl|my_center|LOCUS_25270 27041 27367 gene locus_tag LOCUS_25280 27041 27367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 28543 27374 gene locus_tag LOCUS_25290 gene dapE 28543 27374 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF3 protein_id gnl|my_center|LOCUS_25290 29396 28551 gene locus_tag LOCUS_25300 gene dapD 29396 28551 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_25300 30203 29487 gene locus_tag LOCUS_25310 30203 29487 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_25310 30334 31623 gene locus_tag LOCUS_25320 30334 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 31981 31628 gene locus_tag LOCUS_25330 31981 31628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 33319 31985 gene locus_tag LOCUS_25340 33319 31985 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_25340 34227 33460 gene locus_tag LOCUS_25350 34227 33460 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066944.1 protein_id gnl|my_center|LOCUS_25350 34812 34285 gene locus_tag LOCUS_25360 gene rpoE4 34812 34285 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970227.1 protein_id gnl|my_center|LOCUS_25360 35812 34904 gene locus_tag LOCUS_25370 gene argB 35812 34904 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_25370 36550 35864 gene locus_tag LOCUS_25380 gene engB 36550 35864 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_25380 38354 36576 gene locus_tag LOCUS_25390 gene yidC 38354 36576 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_25390 38667 38362 gene locus_tag LOCUS_25400 38667 38362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 39094 38669 gene locus_tag LOCUS_25410 39094 38669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 39269 39135 gene locus_tag LOCUS_25420 39269 39135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 39508 40287 gene locus_tag LOCUS_25430 39508 40287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 40284 41720 gene locus_tag LOCUS_25440 gene merA1 40284 41720 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_25440 41741 43162 gene locus_tag LOCUS_25450 41741 43162 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970862.1 protein_id gnl|my_center|LOCUS_25450 43260 44048 gene locus_tag LOCUS_25460 gene tam 43260 44048 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085533.1 protein_id gnl|my_center|LOCUS_25460 46036 44054 gene locus_tag LOCUS_25470 46036 44054 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884115.1 protein_id gnl|my_center|LOCUS_25470 46150 46965 gene locus_tag LOCUS_25480 gene panB 46150 46965 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP30 protein_id gnl|my_center|LOCUS_25480 46970 47824 gene locus_tag LOCUS_25490 gene panC 46970 47824 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 protein_id gnl|my_center|LOCUS_25490 48364 47831 gene locus_tag LOCUS_25500 48364 47831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 49439 48432 gene locus_tag LOCUS_25510 49439 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 50809 49553 gene locus_tag LOCUS_25520 gene dadA 50809 49553 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_25520 <52105 50917 gene locus_tag LOCUS_25530 <52105 50917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083316.1:MFS transporter >Feature sequence29 134 523 gene locus_tag LOCUS_25540 134 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 532 1140 gene locus_tag LOCUS_25550 532 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1601 1137 gene locus_tag LOCUS_25560 gene mutT 1601 1137 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_25560 2949 1708 gene locus_tag LOCUS_25570 gene argJ 2949 1708 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_25570 3874 3032 gene locus_tag LOCUS_25580 3874 3032 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MJ0 protein_id gnl|my_center|LOCUS_25580 4119 6845 gene locus_tag LOCUS_25590 gene secA 4119 6845 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXV5 protein_id gnl|my_center|LOCUS_25590 6861 7052 gene locus_tag LOCUS_25600 6861 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 7575 7060 gene locus_tag LOCUS_25610 7575 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 8587 7631 gene locus_tag LOCUS_25620 gene accA 8587 7631 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_25620 8998 8648 gene locus_tag LOCUS_25630 8998 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 10795 9011 gene locus_tag LOCUS_25640 10795 9011 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_25640 11933 10956 gene locus_tag LOCUS_25650 11933 10956 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_25650 13411 12125 gene locus_tag LOCUS_25660 13411 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 13503 14480 gene locus_tag LOCUS_25670 13503 14480 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_25670 14900 16006 gene locus_tag LOCUS_25680 14900 16006 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_25680 16113 16688 gene locus_tag LOCUS_25690 16113 16688 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976073.1 protein_id gnl|my_center|LOCUS_25690 16774 18114 gene locus_tag LOCUS_25700 16774 18114 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_25700 18179 18388 gene locus_tag LOCUS_25710 18179 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 18426 19760 gene locus_tag LOCUS_25720 18426 19760 CDS product glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_25720 19897 20718 gene locus_tag LOCUS_25730 19897 20718 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090097.1 protein_id gnl|my_center|LOCUS_25730 20882 21655 gene locus_tag LOCUS_25740 20882 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 21881 22369 gene locus_tag LOCUS_25750 21881 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 22366 22638 gene locus_tag LOCUS_25760 22366 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 23542 22658 gene locus_tag LOCUS_25770 gene xerC 23542 22658 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW3 protein_id gnl|my_center|LOCUS_25770 25681 23603 gene locus_tag LOCUS_25780 25681 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 25802 25662 gene locus_tag LOCUS_25790 25802 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 26007 26549 gene locus_tag LOCUS_25800 gene aroK 26007 26549 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 protein_id gnl|my_center|LOCUS_25800 26546 27682 gene locus_tag LOCUS_25810 gene aroB 26546 27682 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_25810 27741 29018 gene locus_tag LOCUS_25820 27741 29018 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_25820 29169 29618 gene locus_tag LOCUS_25830 29169 29618 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_25830 29770 30339 gene locus_tag LOCUS_25840 29770 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_25840 30980 31558 gene locus_tag LOCUS_25850 30980 31558 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_25850 31650 32657 gene locus_tag LOCUS_25860 gene cobS 31650 32657 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083012.1 protein_id gnl|my_center|LOCUS_25860 32710 34578 gene locus_tag LOCUS_25870 gene cobT 32710 34578 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_25870 34632 35420 gene locus_tag LOCUS_25880 34632 35420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 35532 35801 gene locus_tag LOCUS_25890 35532 35801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 35893 36876 gene locus_tag LOCUS_25900 35893 36876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 38215 36893 gene locus_tag LOCUS_25910 38215 36893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 40012 38339 gene locus_tag LOCUS_25920 40012 38339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 40709 40116 gene locus_tag LOCUS_25930 40709 40116 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619532.1 protein_id gnl|my_center|LOCUS_25930 41115 40825 gene locus_tag LOCUS_25940 gene rpmB 41115 40825 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4W8 protein_id gnl|my_center|LOCUS_25940 41337 42341 gene locus_tag LOCUS_25950 gene bioB 41337 42341 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_25950 42338 43639 gene locus_tag LOCUS_25960 gene bioA 42338 43639 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_25960 43644 44828 gene locus_tag LOCUS_25970 gene bioF 43644 44828 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z1 protein_id gnl|my_center|LOCUS_25970 44861 45451 gene locus_tag LOCUS_25980 44861 45451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 46473 45547 gene locus_tag LOCUS_25990 46473 45547 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705902.1 protein_id gnl|my_center|LOCUS_25990 47242 46463 gene locus_tag LOCUS_26000 47242 46463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 48897 47677 gene locus_tag LOCUS_26010 48897 47677 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_26010 49590 49006 gene locus_tag LOCUS_26020 49590 49006 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 protein_id gnl|my_center|LOCUS_26020 49758 50231 gene locus_tag LOCUS_26030 49758 50231 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_26030 50946 50245 gene locus_tag LOCUS_26040 50946 50245 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence30 72 1391 gene locus_tag LOCUS_26050 72 1391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_26050 1381 1821 gene locus_tag LOCUS_26060 1381 1821 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886840.1 protein_id gnl|my_center|LOCUS_26060 2039 4246 gene locus_tag LOCUS_26070 gene katG 2039 4246 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BE1 protein_id gnl|my_center|LOCUS_26070 5062 4277 gene locus_tag LOCUS_26080 5062 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 5629 5168 gene locus_tag LOCUS_26090 5629 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 6137 5679 gene locus_tag LOCUS_26100 6137 5679 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918406.1 protein_id gnl|my_center|LOCUS_26100 6770 6168 gene locus_tag LOCUS_26110 6770 6168 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_26110 6902 7666 gene locus_tag LOCUS_26120 6902 7666 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_26120 7788 8681 gene locus_tag LOCUS_26130 7788 8681 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_26130 8678 9772 gene locus_tag LOCUS_26140 gene hisC 8678 9772 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP86 protein_id gnl|my_center|LOCUS_26140 9769 10668 gene locus_tag LOCUS_26150 9769 10668 CDS product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 protein_id gnl|my_center|LOCUS_26150 11262 10699 gene locus_tag LOCUS_26160 11262 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 11763 11320 gene locus_tag LOCUS_26170 11763 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 11908 12321 gene locus_tag LOCUS_26180 11908 12321 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918024.1 protein_id gnl|my_center|LOCUS_26180 12337 13230 gene locus_tag LOCUS_26190 12337 13230 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918025.1 protein_id gnl|my_center|LOCUS_26190 13870 13238 gene locus_tag LOCUS_26200 13870 13238 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_26200 15024 13930 gene locus_tag LOCUS_26210 15024 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 15116 15646 gene locus_tag LOCUS_26220 15116 15646 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J6 protein_id gnl|my_center|LOCUS_26220 18017 15648 gene locus_tag LOCUS_26230 18017 15648 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_26230 18961 18188 gene locus_tag LOCUS_26240 18961 18188 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_26240 19572 18973 gene locus_tag LOCUS_26250 19572 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_26250 20489 19608 gene locus_tag LOCUS_26260 20489 19608 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_26260 21327 20500 gene locus_tag LOCUS_26270 21327 20500 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 protein_id gnl|my_center|LOCUS_26270 21499 22509 gene locus_tag LOCUS_26280 21499 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 25272 22558 gene locus_tag LOCUS_26290 25272 22558 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 protein_id gnl|my_center|LOCUS_26290 26617 25352 gene locus_tag LOCUS_26300 gene lysA 26617 25352 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE4 protein_id gnl|my_center|LOCUS_26300 26911 26672 gene locus_tag LOCUS_26310 26911 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 28382 26952 gene locus_tag LOCUS_26320 gene argH 28382 26952 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 protein_id gnl|my_center|LOCUS_26320 28450 29067 gene locus_tag LOCUS_26330 28450 29067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 29124 29447 gene locus_tag LOCUS_26340 29124 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 29572 30231 gene locus_tag LOCUS_26350 29572 30231 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_26350 30789 30322 gene locus_tag LOCUS_26360 30789 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 31010 32869 gene locus_tag LOCUS_26370 31010 32869 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_26370 33063 33491 gene locus_tag LOCUS_26380 33063 33491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 33571 34155 gene locus_tag LOCUS_26390 33571 34155 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_26390 36310 34283 gene locus_tag LOCUS_26400 36310 34283 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_26400 36537 37817 gene locus_tag LOCUS_26410 36537 37817 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_26410 37863 39536 gene locus_tag LOCUS_26420 37863 39536 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 protein_id gnl|my_center|LOCUS_26420 39676 40041 gene locus_tag LOCUS_26430 39676 40041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 40099 40296 gene locus_tag LOCUS_26440 40099 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 40325 40909 gene locus_tag LOCUS_26450 40325 40909 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_26450 41088 41969 gene locus_tag LOCUS_26460 41088 41969 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_26460 42995 41976 gene locus_tag LOCUS_26470 42995 41976 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970424.1 protein_id gnl|my_center|LOCUS_26470 43467 42985 gene locus_tag LOCUS_26480 43467 42985 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 protein_id gnl|my_center|LOCUS_26480 43718 44593 gene locus_tag LOCUS_26490 43718 44593 CDS product ornithine-acyl ACP N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_26490 44521 45438 gene locus_tag LOCUS_26500 44521 45438 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_26500 46560 45418 gene locus_tag LOCUS_26510 46560 45418 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE0 protein_id gnl|my_center|LOCUS_26510 47314 46676 gene locus_tag LOCUS_26520 gene rnhB 47314 46676 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE1 protein_id gnl|my_center|LOCUS_26520 48913 47327 gene locus_tag LOCUS_26530 48913 47327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 50059 48971 gene locus_tag LOCUS_26540 50059 48971 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971096.1 protein_id gnl|my_center|LOCUS_26540 50205 50426 gene locus_tag LOCUS_26550 50205 50426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence31 1179 421 gene locus_tag LOCUS_26560 gene cysH 1179 421 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B1 protein_id gnl|my_center|LOCUS_26560 1502 4423 gene locus_tag LOCUS_26570 1502 4423 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_26570 4425 5168 gene locus_tag LOCUS_26580 4425 5168 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_26580 5194 6141 gene locus_tag LOCUS_26590 5194 6141 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_26590 6302 24439 gene locus_tag LOCUS_26600 6302 24439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 23462 24031 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcggttccggcaacgacgagatcgaaggc 26890 24536 gene locus_tag LOCUS_26610 26890 24536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 27096 27776 gene locus_tag LOCUS_26620 27096 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 28110 29714 gene locus_tag LOCUS_26630 gene prfC 28110 29714 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_26630 29711 30352 gene locus_tag LOCUS_26640 29711 30352 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEF7 protein_id gnl|my_center|LOCUS_26640 30691 30356 gene locus_tag LOCUS_26650 30691 30356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_26650 31596 30688 gene locus_tag LOCUS_26660 31596 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_26660 32593 31691 gene locus_tag LOCUS_26670 32593 31691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_26670 32760 34127 gene locus_tag LOCUS_26680 gene norM 32760 34127 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58163 protein_id gnl|my_center|LOCUS_26680 34485 34141 gene locus_tag LOCUS_26690 34485 34141 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_26690 36277 34517 gene locus_tag LOCUS_26700 gene argS 36277 34517 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG6 protein_id gnl|my_center|LOCUS_26700 36481 36693 gene locus_tag LOCUS_26710 36481 36693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 36956 38413 gene locus_tag LOCUS_26720 36956 38413 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707734.1 protein_id gnl|my_center|LOCUS_26720 38912 39226 gene locus_tag LOCUS_26730 38912 39226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 39226 39537 gene locus_tag LOCUS_26740 39226 39537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 39538 40023 gene locus_tag LOCUS_26750 39538 40023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 40016 41476 gene locus_tag LOCUS_26760 40016 41476 CDS product phage/plasmid primase P4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531683.1 protein_id gnl|my_center|LOCUS_26760 41734 42069 gene locus_tag LOCUS_26770 41734 42069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 42081 42470 gene locus_tag LOCUS_26780 42081 42470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 42467 42748 gene locus_tag LOCUS_26790 42467 42748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 43074 44261 gene locus_tag LOCUS_26800 43074 44261 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 protein_id gnl|my_center|LOCUS_26800 44381 44722 gene locus_tag LOCUS_26810 44381 44722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 45074 44748 gene locus_tag LOCUS_26820 45074 44748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 45444 45369 gene locus_tag LOCUS_t00300 45444 45369 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45677 46054 gene locus_tag LOCUS_26830 45677 46054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 46582 46076 gene locus_tag LOCUS_26840 46582 46076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 47483 46647 gene locus_tag LOCUS_26850 47483 46647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 47683 47768 gene locus_tag LOCUS_t00310 47683 47768 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 47937 48010 gene locus_tag LOCUS_t00320 47937 48010 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 700 1986 gene locus_tag LOCUS_26860 700 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2080 2847 gene locus_tag LOCUS_26870 2080 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2998 4629 gene locus_tag LOCUS_26880 2998 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4631 7069 gene locus_tag LOCUS_26890 4631 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 7066 8421 gene locus_tag LOCUS_26900 7066 8421 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088217.1 protein_id gnl|my_center|LOCUS_26900 8881 8435 gene locus_tag LOCUS_26910 8881 8435 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_26910 9043 9387 gene locus_tag LOCUS_26920 9043 9387 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_26920 9419 10309 gene locus_tag LOCUS_26930 9419 10309 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_26930 10364 11236 gene locus_tag LOCUS_26940 10364 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 13317 11233 gene locus_tag LOCUS_26950 13317 11233 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_26950 13432 13680 gene locus_tag LOCUS_26960 13432 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537695.1 protein_id gnl|my_center|LOCUS_26960 13702 17187 gene locus_tag LOCUS_26970 gene mfd 13702 17187 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 protein_id gnl|my_center|LOCUS_26970 14305 14404 gene locus_tag LOCUS_t00330 14305 14404 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17810 17220 gene locus_tag LOCUS_26980 17810 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 18463 17834 gene locus_tag LOCUS_26990 18463 17834 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_26990 18703 18557 gene locus_tag LOCUS_27000 18703 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 20225 18936 gene locus_tag LOCUS_27010 20225 18936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_27010 22957 20267 gene locus_tag LOCUS_27020 22957 20267 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_27020 23229 22957 gene locus_tag LOCUS_27030 23229 22957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 23628 23251 gene locus_tag LOCUS_27040 23628 23251 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 protein_id gnl|my_center|LOCUS_27040 25134 23740 gene locus_tag LOCUS_27050 25134 23740 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338041.1 protein_id gnl|my_center|LOCUS_27050 25379 26719 gene locus_tag LOCUS_27060 25379 26719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_27060 26804 27832 gene locus_tag LOCUS_27070 26804 27832 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820410.1 protein_id gnl|my_center|LOCUS_27070 27837 28988 gene locus_tag LOCUS_27080 27837 28988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 29002 29757 gene locus_tag LOCUS_27090 29002 29757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_27090 29754 30590 gene locus_tag LOCUS_27100 29754 30590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 protein_id gnl|my_center|LOCUS_27100 31151 31336 gene locus_tag LOCUS_27110 31151 31336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 31349 31891 gene locus_tag LOCUS_27120 31349 31891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 31901 33598 gene locus_tag LOCUS_27130 31901 33598 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_27130 33641 34516 gene locus_tag LOCUS_27140 gene cyoE 33641 34516 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P487 protein_id gnl|my_center|LOCUS_27140 34500 35321 gene locus_tag LOCUS_27150 34500 35321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 35365 36948 gene locus_tag LOCUS_27160 35365 36948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 36945 37475 gene locus_tag LOCUS_27170 36945 37475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 37472 37876 gene locus_tag LOCUS_27180 37472 37876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 37930 38676 gene locus_tag LOCUS_27190 37930 38676 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 protein_id gnl|my_center|LOCUS_27190 39909 38698 gene locus_tag LOCUS_27200 39909 38698 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_27200 40654 39911 gene locus_tag LOCUS_27210 40654 39911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 42818 40833 gene locus_tag LOCUS_27220 gene nosR 42818 40833 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_27220 43153 44820 gene locus_tag LOCUS_27230 gene nirS 43153 44820 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 protein_id gnl|my_center|LOCUS_27230 44914 45711 gene locus_tag LOCUS_27240 44914 45711 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113243.1 protein_id gnl|my_center|LOCUS_27240 45668 46045 gene locus_tag LOCUS_27250 45668 46045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 46042 47238 gene locus_tag LOCUS_27260 gene nirF 46042 47238 CDS product protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51480 protein_id gnl|my_center|LOCUS_27260 47242 47688 gene locus_tag LOCUS_27270 gene nirD 47242 47688 CDS product protein NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95412 protein_id gnl|my_center|LOCUS_27270 >Feature sequence33 3107 1965 gene locus_tag LOCUS_27280 3107 1965 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_27280 4672 3176 gene locus_tag LOCUS_27290 4672 3176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393806.1 protein_id gnl|my_center|LOCUS_27290 5891 4728 gene locus_tag LOCUS_27300 5891 4728 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545031.1 protein_id gnl|my_center|LOCUS_27300 6097 7776 gene locus_tag LOCUS_27310 6097 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 8049 8393 gene locus_tag LOCUS_27320 8049 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 9055 8420 gene locus_tag LOCUS_27330 gene plsY 9055 8420 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF8 protein_id gnl|my_center|LOCUS_27330 10375 9059 gene locus_tag LOCUS_27340 gene pyrC 10375 9059 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 protein_id gnl|my_center|LOCUS_27340 11366 10395 gene locus_tag LOCUS_27350 gene pyrB 11366 10395 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPG0 protein_id gnl|my_center|LOCUS_27350 11499 12374 gene locus_tag LOCUS_27360 11499 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 12844 12386 gene locus_tag LOCUS_27370 12844 12386 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH2 protein_id gnl|my_center|LOCUS_27370 13059 13871 gene locus_tag LOCUS_27380 13059 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 14252 15004 gene locus_tag LOCUS_27390 14252 15004 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_27390 15272 15559 gene locus_tag LOCUS_27400 gene gatC 15272 15559 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5K9 protein_id gnl|my_center|LOCUS_27400 15559 17040 gene locus_tag LOCUS_27410 gene gatA 15559 17040 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH4 protein_id gnl|my_center|LOCUS_27410 17040 18497 gene locus_tag LOCUS_27420 gene gatB 17040 18497 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH5 protein_id gnl|my_center|LOCUS_27420 18502 19008 gene locus_tag LOCUS_27430 18502 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 20906 19005 gene locus_tag LOCUS_27440 20906 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 21074 21445 gene locus_tag LOCUS_27450 21074 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 21554 22393 gene locus_tag LOCUS_27460 21554 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 22409 22690 gene locus_tag LOCUS_27470 22409 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529114.1 protein_id gnl|my_center|LOCUS_27470 22773 24458 gene locus_tag LOCUS_27480 22773 24458 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_27480 24479 25381 gene locus_tag LOCUS_27490 24479 25381 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087376.1 protein_id gnl|my_center|LOCUS_27490 25374 26408 gene locus_tag LOCUS_27500 gene lhpD 25374 26408 CDS product delta(1)-pyrroline-2-carboxylate/Delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I492 protein_id gnl|my_center|LOCUS_27500 27231 26413 gene locus_tag LOCUS_27510 27231 26413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921519.1 protein_id gnl|my_center|LOCUS_27510 28148 27405 gene locus_tag LOCUS_27520 28148 27405 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103289.1 protein_id gnl|my_center|LOCUS_27520 28379 28795 gene locus_tag LOCUS_27530 28379 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 28893 29525 gene locus_tag LOCUS_27540 28893 29525 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090855.1 protein_id gnl|my_center|LOCUS_27540 29563 30126 gene locus_tag LOCUS_27550 29563 30126 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388088.1 protein_id gnl|my_center|LOCUS_27550 30205 30296 gene locus_tag LOCUS_t00340 30205 30296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30449 31684 gene locus_tag LOCUS_27560 30449 31684 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_27560 31876 32181 gene locus_tag LOCUS_27570 31876 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 32937 32638 gene locus_tag LOCUS_27580 32937 32638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 33821 32931 gene locus_tag LOCUS_27590 33821 32931 CDS product ATPase-like ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389934.1 protein_id gnl|my_center|LOCUS_27590 34066 33818 gene locus_tag LOCUS_27600 34066 33818 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531584.1 protein_id gnl|my_center|LOCUS_27600 34210 34728 gene locus_tag LOCUS_27610 34210 34728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 34730 34963 gene locus_tag LOCUS_27620 34730 34963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 34966 35370 gene locus_tag LOCUS_27630 34966 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 35451 36179 gene locus_tag LOCUS_27640 gene dns 35451 36179 CDS product extracellular deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08038 protein_id gnl|my_center|LOCUS_27640 36163 36789 gene locus_tag LOCUS_27650 36163 36789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 37629 36976 gene locus_tag LOCUS_27660 37629 36976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 38071 37583 gene locus_tag LOCUS_27670 38071 37583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 42281 38061 gene locus_tag LOCUS_27680 42281 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 42532 42281 gene locus_tag LOCUS_27690 42532 42281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 43860 42532 gene locus_tag LOCUS_27700 43860 42532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 44282 43860 gene locus_tag LOCUS_27710 44282 43860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 45108 44275 gene locus_tag LOCUS_27720 45108 44275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 45125 45355 gene locus_tag LOCUS_27730 45125 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 46171 45425 gene locus_tag LOCUS_27740 46171 45425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 46383 46171 gene locus_tag LOCUS_27750 46383 46171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 46579 46388 gene locus_tag LOCUS_27760 46579 46388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence34 1121 273 gene locus_tag LOCUS_27770 1121 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 1496 2416 gene locus_tag LOCUS_27780 1496 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2522 3355 gene locus_tag LOCUS_27790 gene phnC 2522 3355 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035E0 protein_id gnl|my_center|LOCUS_27790 3363 4379 gene locus_tag LOCUS_27800 3363 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 4994 4413 gene locus_tag LOCUS_27810 gene mntP 4994 4413 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z670 protein_id gnl|my_center|LOCUS_27810 5772 5008 gene locus_tag LOCUS_27820 5772 5008 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969919.1 protein_id gnl|my_center|LOCUS_27820 6713 5781 gene locus_tag LOCUS_27830 gene prs 6713 5781 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 protein_id gnl|my_center|LOCUS_27830 8509 6884 gene locus_tag LOCUS_27840 8509 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 9449 8661 gene locus_tag LOCUS_27850 9449 8661 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ3 protein_id gnl|my_center|LOCUS_27850 10625 9519 gene locus_tag LOCUS_27860 10625 9519 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 protein_id gnl|my_center|LOCUS_27860 11494 10622 gene locus_tag LOCUS_27870 gene lgt 11494 10622 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 protein_id gnl|my_center|LOCUS_27870 12494 11508 gene locus_tag LOCUS_27880 gene hldD 12494 11508 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP72 protein_id gnl|my_center|LOCUS_27880 12611 12955 gene locus_tag LOCUS_27890 12611 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 13243 13746 gene locus_tag LOCUS_27900 13243 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_27900 13778 14626 gene locus_tag LOCUS_27910 gene proC 13778 14626 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N78 protein_id gnl|my_center|LOCUS_27910 14714 15388 gene locus_tag LOCUS_27920 14714 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_27920 15535 16032 gene locus_tag LOCUS_27930 15535 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 16135 16488 gene locus_tag LOCUS_27940 16135 16488 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_27940 19159 16502 gene locus_tag LOCUS_27950 19159 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 19841 19182 gene locus_tag LOCUS_27960 19841 19182 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_27960 21316 19997 gene locus_tag LOCUS_27970 21316 19997 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_27970 22011 21328 gene locus_tag LOCUS_27980 22011 21328 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_27980 22617 22105 gene locus_tag LOCUS_27990 22617 22105 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_27990 22761 23660 gene locus_tag LOCUS_28000 22761 23660 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_28000 23670 24821 gene locus_tag LOCUS_28010 gene corA 23670 24821 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_28010 25675 24818 gene locus_tag LOCUS_28020 25675 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 26578 25748 gene locus_tag LOCUS_28030 26578 25748 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_28030 27288 26575 gene locus_tag LOCUS_28040 27288 26575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 27755 27285 gene locus_tag LOCUS_28050 gene moaE 27755 27285 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX97 protein_id gnl|my_center|LOCUS_28050 28036 27773 gene locus_tag LOCUS_28060 gene moaD 28036 27773 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_28060 29302 28037 gene locus_tag LOCUS_28070 gene moeA 29302 28037 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_28070 29948 29289 gene locus_tag LOCUS_28080 29948 29289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 30537 29920 gene locus_tag LOCUS_28090 gene pgsA 30537 29920 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_28090 32592 30643 gene locus_tag LOCUS_28100 gene uvrC 32592 30643 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 protein_id gnl|my_center|LOCUS_28100 33396 32977 gene locus_tag LOCUS_28110 33396 32977 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_28110 34203 33427 gene locus_tag LOCUS_28120 34203 33427 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_28120 35188 34211 gene locus_tag LOCUS_28130 35188 34211 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_28130 35697 35185 gene locus_tag LOCUS_28140 gene rppH 35697 35185 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_28140 >Feature sequence35 189 1040 gene locus_tag LOCUS_28150 189 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4519 1049 gene locus_tag LOCUS_28160 4519 1049 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_28160 4831 4571 gene locus_tag LOCUS_28170 4831 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 4787 5764 gene locus_tag LOCUS_28180 gene uge 4787 5764 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_28180 5787 6692 gene locus_tag LOCUS_28190 5787 6692 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_28190 6720 7553 gene locus_tag LOCUS_28200 6720 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 7786 8406 gene locus_tag LOCUS_28210 7786 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 10190 8403 gene locus_tag LOCUS_28220 10190 8403 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_28220 10344 12179 gene locus_tag LOCUS_28230 10344 12179 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_28230 12183 12995 gene locus_tag LOCUS_28240 12183 12995 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_28240 12988 14343 gene locus_tag LOCUS_28250 12988 14343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_28250 14385 14708 gene locus_tag LOCUS_28260 14385 14708 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN47 protein_id gnl|my_center|LOCUS_28260 14888 16099 gene locus_tag LOCUS_28270 14888 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 16099 16497 gene locus_tag LOCUS_28280 16099 16497 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_28280 17027 16494 gene locus_tag LOCUS_28290 17027 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 18635 17034 gene locus_tag LOCUS_28300 gene ggt 18635 17034 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_28300 18831 20105 gene locus_tag LOCUS_28310 gene pntAA 18831 20105 CDS product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 protein_id gnl|my_center|LOCUS_28310 20108 20527 gene locus_tag LOCUS_28320 gene pntAB 20108 20527 CDS product NAD(P) transhydrogenase subunit alpha part 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB3 protein_id gnl|my_center|LOCUS_28320 20542 21936 gene locus_tag LOCUS_28330 gene pntB 20542 21936 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 protein_id gnl|my_center|LOCUS_28330 23941 21950 gene locus_tag LOCUS_28340 23941 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 24288 24085 gene locus_tag LOCUS_28350 gene rpsU 24288 24085 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK1 protein_id gnl|my_center|LOCUS_28350 24473 25036 gene locus_tag LOCUS_28360 gene def 24473 25036 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK0 protein_id gnl|my_center|LOCUS_28360 25033 25737 gene locus_tag LOCUS_28370 25033 25737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_28370 25853 26716 gene locus_tag LOCUS_28380 25853 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 27836 26736 gene locus_tag LOCUS_28390 gene purK 27836 26736 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_28390 28354 27839 gene locus_tag LOCUS_28400 gene purE 28354 27839 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7B0 protein_id gnl|my_center|LOCUS_28400 28556 29269 gene locus_tag LOCUS_28410 28556 29269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 29421 31376 gene locus_tag LOCUS_28420 29421 31376 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 protein_id gnl|my_center|LOCUS_28420 31451 33061 gene locus_tag LOCUS_28430 31451 33061 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_28430 33293 33853 gene locus_tag LOCUS_28440 33293 33853 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 protein_id gnl|my_center|LOCUS_28440 34089 33889 gene locus_tag LOCUS_28450 34089 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_28450 34222 35316 gene locus_tag LOCUS_28460 gene pfkA 34222 35316 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 protein_id gnl|my_center|LOCUS_28460 35619 35789 gene locus_tag LOCUS_28470 35619 35789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 36489 35947 gene locus_tag LOCUS_28480 36489 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence36 915 484 gene locus_tag LOCUS_28490 915 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1109 1642 gene locus_tag LOCUS_28500 gene ppa 1109 1642 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4C9 protein_id gnl|my_center|LOCUS_28500 1686 2213 gene locus_tag LOCUS_28510 1686 2213 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_28510 4648 2378 gene locus_tag LOCUS_28520 4648 2378 CDS product malic protein NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_28520 5035 7824 gene locus_tag LOCUS_28530 gene mutS 5035 7824 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_28530 7899 10817 gene locus_tag LOCUS_28540 gene glnD 7899 10817 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_28540 10988 12625 gene locus_tag LOCUS_28550 10988 12625 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_28550 12705 13706 gene locus_tag LOCUS_28560 gene trpS 12705 13706 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_28560 13860 14411 gene locus_tag LOCUS_28570 13860 14411 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_28570 14698 15762 gene locus_tag LOCUS_28580 14698 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 16855 15788 gene locus_tag LOCUS_28590 16855 15788 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_28590 17009 17599 gene locus_tag LOCUS_28600 17009 17599 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCJ9 protein_id gnl|my_center|LOCUS_28600 17612 19015 gene locus_tag LOCUS_28610 17612 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 19030 19716 gene locus_tag LOCUS_28620 19030 19716 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_28620 20029 19748 gene locus_tag LOCUS_28630 20029 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 20215 20625 gene locus_tag LOCUS_28640 20215 20625 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_28640 20727 21152 gene locus_tag LOCUS_28650 20727 21152 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_28650 21223 22614 gene locus_tag LOCUS_28660 gene miaB 21223 22614 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF08 protein_id gnl|my_center|LOCUS_28660 22611 23729 gene locus_tag LOCUS_28670 22611 23729 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527679.1 protein_id gnl|my_center|LOCUS_28670 23743 24252 gene locus_tag LOCUS_28680 gene ybeY 23743 24252 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS9 protein_id gnl|my_center|LOCUS_28680 24403 25233 gene locus_tag LOCUS_28690 24403 25233 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_28690 25230 26897 gene locus_tag LOCUS_28700 gene lnt 25230 26897 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 protein_id gnl|my_center|LOCUS_28700 27113 28321 gene locus_tag LOCUS_28710 gene metK2 27113 28321 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_28710 28357 29058 gene locus_tag LOCUS_28720 gene trmB 28357 29058 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_28720 29257 29775 gene locus_tag LOCUS_28730 gene rimP 29257 29775 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN8 protein_id gnl|my_center|LOCUS_28730 29816 31408 gene locus_tag LOCUS_28740 gene nusA 29816 31408 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_28740 31466 32128 gene locus_tag LOCUS_28750 31466 32128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391527.1 protein_id gnl|my_center|LOCUS_28750 32192 34696 gene locus_tag LOCUS_28760 gene infB 32192 34696 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS0 protein_id gnl|my_center|LOCUS_28760 34777 35256 gene locus_tag LOCUS_28770 34777 35256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence37 1542 793 gene locus_tag LOCUS_28780 gene rlmE 1542 793 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 protein_id gnl|my_center|LOCUS_28780 2555 1539 gene locus_tag LOCUS_28790 2555 1539 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919488.1 protein_id gnl|my_center|LOCUS_28790 2774 2848 gene locus_tag LOCUS_t00350 2774 2848 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3384 2914 gene locus_tag LOCUS_28800 3384 2914 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_28800 3764 3573 gene locus_tag LOCUS_28810 3764 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 3865 5829 gene locus_tag LOCUS_28820 gene mnmC 3865 5829 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_28820 7003 5843 gene locus_tag LOCUS_28830 7003 5843 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7K7 protein_id gnl|my_center|LOCUS_28830 8450 7074 gene locus_tag LOCUS_28840 8450 7074 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 protein_id gnl|my_center|LOCUS_28840 8931 8488 gene locus_tag LOCUS_28850 8931 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 9839 9030 gene locus_tag LOCUS_28860 9839 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808752.1 protein_id gnl|my_center|LOCUS_28860 10279 9854 gene locus_tag LOCUS_28870 10279 9854 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389405.1 protein_id gnl|my_center|LOCUS_28870 10703 10284 gene locus_tag LOCUS_28880 10703 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528643.1 protein_id gnl|my_center|LOCUS_28880 11587 10757 gene locus_tag LOCUS_28890 11587 10757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 protein_id gnl|my_center|LOCUS_28890 12581 11649 gene locus_tag LOCUS_28900 12581 11649 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_28900 13333 12584 gene locus_tag LOCUS_28910 gene etfB 13333 12584 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53575 protein_id gnl|my_center|LOCUS_28910 13633 14631 gene locus_tag LOCUS_28920 13633 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 14723 15394 gene locus_tag LOCUS_28930 14723 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 15532 16143 gene locus_tag LOCUS_28940 15532 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 protein_id gnl|my_center|LOCUS_28940 16175 16891 gene locus_tag LOCUS_28950 16175 16891 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_28950 16888 18156 gene locus_tag LOCUS_28960 16888 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_28960 18173 19030 gene locus_tag LOCUS_28970 gene ytbE 18173 19030 CDS product D-xylose reductase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_28970 19191 20822 gene locus_tag LOCUS_28980 19191 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 21188 21042 gene locus_tag LOCUS_28990 21188 21042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 21545 22393 gene locus_tag LOCUS_29000 21545 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29000 22411 23385 gene locus_tag LOCUS_29010 22411 23385 CDS product D-isomer specific 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 protein_id gnl|my_center|LOCUS_29010 23413 24735 gene locus_tag LOCUS_29020 23413 24735 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762837.1 protein_id gnl|my_center|LOCUS_29020 26519 24732 gene locus_tag LOCUS_29030 26519 24732 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_29030 26955 26770 gene locus_tag LOCUS_29040 26955 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 27102 28034 gene locus_tag LOCUS_29050 27102 28034 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976376.1 protein_id gnl|my_center|LOCUS_29050 28124 28684 gene locus_tag LOCUS_29060 28124 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 28695 29843 gene locus_tag LOCUS_29070 28695 29843 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_29070 29840 33016 gene locus_tag LOCUS_29080 29840 33016 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230278.2 protein_id gnl|my_center|LOCUS_29080 33860 33021 gene locus_tag LOCUS_29090 33860 33021 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_29090 34600 33881 gene locus_tag LOCUS_29100 gene psd 34600 33881 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_29100 34776 35300 gene locus_tag LOCUS_29110 34776 35300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence38 <1 943 gene locus_tag LOCUS_29120 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085980.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit 988 1221 gene locus_tag LOCUS_29130 988 1221 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 protein_id gnl|my_center|LOCUS_29130 1240 2202 gene locus_tag LOCUS_29140 1240 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085982.1 protein_id gnl|my_center|LOCUS_29140 2252 2995 gene locus_tag LOCUS_29150 gene dasR 2252 2995 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206682.1 protein_id gnl|my_center|LOCUS_29150 3007 3558 gene locus_tag LOCUS_29160 3007 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3821 5185 gene locus_tag LOCUS_29170 3821 5185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085976.1 protein_id gnl|my_center|LOCUS_29170 5300 6226 gene locus_tag LOCUS_29180 5300 6226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085975.1 protein_id gnl|my_center|LOCUS_29180 6223 6921 gene locus_tag LOCUS_29190 6223 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6918 7775 gene locus_tag LOCUS_29200 6918 7775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088548.1 protein_id gnl|my_center|LOCUS_29200 7798 8415 gene locus_tag LOCUS_29210 7798 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 8416 8997 gene locus_tag LOCUS_29220 8416 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 9008 9667 gene locus_tag LOCUS_29230 9008 9667 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_29230 9680 10447 gene locus_tag LOCUS_29240 9680 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085977.1 protein_id gnl|my_center|LOCUS_29240 11551 10454 gene locus_tag LOCUS_29250 11551 10454 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 protein_id gnl|my_center|LOCUS_29250 12483 11548 gene locus_tag LOCUS_29260 12483 11548 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087329.1 protein_id gnl|my_center|LOCUS_29260 12753 12523 gene locus_tag LOCUS_29270 12753 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 14750 12750 gene locus_tag LOCUS_29280 14750 12750 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 protein_id gnl|my_center|LOCUS_29280 15853 14894 gene locus_tag LOCUS_29290 15853 14894 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_29290 16076 17032 gene locus_tag LOCUS_29300 16076 17032 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728752.1 protein_id gnl|my_center|LOCUS_29300 18528 17290 gene locus_tag LOCUS_29310 18528 17290 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_29310 20492 18525 gene locus_tag LOCUS_29320 20492 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925779.1 protein_id gnl|my_center|LOCUS_29320 21061 20612 gene locus_tag LOCUS_29330 21061 20612 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA4 protein_id gnl|my_center|LOCUS_29330 21160 22185 gene locus_tag LOCUS_29340 21160 22185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_29340 22214 23632 gene locus_tag LOCUS_29350 22214 23632 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707802.1 protein_id gnl|my_center|LOCUS_29350 23672 24682 gene locus_tag LOCUS_29360 23672 24682 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104476.1 protein_id gnl|my_center|LOCUS_29360 25468 24695 gene locus_tag LOCUS_29370 25468 24695 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 protein_id gnl|my_center|LOCUS_29370 25550 25756 gene locus_tag LOCUS_29380 25550 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 26354 25761 gene locus_tag LOCUS_29390 26354 25761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 26852 26508 gene locus_tag LOCUS_29400 26852 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 28782 26968 gene locus_tag LOCUS_29410 28782 26968 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259231.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29410 29042 28794 gene locus_tag LOCUS_29420 29042 28794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_29420 29204 29929 gene locus_tag LOCUS_29430 29204 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 29961 31487 gene locus_tag LOCUS_29440 29961 31487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 31495 32406 gene locus_tag LOCUS_29450 31495 32406 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061271.1 protein_id gnl|my_center|LOCUS_29450 33362 32436 gene locus_tag LOCUS_29460 33362 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence39 <1 2187 gene locus_tag LOCUS_29470 <1 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89R17:phosphoenolpyruvate carboxylase 3284 2208 gene locus_tag LOCUS_29480 3284 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_29480 3588 3304 gene locus_tag LOCUS_29490 3588 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4064 3585 gene locus_tag LOCUS_29500 4064 3585 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 protein_id gnl|my_center|LOCUS_29500 4556 4080 gene locus_tag LOCUS_29510 4556 4080 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969809.1 protein_id gnl|my_center|LOCUS_29510 5101 4586 gene locus_tag LOCUS_29520 5101 4586 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_29520 5435 5088 gene locus_tag LOCUS_29530 5435 5088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_29530 6396 5539 gene locus_tag LOCUS_29540 6396 5539 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV45 protein_id gnl|my_center|LOCUS_29540 6496 7389 gene locus_tag LOCUS_29550 6496 7389 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_29550 7427 8485 gene locus_tag LOCUS_29560 gene mch 7427 8485 CDS product beta-methylmalyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC34 protein_id gnl|my_center|LOCUS_29560 8618 10348 gene locus_tag LOCUS_29570 8618 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 10530 11654 gene locus_tag LOCUS_29580 10530 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 12931 11720 gene locus_tag LOCUS_29590 12931 11720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_29590 13764 14156 gene locus_tag LOCUS_29600 13764 14156 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388957.1 protein_id gnl|my_center|LOCUS_29600 14161 14541 gene locus_tag LOCUS_29610 14161 14541 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_29610 14549 16339 gene locus_tag LOCUS_29620 14549 16339 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV40 protein_id gnl|my_center|LOCUS_29620 16361 17137 gene locus_tag LOCUS_29630 16361 17137 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV39 protein_id gnl|my_center|LOCUS_29630 17293 18612 gene locus_tag LOCUS_29640 17293 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 18646 19704 gene locus_tag LOCUS_29650 18646 19704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 20568 19708 gene locus_tag LOCUS_29660 20568 19708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 20894 20655 gene locus_tag LOCUS_29670 20894 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706319.1 protein_id gnl|my_center|LOCUS_29670 21105 21734 gene locus_tag LOCUS_29680 21105 21734 CDS product negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836195.1 protein_id gnl|my_center|LOCUS_29680 22552 21731 gene locus_tag LOCUS_29690 22552 21731 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_29690 22794 24242 gene locus_tag LOCUS_29700 22794 24242 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_29700 24357 25499 gene locus_tag LOCUS_29710 24357 25499 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_29710 25679 26749 gene locus_tag LOCUS_29720 gene nadA 25679 26749 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_29720 26779 27627 gene locus_tag LOCUS_29730 26779 27627 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_29730 28452 27646 gene locus_tag LOCUS_29740 28452 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 28754 29824 gene locus_tag LOCUS_29750 gene mdh 28754 29824 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDP3 protein_id gnl|my_center|LOCUS_29750 29917 31113 gene locus_tag LOCUS_29760 gene sucC 29917 31113 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 protein_id gnl|my_center|LOCUS_29760 >Feature sequence40 203 703 gene locus_tag LOCUS_29770 203 703 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_29770 820 3051 gene locus_tag LOCUS_29780 820 3051 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929962.1 protein_id gnl|my_center|LOCUS_29780 3051 3788 gene locus_tag LOCUS_29790 gene fadB 3051 3788 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_29790 3804 4583 gene locus_tag LOCUS_29800 gene pcaD 3804 4583 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 protein_id gnl|my_center|LOCUS_29800 4789 5844 gene locus_tag LOCUS_29810 4789 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5932 7746 gene locus_tag LOCUS_29820 5932 7746 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_29820 8250 7753 gene locus_tag LOCUS_29830 8250 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 9508 8360 gene locus_tag LOCUS_29840 9508 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 10696 9707 gene locus_tag LOCUS_29850 10696 9707 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390309.1 protein_id gnl|my_center|LOCUS_29850 11286 10831 gene locus_tag LOCUS_29860 11286 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 11722 12408 gene locus_tag LOCUS_29870 11722 12408 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971683.1 protein_id gnl|my_center|LOCUS_29870 13551 12739 gene locus_tag LOCUS_29880 13551 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705786.1 protein_id gnl|my_center|LOCUS_29880 14754 13576 gene locus_tag LOCUS_29890 14754 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 16073 14886 gene locus_tag LOCUS_29900 16073 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 17338 16109 gene locus_tag LOCUS_29910 17338 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 18901 17462 gene locus_tag LOCUS_29920 18901 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 19644 18919 gene locus_tag LOCUS_29930 19644 18919 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_29930 19831 20325 gene locus_tag LOCUS_29940 19831 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 20859 20404 gene locus_tag LOCUS_29950 gene dtd 20859 20404 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J474 protein_id gnl|my_center|LOCUS_29950 20991 21644 gene locus_tag LOCUS_29960 gene tal 20991 21644 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F0 protein_id gnl|my_center|LOCUS_29960 22259 21693 gene locus_tag LOCUS_29970 22259 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 22430 23623 gene locus_tag LOCUS_29980 gene potD-B 22430 23623 CDS product spermidine/putrescine-binding periplasmic protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45168 protein_id gnl|my_center|LOCUS_29980 24989 23679 gene locus_tag LOCUS_29990 gene bioA 24989 23679 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085009.1 protein_id gnl|my_center|LOCUS_29990 25186 26667 gene locus_tag LOCUS_30000 25186 26667 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_30000 26742 27860 gene locus_tag LOCUS_30010 26742 27860 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN15 protein_id gnl|my_center|LOCUS_30010 >Feature sequence41 1485 2057 gene locus_tag LOCUS_30020 1485 2057 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_30020 2808 2077 gene locus_tag LOCUS_30030 2808 2077 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_30030 5152 2840 gene locus_tag LOCUS_30040 5152 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5826 5149 gene locus_tag LOCUS_30050 5826 5149 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_30050 6120 6602 gene locus_tag LOCUS_30060 6120 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 6688 7521 gene locus_tag LOCUS_30070 6688 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 8831 7836 gene locus_tag LOCUS_30080 8831 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 10053 8902 gene locus_tag LOCUS_30090 10053 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_30090 10753 10070 gene locus_tag LOCUS_30100 10753 10070 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_30100 12049 11012 gene locus_tag LOCUS_30110 12049 11012 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_30110 12426 12049 gene locus_tag LOCUS_30120 gene crcB 12426 12049 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_30120 13789 12473 gene locus_tag LOCUS_30130 13789 12473 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_30130 15228 13786 gene locus_tag LOCUS_30140 15228 13786 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_30140 15823 15395 gene locus_tag LOCUS_30150 gene rplQ 15823 15395 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U884 protein_id gnl|my_center|LOCUS_30150 16978 15962 gene locus_tag LOCUS_30160 gene rpoA 16978 15962 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_30160 17515 17123 gene locus_tag LOCUS_30170 gene rpsK 17515 17123 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME7 protein_id gnl|my_center|LOCUS_30170 17910 17542 gene locus_tag LOCUS_30180 gene rpsM 17910 17542 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 protein_id gnl|my_center|LOCUS_30180 18790 18140 gene locus_tag LOCUS_30190 gene adk 18790 18140 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 protein_id gnl|my_center|LOCUS_30190 20130 18790 gene locus_tag LOCUS_30200 gene secY 20130 18790 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_30200 20722 20177 gene locus_tag LOCUS_30210 gene rplO 20722 20177 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U878 protein_id gnl|my_center|LOCUS_30210 20937 20755 gene locus_tag LOCUS_30220 gene rpmD 20937 20755 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 protein_id gnl|my_center|LOCUS_30220 21563 20952 gene locus_tag LOCUS_30230 gene rpsE 21563 20952 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX7 protein_id gnl|my_center|LOCUS_30230 21959 21597 gene locus_tag LOCUS_30240 gene rplR 21959 21597 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX6 protein_id gnl|my_center|LOCUS_30240 22496 21963 gene locus_tag LOCUS_30250 gene rplF 22496 21963 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J99 protein_id gnl|my_center|LOCUS_30250 22924 22532 gene locus_tag LOCUS_30260 gene rpsH 22924 22532 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_30260 23254 22949 gene locus_tag LOCUS_30270 gene rpsN 23254 22949 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX3 protein_id gnl|my_center|LOCUS_30270 23826 23281 gene locus_tag LOCUS_30280 gene rplE 23826 23281 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX2 protein_id gnl|my_center|LOCUS_30280 24157 23843 gene locus_tag LOCUS_30290 gene rplX 24157 23843 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_30290 24541 24173 gene locus_tag LOCUS_30300 gene rplN 24541 24173 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE28 protein_id gnl|my_center|LOCUS_30300 24835 24599 gene locus_tag LOCUS_30310 gene rpsQ 24835 24599 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW9 protein_id gnl|my_center|LOCUS_30310 25059 24853 gene locus_tag LOCUS_30320 gene rpmC 25059 24853 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R4 protein_id gnl|my_center|LOCUS_30320 25482 25063 gene locus_tag LOCUS_30330 gene rplP 25482 25063 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_30330 26208 25528 gene locus_tag LOCUS_30340 gene rpsC 26208 25528 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_30340 26589 26209 gene locus_tag LOCUS_30350 gene rplV 26589 26209 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW5 protein_id gnl|my_center|LOCUS_30350 26870 26592 gene locus_tag LOCUS_30360 gene rpsS 26870 26592 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_30360 27719 26883 gene locus_tag LOCUS_30370 gene rplB 27719 26883 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW3 protein_id gnl|my_center|LOCUS_30370 28094 27771 gene locus_tag LOCUS_30380 gene rplW 28094 27771 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW2 protein_id gnl|my_center|LOCUS_30380 28711 28091 gene locus_tag LOCUS_30390 gene rplD 28711 28091 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW1 protein_id gnl|my_center|LOCUS_30390 29556 28717 gene locus_tag LOCUS_30400 gene rplC 29556 28717 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U859 protein_id gnl|my_center|LOCUS_30400 >Feature sequence42 <1 1163 gene locus_tag LOCUS_30410 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387796.1:cytochrome c biogenesis protein CcmF 1171 1719 gene locus_tag LOCUS_30420 gene ccmG 1171 1719 CDS product cytochrome C-type biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_30420 1716 2192 gene locus_tag LOCUS_30430 gene cycL 1716 2192 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707360.1 protein_id gnl|my_center|LOCUS_30430 2189 3445 gene locus_tag LOCUS_30440 2189 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3541 4734 gene locus_tag LOCUS_30450 gene pgk 3541 4734 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW9 protein_id gnl|my_center|LOCUS_30450 6672 4705 gene locus_tag LOCUS_30460 6672 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 6884 7087 gene locus_tag LOCUS_30470 6884 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 7157 7693 gene locus_tag LOCUS_30480 7157 7693 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_30480 7767 8009 gene locus_tag LOCUS_30490 7767 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 8105 8533 gene locus_tag LOCUS_30500 8105 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 9376 8567 gene locus_tag LOCUS_30510 9376 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 10098 9529 gene locus_tag LOCUS_30520 10098 9529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_30520 10248 10460 gene locus_tag LOCUS_30530 10248 10460 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 protein_id gnl|my_center|LOCUS_30530 10472 10795 gene locus_tag LOCUS_30540 gene ydbL 10472 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76076 protein_id gnl|my_center|LOCUS_30540 10809 11036 gene locus_tag LOCUS_30550 10809 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 11040 12467 gene locus_tag LOCUS_30560 11040 12467 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_30560 13408 12464 gene locus_tag LOCUS_30570 13408 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30570 14649 13408 gene locus_tag LOCUS_30580 14649 13408 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_30580 15508 14654 gene locus_tag LOCUS_30590 gene dapF 15508 14654 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_30590 16216 15557 gene locus_tag LOCUS_30600 16216 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531177.1 protein_id gnl|my_center|LOCUS_30600 16652 16257 gene locus_tag LOCUS_30610 16652 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 16951 18324 gene locus_tag LOCUS_30620 gene ffh 16951 18324 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV60 protein_id gnl|my_center|LOCUS_30620 18395 18898 gene locus_tag LOCUS_30630 18395 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 18937 19494 gene locus_tag LOCUS_30640 gene rimM 18937 19494 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV58 protein_id gnl|my_center|LOCUS_30640 19494 20192 gene locus_tag LOCUS_30650 gene trmD 19494 20192 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_30650 20239 20727 gene locus_tag LOCUS_30660 gene rplS 20239 20727 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE47 protein_id gnl|my_center|LOCUS_30660 20850 22253 gene locus_tag LOCUS_30670 gene leuC 20850 22253 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 protein_id gnl|my_center|LOCUS_30670 22280 22906 gene locus_tag LOCUS_30680 gene leuD 22280 22906 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X27 protein_id gnl|my_center|LOCUS_30680 22951 24060 gene locus_tag LOCUS_30690 gene leuB 22951 24060 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 protein_id gnl|my_center|LOCUS_30690 24186 25754 gene locus_tag LOCUS_30700 24186 25754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 26020 27051 gene locus_tag LOCUS_30710 gene asd 26020 27051 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV48 protein_id gnl|my_center|LOCUS_30710 27057 27584 gene locus_tag LOCUS_30720 27057 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 27581 29032 gene locus_tag LOCUS_30730 27581 29032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence43 <1 2214 gene locus_tag LOCUS_30740 <1 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWI3:phosphoribosylformylglycinamidine synthase subunit PurL 2402 2190 gene locus_tag LOCUS_30750 2402 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2307 2543 gene locus_tag LOCUS_30760 2307 2543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531391.1 protein_id gnl|my_center|LOCUS_30760 2608 2943 gene locus_tag LOCUS_30770 gene grlA 2608 2943 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 protein_id gnl|my_center|LOCUS_30770 3227 3790 gene locus_tag LOCUS_30780 3227 3790 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920756.1 protein_id gnl|my_center|LOCUS_30780 3905 5491 gene locus_tag LOCUS_30790 3905 5491 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920757.1 protein_id gnl|my_center|LOCUS_30790 5978 5562 gene locus_tag LOCUS_30800 5978 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6687 6073 gene locus_tag LOCUS_30810 gene rpsD 6687 6073 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ0 protein_id gnl|my_center|LOCUS_30810 7020 8171 gene locus_tag LOCUS_30820 7020 8171 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A35 protein_id gnl|my_center|LOCUS_30820 8198 9289 gene locus_tag LOCUS_30830 8198 9289 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 protein_id gnl|my_center|LOCUS_30830 9312 10562 gene locus_tag LOCUS_30840 9312 10562 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_30840 10577 11485 gene locus_tag LOCUS_30850 10577 11485 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_30850 13202 11490 gene locus_tag LOCUS_30860 13202 11490 CDS product Na/Pi cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 protein_id gnl|my_center|LOCUS_30860 14823 13366 gene locus_tag LOCUS_30870 14823 13366 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533038.1 protein_id gnl|my_center|LOCUS_30870 16147 14876 gene locus_tag LOCUS_30880 gene phnA 16147 14876 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_30880 18785 16332 gene locus_tag LOCUS_30890 18785 16332 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708705.1 protein_id gnl|my_center|LOCUS_30890 19928 18795 gene locus_tag LOCUS_30900 gene phnW 19928 18795 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I434 protein_id gnl|my_center|LOCUS_30900 21786 20089 gene locus_tag LOCUS_30910 21786 20089 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061795.1 protein_id gnl|my_center|LOCUS_30910 22896 21790 gene locus_tag LOCUS_30920 gene fbpC 22896 21790 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJ32 protein_id gnl|my_center|LOCUS_30920 24071 23028 gene locus_tag LOCUS_30930 24071 23028 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_30930 24327 25193 gene locus_tag LOCUS_30940 24327 25193 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975819.1 protein_id gnl|my_center|LOCUS_30940 25269 26570 gene locus_tag LOCUS_30950 25269 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 28051 26684 gene locus_tag LOCUS_30960 28051 26684 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_30960 29261 28095 gene locus_tag LOCUS_30970 29261 28095 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence44 <1 1846 gene locus_tag LOCUS_30980 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706856.1:formate dehydrogenase 1864 2460 gene locus_tag LOCUS_30990 1864 2460 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 protein_id gnl|my_center|LOCUS_30990 2564 2881 gene locus_tag LOCUS_31000 2564 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 2917 4041 gene locus_tag LOCUS_31010 2917 4041 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 protein_id gnl|my_center|LOCUS_31010 4428 4213 gene locus_tag LOCUS_31020 4428 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 4550 4909 gene locus_tag LOCUS_31030 4550 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 7732 4958 gene locus_tag LOCUS_31040 7732 4958 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_31040 9393 7729 gene locus_tag LOCUS_31050 9393 7729 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_31050 9779 10441 gene locus_tag LOCUS_31060 9779 10441 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_31060 10704 13637 gene locus_tag LOCUS_31070 10704 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 13877 14200 gene locus_tag LOCUS_31080 13877 14200 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_31080 14261 15367 gene locus_tag LOCUS_31090 gene cheB1 14261 15367 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_31090 15364 16179 gene locus_tag LOCUS_31100 15364 16179 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_31100 16981 16277 gene locus_tag LOCUS_31110 16981 16277 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_31110 17169 18533 gene locus_tag LOCUS_31120 gene fliI 17169 18533 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_31120 18541 18984 gene locus_tag LOCUS_31130 18541 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 19386 19000 gene locus_tag LOCUS_31140 19386 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388287.1 protein_id gnl|my_center|LOCUS_31140 21109 19400 gene locus_tag LOCUS_31150 21109 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388289.1 protein_id gnl|my_center|LOCUS_31150 22209 21157 gene locus_tag LOCUS_31160 22209 21157 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 protein_id gnl|my_center|LOCUS_31160 24408 22237 gene locus_tag LOCUS_31170 gene flhA 24408 22237 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_31170 25859 24510 gene locus_tag LOCUS_31180 25859 24510 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_31180 26742 25924 gene locus_tag LOCUS_31190 26742 25924 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_31190 27134 26769 gene locus_tag LOCUS_31200 27134 26769 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_31200 28388 27144 gene locus_tag LOCUS_31210 28388 27144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 28555 28403 gene locus_tag LOCUS_31220 28555 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence45 <1 807 gene locus_tag LOCUS_31230 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003108823.1:acyl-CoA thiolase 836 1522 gene locus_tag LOCUS_31240 836 1522 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_31240 1539 2159 gene locus_tag LOCUS_31250 1539 2159 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_31250 2156 2560 gene locus_tag LOCUS_31260 2156 2560 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531694.1 protein_id gnl|my_center|LOCUS_31260 2661 3452 gene locus_tag LOCUS_31270 2661 3452 CDS product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_31270 3489 4022 gene locus_tag LOCUS_31280 3489 4022 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_31280 4144 4581 gene locus_tag LOCUS_31290 4144 4581 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531780.1 protein_id gnl|my_center|LOCUS_31290 4781 5278 gene locus_tag LOCUS_31300 4781 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 5850 5296 gene locus_tag LOCUS_31310 5850 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_31310 7337 5946 gene locus_tag LOCUS_31320 7337 5946 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_31320 7513 8346 gene locus_tag LOCUS_31330 7513 8346 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_31330 9281 8379 gene locus_tag LOCUS_31340 9281 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086303.1 protein_id gnl|my_center|LOCUS_31340 9442 10512 gene locus_tag LOCUS_31350 9442 10512 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_31350 11438 10509 gene locus_tag LOCUS_31360 11438 10509 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_31360 12400 11435 gene locus_tag LOCUS_31370 12400 11435 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 protein_id gnl|my_center|LOCUS_31370 12635 12928 gene locus_tag LOCUS_31380 12635 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 14628 12949 gene locus_tag LOCUS_31390 14628 12949 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_31390 15315 14650 gene locus_tag LOCUS_31400 gene pyrE 15315 14650 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD8 protein_id gnl|my_center|LOCUS_31400 15919 15638 gene locus_tag LOCUS_31410 15919 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 15815 17707 gene locus_tag LOCUS_31420 15815 17707 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_31420 17700 18170 gene locus_tag LOCUS_31430 17700 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 18706 18188 gene locus_tag LOCUS_31440 18706 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 18837 19847 gene locus_tag LOCUS_31450 18837 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_31450 19917 20915 gene locus_tag LOCUS_31460 19917 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 21771 20923 gene locus_tag LOCUS_31470 21771 20923 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089100.1 protein_id gnl|my_center|LOCUS_31470 21970 22590 gene locus_tag LOCUS_31480 21970 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 22599 23156 gene locus_tag LOCUS_31490 22599 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 23218 23916 gene locus_tag LOCUS_31500 23218 23916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 24012 24362 gene locus_tag LOCUS_31510 24012 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 24355 24873 gene locus_tag LOCUS_31520 24355 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 24922 25965 gene locus_tag LOCUS_31530 24922 25965 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_31530 <28085 25975 gene locus_tag LOCUS_31540 <28085 25975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942256.1:multidrug transporter >Feature sequence46 <1 735 gene locus_tag LOCUS_31550 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQB6:RNA polymerase sigma factor RpoD 829 905 gene locus_tag LOCUS_t00360 829 905 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1060 2349 gene locus_tag LOCUS_31560 1060 2349 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_31560 3949 2429 gene locus_tag LOCUS_31570 3949 2429 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ0 protein_id gnl|my_center|LOCUS_31570 5779 3953 gene locus_tag LOCUS_31580 5779 3953 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 protein_id gnl|my_center|LOCUS_31580 6809 5895 gene locus_tag LOCUS_31590 6809 5895 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313123.1 protein_id gnl|my_center|LOCUS_31590 6936 7904 gene locus_tag LOCUS_31600 6936 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 7913 8785 gene locus_tag LOCUS_31610 7913 8785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_31610 8778 9599 gene locus_tag LOCUS_31620 8778 9599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806976.1 protein_id gnl|my_center|LOCUS_31620 9601 10467 gene locus_tag LOCUS_31630 9601 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526741.1 protein_id gnl|my_center|LOCUS_31630 10627 11823 gene locus_tag LOCUS_31640 10627 11823 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_31640 13438 11846 gene locus_tag LOCUS_31650 13438 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 14347 13484 gene locus_tag LOCUS_31660 14347 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 15204 14452 gene locus_tag LOCUS_31670 15204 14452 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931405.1 protein_id gnl|my_center|LOCUS_31670 15394 16113 gene locus_tag LOCUS_31680 15394 16113 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927020.1 protein_id gnl|my_center|LOCUS_31680 16221 16922 gene locus_tag LOCUS_31690 16221 16922 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_31690 17254 17772 gene locus_tag LOCUS_31700 17254 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 18824 17769 gene locus_tag LOCUS_31710 18824 17769 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_31710 20689 18821 gene locus_tag LOCUS_31720 20689 18821 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403201.1 protein_id gnl|my_center|LOCUS_31720 20904 21245 gene locus_tag LOCUS_31730 20904 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_31730 21365 23104 gene locus_tag LOCUS_31740 21365 23104 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085980.1 protein_id gnl|my_center|LOCUS_31740 23151 23384 gene locus_tag LOCUS_31750 23151 23384 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085981.1 protein_id gnl|my_center|LOCUS_31750 23402 24364 gene locus_tag LOCUS_31760 23402 24364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085982.1 protein_id gnl|my_center|LOCUS_31760 24433 25161 gene locus_tag LOCUS_31770 gene dasR 24433 25161 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206682.1 protein_id gnl|my_center|LOCUS_31770 25175 25762 gene locus_tag LOCUS_31780 25175 25762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence47 127 690 gene locus_tag LOCUS_31790 gene omp 127 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_31790 861 1616 gene locus_tag LOCUS_31800 861 1616 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_31800 2406 1759 gene locus_tag LOCUS_31810 2406 1759 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_31810 2511 2597 gene locus_tag LOCUS_t00370 2511 2597 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2685 2924 gene locus_tag LOCUS_31820 2685 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2992 3900 gene locus_tag LOCUS_31830 2992 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 4379 4059 gene locus_tag LOCUS_31840 4379 4059 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707779.1 protein_id gnl|my_center|LOCUS_31840 4848 4465 gene locus_tag LOCUS_31850 4848 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 5204 7156 gene locus_tag LOCUS_31860 5204 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 8458 7166 gene locus_tag LOCUS_31870 gene eno 8458 7166 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFL1 protein_id gnl|my_center|LOCUS_31870 9462 8455 gene locus_tag LOCUS_31880 9462 8455 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701066.1 protein_id gnl|my_center|LOCUS_31880 10591 9464 gene locus_tag LOCUS_31890 gene cheB1 10591 9464 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_31890 10784 11965 gene locus_tag LOCUS_31900 10784 11965 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_31900 11982 13556 gene locus_tag LOCUS_31910 gene serA 11982 13556 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_31910 13675 14463 gene locus_tag LOCUS_31920 13675 14463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073325.1 protein_id gnl|my_center|LOCUS_31920 14516 15988 gene locus_tag LOCUS_31930 14516 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 16107 16316 gene locus_tag LOCUS_31940 16107 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 16406 16597 gene locus_tag LOCUS_31950 16406 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 16716 17144 gene locus_tag LOCUS_31960 16716 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 18039 17206 gene locus_tag LOCUS_31970 18039 17206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 18838 18032 gene locus_tag LOCUS_31980 18838 18032 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605157.1 protein_id gnl|my_center|LOCUS_31980 21925 19310 gene locus_tag LOCUS_31990 gene ndvB 21925 19310 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087385.1 protein_id gnl|my_center|LOCUS_31990 23549 22149 gene locus_tag LOCUS_32000 23549 22149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089102.1 protein_id gnl|my_center|LOCUS_32000 24552 23632 gene locus_tag LOCUS_32010 gene metA 24552 23632 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWE8 protein_id gnl|my_center|LOCUS_32010 25679 24633 gene locus_tag LOCUS_32020 25679 24633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence48 <1 829 gene locus_tag LOCUS_32030 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPE8:DNA topoisomerase 1 844 3132 gene locus_tag LOCUS_32040 gene rnr 844 3132 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE7 protein_id gnl|my_center|LOCUS_32040 3205 4824 gene locus_tag LOCUS_32050 3205 4824 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390952.1 protein_id gnl|my_center|LOCUS_32050 4938 5105 gene locus_tag LOCUS_32060 gene rpmG 4938 5105 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE5 protein_id gnl|my_center|LOCUS_32060 6599 5196 gene locus_tag LOCUS_32070 gene pleD 6599 5196 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_32070 6991 6626 gene locus_tag LOCUS_32080 6991 6626 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_32080 7830 7156 gene locus_tag LOCUS_32090 7830 7156 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_32090 9573 7957 gene locus_tag LOCUS_32100 gene ggt 9573 7957 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_32100 9762 10376 gene locus_tag LOCUS_32110 9762 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 10530 11705 gene locus_tag LOCUS_32120 gene hisZ 10530 11705 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_32120 11748 13040 gene locus_tag LOCUS_32130 gene purA 11748 13040 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_32130 13188 15293 gene locus_tag LOCUS_32140 13188 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_32140 15296 15934 gene locus_tag LOCUS_32150 15296 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 16838 15948 gene locus_tag LOCUS_32160 gene rpoH 16838 15948 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD4 protein_id gnl|my_center|LOCUS_32160 17946 16978 gene locus_tag LOCUS_32170 17946 16978 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD3 protein_id gnl|my_center|LOCUS_32170 18040 18393 gene locus_tag LOCUS_32180 18040 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 18398 18826 gene locus_tag LOCUS_32190 18398 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 18838 19872 gene locus_tag LOCUS_32200 18838 19872 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_32200 20937 19876 gene locus_tag LOCUS_32210 20937 19876 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_32210 22088 20937 gene locus_tag LOCUS_32220 22088 20937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039693.1 protein_id gnl|my_center|LOCUS_32220 22191 23006 gene locus_tag LOCUS_32230 22191 23006 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_32230 23012 24427 gene locus_tag LOCUS_32240 23012 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32240 24424 25098 gene locus_tag LOCUS_32250 24424 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence49 <1 533 gene locus_tag LOCUS_32260 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919030.1:dTDP-glucose 4,6-dehydratase 573 1169 gene locus_tag LOCUS_32270 gene gmhA1 573 1169 CDS product phosphoheptose isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNE6 protein_id gnl|my_center|LOCUS_32270 1166 2635 gene locus_tag LOCUS_32280 gene hldE 1166 2635 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_32280 4636 2681 gene locus_tag LOCUS_32290 4636 2681 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_32290 5104 4661 gene locus_tag LOCUS_32300 5104 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 7724 5241 gene locus_tag LOCUS_32310 gene gyrB 7724 5241 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI6 protein_id gnl|my_center|LOCUS_32310 8936 7791 gene locus_tag LOCUS_32320 gene recF 8936 7791 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI7 protein_id gnl|my_center|LOCUS_32320 10152 9037 gene locus_tag LOCUS_32330 10152 9037 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_32330 11895 10462 gene locus_tag LOCUS_32340 gene dnaA 11895 10462 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_32340 12070 11846 gene locus_tag LOCUS_32350 12070 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 12861 12595 gene locus_tag LOCUS_32360 gene rpsT 12861 12595 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5D1 protein_id gnl|my_center|LOCUS_32360 13776 13000 gene locus_tag LOCUS_32370 13776 13000 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_32370 14183 13818 gene locus_tag LOCUS_32380 14183 13818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 15028 14198 gene locus_tag LOCUS_32390 gene mutM 15028 14198 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY7 protein_id gnl|my_center|LOCUS_32390 15112 15924 gene locus_tag LOCUS_32400 gene ubiE 15112 15924 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 protein_id gnl|my_center|LOCUS_32400 15936 17477 gene locus_tag LOCUS_32410 15936 17477 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 protein_id gnl|my_center|LOCUS_32410 17587 18816 gene locus_tag LOCUS_32420 17587 18816 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_32420 18813 19283 gene locus_tag LOCUS_32430 gene dut 18813 19283 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_32430 19288 19743 gene locus_tag LOCUS_32440 19288 19743 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_32440 19787 20779 gene locus_tag LOCUS_32450 19787 20779 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391541.1 protein_id gnl|my_center|LOCUS_32450 20788 21633 gene locus_tag LOCUS_32460 20788 21633 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_32460 21608 22069 gene locus_tag LOCUS_32470 21608 22069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 22977 22168 gene locus_tag LOCUS_32480 22977 22168 CDS product 2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_32480 24370 22991 gene locus_tag LOCUS_32490 24370 22991 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388887.1 protein_id gnl|my_center|LOCUS_32490 <24974 24451 gene locus_tag LOCUS_32500 <24974 24451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391537.1:D-glycerate dehydrogenase >Feature sequence50 <1 1045 gene locus_tag LOCUS_32510 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWV4:60 kDa chaperonin 2 1212 2828 gene locus_tag LOCUS_32520 1212 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2843 3571 gene locus_tag LOCUS_32530 2843 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337347.1 protein_id gnl|my_center|LOCUS_32530 4035 3568 gene locus_tag LOCUS_32540 4035 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089945.1 protein_id gnl|my_center|LOCUS_32540 4303 4890 gene locus_tag LOCUS_32550 4303 4890 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_32550 5229 5858 gene locus_tag LOCUS_32560 5229 5858 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_32560 6086 7717 gene locus_tag LOCUS_32570 gene nrtA 6086 7717 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_32570 7729 8568 gene locus_tag LOCUS_32580 gene nrtB 7729 8568 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32580 8601 9539 gene locus_tag LOCUS_32590 gene nrtC 8601 9539 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_32590 9581 10030 gene locus_tag LOCUS_32600 gene cynS 9581 10030 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IA8 protein_id gnl|my_center|LOCUS_32600 10111 10779 gene locus_tag LOCUS_32610 10111 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 10912 11880 gene locus_tag LOCUS_32620 10912 11880 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 protein_id gnl|my_center|LOCUS_32620 11877 12998 gene locus_tag LOCUS_32630 11877 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 13048 13317 gene locus_tag LOCUS_32640 13048 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 14116 13526 gene locus_tag LOCUS_32650 14116 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 14469 16175 gene locus_tag LOCUS_32660 14469 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 17084 16185 gene locus_tag LOCUS_32670 17084 16185 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 protein_id gnl|my_center|LOCUS_32670 17176 18135 gene locus_tag LOCUS_32680 17176 18135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_32680 20903 18132 gene locus_tag LOCUS_32690 20903 18132 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_32690 <24106 21167 gene locus_tag LOCUS_32700 <24106 21167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084235.1:methionine synthase >Feature sequence51 <1 691 gene locus_tag LOCUS_32710 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387825.1:phytoene synthase 699 1964 gene locus_tag LOCUS_32720 699 1964 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_32720 2080 4071 gene locus_tag LOCUS_32730 2080 4071 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_32730 4085 4771 gene locus_tag LOCUS_32740 4085 4771 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_32740 5908 4724 gene locus_tag LOCUS_32750 5908 4724 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_32750 6907 5948 gene locus_tag LOCUS_32760 gene ispH 6907 5948 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD1 protein_id gnl|my_center|LOCUS_32760 7076 8077 gene locus_tag LOCUS_32770 7076 8077 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_32770 8218 8988 gene locus_tag LOCUS_32780 8218 8988 CDS product ADP-glucose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_32780 9777 9019 gene locus_tag LOCUS_32790 9777 9019 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_32790 9828 10556 gene locus_tag LOCUS_32800 9828 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 10553 13186 gene locus_tag LOCUS_32810 10553 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_32810 13183 14223 gene locus_tag LOCUS_32820 13183 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_32820 14880 14233 gene locus_tag LOCUS_32830 14880 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 15361 14933 gene locus_tag LOCUS_32840 15361 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 15887 16717 gene locus_tag LOCUS_32850 15887 16717 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387816.1 protein_id gnl|my_center|LOCUS_32850 17138 18022 gene locus_tag LOCUS_32860 gene rpoH2 17138 18022 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6K8 protein_id gnl|my_center|LOCUS_32860 18147 18911 gene locus_tag LOCUS_32870 18147 18911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389565.1 protein_id gnl|my_center|LOCUS_32870 19046 19876 gene locus_tag LOCUS_32880 19046 19876 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_32880 20854 19958 gene locus_tag LOCUS_32890 20854 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 21700 20906 gene locus_tag LOCUS_32900 21700 20906 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389559.1 protein_id gnl|my_center|LOCUS_32900 23203 21887 gene locus_tag LOCUS_32910 23203 21887 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_32910 >Feature sequence52 251 598 gene locus_tag LOCUS_32920 251 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 689 765 gene locus_tag LOCUS_t00380 689 765 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1166 855 gene locus_tag LOCUS_32930 1166 855 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974986.1 protein_id gnl|my_center|LOCUS_32930 1401 1156 gene locus_tag LOCUS_32940 1401 1156 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 protein_id gnl|my_center|LOCUS_32940 1631 2455 gene locus_tag LOCUS_32950 1631 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 2501 3421 gene locus_tag LOCUS_32960 2501 3421 CDS product 2-hydroxymethylglutarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461128.1 protein_id gnl|my_center|LOCUS_32960 3494 4024 gene locus_tag LOCUS_32970 3494 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4116 4646 gene locus_tag LOCUS_32980 4116 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 7820 4650 gene locus_tag LOCUS_32990 gene acrB 7820 4650 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123071.1 protein_id gnl|my_center|LOCUS_32990 8993 7827 gene locus_tag LOCUS_33000 8993 7827 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_33000 9775 9164 gene locus_tag LOCUS_33010 9775 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 10158 9841 gene locus_tag LOCUS_33020 gene bolA 10158 9841 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_33020 10445 12397 gene locus_tag LOCUS_33030 gene cbbT 10445 12397 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56900 protein_id gnl|my_center|LOCUS_33030 12427 13449 gene locus_tag LOCUS_33040 12427 13449 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_33040 13465 14121 gene locus_tag LOCUS_33050 13465 14121 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S24 protein_id gnl|my_center|LOCUS_33050 14889 14122 gene locus_tag LOCUS_33060 14889 14122 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 protein_id gnl|my_center|LOCUS_33060 15071 15811 gene locus_tag LOCUS_33070 15071 15811 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940051.1 protein_id gnl|my_center|LOCUS_33070 15825 16466 gene locus_tag LOCUS_33080 15825 16466 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_33080 16992 16483 gene locus_tag LOCUS_33090 16992 16483 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_33090 17743 16997 gene locus_tag LOCUS_33100 17743 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 18657 17746 gene locus_tag LOCUS_33110 18657 17746 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_33110 19765 18851 gene locus_tag LOCUS_33120 19765 18851 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_33120 19988 20209 gene locus_tag LOCUS_33130 19988 20209 CDS product UPF0033 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67103 protein_id gnl|my_center|LOCUS_33130 20250 22013 gene locus_tag LOCUS_33140 20250 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 22185 22033 gene locus_tag LOCUS_33150 22185 22033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence53 <1 899 gene locus_tag LOCUS_33160 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TER2:chaperone protein DnaK 994 2151 gene locus_tag LOCUS_33170 gene dnaJ 994 2151 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE7 protein_id gnl|my_center|LOCUS_33170 2308 3108 gene locus_tag LOCUS_33180 gene dapB 2308 3108 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_33180 3625 3113 gene locus_tag LOCUS_33190 3625 3113 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_33190 4939 3662 gene locus_tag LOCUS_33200 4939 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 5062 5703 gene locus_tag LOCUS_33210 gene nth 5062 5703 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 protein_id gnl|my_center|LOCUS_33210 6132 5710 gene locus_tag LOCUS_33220 6132 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 6728 6138 gene locus_tag LOCUS_33230 6728 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 7497 6733 gene locus_tag LOCUS_33240 7497 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 protein_id gnl|my_center|LOCUS_33240 7736 8746 gene locus_tag LOCUS_33250 7736 8746 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 protein_id gnl|my_center|LOCUS_33250 8870 10711 gene locus_tag LOCUS_33260 8870 10711 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_33260 10734 11372 gene locus_tag LOCUS_33270 gene can-2 10734 11372 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AP5 protein_id gnl|my_center|LOCUS_33270 11408 12670 gene locus_tag LOCUS_33280 11408 12670 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_33280 12771 13709 gene locus_tag LOCUS_33290 12771 13709 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_33290 15482 13764 gene locus_tag LOCUS_33300 15482 13764 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970278.1 protein_id gnl|my_center|LOCUS_33300 15657 16196 gene locus_tag LOCUS_33310 gene ppa 15657 16196 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC20 protein_id gnl|my_center|LOCUS_33310 16427 16936 gene locus_tag LOCUS_33320 16427 16936 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088456.1 protein_id gnl|my_center|LOCUS_33320 18989 17025 gene locus_tag LOCUS_33330 18989 17025 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 protein_id gnl|my_center|LOCUS_33330 <20329 19121 gene locus_tag LOCUS_33340 <20329 19121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528054.1:malic protein NAD-binding protein >Feature sequence54 1438 1214 gene locus_tag LOCUS_33350 1438 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 1531 2823 gene locus_tag LOCUS_33360 1531 2823 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391407.1 protein_id gnl|my_center|LOCUS_33360 2852 4426 gene locus_tag LOCUS_33370 2852 4426 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709806.1 protein_id gnl|my_center|LOCUS_33370 4530 5771 gene locus_tag LOCUS_33380 4530 5771 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389963.1 protein_id gnl|my_center|LOCUS_33380 7393 5768 gene locus_tag LOCUS_33390 7393 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 7558 8964 gene locus_tag LOCUS_33400 7558 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 8997 10454 gene locus_tag LOCUS_33410 8997 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 11467 10451 gene locus_tag LOCUS_33420 11467 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 12558 11647 gene locus_tag LOCUS_33430 12558 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 12614 12862 gene locus_tag LOCUS_33440 12614 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 13395 15347 gene locus_tag LOCUS_33450 gene asnB-2 13395 15347 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_33450 15746 15396 gene locus_tag LOCUS_33460 15746 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 15870 16253 gene locus_tag LOCUS_33470 15870 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 17194 16274 gene locus_tag LOCUS_33480 17194 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 18375 17284 gene locus_tag LOCUS_33490 18375 17284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence55 1549 158 gene locus_tag LOCUS_33500 1549 158 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_33500 2636 1620 gene locus_tag LOCUS_33510 2636 1620 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533036.1 protein_id gnl|my_center|LOCUS_33510 4072 2669 gene locus_tag LOCUS_33520 4072 2669 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533037.1 protein_id gnl|my_center|LOCUS_33520 4299 4682 gene locus_tag LOCUS_33530 4299 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33530 4731 6692 gene locus_tag LOCUS_33540 4731 6692 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33540 6697 7089 gene locus_tag LOCUS_33550 6697 7089 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_33550 7086 7550 gene locus_tag LOCUS_33560 7086 7550 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339163.1 protein_id gnl|my_center|LOCUS_33560 7565 7903 gene locus_tag LOCUS_33570 7565 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 8152 7985 gene locus_tag LOCUS_33580 8152 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 8784 9257 gene locus_tag LOCUS_33590 8784 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 9284 10993 gene locus_tag LOCUS_33600 gene copA 9284 10993 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_33600 10990 11712 gene locus_tag LOCUS_33610 10990 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 11727 12188 gene locus_tag LOCUS_33620 gene copG 11727 12188 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_33620 12688 12185 gene locus_tag LOCUS_33630 12688 12185 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_33630 14102 12921 gene locus_tag LOCUS_33640 14102 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 14899 14159 gene locus_tag LOCUS_33650 14899 14159 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_33650 15031 15927 gene locus_tag LOCUS_33660 15031 15927 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_33660 15924 16733 gene locus_tag LOCUS_33670 15924 16733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 16759 18231 gene locus_tag LOCUS_33680 16759 18231 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709743.1 protein_id gnl|my_center|LOCUS_33680 18705 18241 gene locus_tag LOCUS_33690 18705 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence56 709 623 gene locus_tag LOCUS_t00390 709 623 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 812 1501 gene locus_tag LOCUS_33700 gene lipB 812 1501 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSU9 protein_id gnl|my_center|LOCUS_33700 2483 1518 gene locus_tag LOCUS_33710 2483 1518 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088936.1 protein_id gnl|my_center|LOCUS_33710 2618 3127 gene locus_tag LOCUS_33720 2618 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_33720 3407 5425 gene locus_tag LOCUS_33730 3407 5425 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388476.1 protein_id gnl|my_center|LOCUS_33730 5718 5431 gene locus_tag LOCUS_33740 gene acyP 5718 5431 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ4 protein_id gnl|my_center|LOCUS_33740 7730 5745 gene locus_tag LOCUS_33750 gene pccA 7730 5745 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 protein_id gnl|my_center|LOCUS_33750 8173 7922 gene locus_tag LOCUS_33760 8173 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 8240 9721 gene locus_tag LOCUS_33770 8240 9721 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_33770 9899 9714 gene locus_tag LOCUS_33780 9899 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 9814 10764 gene locus_tag LOCUS_33790 9814 10764 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086114.1 protein_id gnl|my_center|LOCUS_33790 10773 11474 gene locus_tag LOCUS_33800 10773 11474 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102071.1 protein_id gnl|my_center|LOCUS_33800 13058 11886 gene locus_tag LOCUS_33810 13058 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_33810 13232 14350 gene locus_tag LOCUS_33820 13232 14350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_33820 14968 14360 gene locus_tag LOCUS_33830 14968 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 15272 15069 gene locus_tag LOCUS_33840 15272 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 15381 15824 gene locus_tag LOCUS_33850 15381 15824 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 protein_id gnl|my_center|LOCUS_33850 17115 15910 gene locus_tag LOCUS_33860 17115 15910 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545374.1 protein_id gnl|my_center|LOCUS_33860 18011 17127 gene locus_tag LOCUS_33870 18011 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_33870 >Feature sequence57 1179 451 gene locus_tag LOCUS_33880 1179 451 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FT1 protein_id gnl|my_center|LOCUS_33880 1529 1191 gene locus_tag LOCUS_33890 1529 1191 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339082.1 protein_id gnl|my_center|LOCUS_33890 1884 1534 gene locus_tag LOCUS_33900 1884 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 2607 1888 gene locus_tag LOCUS_33910 gene frdB 2607 1888 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_33910 3399 2632 gene locus_tag LOCUS_33920 3399 2632 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931598.1 protein_id gnl|my_center|LOCUS_33920 4377 3511 gene locus_tag LOCUS_33930 4377 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807537.1 protein_id gnl|my_center|LOCUS_33930 6693 4450 gene locus_tag LOCUS_33940 6693 4450 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_33940 7209 6799 gene locus_tag LOCUS_33950 7209 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064846.1 protein_id gnl|my_center|LOCUS_33950 8459 7206 gene locus_tag LOCUS_33960 8459 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064845.1 protein_id gnl|my_center|LOCUS_33960 9381 8473 gene locus_tag LOCUS_33970 9381 8473 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085712.1 protein_id gnl|my_center|LOCUS_33970 10129 9416 gene locus_tag LOCUS_33980 10129 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 10351 11433 gene locus_tag LOCUS_33990 gene ykfB 10351 11433 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34508 protein_id gnl|my_center|LOCUS_33990 11436 12203 gene locus_tag LOCUS_34000 11436 12203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 protein_id gnl|my_center|LOCUS_34000 12232 12966 gene locus_tag LOCUS_34010 12232 12966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 protein_id gnl|my_center|LOCUS_34010 13056 14384 gene locus_tag LOCUS_34020 13056 14384 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B650 protein_id gnl|my_center|LOCUS_34020 14481 15656 gene locus_tag LOCUS_34030 14481 15656 CDS product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972567.1 protein_id gnl|my_center|LOCUS_34030 16123 15653 gene locus_tag LOCUS_34040 gene brf1 16123 15653 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_34040 16601 16137 gene locus_tag LOCUS_34050 gene bfrB 16601 16137 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_34050 16743 17918 gene locus_tag LOCUS_34060 16743 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 >Feature sequence58 251 1051 gene locus_tag LOCUS_34070 251 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 981 2567 gene locus_tag LOCUS_34080 gene imuB 981 2567 CDS product protein ImuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J2 protein_id gnl|my_center|LOCUS_34080 2564 5746 gene locus_tag LOCUS_34090 gene dnaE2 2564 5746 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J3 protein_id gnl|my_center|LOCUS_34090 5823 6302 gene locus_tag LOCUS_34100 5823 6302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619982.1 protein_id gnl|my_center|LOCUS_34100 8618 6639 gene locus_tag LOCUS_34110 8618 6639 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 protein_id gnl|my_center|LOCUS_34110 9843 8812 gene locus_tag LOCUS_34120 9843 8812 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_34120 10335 9877 gene locus_tag LOCUS_34130 10335 9877 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_34130 10418 11044 gene locus_tag LOCUS_34140 gene nudF 10418 11044 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_34140 11846 11055 gene locus_tag LOCUS_34150 11846 11055 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082948.1 protein_id gnl|my_center|LOCUS_34150 12055 13059 gene locus_tag LOCUS_34160 gene cysK 12055 13059 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087225.1 protein_id gnl|my_center|LOCUS_34160 13083 13940 gene locus_tag LOCUS_34170 13083 13940 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_34170 13994 14746 gene locus_tag LOCUS_34180 13994 14746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537472.1 protein_id gnl|my_center|LOCUS_34180 16307 14817 gene locus_tag LOCUS_34190 16307 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 16932 16357 gene locus_tag LOCUS_34200 16932 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 18177 17386 gene locus_tag LOCUS_34210 gene aapP 18177 17386 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707870.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence59 2435 474 gene locus_tag LOCUS_34220 2435 474 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_34220 5633 2868 gene locus_tag LOCUS_34230 gene acnB 5633 2868 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_34230 6064 8781 gene locus_tag LOCUS_34240 6064 8781 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_34240 9177 8860 gene locus_tag LOCUS_34250 9177 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 9407 9607 gene locus_tag LOCUS_34260 9407 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 11595 9655 gene locus_tag LOCUS_34270 gene htpG 11595 9655 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYB8 protein_id gnl|my_center|LOCUS_34270 11730 12413 gene locus_tag LOCUS_34280 gene pcm 11730 12413 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_34280 12457 15027 gene locus_tag LOCUS_34290 12457 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 15024 15428 gene locus_tag LOCUS_34300 15024 15428 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_34300 16056 15433 gene locus_tag LOCUS_34310 16056 15433 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_34310 16152 16631 gene locus_tag LOCUS_34320 16152 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_34320 16726 17061 gene locus_tag LOCUS_34330 16726 17061 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence60 2588 4885 gene locus_tag LOCUS_34340 2588 4885 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_34340 7575 4894 gene locus_tag LOCUS_34350 7575 4894 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 protein_id gnl|my_center|LOCUS_34350 10087 7697 gene locus_tag LOCUS_34360 10087 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 10536 10084 gene locus_tag LOCUS_34370 10536 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 10483 10644 gene locus_tag LOCUS_34380 10483 10644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 10779 12059 gene locus_tag LOCUS_34390 gene dinB1 10779 12059 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM8 protein_id gnl|my_center|LOCUS_34390 12753 12064 gene locus_tag LOCUS_34400 12753 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 12881 13186 gene locus_tag LOCUS_34410 12881 13186 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID2 protein_id gnl|my_center|LOCUS_34410 13226 15154 gene locus_tag LOCUS_34420 13226 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 15292 15217 gene locus_tag LOCUS_t00400 15292 15217 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence61 707 2044 gene locus_tag LOCUS_34430 707 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 2088 3395 gene locus_tag LOCUS_34440 2088 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 4420 3404 gene locus_tag LOCUS_34450 gene cobT 4420 3404 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH66 protein_id gnl|my_center|LOCUS_34450 4537 5334 gene locus_tag LOCUS_34460 gene cobS 4537 5334 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9W5 protein_id gnl|my_center|LOCUS_34460 5331 6005 gene locus_tag LOCUS_34470 5331 6005 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_34470 6076 6609 gene locus_tag LOCUS_34480 6076 6609 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388428.1 protein_id gnl|my_center|LOCUS_34480 6636 7658 gene locus_tag LOCUS_34490 6636 7658 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_34490 7718 11482 gene locus_tag LOCUS_34500 gene cobN 7718 11482 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969595.1 protein_id gnl|my_center|LOCUS_34500 11541 12173 gene locus_tag LOCUS_34510 gene cobO 11541 12173 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 protein_id gnl|my_center|LOCUS_34510 12196 12885 gene locus_tag LOCUS_34520 12196 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 12869 14389 gene locus_tag LOCUS_34530 gene cobQ 12869 14389 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNX0 protein_id gnl|my_center|LOCUS_34530 14754 14386 gene locus_tag LOCUS_34540 14754 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972482.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence62 <1 882 gene locus_tag LOCUS_34550 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXU6:inosine-5'-monophosphate dehydrogenase 893 1504 gene locus_tag LOCUS_34560 893 1504 CDS product pyridoxamine 5'-phosphate oxidase-like FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_34560 2006 1524 gene locus_tag LOCUS_34570 2006 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2650 2132 gene locus_tag LOCUS_34580 2650 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3278 2667 gene locus_tag LOCUS_34590 3278 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3967 3299 gene locus_tag LOCUS_34600 3967 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 4176 5501 gene locus_tag LOCUS_34610 4176 5501 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_34610 5541 6566 gene locus_tag LOCUS_34620 5541 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_34620 6863 6639 gene locus_tag LOCUS_34630 6863 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 6996 7328 gene locus_tag LOCUS_34640 6996 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389484.1 protein_id gnl|my_center|LOCUS_34640 7360 8223 gene locus_tag LOCUS_34650 7360 8223 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027572.1 protein_id gnl|my_center|LOCUS_34650 8300 8776 gene locus_tag LOCUS_34660 8300 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 8798 9571 gene locus_tag LOCUS_34670 8798 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 10564 9581 gene locus_tag LOCUS_34680 10564 9581 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_34680 11643 10561 gene locus_tag LOCUS_34690 11643 10561 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090352.1 protein_id gnl|my_center|LOCUS_34690 12449 11640 gene locus_tag LOCUS_34700 12449 11640 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_34700 13033 12446 gene locus_tag LOCUS_34710 13033 12446 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_34710 13582 13088 gene locus_tag LOCUS_34720 13582 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence63 35 532 gene locus_tag LOCUS_34730 35 532 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496437.1 protein_id gnl|my_center|LOCUS_34730 535 1098 gene locus_tag LOCUS_34740 535 1098 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496438.1 protein_id gnl|my_center|LOCUS_34740 1286 2218 gene locus_tag LOCUS_34750 1286 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 2224 3267 gene locus_tag LOCUS_34760 2224 3267 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_34760 4263 4535 gene locus_tag LOCUS_34770 4263 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 6838 5411 gene locus_tag LOCUS_34780 6838 5411 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_34780 6930 8210 gene locus_tag LOCUS_34790 6930 8210 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709513.1 protein_id gnl|my_center|LOCUS_34790 8777 8229 gene locus_tag LOCUS_34800 8777 8229 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_34800 8950 9576 gene locus_tag LOCUS_34810 8950 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 9600 10508 gene locus_tag LOCUS_34820 9600 10508 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_34820 10519 11703 gene locus_tag LOCUS_34830 10519 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34830 11666 12622 gene locus_tag LOCUS_34840 11666 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34840 12652 13896 gene locus_tag LOCUS_34850 12652 13896 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence64 2675 1512 gene locus_tag LOCUS_34860 2675 1512 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_34860 3993 3115 gene locus_tag LOCUS_34870 3993 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 4721 3990 gene locus_tag LOCUS_34880 4721 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 5090 4776 gene locus_tag LOCUS_34890 5090 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 5206 5931 gene locus_tag LOCUS_34900 5206 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384149.1 protein_id gnl|my_center|LOCUS_34900 5985 7394 gene locus_tag LOCUS_34910 gene bamB 5985 7394 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV98 protein_id gnl|my_center|LOCUS_34910 7439 8857 gene locus_tag LOCUS_34920 gene der 7439 8857 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPR6 protein_id gnl|my_center|LOCUS_34920 9536 8871 gene locus_tag LOCUS_34930 9536 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 9999 9697 gene locus_tag LOCUS_34940 9999 9697 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_34940 10423 10100 gene locus_tag LOCUS_34950 10423 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 10650 10399 gene locus_tag LOCUS_34960 10650 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 11901 10666 gene locus_tag LOCUS_34970 11901 10666 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_34970 13753 11906 gene locus_tag LOCUS_34980 13753 11906 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_34980 12172 12082 gene locus_tag LOCUS_t00410 12172 12082 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence65 <1 1004 gene locus_tag LOCUS_34990 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZ87:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1063 2475 gene locus_tag LOCUS_35000 1063 2475 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_35000 2632 3468 gene locus_tag LOCUS_35010 2632 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529691.1 protein_id gnl|my_center|LOCUS_35010 3550 4770 gene locus_tag LOCUS_35020 3550 4770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085877.1 protein_id gnl|my_center|LOCUS_35020 5729 4767 gene locus_tag LOCUS_35030 gene xerC 5729 4767 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV24 protein_id gnl|my_center|LOCUS_35030 6475 5726 gene locus_tag LOCUS_35040 6475 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 6590 8803 gene locus_tag LOCUS_35050 gene priA 6590 8803 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S6 protein_id gnl|my_center|LOCUS_35050 9034 9585 gene locus_tag LOCUS_35060 gene atpH 9034 9585 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_35060 9601 11136 gene locus_tag LOCUS_35070 gene atpA 9601 11136 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 protein_id gnl|my_center|LOCUS_35070 11191 12081 gene locus_tag LOCUS_35080 gene atpG 11191 12081 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV19 protein_id gnl|my_center|LOCUS_35080 >Feature sequence66 467 1078 gene locus_tag LOCUS_35090 467 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_35090 1570 1082 gene locus_tag LOCUS_35100 1570 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 2277 1786 gene locus_tag LOCUS_35110 2277 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 2937 2659 gene locus_tag LOCUS_35120 2937 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3121 3375 gene locus_tag LOCUS_35130 3121 3375 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_35130 3372 3710 gene locus_tag LOCUS_35140 3372 3710 CDS product antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390945.1 protein_id gnl|my_center|LOCUS_35140 4288 3761 gene locus_tag LOCUS_35150 4288 3761 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_35150 6158 4257 gene locus_tag LOCUS_35160 6158 4257 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_35160 7324 6431 gene locus_tag LOCUS_35170 7324 6431 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_35170 7469 9106 gene locus_tag LOCUS_35180 7469 9106 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_35180 9370 9170 gene locus_tag LOCUS_35190 9370 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 10866 9466 gene locus_tag LOCUS_35200 gene udhA 10866 9466 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224567.1 protein_id gnl|my_center|LOCUS_35200 11695 10970 gene locus_tag LOCUS_35210 11695 10970 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MX7 protein_id gnl|my_center|LOCUS_35210 12164 11895 gene locus_tag LOCUS_35220 12164 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 12583 12329 gene locus_tag LOCUS_35230 12583 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence67 <1 617 gene locus_tag LOCUS_35240 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337372.1:ABC transporter ATP-binding protein 639 1580 gene locus_tag LOCUS_35250 639 1580 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_35250 1584 2660 gene locus_tag LOCUS_35260 1584 2660 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_35260 2843 4162 gene locus_tag LOCUS_35270 2843 4162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_35270 4207 5058 gene locus_tag LOCUS_35280 4207 5058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_35280 5130 6371 gene locus_tag LOCUS_35290 5130 6371 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_35290 7317 6385 gene locus_tag LOCUS_35300 7317 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 8046 7411 gene locus_tag LOCUS_35310 8046 7411 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_35310 8405 9058 gene locus_tag LOCUS_35320 gene ccmA 8405 9058 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 protein_id gnl|my_center|LOCUS_35320 9055 9720 gene locus_tag LOCUS_35330 9055 9720 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF1 protein_id gnl|my_center|LOCUS_35330 9749 10480 gene locus_tag LOCUS_35340 gene ccmC 9749 10480 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709716.1 protein_id gnl|my_center|LOCUS_35340 10640 10849 gene locus_tag LOCUS_35350 10640 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 10846 11316 gene locus_tag LOCUS_35360 gene ccmE 10846 11316 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_35360 >Feature sequence68 <1 662 gene locus_tag LOCUS_35370 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQI0:alanine--tRNA ligase 671 1522 gene locus_tag LOCUS_35380 671 1522 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089434.1 protein_id gnl|my_center|LOCUS_35380 1530 1841 gene locus_tag LOCUS_35390 1530 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 1888 3231 gene locus_tag LOCUS_35400 1888 3231 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_35400 3559 3251 gene locus_tag LOCUS_35410 3559 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3654 4829 gene locus_tag LOCUS_35420 3654 4829 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_35420 5404 4850 gene locus_tag LOCUS_35430 gene ppiB 5404 4850 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L58 protein_id gnl|my_center|LOCUS_35430 6041 5511 gene locus_tag LOCUS_35440 6041 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 7166 6120 gene locus_tag LOCUS_35450 7166 6120 CDS product LAO/AO transport system kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_35450 7522 7163 gene locus_tag LOCUS_35460 7522 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 8924 7629 gene locus_tag LOCUS_35470 8924 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 9231 10646 gene locus_tag LOCUS_35480 9231 10646 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_35480 >Feature sequence69 <1 768 gene locus_tag LOCUS_35490 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YIH1:UPF0173 metal-dependent hydrolase 854 2020 gene locus_tag LOCUS_35500 854 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 2973 2056 gene locus_tag LOCUS_35510 gene htpX 2973 2056 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 protein_id gnl|my_center|LOCUS_35510 3930 3079 gene locus_tag LOCUS_35520 3930 3079 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105361.1 protein_id gnl|my_center|LOCUS_35520 4100 4618 gene locus_tag LOCUS_35530 4100 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 5109 4615 gene locus_tag LOCUS_35540 5109 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 5318 5884 gene locus_tag LOCUS_35550 5318 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 7254 5845 gene locus_tag LOCUS_35560 7254 5845 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_35560 8145 7261 gene locus_tag LOCUS_35570 gene tauD 8145 7261 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_35570 9309 8185 gene locus_tag LOCUS_35580 9309 8185 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970240.1 protein_id gnl|my_center|LOCUS_35580 9484 10506 gene locus_tag LOCUS_35590 9484 10506 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence70 367 636 gene locus_tag LOCUS_35600 gene rpsO 367 636 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU3 protein_id gnl|my_center|LOCUS_35600 861 3047 gene locus_tag LOCUS_35610 gene pnp 861 3047 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR6 protein_id gnl|my_center|LOCUS_35610 3293 3805 gene locus_tag LOCUS_35620 gene fabA 3293 3805 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVZ8 protein_id gnl|my_center|LOCUS_35620 3818 5038 gene locus_tag LOCUS_35630 gene fabB 3818 5038 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_35630 5076 5936 gene locus_tag LOCUS_35640 5076 5936 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT9 protein_id gnl|my_center|LOCUS_35640 6081 6548 gene locus_tag LOCUS_35650 6081 6548 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_35650 6739 7155 gene locus_tag LOCUS_35660 6739 7155 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_35660 7415 8755 gene locus_tag LOCUS_35670 7415 8755 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_35670 8763 9380 gene locus_tag LOCUS_35680 8763 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 10109 9540 gene locus_tag LOCUS_35690 10109 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence71 134 61 gene locus_tag LOCUS_t00420 134 61 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 412 1068 gene locus_tag LOCUS_35700 412 1068 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_35700 1227 2645 gene locus_tag LOCUS_35710 1227 2645 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_35710 2889 3476 gene locus_tag LOCUS_35720 2889 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3605 6274 gene locus_tag LOCUS_35730 gene valS 3605 6274 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 protein_id gnl|my_center|LOCUS_35730 6736 7602 gene locus_tag LOCUS_35740 6736 7602 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_35740 8461 7631 gene locus_tag LOCUS_35750 8461 7631 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707167.1 protein_id gnl|my_center|LOCUS_35750 8883 8461 gene locus_tag LOCUS_35760 8883 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 9244 8909 gene locus_tag LOCUS_35770 9244 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence72 846 409 gene locus_tag LOCUS_35780 846 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1223 843 gene locus_tag LOCUS_35790 1223 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 1694 1236 gene locus_tag LOCUS_35800 1694 1236 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840937.1 protein_id gnl|my_center|LOCUS_35800 2049 3779 gene locus_tag LOCUS_35810 2049 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 3794 6124 gene locus_tag LOCUS_35820 3794 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 7109 6279 gene locus_tag LOCUS_35830 gene nadX 7109 6279 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FY1 protein_id gnl|my_center|LOCUS_35830 7595 7179 gene locus_tag LOCUS_35840 7595 7179 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389747.1 protein_id gnl|my_center|LOCUS_35840 9087 7672 gene locus_tag LOCUS_35850 9087 7672 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_35850 >Feature sequence73 <1 576 gene locus_tag LOCUS_35860 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870811.1:fumarate hydratase 663 1274 gene locus_tag LOCUS_35870 663 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35870 1271 3010 gene locus_tag LOCUS_35880 gene sdhA 1271 3010 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_35880 3743 3012 gene locus_tag LOCUS_35890 3743 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933004.1 protein_id gnl|my_center|LOCUS_35890 3888 4673 gene locus_tag LOCUS_35900 3888 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4780 5835 gene locus_tag LOCUS_35910 4780 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 6760 5828 gene locus_tag LOCUS_35920 6760 5828 CDS product phosphate acetyl/butyryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064309.1 protein_id gnl|my_center|LOCUS_35920 >Feature sequence74 1660 794 gene locus_tag LOCUS_35930 gene coxB 1660 794 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6E5 protein_id gnl|my_center|LOCUS_35930 2081 2512 gene locus_tag LOCUS_35940 2081 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2509 3927 gene locus_tag LOCUS_35950 2509 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDE9 protein_id gnl|my_center|LOCUS_35950 3971 4933 gene locus_tag LOCUS_35960 gene ctaB 3971 4933 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX3 protein_id gnl|my_center|LOCUS_35960 4949 6466 gene locus_tag LOCUS_35970 4949 6466 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence75 1802 414 gene locus_tag LOCUS_35980 1802 414 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_35980 3070 1799 gene locus_tag LOCUS_35990 3070 1799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_35990 4657 3080 gene locus_tag LOCUS_36000 gene gpmI 4657 3080 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_36000 5265 4807 gene locus_tag LOCUS_36010 gene rlmH 5265 4807 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI5 protein_id gnl|my_center|LOCUS_36010 5779 5420 gene locus_tag LOCUS_36020 gene rsfS 5779 5420 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2X4 protein_id gnl|my_center|LOCUS_36020 >Feature sequence76 866 1087 gene locus_tag LOCUS_36030 866 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 1341 1252 gene locus_tag LOCUS_t00430 1341 1252 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1684 2181 gene locus_tag LOCUS_36040 1684 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 2195 2452 gene locus_tag LOCUS_36050 gene rpmA 2195 2452 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9X6 protein_id gnl|my_center|LOCUS_36050 2548 3600 gene locus_tag LOCUS_36060 gene obg 2548 3600 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_36060 3597 4739 gene locus_tag LOCUS_36070 gene proB 3597 4739 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV05 protein_id gnl|my_center|LOCUS_36070 >Feature sequence77 <1 525 gene locus_tag LOCUS_36080 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV32:succinate--CoA ligase [ADP-forming] subunit alpha 597 3587 gene locus_tag LOCUS_36090 gene sucA 597 3587 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence78 1752 496 gene locus_tag LOCUS_36100 1752 496 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_36100 2195 1893 gene locus_tag LOCUS_36110 2195 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 <3634 2257 gene locus_tag LOCUS_36120 <3634 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TKA4:dihydroxy-acid dehydratase >Feature sequence79 1407 541 gene locus_tag LOCUS_36130 1407 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_36130 >Feature sequence80 85 483 gene locus_tag LOCUS_36140 85 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence81 173 1021 gene locus_tag LOCUS_36150 gene ureD 173 1021 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42888 protein_id gnl|my_center|LOCUS_36150 1049 1351 gene locus_tag LOCUS_36160 gene ureA 1049 1351 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42887 protein_id gnl|my_center|LOCUS_36160