>Feature sequence001 1064 321 gene locus_tag LOCUS_00010 gene pdxJ 1064 321 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_00010 2107 1061 gene locus_tag LOCUS_00020 gene queA 2107 1061 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y2 protein_id gnl|my_center|LOCUS_00020 2807 2112 gene locus_tag LOCUS_00030 2807 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4615 2870 gene locus_tag LOCUS_00040 gene ilvD 4615 2870 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_00040 4784 5305 gene locus_tag LOCUS_00050 4784 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6185 5361 gene locus_tag LOCUS_00060 gene mutM 6185 5361 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGY3 protein_id gnl|my_center|LOCUS_00060 6931 6365 gene locus_tag LOCUS_00070 6931 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7883 6915 gene locus_tag LOCUS_00080 gene thiL 7883 6915 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57532 protein_id gnl|my_center|LOCUS_00080 8392 8655 gene locus_tag LOCUS_00090 8392 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8696 9616 gene locus_tag LOCUS_00100 8696 9616 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774558.1 protein_id gnl|my_center|LOCUS_00100 9609 9872 gene locus_tag LOCUS_00110 9609 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9899 10831 gene locus_tag LOCUS_00120 gene ddl 9899 10831 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF57 protein_id gnl|my_center|LOCUS_00120 11075 10893 gene locus_tag LOCUS_00130 11075 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11351 11139 gene locus_tag LOCUS_00140 11351 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12158 11445 gene locus_tag LOCUS_00150 12158 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12781 12185 gene locus_tag LOCUS_00160 12781 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14875 12806 gene locus_tag LOCUS_00170 14875 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_00170 15797 15300 gene locus_tag LOCUS_00180 15797 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17331 15931 gene locus_tag LOCUS_00190 gene radA 17331 15931 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJI4 protein_id gnl|my_center|LOCUS_00190 17797 17348 gene locus_tag LOCUS_00200 17797 17348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17841 18959 gene locus_tag LOCUS_00210 gene mnmA 17841 18959 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDM1 protein_id gnl|my_center|LOCUS_00210 21773 19218 gene locus_tag LOCUS_00220 gene leuS 21773 19218 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDB1 protein_id gnl|my_center|LOCUS_00220 22584 21808 gene locus_tag LOCUS_00230 gene map 22584 21808 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCD3 protein_id gnl|my_center|LOCUS_00230 22692 23006 gene locus_tag LOCUS_00240 22692 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23382 23633 gene locus_tag LOCUS_00250 23382 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23630 23995 gene locus_tag LOCUS_00260 gene nuoA1 23630 23995 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68852 protein_id gnl|my_center|LOCUS_00260 24851 24336 gene locus_tag LOCUS_00270 24851 24336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26931 24856 gene locus_tag LOCUS_00280 26931 24856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_00280 27708 28838 gene locus_tag LOCUS_00290 27708 28838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29384 28938 gene locus_tag LOCUS_00300 29384 28938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30623 30952 gene locus_tag LOCUS_00310 30623 30952 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707673.1 protein_id gnl|my_center|LOCUS_00310 30967 31422 gene locus_tag LOCUS_00320 30967 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31415 32068 gene locus_tag LOCUS_00330 31415 32068 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFL5 protein_id gnl|my_center|LOCUS_00330 32061 32894 gene locus_tag LOCUS_00340 32061 32894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 32898 33617 gene locus_tag LOCUS_00350 32898 33617 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_00350 33633 34118 gene locus_tag LOCUS_00360 33633 34118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38403 34636 gene locus_tag LOCUS_00370 38403 34636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39040 38390 gene locus_tag LOCUS_00380 gene hisG 39040 38390 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_00380 39869 39297 gene locus_tag LOCUS_00390 39869 39297 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_00390 40812 39916 gene locus_tag LOCUS_00400 40812 39916 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_00400 41872 40805 gene locus_tag LOCUS_00410 gene purK 41872 40805 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7A9 protein_id gnl|my_center|LOCUS_00410 42337 41873 gene locus_tag LOCUS_00420 42337 41873 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_00420 42885 42340 gene locus_tag LOCUS_00430 42885 42340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596551.1 protein_id gnl|my_center|LOCUS_00430 43105 44334 gene locus_tag LOCUS_00440 gene ftsA 43105 44334 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_00440 45074 44580 gene locus_tag LOCUS_00450 45074 44580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46036 45068 gene locus_tag LOCUS_00460 46036 45068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46878 46189 gene locus_tag LOCUS_00470 46878 46189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46901 47404 gene locus_tag LOCUS_00480 gene rimM 46901 47404 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBZ8 protein_id gnl|my_center|LOCUS_00480 47401 47925 gene locus_tag LOCUS_00490 gene ddpX 47401 47925 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMT9 protein_id gnl|my_center|LOCUS_00490 47941 48801 gene locus_tag LOCUS_00500 gene exoN 47941 48801 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084315.1 protein_id gnl|my_center|LOCUS_00500 50653 48845 gene locus_tag LOCUS_00510 50653 48845 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_00510 50849 51745 gene locus_tag LOCUS_00520 gene ispE 50849 51745 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HY17 protein_id gnl|my_center|LOCUS_00520 51841 52590 gene locus_tag LOCUS_00530 51841 52590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_00530 53282 52866 gene locus_tag LOCUS_00540 53282 52866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 protein_id gnl|my_center|LOCUS_00540 53642 53292 gene locus_tag LOCUS_00550 53642 53292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54253 53735 gene locus_tag LOCUS_00560 gene ahpD 54253 53735 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM5 protein_id gnl|my_center|LOCUS_00560 54872 54324 gene locus_tag LOCUS_00570 54872 54324 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_00570 55569 55494 gene locus_tag LOCUS_t00010 55569 55494 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 56726 55707 gene locus_tag LOCUS_00580 56726 55707 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 protein_id gnl|my_center|LOCUS_00580 57741 56896 gene locus_tag LOCUS_00590 57741 56896 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090211.1 protein_id gnl|my_center|LOCUS_00590 58892 57894 gene locus_tag LOCUS_00600 58892 57894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59008 59409 gene locus_tag LOCUS_00610 59008 59409 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881597.1 protein_id gnl|my_center|LOCUS_00610 59412 60785 gene locus_tag LOCUS_00620 gene ffh 59412 60785 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2B3 protein_id gnl|my_center|LOCUS_00620 60785 61597 gene locus_tag LOCUS_00630 60785 61597 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537935.1 protein_id gnl|my_center|LOCUS_00630 61670 61948 gene locus_tag LOCUS_00640 61670 61948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 61951 62505 gene locus_tag LOCUS_00650 61951 62505 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_00650 62521 63393 gene locus_tag LOCUS_00660 62521 63393 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886283.1 protein_id gnl|my_center|LOCUS_00660 63409 64155 gene locus_tag LOCUS_00670 gene truA 63409 64155 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCA3 protein_id gnl|my_center|LOCUS_00670 <65003 64337 gene locus_tag LOCUS_00680 <65003 64337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886288.1:glycosyl transferase family 1 >Feature sequence002 700 2184 gene locus_tag LOCUS_00690 gene trpE 700 2184 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95646 protein_id gnl|my_center|LOCUS_00690 3428 2199 gene locus_tag LOCUS_00700 3428 2199 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_00700 4007 3429 gene locus_tag LOCUS_00710 4007 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4941 4168 gene locus_tag LOCUS_00720 4941 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 6971 5253 gene locus_tag LOCUS_00730 6971 5253 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597660.1 protein_id gnl|my_center|LOCUS_00730 8730 7324 gene locus_tag LOCUS_00740 gene thrC 8730 7324 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103569.1 protein_id gnl|my_center|LOCUS_00740 9992 8904 gene locus_tag LOCUS_00750 gene ribD 9992 8904 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_00750 11502 10006 gene locus_tag LOCUS_00760 11502 10006 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_00760 12196 11798 gene locus_tag LOCUS_00770 12196 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12388 12230 gene locus_tag LOCUS_00780 12388 12230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12484 12408 gene locus_tag LOCUS_t00020 12484 12408 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 12661 13293 gene locus_tag LOCUS_00790 12661 13293 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_00790 14935 13481 gene locus_tag LOCUS_00800 gene dnaB 14935 13481 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD08 protein_id gnl|my_center|LOCUS_00800 15277 16017 gene locus_tag LOCUS_00810 15277 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 16505 16086 gene locus_tag LOCUS_00820 gene ndk 16505 16086 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7M2 protein_id gnl|my_center|LOCUS_00820 16641 18407 gene locus_tag LOCUS_00830 16641 18407 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_00830 18397 20898 gene locus_tag LOCUS_00840 18397 20898 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_00840 22257 21319 gene locus_tag LOCUS_00850 gene rimK 22257 21319 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYF8 protein_id gnl|my_center|LOCUS_00850 22295 23179 gene locus_tag LOCUS_00860 22295 23179 CDS product putative glutamine amidotransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC7 protein_id gnl|my_center|LOCUS_00860 23653 24291 gene locus_tag LOCUS_00870 23653 24291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 26181 24646 gene locus_tag LOCUS_00880 gene secD 26181 24646 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCW8 protein_id gnl|my_center|LOCUS_00880 26435 26181 gene locus_tag LOCUS_00890 26435 26181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 27334 26744 gene locus_tag LOCUS_00900 27334 26744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 28199 27342 gene locus_tag LOCUS_00910 28199 27342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 29299 28460 gene locus_tag LOCUS_00920 29299 28460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 29244 29522 gene locus_tag LOCUS_00930 29244 29522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 29629 29838 gene locus_tag LOCUS_00940 gene thiS 29629 29838 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941252.1 protein_id gnl|my_center|LOCUS_00940 30514 30599 gene locus_tag LOCUS_t00030 30514 30599 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30794 34837 gene locus_tag LOCUS_00950 30794 34837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 34915 35514 gene locus_tag LOCUS_00960 34915 35514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 35489 36277 gene locus_tag LOCUS_00970 35489 36277 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709173.1 protein_id gnl|my_center|LOCUS_00970 36265 37617 gene locus_tag LOCUS_00980 gene miaB 36265 37617 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCE8 protein_id gnl|my_center|LOCUS_00980 38687 37644 gene locus_tag LOCUS_00990 38687 37644 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596966.1 protein_id gnl|my_center|LOCUS_00990 40191 38680 gene locus_tag LOCUS_01000 gene leuA 40191 38680 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H607 protein_id gnl|my_center|LOCUS_01000 40917 42341 gene locus_tag LOCUS_01010 40917 42341 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_01010 42807 43910 gene locus_tag LOCUS_01020 42807 43910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 43900 45219 gene locus_tag LOCUS_01030 gene aroA 43900 45219 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC80 protein_id gnl|my_center|LOCUS_01030 45991 45239 gene locus_tag LOCUS_01040 gene ubiG 45991 45239 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ9 protein_id gnl|my_center|LOCUS_01040 46922 46272 gene locus_tag LOCUS_01050 gene rplY 46922 46272 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_01050 48944 47430 gene locus_tag LOCUS_01060 48944 47430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852900.1 protein_id gnl|my_center|LOCUS_01060 54037 49289 gene locus_tag LOCUS_01070 54037 49289 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_01070 54740 54213 gene locus_tag LOCUS_01080 gene infC 54740 54213 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_01080 54896 57280 gene locus_tag LOCUS_01090 54896 57280 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599743.1 protein_id gnl|my_center|LOCUS_01090 57351 61127 gene locus_tag LOCUS_01100 57351 61127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 61120 61608 gene locus_tag LOCUS_01110 gene pgpA 61120 61608 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P818 protein_id gnl|my_center|LOCUS_01110 61608 62672 gene locus_tag LOCUS_01120 61608 62672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence003 1561 407 gene locus_tag LOCUS_01130 1561 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3169 1601 gene locus_tag LOCUS_01140 3169 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3911 3243 gene locus_tag LOCUS_01150 3911 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5275 4196 gene locus_tag LOCUS_01160 gene wbiB 5275 4196 CDS product epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205203.1 protein_id gnl|my_center|LOCUS_01160 8711 5268 gene locus_tag LOCUS_01170 8711 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9937 8822 gene locus_tag LOCUS_01180 9937 8822 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965472.1 protein_id gnl|my_center|LOCUS_01180 11149 9995 gene locus_tag LOCUS_01190 11149 9995 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_01190 12145 11150 gene locus_tag LOCUS_01200 gene pseB 12145 11150 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_01200 13568 12132 gene locus_tag LOCUS_01210 13568 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 14595 13561 gene locus_tag LOCUS_01220 14595 13561 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_01220 15924 14599 gene locus_tag LOCUS_01230 15924 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 16079 17428 gene locus_tag LOCUS_01240 gene manC 16079 17428 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125914.1 protein_id gnl|my_center|LOCUS_01240 17511 18587 gene locus_tag LOCUS_01250 17511 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 19201 18698 gene locus_tag LOCUS_01260 19201 18698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20244 19198 gene locus_tag LOCUS_01270 gene rkpO 20244 19198 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887053.1 protein_id gnl|my_center|LOCUS_01270 20926 20234 gene locus_tag LOCUS_01280 20926 20234 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_01280 22313 20913 gene locus_tag LOCUS_01290 22313 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 23192 22326 gene locus_tag LOCUS_01300 23192 22326 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_01300 24482 23196 gene locus_tag LOCUS_01310 gene hemL 24482 23196 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974175.1 protein_id gnl|my_center|LOCUS_01310 24566 25531 gene locus_tag LOCUS_01320 gene rluD 24566 25531 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CX17 protein_id gnl|my_center|LOCUS_01320 25687 26271 gene locus_tag LOCUS_01330 25687 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 28509 26668 gene locus_tag LOCUS_01340 28509 26668 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW91 protein_id gnl|my_center|LOCUS_01340 32461 28991 gene locus_tag LOCUS_01350 gene mfd 32461 28991 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LE3 protein_id gnl|my_center|LOCUS_01350 32787 33305 gene locus_tag LOCUS_01360 32787 33305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 33581 34888 gene locus_tag LOCUS_01370 gene gltP 33581 34888 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_01370 35109 36392 gene locus_tag LOCUS_01380 35109 36392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 36382 37191 gene locus_tag LOCUS_01390 36382 37191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 37296 37625 gene locus_tag LOCUS_01400 37296 37625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 37632 39161 gene locus_tag LOCUS_01410 37632 39161 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_01410 40694 39354 gene locus_tag LOCUS_01420 40694 39354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919744.1 protein_id gnl|my_center|LOCUS_01420 42206 40746 gene locus_tag LOCUS_01430 gene murE 42206 40746 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05954 protein_id gnl|my_center|LOCUS_01430 42290 43129 gene locus_tag LOCUS_01440 gene ubiA 42290 43129 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGI4 protein_id gnl|my_center|LOCUS_01440 43944 43150 gene locus_tag LOCUS_01450 43944 43150 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596361.1 protein_id gnl|my_center|LOCUS_01450 45336 44101 gene locus_tag LOCUS_01460 gene tyrS 45336 44101 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGB4 protein_id gnl|my_center|LOCUS_01460 45709 47802 gene locus_tag LOCUS_01470 gene fusA 45709 47802 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41084 protein_id gnl|my_center|LOCUS_01470 48900 49700 gene locus_tag LOCUS_01480 48900 49700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 50025 51131 gene locus_tag LOCUS_01490 gene nhaA 50025 51131 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG3 protein_id gnl|my_center|LOCUS_01490 51406 54102 gene locus_tag LOCUS_01500 gene secA 51406 54102 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCX7 protein_id gnl|my_center|LOCUS_01500 54105 56054 gene locus_tag LOCUS_01510 gene rpoD 54105 56054 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM5 protein_id gnl|my_center|LOCUS_01510 56758 57636 gene locus_tag LOCUS_01520 gene rpoH 56758 57636 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDM4 protein_id gnl|my_center|LOCUS_01520 57992 58927 gene locus_tag LOCUS_01530 gene argB 57992 58927 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_01530 58983 61745 gene locus_tag LOCUS_01540 58983 61745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 61742 62527 gene locus_tag LOCUS_01550 gene panB 61742 62527 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5N1 protein_id gnl|my_center|LOCUS_01550 62530 63813 gene locus_tag LOCUS_01560 gene murA 62530 63813 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKS2 protein_id gnl|my_center|LOCUS_01560 >Feature sequence004 649 14 gene locus_tag LOCUS_01570 649 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 1187 1113 gene locus_tag LOCUS_t00040 1187 1113 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1741 1388 gene locus_tag LOCUS_01580 gene rnpA 1741 1388 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DN92 protein_id gnl|my_center|LOCUS_01580 3976 2024 gene locus_tag LOCUS_01590 gene dnaK 3976 2024 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 protein_id gnl|my_center|LOCUS_01590 6965 4458 gene locus_tag LOCUS_01600 gene fadE 6965 4458 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_01600 8766 7981 gene locus_tag LOCUS_01610 8766 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9195 9401 gene locus_tag LOCUS_01620 9195 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9743 9357 gene locus_tag LOCUS_01630 gene rplS 9743 9357 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7K9 protein_id gnl|my_center|LOCUS_01630 10175 9756 gene locus_tag LOCUS_01640 gene rplQ 10175 9756 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E888 protein_id gnl|my_center|LOCUS_01640 11203 10178 gene locus_tag LOCUS_01650 gene rpoA 11203 10178 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_01650 11618 11226 gene locus_tag LOCUS_01660 gene rpsK 11618 11226 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_01660 12008 11631 gene locus_tag LOCUS_01670 gene rpsM 12008 11631 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7S6 protein_id gnl|my_center|LOCUS_01670 12701 12021 gene locus_tag LOCUS_01680 12701 12021 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01680 13989 12721 gene locus_tag LOCUS_01690 gene secY 13989 12721 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_01690 14635 14192 gene locus_tag LOCUS_01700 gene rplO 14635 14192 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCS4 protein_id gnl|my_center|LOCUS_01700 14833 14639 gene locus_tag LOCUS_01710 14833 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 15370 14840 gene locus_tag LOCUS_01720 gene rpsE 15370 14840 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA1 protein_id gnl|my_center|LOCUS_01720 15770 15405 gene locus_tag LOCUS_01730 15770 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 16477 15944 gene locus_tag LOCUS_01740 gene rplF 16477 15944 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAI6 protein_id gnl|my_center|LOCUS_01740 16932 16480 gene locus_tag LOCUS_01750 gene rpsH 16932 16480 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J98 protein_id gnl|my_center|LOCUS_01750 17191 16886 gene locus_tag LOCUS_01760 gene rpsN 17191 16886 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF7 protein_id gnl|my_center|LOCUS_01760 17745 17200 gene locus_tag LOCUS_01770 gene rplE 17745 17200 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ20 protein_id gnl|my_center|LOCUS_01770 18064 17747 gene locus_tag LOCUS_01780 18064 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 18436 18068 gene locus_tag LOCUS_01790 gene rplN 18436 18068 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE28 protein_id gnl|my_center|LOCUS_01790 18665 18444 gene locus_tag LOCUS_01800 18665 18444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 18857 18666 gene locus_tag LOCUS_01810 18857 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 19371 18955 gene locus_tag LOCUS_01820 gene rplP 19371 18955 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U866 protein_id gnl|my_center|LOCUS_01820 20011 19391 gene locus_tag LOCUS_01830 gene rpsC 20011 19391 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B896 protein_id gnl|my_center|LOCUS_01830 20379 20026 gene locus_tag LOCUS_01840 gene rplV 20379 20026 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW5 protein_id gnl|my_center|LOCUS_01840 20658 20383 gene locus_tag LOCUS_01850 gene rpsS 20658 20383 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC8 protein_id gnl|my_center|LOCUS_01850 21508 20672 gene locus_tag LOCUS_01860 gene rplB 21508 20672 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCQ8 protein_id gnl|my_center|LOCUS_01860 21790 21512 gene locus_tag LOCUS_01870 gene rplW 21790 21512 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CF8 protein_id gnl|my_center|LOCUS_01870 22433 21801 gene locus_tag LOCUS_01880 gene rplD 22433 21801 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPQ7 protein_id gnl|my_center|LOCUS_01880 23113 22484 gene locus_tag LOCUS_01890 gene rplC 23113 22484 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S2 protein_id gnl|my_center|LOCUS_01890 23440 23126 gene locus_tag LOCUS_01900 gene rpsJ 23440 23126 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D8 protein_id gnl|my_center|LOCUS_01900 24633 23443 gene locus_tag LOCUS_01910 gene tuf-2 24633 23443 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_953913.1 protein_id gnl|my_center|LOCUS_01910 25274 24804 gene locus_tag LOCUS_01920 gene rpsI 25274 24804 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD66 protein_id gnl|my_center|LOCUS_01920 25735 25277 gene locus_tag LOCUS_01930 gene rplM 25735 25277 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z4 protein_id gnl|my_center|LOCUS_01930 27753 26470 gene locus_tag LOCUS_01940 gene proS 27753 26470 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU19 protein_id gnl|my_center|LOCUS_01940 30485 28593 gene locus_tag LOCUS_01950 gene thrS 30485 28593 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05947 protein_id gnl|my_center|LOCUS_01950 31100 30495 gene locus_tag LOCUS_01960 31100 30495 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_01960 31217 32194 gene locus_tag LOCUS_01970 31217 32194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 32181 32531 gene locus_tag LOCUS_01980 32181 32531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 32546 33277 gene locus_tag LOCUS_01990 32546 33277 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387878.1 protein_id gnl|my_center|LOCUS_01990 33522 33935 gene locus_tag LOCUS_02000 33522 33935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 35312 34104 gene locus_tag LOCUS_02010 35312 34104 CDS product capsular polysaccharide biosynthesis protein CapM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597471.1 protein_id gnl|my_center|LOCUS_02010 36736 35450 gene locus_tag LOCUS_02020 gene purA 36736 35450 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_02020 36891 36736 gene locus_tag LOCUS_02030 36891 36736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 37023 38840 gene locus_tag LOCUS_02040 37023 38840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 38881 39435 gene locus_tag LOCUS_02050 38881 39435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_02050 39516 39737 gene locus_tag LOCUS_02060 39516 39737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 39737 40348 gene locus_tag LOCUS_02070 39737 40348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 40434 42551 gene locus_tag LOCUS_02080 40434 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 42551 43471 gene locus_tag LOCUS_02090 42551 43471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 44721 43924 gene locus_tag LOCUS_02100 44721 43924 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598520.1 protein_id gnl|my_center|LOCUS_02100 45494 44718 gene locus_tag LOCUS_02110 45494 44718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 46820 45567 gene locus_tag LOCUS_02120 gene kdtA 46820 45567 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_02120 47297 46905 gene locus_tag LOCUS_02130 47297 46905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 47591 48238 gene locus_tag LOCUS_02140 gene lipB 47591 48238 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JM6 protein_id gnl|my_center|LOCUS_02140 49583 48339 gene locus_tag LOCUS_02150 gene mntH 49583 48339 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125355.1 protein_id gnl|my_center|LOCUS_02150 50445 49588 gene locus_tag LOCUS_02160 gene nadC 50445 49588 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545113.1 protein_id gnl|my_center|LOCUS_02160 51366 50623 gene locus_tag LOCUS_02170 51366 50623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 52129 51368 gene locus_tag LOCUS_02180 52129 51368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 53989 52403 gene locus_tag LOCUS_02190 53989 52403 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_02190 54582 55697 gene locus_tag LOCUS_02200 54582 55697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 55708 56157 gene locus_tag LOCUS_02210 55708 56157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 56747 56184 gene locus_tag LOCUS_02220 56747 56184 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E405 protein_id gnl|my_center|LOCUS_02220 57699 56764 gene locus_tag LOCUS_02230 57699 56764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 58717 57803 gene locus_tag LOCUS_02240 58717 57803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 61010 60546 gene locus_tag LOCUS_02250 gene rpsG 61010 60546 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV4 protein_id gnl|my_center|LOCUS_02250 61403 61032 gene locus_tag LOCUS_02260 gene rpsL 61403 61032 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE13 protein_id gnl|my_center|LOCUS_02260 61621 61944 gene locus_tag LOCUS_02270 gene rpsT 61621 61944 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMP9 protein_id gnl|my_center|LOCUS_02270 61992 62067 gene locus_tag LOCUS_t00050 61992 62067 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 62427 62684 gene locus_tag LOCUS_02280 62427 62684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence005 2400 1192 gene locus_tag LOCUS_02290 2400 1192 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_02290 3609 2410 gene locus_tag LOCUS_02300 3609 2410 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_02300 4930 4262 gene locus_tag LOCUS_02310 4930 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5806 4961 gene locus_tag LOCUS_02320 5806 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6467 6147 gene locus_tag LOCUS_02330 6467 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6612 10031 gene locus_tag LOCUS_02340 6612 10031 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083575.1 protein_id gnl|my_center|LOCUS_02340 10889 10668 gene locus_tag LOCUS_02350 10889 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 11471 12292 gene locus_tag LOCUS_02360 gene kdsA 11471 12292 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE84 protein_id gnl|my_center|LOCUS_02360 15327 12454 gene locus_tag LOCUS_02370 15327 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 15593 15772 gene locus_tag LOCUS_02380 15593 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 16773 16060 gene locus_tag LOCUS_02390 16773 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 23056 16787 gene locus_tag LOCUS_02400 23056 16787 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966627.1 protein_id gnl|my_center|LOCUS_02400 24746 23193 gene locus_tag LOCUS_02410 gene fumC 24746 23193 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCQ4 protein_id gnl|my_center|LOCUS_02410 25233 24817 gene locus_tag LOCUS_02420 25233 24817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 25343 26536 gene locus_tag LOCUS_02430 25343 26536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 26582 27178 gene locus_tag LOCUS_02440 gene sodB 26582 27178 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_02440 27168 27881 gene locus_tag LOCUS_02450 gene bioC 27168 27881 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QN4 protein_id gnl|my_center|LOCUS_02450 27964 29199 gene locus_tag LOCUS_02460 gene udg 27964 29199 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05973 protein_id gnl|my_center|LOCUS_02460 32263 29210 gene locus_tag LOCUS_02470 32263 29210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 34142 32307 gene locus_tag LOCUS_02480 gene glmS 34142 32307 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC54 protein_id gnl|my_center|LOCUS_02480 35024 34203 gene locus_tag LOCUS_02490 gene cysQ 35024 34203 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57624 protein_id gnl|my_center|LOCUS_02490 35076 35957 gene locus_tag LOCUS_02500 35076 35957 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_02500 37243 35954 gene locus_tag LOCUS_02510 gene hisD 37243 35954 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_02510 37782 37240 gene locus_tag LOCUS_02520 37782 37240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 39336 37795 gene locus_tag LOCUS_02530 gene metG 39336 37795 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_02530 40409 39333 gene locus_tag LOCUS_02540 gene aroB 40409 39333 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW8 protein_id gnl|my_center|LOCUS_02540 41417 40458 gene locus_tag LOCUS_02550 41417 40458 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057971.1 protein_id gnl|my_center|LOCUS_02550 42138 41557 gene locus_tag LOCUS_02560 gene thiE2 42138 41557 CDS product putative thiamine-phosphate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67378 protein_id gnl|my_center|LOCUS_02560 43282 42245 gene locus_tag LOCUS_02570 gene pheS 43282 42245 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDB5 protein_id gnl|my_center|LOCUS_02570 43460 44221 gene locus_tag LOCUS_02580 43460 44221 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_02580 44221 44934 gene locus_tag LOCUS_02590 gene znuC 44221 44934 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32HA3 protein_id gnl|my_center|LOCUS_02590 44927 45721 gene locus_tag LOCUS_02600 gene znuB 44927 45721 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261503.1 protein_id gnl|my_center|LOCUS_02600 45881 46744 gene locus_tag LOCUS_02610 gene miaA 45881 46744 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD37 protein_id gnl|my_center|LOCUS_02610 46734 47531 gene locus_tag LOCUS_02620 46734 47531 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_02620 47771 47962 gene locus_tag LOCUS_02630 47771 47962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 48058 48858 gene locus_tag LOCUS_02640 48058 48858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 49163 48855 gene locus_tag LOCUS_02650 49163 48855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 50478 49228 gene locus_tag LOCUS_02660 50478 49228 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_02660 51191 50478 gene locus_tag LOCUS_02670 51191 50478 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U83 protein_id gnl|my_center|LOCUS_02670 52489 51221 gene locus_tag LOCUS_02680 gene purD 52489 51221 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5V8 protein_id gnl|my_center|LOCUS_02680 52961 52650 gene locus_tag LOCUS_02690 gene cyoD 52961 52650 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_02690 53635 53021 gene locus_tag LOCUS_02700 53635 53021 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597621.1 protein_id gnl|my_center|LOCUS_02700 54558 53635 gene locus_tag LOCUS_02710 54558 53635 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919872.1 protein_id gnl|my_center|LOCUS_02710 56716 54563 gene locus_tag LOCUS_02720 gene feoB-1 56716 54563 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBP3 protein_id gnl|my_center|LOCUS_02720 56990 56718 gene locus_tag LOCUS_02730 56990 56718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 57219 58514 gene locus_tag LOCUS_02740 57219 58514 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW4 protein_id gnl|my_center|LOCUS_02740 58504 58935 gene locus_tag LOCUS_02750 gene tsaE 58504 58935 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED0 protein_id gnl|my_center|LOCUS_02750 >Feature sequence006 1787 828 gene locus_tag LOCUS_02760 1787 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3097 1979 gene locus_tag LOCUS_02770 3097 1979 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886254.1 protein_id gnl|my_center|LOCUS_02770 3423 5816 gene locus_tag LOCUS_02780 gene gyrB 3423 5816 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCX2 protein_id gnl|my_center|LOCUS_02780 5849 6196 gene locus_tag LOCUS_02790 5849 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6227 6508 gene locus_tag LOCUS_02800 gene gatC1 6227 6508 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58251 protein_id gnl|my_center|LOCUS_02800 6755 7936 gene locus_tag LOCUS_02810 6755 7936 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_02810 7921 8418 gene locus_tag LOCUS_02820 gene rppH 7921 8418 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDT9 protein_id gnl|my_center|LOCUS_02820 8509 9609 gene locus_tag LOCUS_02830 gene leuB 8509 9609 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 protein_id gnl|my_center|LOCUS_02830 9610 10251 gene locus_tag LOCUS_02840 9610 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 10236 10931 gene locus_tag LOCUS_02850 10236 10931 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597405.1 protein_id gnl|my_center|LOCUS_02850 11118 12116 gene locus_tag LOCUS_02860 11118 12116 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD35 protein_id gnl|my_center|LOCUS_02860 12129 12347 gene locus_tag LOCUS_02870 12129 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13541 12684 gene locus_tag LOCUS_02880 gene aroE 13541 12684 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_02880 13649 15058 gene locus_tag LOCUS_02890 gene atpD 13649 15058 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_02890 15061 15309 gene locus_tag LOCUS_02900 15061 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 15330 17006 gene locus_tag LOCUS_02910 gene recN 15330 17006 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY2 protein_id gnl|my_center|LOCUS_02910 17019 17537 gene locus_tag LOCUS_02920 gene ilvH 17019 17537 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_02920 18911 17778 gene locus_tag LOCUS_02930 gene dxr 18911 17778 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW4 protein_id gnl|my_center|LOCUS_02930 19428 18904 gene locus_tag LOCUS_02940 19428 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 19973 19488 gene locus_tag LOCUS_02950 19973 19488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 20685 20062 gene locus_tag LOCUS_02960 20685 20062 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_02960 21579 20842 gene locus_tag LOCUS_02970 gene fabG 21579 20842 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50941 protein_id gnl|my_center|LOCUS_02970 22539 21742 gene locus_tag LOCUS_02980 22539 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 23224 22526 gene locus_tag LOCUS_02990 23224 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 24664 23249 gene locus_tag LOCUS_03000 gene leuC 24664 23249 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBY9 protein_id gnl|my_center|LOCUS_03000 25205 24987 gene locus_tag LOCUS_03010 gene infA 25205 24987 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCE3 protein_id gnl|my_center|LOCUS_03010 25979 25215 gene locus_tag LOCUS_03020 25979 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403302.1 protein_id gnl|my_center|LOCUS_03020 27390 25981 gene locus_tag LOCUS_03030 27390 25981 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_03030 27514 28068 gene locus_tag LOCUS_03040 27514 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 28161 28472 gene locus_tag LOCUS_03050 gene tolR 28161 28472 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_03050 28475 29134 gene locus_tag LOCUS_03060 28475 29134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 29109 29627 gene locus_tag LOCUS_03070 gene ispF 29109 29627 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFU1 protein_id gnl|my_center|LOCUS_03070 30803 29865 gene locus_tag LOCUS_03080 30803 29865 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQA0 protein_id gnl|my_center|LOCUS_03080 31028 31102 gene locus_tag LOCUS_t00060 31028 31102 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 32135 31323 gene locus_tag LOCUS_03090 gene proI 32135 31323 CDS product pyrroline-5-carboxylate reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54552 protein_id gnl|my_center|LOCUS_03090 33560 32199 gene locus_tag LOCUS_03100 33560 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 33637 34299 gene locus_tag LOCUS_03110 33637 34299 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886193.1 protein_id gnl|my_center|LOCUS_03110 34313 34621 gene locus_tag LOCUS_03120 34313 34621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 35453 34722 gene locus_tag LOCUS_03130 gene recO 35453 34722 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ0 protein_id gnl|my_center|LOCUS_03130 36100 35450 gene locus_tag LOCUS_03140 gene bioD 36100 35450 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z2 protein_id gnl|my_center|LOCUS_03140 36162 36641 gene locus_tag LOCUS_03150 36162 36641 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UG74 protein_id gnl|my_center|LOCUS_03150 36741 37142 gene locus_tag LOCUS_03160 36741 37142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 39620 38040 gene locus_tag LOCUS_03170 39620 38040 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_03170 40462 39734 gene locus_tag LOCUS_03180 40462 39734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 41043 40777 gene locus_tag LOCUS_03190 gene rpmA 41043 40777 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_03190 41363 41046 gene locus_tag LOCUS_03200 gene rplU 41363 41046 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBR5 protein_id gnl|my_center|LOCUS_03200 41547 41879 gene locus_tag LOCUS_03210 gene fdxB 41547 41879 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDW6 protein_id gnl|my_center|LOCUS_03210 41883 42944 gene locus_tag LOCUS_03220 41883 42944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 42941 43816 gene locus_tag LOCUS_03230 42941 43816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 43792 44646 gene locus_tag LOCUS_03240 gene panC 43792 44646 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NI93 protein_id gnl|my_center|LOCUS_03240 44775 45608 gene locus_tag LOCUS_03250 44775 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 45612 46649 gene locus_tag LOCUS_03260 45612 46649 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886236.1 protein_id gnl|my_center|LOCUS_03260 46714 47907 gene locus_tag LOCUS_03270 46714 47907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCJ2 protein_id gnl|my_center|LOCUS_03270 48916 48155 gene locus_tag LOCUS_03280 48916 48155 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_03280 49130 48924 gene locus_tag LOCUS_03290 49130 48924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 49208 50173 gene locus_tag LOCUS_03300 gene lipA 49208 50173 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFG1 protein_id gnl|my_center|LOCUS_03300 50311 52176 gene locus_tag LOCUS_03310 gene htpG 50311 52176 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCB9 protein_id gnl|my_center|LOCUS_03310 52478 53326 gene locus_tag LOCUS_03320 gene lpxC 52478 53326 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS1 protein_id gnl|my_center|LOCUS_03320 53323 54294 gene locus_tag LOCUS_03330 gene lpxK 53323 54294 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCL0 protein_id gnl|my_center|LOCUS_03330 54654 54554 gene locus_tag LOCUS_r00010 54654 54554 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence007 1631 333 gene locus_tag LOCUS_03340 1631 333 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994423.1 protein_id gnl|my_center|LOCUS_03340 2452 1637 gene locus_tag LOCUS_03350 2452 1637 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705041.1 protein_id gnl|my_center|LOCUS_03350 3780 2644 gene locus_tag LOCUS_03360 gene rnd 3780 2644 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QV7 protein_id gnl|my_center|LOCUS_03360 4720 3788 gene locus_tag LOCUS_03370 gene prs 4720 3788 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDA9 protein_id gnl|my_center|LOCUS_03370 4836 5279 gene locus_tag LOCUS_03380 4836 5279 CDS product UPF0093 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC85 protein_id gnl|my_center|LOCUS_03380 5298 5555 gene locus_tag LOCUS_03390 5298 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6116 5565 gene locus_tag LOCUS_03400 6116 5565 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44905 protein_id gnl|my_center|LOCUS_03400 6909 6094 gene locus_tag LOCUS_03410 6909 6094 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WP1 protein_id gnl|my_center|LOCUS_03410 7057 8385 gene locus_tag LOCUS_03420 gene rhlE 7057 8385 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_03420 8762 8980 gene locus_tag LOCUS_03430 8762 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 9326 10813 gene locus_tag LOCUS_03440 gene uup 9326 10813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_03440 11041 12435 gene locus_tag LOCUS_03450 11041 12435 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_03450 12578 12823 gene locus_tag LOCUS_03460 gene rbpD 12578 12823 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_03460 14456 13899 gene locus_tag LOCUS_03470 gene dcd 14456 13899 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE77 protein_id gnl|my_center|LOCUS_03470 14910 15926 gene locus_tag LOCUS_03480 14910 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 15930 18086 gene locus_tag LOCUS_03490 15930 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 18089 18928 gene locus_tag LOCUS_03500 18089 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 20066 19038 gene locus_tag LOCUS_03510 20066 19038 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_03510 21386 20478 gene locus_tag LOCUS_03520 gene fmt 21386 20478 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50932 protein_id gnl|my_center|LOCUS_03520 21711 22388 gene locus_tag LOCUS_03530 21711 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 22547 22474 gene locus_tag LOCUS_t00070 22547 22474 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23791 22832 gene locus_tag LOCUS_03540 23791 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_03540 23933 25138 gene locus_tag LOCUS_03550 23933 25138 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_03550 25119 25718 gene locus_tag LOCUS_03560 25119 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869554.1 protein_id gnl|my_center|LOCUS_03560 25862 26365 gene locus_tag LOCUS_03570 25862 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03570 26358 27905 gene locus_tag LOCUS_03580 gene purH 26358 27905 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI79 protein_id gnl|my_center|LOCUS_03580 28138 29715 gene locus_tag LOCUS_03590 28138 29715 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599027.1 protein_id gnl|my_center|LOCUS_03590 29726 30271 gene locus_tag LOCUS_03600 gene hslV 29726 30271 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_03600 30271 31599 gene locus_tag LOCUS_03610 30271 31599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 31658 33571 gene locus_tag LOCUS_03620 gene aspS 31658 33571 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 protein_id gnl|my_center|LOCUS_03620 33582 34553 gene locus_tag LOCUS_03630 gene thrB 33582 34553 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA8 protein_id gnl|my_center|LOCUS_03630 34854 35405 gene locus_tag LOCUS_03640 34854 35405 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_03640 36084 35755 gene locus_tag LOCUS_03650 36084 35755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 36528 36265 gene locus_tag LOCUS_03660 36528 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 38948 36699 gene locus_tag LOCUS_03670 gene pnp 38948 36699 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF34 protein_id gnl|my_center|LOCUS_03670 39242 38973 gene locus_tag LOCUS_03680 gene rpsO 39242 38973 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU3 protein_id gnl|my_center|LOCUS_03680 40130 39255 gene locus_tag LOCUS_03690 gene truB 40130 39255 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR8 protein_id gnl|my_center|LOCUS_03690 41766 40144 gene locus_tag LOCUS_03700 41766 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 42447 42025 gene locus_tag LOCUS_03710 42447 42025 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454456.1 protein_id gnl|my_center|LOCUS_03710 42973 42440 gene locus_tag LOCUS_03720 gene exbB1 42973 42440 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261840.1 protein_id gnl|my_center|LOCUS_03720 43422 42976 gene locus_tag LOCUS_03730 43422 42976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 44456 43782 gene locus_tag LOCUS_03740 44456 43782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_03740 46542 44512 gene locus_tag LOCUS_03750 46542 44512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 46942 46547 gene locus_tag LOCUS_03760 46942 46547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence008 1737 478 gene locus_tag LOCUS_03770 gene pgi 1737 478 CDS product putative glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMD4 protein_id gnl|my_center|LOCUS_03770 3538 1730 gene locus_tag LOCUS_03780 gene msbA 3538 1730 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_03780 4533 3598 gene locus_tag LOCUS_03790 4533 3598 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 protein_id gnl|my_center|LOCUS_03790 4844 4677 gene locus_tag LOCUS_03800 4844 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4997 6235 gene locus_tag LOCUS_03810 4997 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 6228 7274 gene locus_tag LOCUS_03820 6228 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7293 10100 gene locus_tag LOCUS_03830 7293 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 10384 11094 gene locus_tag LOCUS_03840 gene purQ 10384 11094 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FIV0 protein_id gnl|my_center|LOCUS_03840 11091 12722 gene locus_tag LOCUS_03850 gene pyrG 11091 12722 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT58 protein_id gnl|my_center|LOCUS_03850 13020 13095 gene locus_tag LOCUS_t00080 13020 13095 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14181 13111 gene locus_tag LOCUS_03860 14181 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14416 14721 gene locus_tag LOCUS_03870 14416 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008550181.1 protein_id gnl|my_center|LOCUS_03870 14752 15288 gene locus_tag LOCUS_03880 gene ppa 14752 15288 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LH1 protein_id gnl|my_center|LOCUS_03880 15288 16175 gene locus_tag LOCUS_03890 gene era 15288 16175 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGK1 protein_id gnl|my_center|LOCUS_03890 17176 16664 gene locus_tag LOCUS_03900 gene nadD 17176 16664 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 protein_id gnl|my_center|LOCUS_03900 18351 17173 gene locus_tag LOCUS_03910 gene murG 18351 17173 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC0 protein_id gnl|my_center|LOCUS_03910 18829 18344 gene locus_tag LOCUS_03920 gene nusB 18829 18344 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE01 protein_id gnl|my_center|LOCUS_03920 18834 19772 gene locus_tag LOCUS_03930 gene thyX 18834 19772 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDM6 protein_id gnl|my_center|LOCUS_03930 20067 20702 gene locus_tag LOCUS_03940 gene exoD 20067 20702 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772526.1 protein_id gnl|my_center|LOCUS_03940 20733 21803 gene locus_tag LOCUS_03950 gene tsaD 20733 21803 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_03950 21875 22570 gene locus_tag LOCUS_03960 21875 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE57 protein_id gnl|my_center|LOCUS_03960 22941 23402 gene locus_tag LOCUS_03970 22941 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976157.1 protein_id gnl|my_center|LOCUS_03970 23421 24038 gene locus_tag LOCUS_03980 gene plsY 23421 24038 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI04 protein_id gnl|my_center|LOCUS_03980 24022 24714 gene locus_tag LOCUS_03990 gene pyrF 24022 24714 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_03990 24719 27010 gene locus_tag LOCUS_04000 gene bamA 24719 27010 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A711 protein_id gnl|my_center|LOCUS_04000 27021 27380 gene locus_tag LOCUS_04010 27021 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 28317 27601 gene locus_tag LOCUS_04020 28317 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 29600 28428 gene locus_tag LOCUS_04030 gene lpxB 29600 28428 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDK7 protein_id gnl|my_center|LOCUS_04030 30228 29587 gene locus_tag LOCUS_04040 gene hisH 30228 29587 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_04040 30975 30247 gene locus_tag LOCUS_04050 30975 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 32436 31228 gene locus_tag LOCUS_04060 32436 31228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 33605 32661 gene locus_tag LOCUS_04070 33605 32661 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582623.1 protein_id gnl|my_center|LOCUS_04070 35312 33672 gene locus_tag LOCUS_04080 35312 33672 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599662.1 protein_id gnl|my_center|LOCUS_04080 35493 36686 gene locus_tag LOCUS_04090 gene argJ 35493 36686 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK3 protein_id gnl|my_center|LOCUS_04090 39022 37364 gene locus_tag LOCUS_04100 gene groL2 39022 37364 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 protein_id gnl|my_center|LOCUS_04100 39332 39042 gene locus_tag LOCUS_04110 gene groS 39332 39042 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJG8 protein_id gnl|my_center|LOCUS_04110 40777 39596 gene locus_tag LOCUS_04120 40777 39596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence009 2215 1241 gene locus_tag LOCUS_04130 gene trpS 2215 1241 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_04130 2310 3281 gene locus_tag LOCUS_04140 2310 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3297 3384 gene locus_tag LOCUS_t00090 3297 3384 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3397 3699 gene locus_tag LOCUS_04150 3397 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3674 4111 gene locus_tag LOCUS_04160 gene smpB 3674 4111 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0I0 protein_id gnl|my_center|LOCUS_04160 4108 4533 gene locus_tag LOCUS_04170 gene rpiB 4108 4533 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_04170 4536 5228 gene locus_tag LOCUS_04180 gene galF 4536 5228 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_04180 5276 6424 gene locus_tag LOCUS_04190 gene metK2 5276 6424 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_04190 6863 8269 gene locus_tag LOCUS_04200 6863 8269 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_04200 8270 9139 gene locus_tag LOCUS_04210 gene secF 8270 9139 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE34 protein_id gnl|my_center|LOCUS_04210 9148 9585 gene locus_tag LOCUS_04220 9148 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9829 10425 gene locus_tag LOCUS_04230 gene nuoC 9829 10425 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU38 protein_id gnl|my_center|LOCUS_04230 10818 11216 gene locus_tag LOCUS_04240 10818 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 11213 13177 gene locus_tag LOCUS_04250 gene dxs 11213 13177 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHG3 protein_id gnl|my_center|LOCUS_04250 13338 13781 gene locus_tag LOCUS_04260 gene rnhA 13338 13781 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 protein_id gnl|my_center|LOCUS_04260 14307 13840 gene locus_tag LOCUS_04270 gene rlmH 14307 13840 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7U4 protein_id gnl|my_center|LOCUS_04270 14300 15415 gene locus_tag LOCUS_04280 14300 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 15408 15962 gene locus_tag LOCUS_04290 15408 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 15964 17013 gene locus_tag LOCUS_04300 gene argC1 15964 17013 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH7 protein_id gnl|my_center|LOCUS_04300 17089 18546 gene locus_tag LOCUS_04310 gene gatB 17089 18546 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE11 protein_id gnl|my_center|LOCUS_04310 18648 21104 gene locus_tag LOCUS_04320 18648 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 21539 21450 gene locus_tag LOCUS_t00100 21539 21450 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21811 21726 gene locus_tag LOCUS_t00110 21811 21726 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 22302 22147 gene locus_tag LOCUS_04330 22302 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 22679 22449 gene locus_tag LOCUS_04340 22679 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 24102 23080 gene locus_tag LOCUS_04350 gene hemH 24102 23080 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFT3 protein_id gnl|my_center|LOCUS_04350 24412 24095 gene locus_tag LOCUS_04360 24412 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 25412 24405 gene locus_tag LOCUS_04370 25412 24405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 26314 25415 gene locus_tag LOCUS_04380 26314 25415 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_04380 26387 27766 gene locus_tag LOCUS_04390 gene phrB 26387 27766 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_04390 28097 28420 gene locus_tag LOCUS_04400 28097 28420 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFI4 protein_id gnl|my_center|LOCUS_04400 28669 28415 gene locus_tag LOCUS_04410 28669 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 29368 28703 gene locus_tag LOCUS_04420 gene fabG 29368 28703 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 protein_id gnl|my_center|LOCUS_04420 30191 29457 gene locus_tag LOCUS_04430 30191 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 31018 30296 gene locus_tag LOCUS_04440 gene purC 31018 30296 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CV5 protein_id gnl|my_center|LOCUS_04440 31140 34433 gene locus_tag LOCUS_04450 31140 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 34498 35685 gene locus_tag LOCUS_04460 34498 35685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 36029 37963 gene locus_tag LOCUS_04470 36029 37963 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_04470 37970 39355 gene locus_tag LOCUS_04480 gene argH1 37970 39355 CDS product argininosuccinate lyase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9X6 protein_id gnl|my_center|LOCUS_04480 >Feature sequence010 2186 159 gene locus_tag LOCUS_04490 gene ptrB 2186 159 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_04490 2434 3543 gene locus_tag LOCUS_04500 gene frmA 2434 3543 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E800 protein_id gnl|my_center|LOCUS_04500 3548 4387 gene locus_tag LOCUS_04510 3548 4387 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K28 protein_id gnl|my_center|LOCUS_04510 5116 4406 gene locus_tag LOCUS_04520 gene ung 5116 4406 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_04520 6417 5398 gene locus_tag LOCUS_04530 gene obg 6417 5398 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCB6 protein_id gnl|my_center|LOCUS_04530 6841 6419 gene locus_tag LOCUS_04540 gene ribH2 6841 6419 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_04540 7609 6854 gene locus_tag LOCUS_04550 gene ubiE 7609 6854 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCP3 protein_id gnl|my_center|LOCUS_04550 8253 10379 gene locus_tag LOCUS_04560 8253 10379 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_04560 10553 10897 gene locus_tag LOCUS_04570 10553 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 11297 11079 gene locus_tag LOCUS_04580 11297 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 11775 11278 gene locus_tag LOCUS_04590 11775 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12164 11775 gene locus_tag LOCUS_04600 12164 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12516 13616 gene locus_tag LOCUS_04610 12516 13616 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_04610 13629 13898 gene locus_tag LOCUS_04620 13629 13898 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A385 protein_id gnl|my_center|LOCUS_04620 14089 15471 gene locus_tag LOCUS_04630 gene gltX1 14089 15471 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDK3 protein_id gnl|my_center|LOCUS_04630 15459 15773 gene locus_tag LOCUS_04640 15459 15773 CDS product septum formation initiator precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719640.1 protein_id gnl|my_center|LOCUS_04640 15832 17649 gene locus_tag LOCUS_04650 15832 17649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 18280 18098 gene locus_tag LOCUS_04660 18280 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 18259 18720 gene locus_tag LOCUS_04670 gene mraZ 18259 18720 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY1 protein_id gnl|my_center|LOCUS_04670 18713 19633 gene locus_tag LOCUS_04680 gene rsmH 18713 19633 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY2 protein_id gnl|my_center|LOCUS_04680 19738 20073 gene locus_tag LOCUS_04690 19738 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 21357 20296 gene locus_tag LOCUS_04700 21357 20296 CDS product succinate dehydrogenase [ubiquinone] iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599715.1 protein_id gnl|my_center|LOCUS_04700 22404 21424 gene locus_tag LOCUS_04710 22404 21424 CDS product sulfate transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754225.1 protein_id gnl|my_center|LOCUS_04710 23376 22657 gene locus_tag LOCUS_04720 23376 22657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_04720 23869 23357 gene locus_tag LOCUS_04730 23869 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 25231 23870 gene locus_tag LOCUS_04740 25231 23870 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_04740 25929 25399 gene locus_tag LOCUS_04750 25929 25399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 26185 25952 gene locus_tag LOCUS_04760 26185 25952 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369179.1 protein_id gnl|my_center|LOCUS_04760 28122 26506 gene locus_tag LOCUS_04770 28122 26506 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_04770 28376 28164 gene locus_tag LOCUS_04780 28376 28164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 29487 28474 gene locus_tag LOCUS_04790 gene asd 29487 28474 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KY2 protein_id gnl|my_center|LOCUS_04790 30380 29721 gene locus_tag LOCUS_04800 30380 29721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_04800 31327 30380 gene locus_tag LOCUS_04810 gene fabD 31327 30380 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJH8 protein_id gnl|my_center|LOCUS_04810 32723 31329 gene locus_tag LOCUS_04820 gene ntrC1 32723 31329 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_04820 34142 32889 gene locus_tag LOCUS_04830 gene bioA 34142 32889 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_04830 34299 37652 gene locus_tag LOCUS_04840 34299 37652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_04840 38039 38320 gene locus_tag LOCUS_04850 38039 38320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 38325 38720 gene locus_tag LOCUS_04860 38325 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence011 1322 237 gene locus_tag LOCUS_04870 gene gcpE 1322 237 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J241 protein_id gnl|my_center|LOCUS_04870 1600 1388 gene locus_tag LOCUS_04880 1600 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2552 1575 gene locus_tag LOCUS_04890 2552 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE28 protein_id gnl|my_center|LOCUS_04890 3212 2556 gene locus_tag LOCUS_04900 gene tal 3212 2556 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7E7 protein_id gnl|my_center|LOCUS_04900 3291 4208 gene locus_tag LOCUS_04910 3291 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4218 6008 gene locus_tag LOCUS_04920 4218 6008 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886326.1 protein_id gnl|my_center|LOCUS_04920 7222 6551 gene locus_tag LOCUS_04930 7222 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599681.1 protein_id gnl|my_center|LOCUS_04930 7682 7197 gene locus_tag LOCUS_04940 gene secB 7682 7197 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE76 protein_id gnl|my_center|LOCUS_04940 8626 7682 gene locus_tag LOCUS_04950 gene glpX 8626 7682 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C840 protein_id gnl|my_center|LOCUS_04950 8820 8632 gene locus_tag LOCUS_04960 gene rpmG 8820 8632 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC65 protein_id gnl|my_center|LOCUS_04960 8919 9563 gene locus_tag LOCUS_04970 gene queE 8919 9563 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCV2 protein_id gnl|my_center|LOCUS_04970 10838 9633 gene locus_tag LOCUS_04980 gene trpB 10838 9633 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ6 protein_id gnl|my_center|LOCUS_04980 12669 11476 gene locus_tag LOCUS_04990 12669 11476 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_04990 14558 12678 gene locus_tag LOCUS_05000 gene ppiD 14558 12678 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ1 protein_id gnl|my_center|LOCUS_05000 16227 14803 gene locus_tag LOCUS_05010 16227 14803 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_05010 17082 16231 gene locus_tag LOCUS_05020 17082 16231 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE25 protein_id gnl|my_center|LOCUS_05020 18218 17082 gene locus_tag LOCUS_05030 18218 17082 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_05030 18641 20140 gene locus_tag LOCUS_05040 gene icd 18641 20140 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDR0 protein_id gnl|my_center|LOCUS_05040 20137 21441 gene locus_tag LOCUS_05050 20137 21441 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090890.1 protein_id gnl|my_center|LOCUS_05050 21760 22692 gene locus_tag LOCUS_05060 gene bioB 21760 22692 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY64 protein_id gnl|my_center|LOCUS_05060 22870 24405 gene locus_tag LOCUS_05070 22870 24405 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596285.1 protein_id gnl|my_center|LOCUS_05070 24435 25379 gene locus_tag LOCUS_05080 24435 25379 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597675.1 protein_id gnl|my_center|LOCUS_05080 26183 26974 gene locus_tag LOCUS_05090 gene sdhB 26183 26974 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZEA1 protein_id gnl|my_center|LOCUS_05090 29089 27263 gene locus_tag LOCUS_05100 gene lepA 29089 27263 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNY6 protein_id gnl|my_center|LOCUS_05100 33788 29073 gene locus_tag LOCUS_05110 33788 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 35597 33798 gene locus_tag LOCUS_05120 gene thiC 35597 33798 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCC9 protein_id gnl|my_center|LOCUS_05120 35877 36878 gene locus_tag LOCUS_05130 gene gap 35877 36878 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU5 protein_id gnl|my_center|LOCUS_05130 >Feature sequence012 2197 1022 gene locus_tag LOCUS_05140 2197 1022 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_05140 2454 3527 gene locus_tag LOCUS_05150 gene prfA 2454 3527 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD21 protein_id gnl|my_center|LOCUS_05150 3706 4503 gene locus_tag LOCUS_05160 gene trpC 3706 4503 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX99 protein_id gnl|my_center|LOCUS_05160 5700 4597 gene locus_tag LOCUS_05170 gene ychF 5700 4597 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 protein_id gnl|my_center|LOCUS_05170 7084 6884 gene locus_tag LOCUS_05180 7084 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 7690 7247 gene locus_tag LOCUS_05190 7690 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7980 8627 gene locus_tag LOCUS_05200 7980 8627 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_05200 8620 9693 gene locus_tag LOCUS_05210 gene tgt 8620 9693 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 protein_id gnl|my_center|LOCUS_05210 9838 11673 gene locus_tag LOCUS_05220 9838 11673 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD34 protein_id gnl|my_center|LOCUS_05220 11938 12582 gene locus_tag LOCUS_05230 gene trpF 11938 12582 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB98 protein_id gnl|my_center|LOCUS_05230 13134 13724 gene locus_tag LOCUS_05240 gene purN 13134 13724 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL71 protein_id gnl|my_center|LOCUS_05240 13717 14199 gene locus_tag LOCUS_05250 13717 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 14372 16156 gene locus_tag LOCUS_05260 14372 16156 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599075.1 protein_id gnl|my_center|LOCUS_05260 17298 19310 gene locus_tag LOCUS_05270 gene uvrB 17298 19310 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3V0 protein_id gnl|my_center|LOCUS_05270 21690 19639 gene locus_tag LOCUS_05280 gene nuoG 21690 19639 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCF6 protein_id gnl|my_center|LOCUS_05280 22195 21821 gene locus_tag LOCUS_05290 22195 21821 CDS product chromosome condensation protein CcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_05290 24187 22301 gene locus_tag LOCUS_05300 gene ftsH 24187 22301 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 protein_id gnl|my_center|LOCUS_05300 25088 24192 gene locus_tag LOCUS_05310 25088 24192 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598029.1 protein_id gnl|my_center|LOCUS_05310 25715 25125 gene locus_tag LOCUS_05320 gene recR 25715 25125 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ45 protein_id gnl|my_center|LOCUS_05320 26327 25725 gene locus_tag LOCUS_05330 26327 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 26378 27286 gene locus_tag LOCUS_05340 gene sipf 26378 27286 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJK6 protein_id gnl|my_center|LOCUS_05340 27289 27780 gene locus_tag LOCUS_05350 gene nuoE 27289 27780 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDH5 protein_id gnl|my_center|LOCUS_05350 28827 27787 gene locus_tag LOCUS_05360 gene hemE 28827 27787 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_05360 29318 30715 gene locus_tag LOCUS_05370 gene rho 29318 30715 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD24 protein_id gnl|my_center|LOCUS_05370 31289 30792 gene locus_tag LOCUS_05380 31289 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 31357 32685 gene locus_tag LOCUS_05390 gene hslU 31357 32685 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDK8 protein_id gnl|my_center|LOCUS_05390 34046 33261 gene locus_tag LOCUS_05400 34046 33261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 35109 34114 gene locus_tag LOCUS_05410 gene purM 35109 34114 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG98 protein_id gnl|my_center|LOCUS_05410 35529 35732 gene locus_tag LOCUS_05420 gene cspA 35529 35732 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090960.1 protein_id gnl|my_center|LOCUS_05420 35820 36179 gene locus_tag LOCUS_05430 35820 36179 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDL1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence013 592 1311 gene locus_tag LOCUS_05440 592 1311 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_05440 2856 1486 gene locus_tag LOCUS_05450 gene cysS 2856 1486 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE62 protein_id gnl|my_center|LOCUS_05450 4267 2876 gene locus_tag LOCUS_05460 gene sdaA 4267 2876 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_05460 5159 4269 gene locus_tag LOCUS_05470 gene murB 5159 4269 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS7 protein_id gnl|my_center|LOCUS_05470 5428 5156 gene locus_tag LOCUS_05480 5428 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5672 6982 gene locus_tag LOCUS_05490 gene nusA 5672 6982 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU9 protein_id gnl|my_center|LOCUS_05490 7091 9589 gene locus_tag LOCUS_05500 gene infB 7091 9589 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCZ8 protein_id gnl|my_center|LOCUS_05500 10054 9617 gene locus_tag LOCUS_05510 10054 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 11917 10061 gene locus_tag LOCUS_05520 gene mnmG 11917 10061 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE90 protein_id gnl|my_center|LOCUS_05520 12612 11923 gene locus_tag LOCUS_05530 12612 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 13310 12636 gene locus_tag LOCUS_05540 13310 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 14790 13777 gene locus_tag LOCUS_05550 gene lpxD 14790 13777 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED3 protein_id gnl|my_center|LOCUS_05550 15811 14813 gene locus_tag LOCUS_05560 15811 14813 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597371.1 protein_id gnl|my_center|LOCUS_05560 17466 15811 gene locus_tag LOCUS_05570 17466 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 18697 17456 gene locus_tag LOCUS_05580 gene kbl 18697 17456 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F40 protein_id gnl|my_center|LOCUS_05580 20401 19019 gene locus_tag LOCUS_05590 20401 19019 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_05590 21110 20409 gene locus_tag LOCUS_05600 gene rnc 21110 20409 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE31 protein_id gnl|my_center|LOCUS_05600 21221 22183 gene locus_tag LOCUS_05610 gene dus 21221 22183 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_05610 22970 22374 gene locus_tag LOCUS_05620 gene cyoC 22970 22374 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706742.1 protein_id gnl|my_center|LOCUS_05620 25286 23301 gene locus_tag LOCUS_05630 gene cyoB 25286 23301 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931208.1 protein_id gnl|my_center|LOCUS_05630 26169 25294 gene locus_tag LOCUS_05640 gene cyoA 26169 25294 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI11 protein_id gnl|my_center|LOCUS_05640 26328 27167 gene locus_tag LOCUS_05650 26328 27167 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 protein_id gnl|my_center|LOCUS_05650 27588 29582 gene locus_tag LOCUS_05660 27588 29582 CDS product propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596288.1 protein_id gnl|my_center|LOCUS_05660 29606 30535 gene locus_tag LOCUS_05670 gene nadA 29606 30535 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_05670 30595 30686 gene locus_tag LOCUS_t00120 30595 30686 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 1588 383 gene locus_tag LOCUS_05680 gene metZ 1588 383 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKA2 protein_id gnl|my_center|LOCUS_05680 2394 1585 gene locus_tag LOCUS_05690 2394 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2822 10300 gene locus_tag LOCUS_05700 2822 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10516 10598 gene locus_tag LOCUS_t00130 10516 10598 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10744 12090 gene locus_tag LOCUS_05710 gene tig 10744 12090 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_05710 12417 12229 gene locus_tag LOCUS_05720 12417 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 13008 12499 gene locus_tag LOCUS_05730 gene pabA 13008 12499 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861216.1 protein_id gnl|my_center|LOCUS_05730 14180 13062 gene locus_tag LOCUS_05740 gene bioF 14180 13062 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE2 protein_id gnl|my_center|LOCUS_05740 14643 14380 gene locus_tag LOCUS_05750 14643 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 14642 15043 gene locus_tag LOCUS_05760 14642 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15027 16355 gene locus_tag LOCUS_05770 gene mtaB 15027 16355 CDS product threonylcarbamoyladenosine tRNA methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDB6 protein_id gnl|my_center|LOCUS_05770 17584 16406 gene locus_tag LOCUS_05780 gene hemA 17584 16406 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCB8 protein_id gnl|my_center|LOCUS_05780 18961 17618 gene locus_tag LOCUS_05790 18961 17618 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQB8 protein_id gnl|my_center|LOCUS_05790 19529 18948 gene locus_tag LOCUS_05800 gene wrbA 19529 18948 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075275.1 protein_id gnl|my_center|LOCUS_05800 19961 19533 gene locus_tag LOCUS_05810 19961 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 21366 19954 gene locus_tag LOCUS_05820 gene murC 21366 19954 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 protein_id gnl|my_center|LOCUS_05820 21712 22371 gene locus_tag LOCUS_05830 21712 22371 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05958 protein_id gnl|my_center|LOCUS_05830 22604 22680 gene locus_tag LOCUS_t00140 22604 22680 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23603 24307 gene locus_tag LOCUS_05840 23603 24307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence015 293 1684 gene locus_tag LOCUS_05850 293 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1931 1686 gene locus_tag LOCUS_05860 1931 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3226 2414 gene locus_tag LOCUS_05870 3226 2414 CDS product primitive phytochelatin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550267.1 protein_id gnl|my_center|LOCUS_05870 3633 3223 gene locus_tag LOCUS_05880 3633 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6189 3766 gene locus_tag LOCUS_05890 6189 3766 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_05890 6895 6242 gene locus_tag LOCUS_05900 6895 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 7888 7505 gene locus_tag LOCUS_05910 7888 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8965 8129 gene locus_tag LOCUS_05920 gene rsmA 8965 8129 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MU0 protein_id gnl|my_center|LOCUS_05920 9214 10518 gene locus_tag LOCUS_05930 gene xseA 9214 10518 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCP8 protein_id gnl|my_center|LOCUS_05930 10770 11684 gene locus_tag LOCUS_05940 gene ribF 10770 11684 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0P3 protein_id gnl|my_center|LOCUS_05940 12513 12043 gene locus_tag LOCUS_05950 gene ruvC 12513 12043 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ9 protein_id gnl|my_center|LOCUS_05950 12635 13201 gene locus_tag LOCUS_05960 gene efp 12635 13201 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDT7 protein_id gnl|my_center|LOCUS_05960 13307 13549 gene locus_tag LOCUS_05970 gene acpP 13307 13549 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y448 protein_id gnl|my_center|LOCUS_05970 13617 14927 gene locus_tag LOCUS_05980 13617 14927 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_05980 15091 15324 gene locus_tag LOCUS_05990 15091 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 15347 16405 gene locus_tag LOCUS_06000 gene plsX 15347 16405 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 protein_id gnl|my_center|LOCUS_06000 16402 17361 gene locus_tag LOCUS_06010 gene fabH 16402 17361 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 protein_id gnl|my_center|LOCUS_06010 17443 20124 gene locus_tag LOCUS_06020 17443 20124 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_06020 20811 20221 gene locus_tag LOCUS_06030 20811 20221 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883304.1 protein_id gnl|my_center|LOCUS_06030 21850 21023 gene locus_tag LOCUS_06040 21850 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 22468 22298 gene locus_tag LOCUS_06050 22468 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 23017 24213 gene locus_tag LOCUS_06060 23017 24213 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974637.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence016 1872 235 gene locus_tag LOCUS_06070 1872 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2901 1960 gene locus_tag LOCUS_06080 2901 1960 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_06080 3727 2885 gene locus_tag LOCUS_06090 gene dapF 3727 2885 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ4 protein_id gnl|my_center|LOCUS_06090 5242 4049 gene locus_tag LOCUS_06100 5242 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6061 5312 gene locus_tag LOCUS_06110 gene cysW 6061 5312 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_06110 6969 6148 gene locus_tag LOCUS_06120 6969 6148 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142071.1 protein_id gnl|my_center|LOCUS_06120 7894 7058 gene locus_tag LOCUS_06130 7894 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 8553 7903 gene locus_tag LOCUS_06140 8553 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 9584 8784 gene locus_tag LOCUS_06150 9584 8784 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599443.1 protein_id gnl|my_center|LOCUS_06150 10478 9828 gene locus_tag LOCUS_06160 10478 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 10559 11812 gene locus_tag LOCUS_06170 gene eno 10559 11812 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP8 protein_id gnl|my_center|LOCUS_06170 11960 13513 gene locus_tag LOCUS_06180 11960 13513 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_06180 14288 13680 gene locus_tag LOCUS_06190 gene thiE 14288 13680 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q186F8 protein_id gnl|my_center|LOCUS_06190 14303 16309 gene locus_tag LOCUS_06200 14303 16309 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597581.1 protein_id gnl|my_center|LOCUS_06200 16313 17737 gene locus_tag LOCUS_06210 gene purF 16313 17737 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ7 protein_id gnl|my_center|LOCUS_06210 17730 18977 gene locus_tag LOCUS_06220 17730 18977 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598076.1 protein_id gnl|my_center|LOCUS_06220 19326 20615 gene locus_tag LOCUS_06230 gene gltA 19326 20615 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09948 protein_id gnl|my_center|LOCUS_06230 20612 23005 gene locus_tag LOCUS_06240 20612 23005 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596936.1 protein_id gnl|my_center|LOCUS_06240 23907 23551 gene locus_tag LOCUS_06250 gene rpmB 23907 23551 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9H8 protein_id gnl|my_center|LOCUS_06250 >Feature sequence017 83 7 gene locus_tag LOCUS_t00150 83 7 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 612 205 gene locus_tag LOCUS_06260 612 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 713 1144 gene locus_tag LOCUS_06270 gene tadA 713 1144 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DE3 protein_id gnl|my_center|LOCUS_06270 2104 1313 gene locus_tag LOCUS_06280 2104 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3378 2116 gene locus_tag LOCUS_06290 gene pdhC 3378 2116 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD20 protein_id gnl|my_center|LOCUS_06290 4848 3565 gene locus_tag LOCUS_06300 gene tilS 4848 3565 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZEA3 protein_id gnl|my_center|LOCUS_06300 5643 4987 gene locus_tag LOCUS_06310 5643 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7535 5673 gene locus_tag LOCUS_06320 7535 5673 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596085.1 protein_id gnl|my_center|LOCUS_06320 7911 8681 gene locus_tag LOCUS_06330 7911 8681 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_06330 9627 8731 gene locus_tag LOCUS_06340 9627 8731 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967137.1 protein_id gnl|my_center|LOCUS_06340 10255 11742 gene locus_tag LOCUS_06350 10255 11742 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710147.1 protein_id gnl|my_center|LOCUS_06350 12301 11858 gene locus_tag LOCUS_06360 12301 11858 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018151.1 protein_id gnl|my_center|LOCUS_06360 12749 12375 gene locus_tag LOCUS_06370 gene gcvH1 12749 12375 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHN9 protein_id gnl|my_center|LOCUS_06370 13120 12761 gene locus_tag LOCUS_06380 13120 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 14235 13120 gene locus_tag LOCUS_06390 gene gcvT 14235 13120 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD57 protein_id gnl|my_center|LOCUS_06390 14557 14228 gene locus_tag LOCUS_06400 14557 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14646 14570 gene locus_tag LOCUS_t00160 14646 14570 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14757 15041 gene locus_tag LOCUS_06410 14757 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 15034 16551 gene locus_tag LOCUS_06420 gene gpmI 15034 16551 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_06420 17686 16628 gene locus_tag LOCUS_06430 gene aroC 17686 16628 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ85 protein_id gnl|my_center|LOCUS_06430 21353 18498 gene locus_tag LOCUS_06440 gene uvrA 21353 18498 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCC3 protein_id gnl|my_center|LOCUS_06440 21751 22623 gene locus_tag LOCUS_06450 gene dapA 21751 22623 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKK4 protein_id gnl|my_center|LOCUS_06450 22623 23642 gene locus_tag LOCUS_06460 gene ilvC 22623 23642 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 protein_id gnl|my_center|LOCUS_06460 >Feature sequence018 625 101 gene locus_tag LOCUS_06470 625 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1554 622 gene locus_tag LOCUS_06480 1554 622 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T3 protein_id gnl|my_center|LOCUS_06480 2784 1579 gene locus_tag LOCUS_06490 gene cysNC 2784 1579 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW1 protein_id gnl|my_center|LOCUS_06490 3744 2863 gene locus_tag LOCUS_06500 gene cysD 3744 2863 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_06500 5312 3747 gene locus_tag LOCUS_06510 gene cysI 5312 3747 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMX5 protein_id gnl|my_center|LOCUS_06510 6638 5316 gene locus_tag LOCUS_06520 6638 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7335 6628 gene locus_tag LOCUS_06530 gene cysH 7335 6628 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_06530 8743 7325 gene locus_tag LOCUS_06540 gene cysG 8743 7325 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 protein_id gnl|my_center|LOCUS_06540 9709 9407 gene locus_tag LOCUS_06550 9709 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 9840 10100 gene locus_tag LOCUS_06560 9840 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 11897 10599 gene locus_tag LOCUS_06570 11897 10599 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886315.1 protein_id gnl|my_center|LOCUS_06570 12791 11910 gene locus_tag LOCUS_06580 12791 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 13003 13398 gene locus_tag LOCUS_06590 13003 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 13406 13690 gene locus_tag LOCUS_06600 13406 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 13699 14244 gene locus_tag LOCUS_06610 gene rplI 13699 14244 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC9 protein_id gnl|my_center|LOCUS_06610 14812 14887 gene locus_tag LOCUS_t00170 14812 14887 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15332 16342 gene locus_tag LOCUS_06620 gene rbsK 15332 16342 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124659.1 protein_id gnl|my_center|LOCUS_06620 16324 17745 gene locus_tag LOCUS_06630 gene murF 16324 17745 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIA7 protein_id gnl|my_center|LOCUS_06630 19246 18215 gene locus_tag LOCUS_06640 19246 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 19379 20626 gene locus_tag LOCUS_06650 19379 20626 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_06650 20736 21827 gene locus_tag LOCUS_06660 20736 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 22116 22997 gene locus_tag LOCUS_06670 22116 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence019 217 666 gene locus_tag LOCUS_06680 217 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2687 798 gene locus_tag LOCUS_06690 2687 798 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_06690 3469 2873 gene locus_tag LOCUS_06700 3469 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_06700 5053 3518 gene locus_tag LOCUS_06710 gene guaA 5053 3518 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N53 protein_id gnl|my_center|LOCUS_06710 5153 5079 gene locus_tag LOCUS_t00180 5153 5079 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6570 5197 gene locus_tag LOCUS_06720 6570 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6989 6675 gene locus_tag LOCUS_06730 gene nuoK 6989 6675 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU30 protein_id gnl|my_center|LOCUS_06730 7509 7021 gene locus_tag LOCUS_06740 gene nuoJ 7509 7021 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCG3 protein_id gnl|my_center|LOCUS_06740 8126 7650 gene locus_tag LOCUS_06750 gene nuoI 8126 7650 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFW9 protein_id gnl|my_center|LOCUS_06750 9123 8131 gene locus_tag LOCUS_06760 gene nuoH 9123 8131 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 protein_id gnl|my_center|LOCUS_06760 10543 9464 gene locus_tag LOCUS_06770 gene rlmN 10543 9464 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X03 protein_id gnl|my_center|LOCUS_06770 11700 10543 gene locus_tag LOCUS_06780 11700 10543 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886226.1 protein_id gnl|my_center|LOCUS_06780 12817 11735 gene locus_tag LOCUS_06790 gene prfB 12817 11735 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDQ2 protein_id gnl|my_center|LOCUS_06790 13522 12821 gene locus_tag LOCUS_06800 13522 12821 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_06800 14432 13512 gene locus_tag LOCUS_06810 14432 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 15583 14441 gene locus_tag LOCUS_06820 gene metX 15583 14441 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_06820 17388 15643 gene locus_tag LOCUS_06830 gene abcT3 17388 15643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947008.1 protein_id gnl|my_center|LOCUS_06830 18288 17479 gene locus_tag LOCUS_06840 gene tpiA 18288 17479 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1S1 protein_id gnl|my_center|LOCUS_06840 18896 18285 gene locus_tag LOCUS_06850 gene coaE 18896 18285 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHR7 protein_id gnl|my_center|LOCUS_06850 19806 18874 gene locus_tag LOCUS_06860 gene hemC 19806 18874 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_06860 19954 19829 gene locus_tag LOCUS_06870 gene rpmJ 19954 19829 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH8 protein_id gnl|my_center|LOCUS_06870 20040 19967 gene locus_tag LOCUS_t00190 20040 19967 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20769 20053 gene locus_tag LOCUS_06880 20769 20053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_06880 20920 21414 gene locus_tag LOCUS_06890 20920 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 21398 22315 gene locus_tag LOCUS_06900 gene argF 21398 22315 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE8 protein_id gnl|my_center|LOCUS_06900 >Feature sequence020 827 156 gene locus_tag LOCUS_06910 827 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1051 890 gene locus_tag LOCUS_06920 1051 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1698 1051 gene locus_tag LOCUS_06930 gene nth 1698 1051 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05956 protein_id gnl|my_center|LOCUS_06930 1912 3351 gene locus_tag LOCUS_06940 1912 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3344 6418 gene locus_tag LOCUS_06950 3344 6418 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_06950 6442 7233 gene locus_tag LOCUS_06960 gene thiG 6442 7233 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_06960 7679 8644 gene locus_tag LOCUS_06970 7679 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 8666 9586 gene locus_tag LOCUS_06980 gene tsf 8666 9586 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_06980 9586 10305 gene locus_tag LOCUS_06990 gene pyrH 9586 10305 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 protein_id gnl|my_center|LOCUS_06990 10309 10860 gene locus_tag LOCUS_07000 gene frr 10309 10860 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F143 protein_id gnl|my_center|LOCUS_07000 10865 11575 gene locus_tag LOCUS_07010 gene uppS 10865 11575 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185S4 protein_id gnl|my_center|LOCUS_07010 11535 12296 gene locus_tag LOCUS_07020 11535 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 12334 12420 gene locus_tag LOCUS_t00200 12334 12420 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12459 13268 gene locus_tag LOCUS_07030 gene uppP2 12459 13268 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9K1 protein_id gnl|my_center|LOCUS_07030 13424 13636 gene locus_tag LOCUS_07040 13424 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 15251 13788 gene locus_tag LOCUS_07050 gene gatA 15251 13788 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 protein_id gnl|my_center|LOCUS_07050 15561 15244 gene locus_tag LOCUS_07060 gene panD 15561 15244 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYW7 protein_id gnl|my_center|LOCUS_07060 16563 15568 gene locus_tag LOCUS_07070 16563 15568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 17541 16576 gene locus_tag LOCUS_07080 gene pdhA 17541 16576 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMJ2 protein_id gnl|my_center|LOCUS_07080 18439 18014 gene locus_tag LOCUS_07090 gene aroQ 18439 18014 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHI3 protein_id gnl|my_center|LOCUS_07090 19254 18502 gene locus_tag LOCUS_07100 19254 18502 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_07100 19436 20152 gene locus_tag LOCUS_07110 19436 20152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence021 636 214 gene locus_tag LOCUS_07120 636 214 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_07120 733 1167 gene locus_tag LOCUS_07130 733 1167 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_07130 1197 2702 gene locus_tag LOCUS_07140 gene ycf24 1197 2702 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_07140 2729 3490 gene locus_tag LOCUS_07150 gene sufC 2729 3490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537716.1 protein_id gnl|my_center|LOCUS_07150 3483 4772 gene locus_tag LOCUS_07160 gene sufD 3483 4772 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_07160 4781 6010 gene locus_tag LOCUS_07170 4781 6010 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_07170 6016 6429 gene locus_tag LOCUS_07180 6016 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6432 6776 gene locus_tag LOCUS_07190 6432 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_07190 6752 7006 gene locus_tag LOCUS_07200 6752 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7019 7354 gene locus_tag LOCUS_07210 gene grlA 7019 7354 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CYD6 protein_id gnl|my_center|LOCUS_07210 7728 8597 gene locus_tag LOCUS_07220 7728 8597 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 protein_id gnl|my_center|LOCUS_07220 8654 9160 gene locus_tag LOCUS_07230 8654 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123243.1 protein_id gnl|my_center|LOCUS_07230 10191 9169 gene locus_tag LOCUS_07240 10191 9169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388877.1 protein_id gnl|my_center|LOCUS_07240 10569 10195 gene locus_tag LOCUS_07250 10569 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_07250 11081 10566 gene locus_tag LOCUS_07260 11081 10566 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT82 protein_id gnl|my_center|LOCUS_07260 11837 11205 gene locus_tag LOCUS_07270 11837 11205 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_07270 12437 12646 gene locus_tag LOCUS_07280 12437 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 13466 13891 gene locus_tag LOCUS_07290 13466 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCV8 protein_id gnl|my_center|LOCUS_07290 13892 15277 gene locus_tag LOCUS_07300 gene dnaA 13892 15277 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59758 protein_id gnl|my_center|LOCUS_07300 >Feature sequence022 1108 284 gene locus_tag LOCUS_07310 1108 284 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_07310 2376 1120 gene locus_tag LOCUS_07320 gene proA 2376 1120 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV8 protein_id gnl|my_center|LOCUS_07320 2813 2388 gene locus_tag LOCUS_07330 2813 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5129 2868 gene locus_tag LOCUS_07340 5129 2868 CDS product malic protein NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_07340 6290 5679 gene locus_tag LOCUS_07350 gene tmk 6290 5679 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_07350 6634 7179 gene locus_tag LOCUS_07360 gene def 6634 7179 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF24 protein_id gnl|my_center|LOCUS_07360 7166 8365 gene locus_tag LOCUS_07370 7166 8365 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_07370 8377 10134 gene locus_tag LOCUS_07380 gene ilvB 8377 10134 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y481 protein_id gnl|my_center|LOCUS_07380 10995 10318 gene locus_tag LOCUS_07390 10995 10318 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597733.1 protein_id gnl|my_center|LOCUS_07390 11355 11005 gene locus_tag LOCUS_07400 11355 11005 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIJ2 protein_id gnl|my_center|LOCUS_07400 12157 11342 gene locus_tag LOCUS_07410 12157 11342 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016511.1 protein_id gnl|my_center|LOCUS_07410 12469 13737 gene locus_tag LOCUS_07420 gene nuoF 12469 13737 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE33 protein_id gnl|my_center|LOCUS_07420 15326 14028 gene locus_tag LOCUS_07430 15326 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 15859 15329 gene locus_tag LOCUS_07440 gene dut 15859 15329 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Y7 protein_id gnl|my_center|LOCUS_07440 16990 16043 gene locus_tag LOCUS_07450 gene ispH 16990 16043 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI7 protein_id gnl|my_center|LOCUS_07450 18043 17273 gene locus_tag LOCUS_07460 gene psd 18043 17273 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDT4 protein_id gnl|my_center|LOCUS_07460 18261 19001 gene locus_tag LOCUS_07470 18261 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 19187 18993 gene locus_tag LOCUS_07480 19187 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 <20342 19613 gene locus_tag LOCUS_07490 <20342 19613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765612.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence023 252 623 gene locus_tag LOCUS_07500 252 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4167 1753 gene locus_tag LOCUS_07510 gene topA 4167 1753 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDK2 protein_id gnl|my_center|LOCUS_07510 4958 4236 gene locus_tag LOCUS_07520 4958 4236 CDS product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707139.1 protein_id gnl|my_center|LOCUS_07520 5209 5985 gene locus_tag LOCUS_07530 5209 5985 CDS product putative glycosyltransferase RP128 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05944 protein_id gnl|my_center|LOCUS_07530 6108 6332 gene locus_tag LOCUS_07540 gene atpE 6108 6332 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZEC2 protein_id gnl|my_center|LOCUS_07540 6348 6791 gene locus_tag LOCUS_07550 6348 6791 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596669.1 protein_id gnl|my_center|LOCUS_07550 6799 7284 gene locus_tag LOCUS_07560 6799 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7304 7525 gene locus_tag LOCUS_07570 gene rpmE 7304 7525 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ07 protein_id gnl|my_center|LOCUS_07570 8693 7725 gene locus_tag LOCUS_07580 8693 7725 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391367.1 protein_id gnl|my_center|LOCUS_07580 9663 8881 gene locus_tag LOCUS_07590 9663 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 9705 10457 gene locus_tag LOCUS_07600 gene hisF 9705 10457 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_07600 10473 11465 gene locus_tag LOCUS_07610 gene msrA 10473 11465 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCX9 protein_id gnl|my_center|LOCUS_07610 12550 11564 gene locus_tag LOCUS_07620 gene hemB 12550 11564 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8U8 protein_id gnl|my_center|LOCUS_07620 12736 13260 gene locus_tag LOCUS_07630 12736 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 13393 13318 gene locus_tag LOCUS_t00210 13393 13318 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13437 13799 gene locus_tag LOCUS_07640 13437 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 13796 15046 gene locus_tag LOCUS_07650 gene lysA 13796 15046 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX9 protein_id gnl|my_center|LOCUS_07650 15267 16208 gene locus_tag LOCUS_07660 gene mdh 15267 16208 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EYJ6 protein_id gnl|my_center|LOCUS_07660 16208 16528 gene locus_tag LOCUS_07670 16208 16528 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719579.1 protein_id gnl|my_center|LOCUS_07670 16603 17196 gene locus_tag LOCUS_07680 gene hisB 16603 17196 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM8 protein_id gnl|my_center|LOCUS_07680 17193 17726 gene locus_tag LOCUS_07690 17193 17726 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK3 protein_id gnl|my_center|LOCUS_07690 17788 17991 gene locus_tag LOCUS_07700 gene rpmI 17788 17991 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_07700 18006 18365 gene locus_tag LOCUS_07710 gene rplT 18006 18365 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCV0 protein_id gnl|my_center|LOCUS_07710 18384 19268 gene locus_tag LOCUS_07720 18384 19268 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence024 988 89 gene locus_tag LOCUS_07730 988 89 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_07730 1036 1350 gene locus_tag LOCUS_07740 1036 1350 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_07740 1605 3917 gene locus_tag LOCUS_07750 gene metE 1605 3917 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S338 protein_id gnl|my_center|LOCUS_07750 4053 4661 gene locus_tag LOCUS_07760 gene ruvA 4053 4661 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDE6 protein_id gnl|my_center|LOCUS_07760 4658 5440 gene locus_tag LOCUS_07770 4658 5440 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_07770 5451 6089 gene locus_tag LOCUS_07780 5451 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7196 6084 gene locus_tag LOCUS_07790 gene proB 7196 6084 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X86 protein_id gnl|my_center|LOCUS_07790 9458 7551 gene locus_tag LOCUS_07800 gene kup 9458 7551 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_07800 10282 9554 gene locus_tag LOCUS_07810 10282 9554 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_07810 10591 10923 gene locus_tag LOCUS_07820 10591 10923 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DV9 protein_id gnl|my_center|LOCUS_07820 10916 11737 gene locus_tag LOCUS_07830 10916 11737 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597696.1 protein_id gnl|my_center|LOCUS_07830 11782 12318 gene locus_tag LOCUS_07840 gene pth 11782 12318 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCV4 protein_id gnl|my_center|LOCUS_07840 12328 12774 gene locus_tag LOCUS_07850 gene queF 12328 12774 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A515 protein_id gnl|my_center|LOCUS_07850 12833 13288 gene locus_tag LOCUS_07860 12833 13288 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707850.1 protein_id gnl|my_center|LOCUS_07860 13333 14334 gene locus_tag LOCUS_07870 13333 14334 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD33 protein_id gnl|my_center|LOCUS_07870 14331 14960 gene locus_tag LOCUS_07880 14331 14960 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_07880 15530 14952 gene locus_tag LOCUS_07890 gene folE 15530 14952 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_07890 15683 16423 gene locus_tag LOCUS_07900 15683 16423 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_07900 16404 17306 gene locus_tag LOCUS_07910 16404 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence025 1337 132 gene locus_tag LOCUS_07920 1337 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1857 2699 gene locus_tag LOCUS_07930 gene hemF 1857 2699 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC86 protein_id gnl|my_center|LOCUS_07930 3266 3850 gene locus_tag LOCUS_07940 3266 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4238 4969 gene locus_tag LOCUS_07950 4238 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6832 5630 gene locus_tag LOCUS_07960 6832 5630 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957762.1 protein_id gnl|my_center|LOCUS_07960 8987 7188 gene locus_tag LOCUS_07970 8987 7188 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_07970 11287 9119 gene locus_tag LOCUS_07980 gene priA 11287 9119 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD10 protein_id gnl|my_center|LOCUS_07980 12028 11447 gene locus_tag LOCUS_07990 12028 11447 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE36 protein_id gnl|my_center|LOCUS_07990 13120 12101 gene locus_tag LOCUS_08000 13120 12101 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891843.1 protein_id gnl|my_center|LOCUS_08000 13449 13120 gene locus_tag LOCUS_08010 13449 13120 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124399.1 protein_id gnl|my_center|LOCUS_08010 13569 13496 gene locus_tag LOCUS_t00220 13569 13496 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14730 13651 gene locus_tag LOCUS_08020 14730 13651 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883103.1 protein_id gnl|my_center|LOCUS_08020 15078 16559 gene locus_tag LOCUS_08030 gene pepA 15078 16559 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_08030 17056 16844 gene locus_tag LOCUS_08040 17056 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence026 890 90 gene locus_tag LOCUS_08050 gene trpA 890 90 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07344 protein_id gnl|my_center|LOCUS_08050 1007 2743 gene locus_tag LOCUS_08060 gene yidC 1007 2743 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_08060 5075 3276 gene locus_tag LOCUS_08070 gene sdhA 5075 3276 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31038 protein_id gnl|my_center|LOCUS_08070 5593 5240 gene locus_tag LOCUS_08080 5593 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5994 5593 gene locus_tag LOCUS_08090 gene sdhC 5994 5593 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41085 protein_id gnl|my_center|LOCUS_08090 6220 6963 gene locus_tag LOCUS_08100 gene thiD1 6220 6963 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948213.1 protein_id gnl|my_center|LOCUS_08100 6990 7862 gene locus_tag LOCUS_08110 gene cyoE 6990 7862 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXC3 protein_id gnl|my_center|LOCUS_08110 7869 8570 gene locus_tag LOCUS_08120 gene queC 7869 8570 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFU6 protein_id gnl|my_center|LOCUS_08120 8557 10086 gene locus_tag LOCUS_08130 8557 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10090 10803 gene locus_tag LOCUS_08140 10090 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 11036 11617 gene locus_tag LOCUS_08150 11036 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 12881 11718 gene locus_tag LOCUS_08160 12881 11718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920866.1 protein_id gnl|my_center|LOCUS_08160 13959 13114 gene locus_tag LOCUS_08170 gene pheA 13959 13114 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_08170 14114 13956 gene locus_tag LOCUS_08180 14114 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 15426 14056 gene locus_tag LOCUS_08190 15426 14056 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886315.1 protein_id gnl|my_center|LOCUS_08190 15842 15423 gene locus_tag LOCUS_08200 15842 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15898 16215 gene locus_tag LOCUS_08210 15898 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 16362 16541 gene locus_tag LOCUS_08220 16362 16541 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU87 protein_id gnl|my_center|LOCUS_08220 >Feature sequence027 843 181 gene locus_tag LOCUS_08230 gene trmD 843 181 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BC2 protein_id gnl|my_center|LOCUS_08230 1256 939 gene locus_tag LOCUS_08240 1256 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08240 1870 1292 gene locus_tag LOCUS_08250 1870 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 2273 1878 gene locus_tag LOCUS_08260 2273 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2748 2287 gene locus_tag LOCUS_08270 2748 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3737 2745 gene locus_tag LOCUS_08280 gene ruvB 3737 2745 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDE5 protein_id gnl|my_center|LOCUS_08280 4625 3750 gene locus_tag LOCUS_08290 4625 3750 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597362.1 protein_id gnl|my_center|LOCUS_08290 5421 4627 gene locus_tag LOCUS_08300 5421 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6121 5414 gene locus_tag LOCUS_08310 gene cinA 6121 5414 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_08310 6312 6175 gene locus_tag LOCUS_08320 6312 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7024 6269 gene locus_tag LOCUS_08330 7024 6269 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480548.1 protein_id gnl|my_center|LOCUS_08330 8234 7092 gene locus_tag LOCUS_08340 8234 7092 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_08340 9148 8537 gene locus_tag LOCUS_08350 gene rsmG 9148 8537 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE89 protein_id gnl|my_center|LOCUS_08350 9278 10207 gene locus_tag LOCUS_08360 9278 10207 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_08360 10249 10563 gene locus_tag LOCUS_08370 10249 10563 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E465 protein_id gnl|my_center|LOCUS_08370 10565 11305 gene locus_tag LOCUS_08380 gene kdsB 10565 11305 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDF0 protein_id gnl|my_center|LOCUS_08380 11295 11534 gene locus_tag LOCUS_08390 gene purS 11295 11534 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB02 protein_id gnl|my_center|LOCUS_08390 11537 12361 gene locus_tag LOCUS_08400 gene dapD 11537 12361 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_08400 12367 12443 gene locus_tag LOCUS_t00230 12367 12443 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14139 12991 gene locus_tag LOCUS_08410 14139 12991 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599197.1 protein_id gnl|my_center|LOCUS_08410 14361 14149 gene locus_tag LOCUS_08420 14361 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14867 15784 gene locus_tag LOCUS_08430 gene folD 14867 15784 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_08430 >Feature sequence028 483 836 gene locus_tag LOCUS_08440 483 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1004 1080 gene locus_tag LOCUS_t00240 1004 1080 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1093 1638 gene locus_tag LOCUS_08450 gene atpH 1093 1638 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 protein_id gnl|my_center|LOCUS_08450 1657 3186 gene locus_tag LOCUS_08460 gene atpA 1657 3186 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50288 protein_id gnl|my_center|LOCUS_08460 3440 4333 gene locus_tag LOCUS_08470 gene atpG 3440 4333 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S2 protein_id gnl|my_center|LOCUS_08470 4786 5118 gene locus_tag LOCUS_08480 4786 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 6197 5253 gene locus_tag LOCUS_08490 gene pyrB 6197 5253 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022616.1 protein_id gnl|my_center|LOCUS_08490 9495 6190 gene locus_tag LOCUS_08500 gene carB 9495 6190 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEH1 protein_id gnl|my_center|LOCUS_08500 10696 9530 gene locus_tag LOCUS_08510 gene carA 10696 9530 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEH2 protein_id gnl|my_center|LOCUS_08510 12629 11574 gene locus_tag LOCUS_08520 gene glnA 12629 11574 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E31 protein_id gnl|my_center|LOCUS_08520 12831 14960 gene locus_tag LOCUS_08530 gene pcrA 12831 14960 CDS product ATP-dependent DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRT9 protein_id gnl|my_center|LOCUS_08530 15197 14928 gene locus_tag LOCUS_08540 15197 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 15310 15831 gene locus_tag LOCUS_08550 15310 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence029 157 1650 gene locus_tag LOCUS_08560 157 1650 CDS product UPF0061 protein R00982 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RB2 protein_id gnl|my_center|LOCUS_08560 1963 4701 gene locus_tag LOCUS_08570 gene gyrA 1963 4701 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_08570 4892 6052 gene locus_tag LOCUS_08580 4892 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6720 7934 gene locus_tag LOCUS_08590 6720 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8052 9368 gene locus_tag LOCUS_08600 gene ubiB 8052 9368 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFD9 protein_id gnl|my_center|LOCUS_08600 9455 10072 gene locus_tag LOCUS_08610 gene leuD 9455 10072 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LA1 protein_id gnl|my_center|LOCUS_08610 10079 10897 gene locus_tag LOCUS_08620 gene fabI-2 10079 10897 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U2 protein_id gnl|my_center|LOCUS_08620 10922 11578 gene locus_tag LOCUS_08630 gene gmk 10922 11578 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD7 protein_id gnl|my_center|LOCUS_08630 11664 11999 gene locus_tag LOCUS_08640 11664 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12095 12529 gene locus_tag LOCUS_08650 12095 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 12566 14080 gene locus_tag LOCUS_08660 12566 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 15797 14619 gene locus_tag LOCUS_08670 gene nuoD 15797 14619 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDH4 protein_id gnl|my_center|LOCUS_08670 >Feature sequence030 1590 244 gene locus_tag LOCUS_08680 gene murD 1590 244 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC2 protein_id gnl|my_center|LOCUS_08680 2874 2383 gene locus_tag LOCUS_08690 gene purE 2874 2383 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8M2 protein_id gnl|my_center|LOCUS_08690 3538 2867 gene locus_tag LOCUS_08700 3538 2867 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_08700 3784 5187 gene locus_tag LOCUS_08710 3784 5187 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_08710 5174 5623 gene locus_tag LOCUS_08720 gene fabZ 5174 5623 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_08720 5625 6404 gene locus_tag LOCUS_08730 gene lpxA 5625 6404 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_08730 6873 6948 gene locus_tag LOCUS_t00250 6873 6948 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6981 7169 gene locus_tag LOCUS_08740 6981 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7467 9077 gene locus_tag LOCUS_08750 7467 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 9070 9369 gene locus_tag LOCUS_08760 9070 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9366 9698 gene locus_tag LOCUS_08770 9366 9698 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_08770 9726 9800 gene locus_tag LOCUS_t00260 9726 9800 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12215 9846 gene locus_tag LOCUS_08780 gene pheT 12215 9846 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WI2 protein_id gnl|my_center|LOCUS_08780 12977 12252 gene locus_tag LOCUS_08790 gene hisA 12977 12252 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM5 protein_id gnl|my_center|LOCUS_08790 13767 12985 gene locus_tag LOCUS_08800 gene nadK 13767 12985 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDA2 protein_id gnl|my_center|LOCUS_08800 14177 15277 gene locus_tag LOCUS_08810 gene hisC2 14177 15277 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL9 protein_id gnl|my_center|LOCUS_08810 >Feature sequence031 1664 996 gene locus_tag LOCUS_08820 1664 996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065420.1 protein_id gnl|my_center|LOCUS_08820 3475 1733 gene locus_tag LOCUS_08830 3475 1733 CDS product type IV secretion system protein VirD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597372.1 protein_id gnl|my_center|LOCUS_08830 4856 3588 gene locus_tag LOCUS_08840 gene glyA 4856 3588 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_08840 6164 4956 gene locus_tag LOCUS_08850 gene iscS 6164 4956 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 protein_id gnl|my_center|LOCUS_08850 7282 6167 gene locus_tag LOCUS_08860 gene iscS 7282 6167 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Z9 protein_id gnl|my_center|LOCUS_08860 8865 7867 gene locus_tag LOCUS_08870 8865 7867 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_08870 10111 8858 gene locus_tag LOCUS_08880 10111 8858 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA77 protein_id gnl|my_center|LOCUS_08880 11255 10317 gene locus_tag LOCUS_08890 11255 10317 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_08890 13253 11412 gene locus_tag LOCUS_08900 13253 11412 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 protein_id gnl|my_center|LOCUS_08900 14526 13240 gene locus_tag LOCUS_08910 14526 13240 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_08910 15218 14547 gene locus_tag LOCUS_08920 15218 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence032 <1 1151 gene locus_tag LOCUS_08930 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YLE1:dihydroorotase 1432 1689 gene locus_tag LOCUS_08940 1432 1689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_08940 1856 2692 gene locus_tag LOCUS_08950 1856 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946413.1 protein_id gnl|my_center|LOCUS_08950 4168 2993 gene locus_tag LOCUS_08960 gene argD 4168 2993 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI71 protein_id gnl|my_center|LOCUS_08960 4736 4155 gene locus_tag LOCUS_08970 4736 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 5974 4733 gene locus_tag LOCUS_08980 gene hisS 5974 4733 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_08980 6119 7324 gene locus_tag LOCUS_08990 6119 7324 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVA9 protein_id gnl|my_center|LOCUS_08990 8269 7541 gene locus_tag LOCUS_09000 8269 7541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_09000 9020 8259 gene locus_tag LOCUS_09010 9020 8259 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022442.1 protein_id gnl|my_center|LOCUS_09010 9569 9021 gene locus_tag LOCUS_09020 9569 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_09020 9898 9566 gene locus_tag LOCUS_09030 9898 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 9927 10205 gene locus_tag LOCUS_09040 9927 10205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11315 10791 gene locus_tag LOCUS_09050 11315 10791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263585.1 protein_id gnl|my_center|LOCUS_09050 12456 11308 gene locus_tag LOCUS_09060 12456 11308 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_09060 13231 12446 gene locus_tag LOCUS_09070 13231 12446 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_09070 14478 13219 gene locus_tag LOCUS_09080 14478 13219 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263589.1 protein_id gnl|my_center|LOCUS_09080 14834 14589 gene locus_tag LOCUS_09090 14834 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence033 3195 91 gene locus_tag LOCUS_09100 3195 91 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941986.1 protein_id gnl|my_center|LOCUS_09100 4507 3197 gene locus_tag LOCUS_09110 4507 3197 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_09110 5723 4509 gene locus_tag LOCUS_09120 5723 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7272 6160 gene locus_tag LOCUS_09130 gene recF 7272 6160 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ65 protein_id gnl|my_center|LOCUS_09130 8388 7273 gene locus_tag LOCUS_09140 8388 7273 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_09140 8529 9284 gene locus_tag LOCUS_09150 gene atpB 8529 9284 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_09150 9449 12358 gene locus_tag LOCUS_09160 9449 12358 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083576.1 protein_id gnl|my_center|LOCUS_09160 13037 12495 gene locus_tag LOCUS_09170 13037 12495 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597783.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence034 2430 1510 gene locus_tag LOCUS_09180 gene xerC 2430 1510 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV24 protein_id gnl|my_center|LOCUS_09180 2490 3119 gene locus_tag LOCUS_09190 gene pgsA 2490 3119 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE96 protein_id gnl|my_center|LOCUS_09190 4366 3437 gene locus_tag LOCUS_09200 gene ltd 4366 3437 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_09200 4538 5512 gene locus_tag LOCUS_09210 gene gpsA 4538 5512 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZB6 protein_id gnl|my_center|LOCUS_09210 5551 5626 gene locus_tag LOCUS_t00270 5551 5626 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5651 6352 gene locus_tag LOCUS_09220 5651 6352 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_09220 6425 9055 gene locus_tag LOCUS_09230 gene acn 6425 9055 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37032 protein_id gnl|my_center|LOCUS_09230 9378 12134 gene locus_tag LOCUS_09240 gene polA 9378 12134 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260947.1 protein_id gnl|my_center|LOCUS_09240 12365 12195 gene locus_tag LOCUS_09250 12365 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 12640 12407 gene locus_tag LOCUS_09260 12640 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 >Feature sequence035 <1 949 gene locus_tag LOCUS_09270 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001252884.1:two-component sensor kinase 1010 2170 gene locus_tag LOCUS_09280 1010 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2183 3826 gene locus_tag LOCUS_09290 gene nadE 2183 3826 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975715.1 protein_id gnl|my_center|LOCUS_09290 3876 5804 gene locus_tag LOCUS_09300 gene uvrC 3876 5804 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCX9 protein_id gnl|my_center|LOCUS_09300 6124 6579 gene locus_tag LOCUS_09310 6124 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 7447 6617 gene locus_tag LOCUS_09320 7447 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7897 7460 gene locus_tag LOCUS_09330 7897 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7999 9255 gene locus_tag LOCUS_09340 gene serS 7999 9255 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBU2 protein_id gnl|my_center|LOCUS_09340 10842 9451 gene locus_tag LOCUS_09350 gene gltX2 10842 9451 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCT8 protein_id gnl|my_center|LOCUS_09350 >Feature sequence036 243 37 gene locus_tag LOCUS_09360 243 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 433 218 gene locus_tag LOCUS_09370 433 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 853 605 gene locus_tag LOCUS_09380 853 605 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHA5 protein_id gnl|my_center|LOCUS_09380 1846 929 gene locus_tag LOCUS_09390 gene rluC 1846 929 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZ66 protein_id gnl|my_center|LOCUS_09390 2638 2042 gene locus_tag LOCUS_09400 2638 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970823.1 protein_id gnl|my_center|LOCUS_09400 3152 4135 gene locus_tag LOCUS_09410 3152 4135 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858949.1 protein_id gnl|my_center|LOCUS_09410 6481 4370 gene locus_tag LOCUS_09420 gene ligA 6481 4370 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCK9 protein_id gnl|my_center|LOCUS_09420 7032 6583 gene locus_tag LOCUS_09430 7032 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8140 7118 gene locus_tag LOCUS_09440 gene recA 8140 7118 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41079 protein_id gnl|my_center|LOCUS_09440 9043 8162 gene locus_tag LOCUS_09450 9043 8162 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_09450 10267 9065 gene locus_tag LOCUS_09460 gene sucC 10267 9065 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 protein_id gnl|my_center|LOCUS_09460 >Feature sequence037 300 608 gene locus_tag LOCUS_09470 300 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 977 1129 gene locus_tag LOCUS_09480 977 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1254 1613 gene locus_tag LOCUS_09490 1254 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1813 2889 gene locus_tag LOCUS_09500 1813 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7095 3496 gene locus_tag LOCUS_09510 7095 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392178.1 protein_id gnl|my_center|LOCUS_09510 11702 7155 gene locus_tag LOCUS_09520 11702 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence038 2100 811 gene locus_tag LOCUS_09530 gene clpX 2100 811 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_09530 2723 2136 gene locus_tag LOCUS_09540 gene clpP 2723 2136 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHI5 protein_id gnl|my_center|LOCUS_09540 2803 3393 gene locus_tag LOCUS_09550 gene grpE 2803 3393 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5E2 protein_id gnl|my_center|LOCUS_09550 3394 4260 gene locus_tag LOCUS_09560 3394 4260 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_09560 4260 4334 gene locus_tag LOCUS_t00280 4260 4334 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6002 4476 gene locus_tag LOCUS_09570 6002 4476 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020819.1 protein_id gnl|my_center|LOCUS_09570 7371 6148 gene locus_tag LOCUS_09580 7371 6148 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596689.1 protein_id gnl|my_center|LOCUS_09580 7808 7371 gene locus_tag LOCUS_09590 gene queD 7808 7371 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY5 protein_id gnl|my_center|LOCUS_09590 9451 7805 gene locus_tag LOCUS_09600 9451 7805 CDS product putative export ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCM8 protein_id gnl|my_center|LOCUS_09600 10212 9463 gene locus_tag LOCUS_09610 gene moeB 10212 9463 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_09610 10369 10223 gene locus_tag LOCUS_09620 10369 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 10649 10798 gene locus_tag LOCUS_09630 10649 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence039 635 195 gene locus_tag LOCUS_09640 635 195 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_09640 1020 2411 gene locus_tag LOCUS_09650 gene guaB 1020 2411 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU6 protein_id gnl|my_center|LOCUS_09650 2411 3109 gene locus_tag LOCUS_09660 2411 3109 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886314.1 protein_id gnl|my_center|LOCUS_09660 3122 4858 gene locus_tag LOCUS_09670 3122 4858 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260919.1 protein_id gnl|my_center|LOCUS_09670 5281 5207 gene locus_tag LOCUS_t00290 5281 5207 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5576 5974 gene locus_tag LOCUS_09680 5576 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5967 8120 gene locus_tag LOCUS_09690 gene fadJ 5967 8120 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM3 protein_id gnl|my_center|LOCUS_09690 8107 8634 gene locus_tag LOCUS_09700 gene coq7 8107 8634 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_09700 8634 10790 gene locus_tag LOCUS_09710 gene glyS 8634 10790 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCB1 protein_id gnl|my_center|LOCUS_09710 11007 10858 gene locus_tag LOCUS_09720 11007 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence040 2788 803 gene locus_tag LOCUS_09730 gene recG 2788 803 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537742.1 protein_id gnl|my_center|LOCUS_09730 3073 3354 gene locus_tag LOCUS_09740 gene hup-3 3073 3354 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_09740 3923 5476 gene locus_tag LOCUS_09750 gene lysS 3923 5476 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX38 protein_id gnl|my_center|LOCUS_09750 5463 6260 gene locus_tag LOCUS_09760 gene ftsQ 5463 6260 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS5 protein_id gnl|my_center|LOCUS_09760 6253 8481 gene locus_tag LOCUS_09770 gene lptD 6253 8481 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 protein_id gnl|my_center|LOCUS_09770 9432 10757 gene locus_tag LOCUS_09780 9432 10757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence041 167 379 gene locus_tag LOCUS_09790 167 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 414 563 gene locus_tag LOCUS_09800 414 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1010 591 gene locus_tag LOCUS_09810 1010 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09810 1677 1414 gene locus_tag LOCUS_09820 1677 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09820 2032 2394 gene locus_tag LOCUS_09830 2032 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3333 2638 gene locus_tag LOCUS_09840 3333 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4468 3317 gene locus_tag LOCUS_09850 gene dapE 4468 3317 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYE7 protein_id gnl|my_center|LOCUS_09850 5802 4465 gene locus_tag LOCUS_09860 gene glmM 5802 4465 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN17 protein_id gnl|my_center|LOCUS_09860 6351 5815 gene locus_tag LOCUS_09870 gene nuoB 6351 5815 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 protein_id gnl|my_center|LOCUS_09870 7499 7017 gene locus_tag LOCUS_09880 7499 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7916 7701 gene locus_tag LOCUS_09890 7916 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8784 8032 gene locus_tag LOCUS_09900 gene znuB 8784 8032 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_09900 9665 8781 gene locus_tag LOCUS_09910 gene znuA 9665 8781 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence042 5589 1504 gene locus_tag LOCUS_09920 gene rpoB 5589 1504 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52271 protein_id gnl|my_center|LOCUS_09920 6099 5671 gene locus_tag LOCUS_09930 6099 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6719 6207 gene locus_tag LOCUS_09940 gene rplJ 6719 6207 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_09940 7396 6719 gene locus_tag LOCUS_09950 gene rplA 7396 6719 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFW1 protein_id gnl|my_center|LOCUS_09950 7838 7407 gene locus_tag LOCUS_09960 gene rplK 7838 7407 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU9 protein_id gnl|my_center|LOCUS_09960 8423 7896 gene locus_tag LOCUS_09970 gene nusG 8423 7896 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU8 protein_id gnl|my_center|LOCUS_09970 8609 8433 gene locus_tag LOCUS_09980 8609 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 8698 8622 gene locus_tag LOCUS_t00300 8698 8622 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 1782 367 gene locus_tag LOCUS_09990 gene rmuC 1782 367 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCN3 protein_id gnl|my_center|LOCUS_09990 1865 4207 gene locus_tag LOCUS_10000 gene lon 1865 4207 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5I4 protein_id gnl|my_center|LOCUS_10000 4207 4980 gene locus_tag LOCUS_10010 4207 4980 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_10010 5769 7648 gene locus_tag LOCUS_r00020 5769 7648 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 58 percent of the 23S ribosomal RNA >Feature sequence044 435 893 gene locus_tag LOCUS_10020 gene zur 435 893 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_10020 1259 897 gene locus_tag LOCUS_10030 1259 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1984 2196 gene locus_tag LOCUS_10040 1984 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2248 3312 gene locus_tag LOCUS_10050 gene ribBA 2248 3312 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZU9 protein_id gnl|my_center|LOCUS_10050 4472 3360 gene locus_tag LOCUS_10060 4472 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4815 5270 gene locus_tag LOCUS_10070 4815 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence045 129 1181 gene locus_tag LOCUS_10080 gene rfaK 129 1181 CDS product LPS N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222112.1 protein_id gnl|my_center|LOCUS_10080 1975 1397 gene locus_tag LOCUS_10090 1975 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3271 2003 gene locus_tag LOCUS_10100 3271 2003 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K7 protein_id gnl|my_center|LOCUS_10100 4211 3339 gene locus_tag LOCUS_10110 4211 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5737 4211 gene locus_tag LOCUS_10120 5737 4211 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 protein_id gnl|my_center|LOCUS_10120 7020 5737 gene locus_tag LOCUS_10130 gene gcvPA 7020 5737 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 protein_id gnl|my_center|LOCUS_10130 >Feature sequence046 1134 577 gene locus_tag LOCUS_10140 gene engB 1134 577 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZG89 protein_id gnl|my_center|LOCUS_10140 4022 1527 gene locus_tag LOCUS_10150 4022 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4548 4024 gene locus_tag LOCUS_10160 4548 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5858 4602 gene locus_tag LOCUS_10170 5858 4602 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE4 protein_id gnl|my_center|LOCUS_10170 6049 6125 gene locus_tag LOCUS_t00310 6049 6125 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6590 6901 gene locus_tag LOCUS_10180 6590 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence047 2532 1630 gene locus_tag LOCUS_10190 2532 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2851 3579 gene locus_tag LOCUS_10200 2851 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3583 4572 gene locus_tag LOCUS_10210 3583 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_10210 6032 4740 gene locus_tag LOCUS_10220 6032 4740 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_10220 6128 6883 gene locus_tag LOCUS_10230 6128 6883 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RS8 protein_id gnl|my_center|LOCUS_10230 6971 7060 gene locus_tag LOCUS_t00320 6971 7060 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 180 1235 gene locus_tag LOCUS_10240 gene pyrD 180 1235 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK85 protein_id gnl|my_center|LOCUS_10240 2339 1239 gene locus_tag LOCUS_10250 gene ald 2339 1239 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_10250 3149 2403 gene locus_tag LOCUS_10260 3149 2403 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_10260 3227 4915 gene locus_tag LOCUS_10270 gene pbpC 3227 4915 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence049 154 1320 gene locus_tag LOCUS_10280 154 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1320 2000 gene locus_tag LOCUS_10290 1320 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2642 5176 gene locus_tag LOCUS_10300 gene valS 2642 5176 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCN6 protein_id gnl|my_center|LOCUS_10300 >Feature sequence050 2249 1086 gene locus_tag LOCUS_10310 2249 1086 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX62 protein_id gnl|my_center|LOCUS_10310 3076 2246 gene locus_tag LOCUS_10320 3076 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3339 4367 gene locus_tag LOCUS_10330 3339 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4380 4775 gene locus_tag LOCUS_10340 4380 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4768 4923 gene locus_tag LOCUS_10350 4768 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4978 5466 gene locus_tag LOCUS_10360 4978 5466 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence051 77 916 gene locus_tag LOCUS_10370 77 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1083 2123 gene locus_tag LOCUS_10380 1083 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2125 3300 gene locus_tag LOCUS_10390 2125 3300 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_10390 3466 3816 gene locus_tag LOCUS_10400 3466 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3806 4372 gene locus_tag LOCUS_10410 3806 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4468 4662 gene locus_tag LOCUS_10420 4468 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4649 6235 gene locus_tag LOCUS_10430 4649 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence052 2752 539 gene locus_tag LOCUS_10440 2752 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2843 2670 gene locus_tag LOCUS_10450 2843 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3128 3319 gene locus_tag LOCUS_10460 3128 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4090 4356 gene locus_tag LOCUS_10470 4090 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4290 4718 gene locus_tag LOCUS_10480 4290 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4959 4762 gene locus_tag LOCUS_10490 4959 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5061 5315 gene locus_tag LOCUS_10500 5061 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5315 5584 gene locus_tag LOCUS_10510 5315 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_10510 5598 5822 gene locus_tag LOCUS_10520 5598 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence053 402 884 gene locus_tag LOCUS_10530 gene coaD 402 884 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEN5 protein_id gnl|my_center|LOCUS_10530 884 1603 gene locus_tag LOCUS_10540 884 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1600 2334 gene locus_tag LOCUS_10550 gene modA 1600 2334 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113014.1 protein_id gnl|my_center|LOCUS_10550 2933 2403 gene locus_tag LOCUS_10560 2933 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3894 2926 gene locus_tag LOCUS_10570 gene xerD 3894 2926 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDG8 protein_id gnl|my_center|LOCUS_10570 5295 4153 gene locus_tag LOCUS_10580 5295 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5662 5441 gene locus_tag LOCUS_10590 5662 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence054 3380 234 gene locus_tag LOCUS_10600 gene hsdR 3380 234 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_10600 4892 3384 gene locus_tag LOCUS_10610 gene hsdS 4892 3384 CDS product type I restriction-modification protein subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948401.1 protein_id gnl|my_center|LOCUS_10610 5305 4880 gene locus_tag LOCUS_10620 5305 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence055 1507 1761 gene locus_tag LOCUS_10630 1507 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1762 2106 gene locus_tag LOCUS_10640 1762 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2434 2240 gene locus_tag LOCUS_10650 2434 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2713 3576 gene locus_tag LOCUS_10660 2713 3576 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLC4 protein_id gnl|my_center|LOCUS_10660 >Feature sequence056 77 1477 gene locus_tag LOCUS_10670 77 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1505 2899 gene locus_tag LOCUS_10680 1505 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2968 3129 gene locus_tag LOCUS_10690 2968 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4941 3712 gene locus_tag LOCUS_10700 4941 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence057 180 626 gene locus_tag LOCUS_10710 180 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 692 2476 gene locus_tag LOCUS_10720 gene argS 692 2476 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE81 protein_id gnl|my_center|LOCUS_10720 2473 3165 gene locus_tag LOCUS_10730 2473 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3178 3846 gene locus_tag LOCUS_10740 3178 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence058 >Feature sequence059 5 1114 gene locus_tag LOCUS_10750 5 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1516 2187 gene locus_tag LOCUS_10760 1516 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3716 2367 gene locus_tag LOCUS_10770 gene glmU 3716 2367 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEH0 protein_id gnl|my_center|LOCUS_10770 >Feature sequence060 1512 4337 gene locus_tag LOCUS_10780 gene sucA 1512 4337 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDY3 protein_id gnl|my_center|LOCUS_10780 >Feature sequence061 576 274 gene locus_tag LOCUS_10790 576 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1000 1407 gene locus_tag LOCUS_10800 1000 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1421 2296 gene locus_tag LOCUS_10810 1421 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2357 3220 gene locus_tag LOCUS_10820 gene glyQ 2357 3220 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T913 protein_id gnl|my_center|LOCUS_10820 3285 4085 gene locus_tag LOCUS_10830 gene dapB 3285 4085 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_10830 >Feature sequence062 901 1641 gene locus_tag LOCUS_10840 901 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1638 2957 gene locus_tag LOCUS_10850 gene ahcY 1638 2957 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_10850 2963 3436 gene locus_tag LOCUS_10860 gene greA 2963 3436 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ80 protein_id gnl|my_center|LOCUS_10860 >Feature sequence063 370 1338 gene locus_tag LOCUS_10870 370 1338 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25746 protein_id gnl|my_center|LOCUS_10870 1335 2093 gene locus_tag LOCUS_10880 1335 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2111 2464 gene locus_tag LOCUS_10890 2111 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3407 2646 gene locus_tag LOCUS_10900 3407 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3916 3428 gene locus_tag LOCUS_10910 3916 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence064 288 455 gene locus_tag LOCUS_10920 288 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1839 886 gene locus_tag LOCUS_10930 1839 886 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_10930 2282 1863 gene locus_tag LOCUS_10940 2282 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2833 2324 gene locus_tag LOCUS_10950 2833 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3498 2851 gene locus_tag LOCUS_10960 3498 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence065 894 58 gene locus_tag LOCUS_10970 894 58 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393714.1 protein_id gnl|my_center|LOCUS_10970 1292 936 gene locus_tag LOCUS_10980 1292 936 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_10980 2787 1318 gene locus_tag LOCUS_10990 2787 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence066 2868 556 gene locus_tag LOCUS_11000 2868 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3218 2976 gene locus_tag LOCUS_11010 3218 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence067 198 1319 gene locus_tag LOCUS_11020 198 1319 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_11020 1316 1453 gene locus_tag LOCUS_11030 1316 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1988 1770 gene locus_tag LOCUS_11040 1988 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2080 2202 gene locus_tag LOCUS_11050 2080 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2272 2559 gene locus_tag LOCUS_11060 2272 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11060 2541 2756 gene locus_tag LOCUS_11070 2541 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11070 2731 3270 gene locus_tag LOCUS_11080 2731 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11080 >Feature sequence068 1282 386 gene locus_tag LOCUS_11090 1282 386 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_11090 2249 1272 gene locus_tag LOCUS_11100 2249 1272 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B748 protein_id gnl|my_center|LOCUS_11100 2800 2255 gene locus_tag LOCUS_11110 gene rfbC 2800 2255 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37780 protein_id gnl|my_center|LOCUS_11110 <3433 2790 gene locus_tag LOCUS_11120 <3433 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y837:glucose-1-phosphate thymidylyltransferase >Feature sequence069 1888 599 gene locus_tag LOCUS_11130 gene pabB 1888 599 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861217.1 protein_id gnl|my_center|LOCUS_11130 2537 1881 gene locus_tag LOCUS_11140 2537 1881 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence070 1660 824 gene locus_tag LOCUS_11150 1660 824 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_11150 2729 1653 gene locus_tag LOCUS_11160 2729 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence071 <1 2202 gene locus_tag LOCUS_11170 <1 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205723.1:cell surface protein 2195 2602 gene locus_tag LOCUS_11180 2195 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence072 431 757 gene locus_tag LOCUS_11190 431 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 839 1921 gene locus_tag LOCUS_11200 839 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence073 393 1430 gene locus_tag LOCUS_11210 393 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1614 2492 gene locus_tag LOCUS_11220 1614 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence074 145 1998 gene locus_tag LOCUS_11230 gene recQ 145 1998 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence075 >Feature sequence076 658 1689 gene locus_tag LOCUS_11240 658 1689 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_11240 1713 2000 gene locus_tag LOCUS_11250 1713 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11250 >Feature sequence077 311 132 gene locus_tag LOCUS_11260 311 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 <2224 283 gene locus_tag LOCUS_11270 <2224 283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183344.1:lipoprotein note possible pseudo, frameshifted >Feature sequence078 322 1647 gene locus_tag LOCUS_11280 gene mnmE 322 1647 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCI1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence079 1641 1219 gene locus_tag LOCUS_11290 1641 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1926 1666 gene locus_tag LOCUS_11300 1926 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence080 >Feature sequence081 1216 314 gene locus_tag LOCUS_11310 1216 314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706660.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence082 1379 1038 gene locus_tag LOCUS_11320 1379 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1529 1978 gene locus_tag LOCUS_11330 1529 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence083 258 611 gene locus_tag LOCUS_11340 258 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence084 543 619 gene locus_tag LOCUS_t00330 543 619 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1659 838 gene locus_tag LOCUS_11350 1659 838 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000336726.1 protein_id gnl|my_center|LOCUS_11350 2015 1719 gene locus_tag LOCUS_11360 2015 1719 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence085 >Feature sequence086 >Feature sequence087 >Feature sequence088 781 614 gene locus_tag LOCUS_11370 781 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 <1920 772 gene locus_tag LOCUS_11380 <1920 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183344.1:lipoprotein >Feature sequence089 <1 729 gene locus_tag LOCUS_11390 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729117.1:aspartate aminotransferase family protein 749 1588 gene locus_tag LOCUS_11400 749 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence090 >Feature sequence091 412 546 gene locus_tag LOCUS_11410 412 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence092 >Feature sequence093 232 357 gene locus_tag LOCUS_11420 232 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 693 457 gene locus_tag LOCUS_11430 693 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 927 1610 gene locus_tag LOCUS_11440 927 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence094 <1 994 gene locus_tag LOCUS_11450 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963504.1:glycosyl transferase 1231 1398 gene locus_tag LOCUS_11460 1231 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence095 100 279 gene locus_tag LOCUS_11470 100 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 248 574 gene locus_tag LOCUS_11480 248 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 756 571 gene locus_tag LOCUS_11490 756 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence096 1019 63 gene locus_tag LOCUS_11500 1019 63 CDS product teichoic acid biosynthesis protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107919.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence097 >Feature sequence098 >Feature sequence099 >Feature sequence100 >Feature sequence101 304 510 gene locus_tag LOCUS_11510 304 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 673 880 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaacggccgcgtaggccgcttagaag >Feature sequence102 >Feature sequence103 <1 1248 gene locus_tag LOCUS_11520 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183344.1:lipoprotein 1239 1358 gene locus_tag LOCUS_11530 1239 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 742 1167 gene locus_tag LOCUS_11540 742 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 >Feature sequence112 >Feature sequence113 71 364 gene locus_tag LOCUS_11550 71 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence114 438 184 gene locus_tag LOCUS_11560 438 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 <1160 478 gene locus_tag LOCUS_11570 <1160 478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P71366:putative type III restriction-modification system HindVIP enzyme mod >Feature sequence115 218 640 gene locus_tag LOCUS_11580 218 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence116 >Feature sequence117 488 93 gene locus_tag LOCUS_11590 488 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_11590 727 485 gene locus_tag LOCUS_11600 727 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence118 273 890 gene locus_tag LOCUS_11610 273 890 CDS product TniR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904941.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence119 >Feature sequence120 >Feature sequence121 >Feature sequence122 735 133 gene locus_tag LOCUS_11620 735 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence123 >Feature sequence124 <1004 26 gene locus_tag LOCUS_11630 <1004 26 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261129.1:permease >Feature sequence125 155 30 gene locus_tag LOCUS_11640 155 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 515 270 gene locus_tag LOCUS_11650 515 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 866 732 gene locus_tag LOCUS_11660 866 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660