>Feature sequence001 1097 906 gene locus_tag LOCUS_00010 1097 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1020 1688 gene locus_tag LOCUS_00020 1020 1688 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_00020 2147 1779 gene locus_tag LOCUS_00030 2147 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2296 2985 gene locus_tag LOCUS_00040 gene trkA 2296 2985 CDS product Trk system potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53949 protein_id gnl|my_center|LOCUS_00040 3074 3742 gene locus_tag LOCUS_00050 3074 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3742 4689 gene locus_tag LOCUS_00060 3742 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4764 7055 gene locus_tag LOCUS_00070 4764 7055 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029077.1 protein_id gnl|my_center|LOCUS_00070 7400 7062 gene locus_tag LOCUS_00080 7400 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7834 7397 gene locus_tag LOCUS_00090 7834 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8028 7837 gene locus_tag LOCUS_00100 8028 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8534 8094 gene locus_tag LOCUS_00110 8534 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9603 8752 gene locus_tag LOCUS_00120 9603 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10763 9600 gene locus_tag LOCUS_00130 10763 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11464 10760 gene locus_tag LOCUS_00140 11464 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11658 12455 gene locus_tag LOCUS_00150 11658 12455 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_00150 12452 13429 gene locus_tag LOCUS_00160 12452 13429 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_00160 14522 13578 gene locus_tag LOCUS_00170 14522 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15070 15363 gene locus_tag LOCUS_00180 15070 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16051 15440 gene locus_tag LOCUS_00190 16051 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16866 16057 gene locus_tag LOCUS_00200 16866 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17534 16863 gene locus_tag LOCUS_00210 17534 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 <18108 17566 gene locus_tag LOCUS_00220 <18108 17566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944018.1:membrane protein >Feature sequence002 344 778 gene locus_tag LOCUS_00230 344 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 1591 881 gene locus_tag LOCUS_00240 1591 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 2612 1674 gene locus_tag LOCUS_00250 2612 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 3462 2677 gene locus_tag LOCUS_00260 3462 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 3708 4376 gene locus_tag LOCUS_00270 3708 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 4972 4418 gene locus_tag LOCUS_00280 4972 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 5187 5333 gene locus_tag LOCUS_00290 5187 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5421 5942 gene locus_tag LOCUS_00300 5421 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 6100 7233 gene locus_tag LOCUS_00310 6100 7233 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_00310 7339 8310 gene locus_tag LOCUS_00320 7339 8310 CDS product putative luciferase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703166.1 protein_id gnl|my_center|LOCUS_00320 8487 9317 gene locus_tag LOCUS_00330 8487 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223011.1 protein_id gnl|my_center|LOCUS_00330 9314 10537 gene locus_tag LOCUS_00340 9314 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_00340 11594 10614 gene locus_tag LOCUS_00350 11594 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 11920 12870 gene locus_tag LOCUS_00360 11920 12870 CDS product polyhydroxybutyrate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence003 1624 941 gene locus_tag LOCUS_00370 1624 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 2143 1880 gene locus_tag LOCUS_00380 2143 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2040 2615 gene locus_tag LOCUS_00390 2040 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 2612 3433 gene locus_tag LOCUS_00400 2612 3433 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_00400 3430 4212 gene locus_tag LOCUS_00410 3430 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4278 5741 gene locus_tag LOCUS_00420 4278 5741 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_00420 6445 5738 gene locus_tag LOCUS_00430 6445 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 6506 7195 gene locus_tag LOCUS_00440 6506 7195 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_00440 7186 8472 gene locus_tag LOCUS_00450 7186 8472 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460182.1 protein_id gnl|my_center|LOCUS_00450 8509 9384 gene locus_tag LOCUS_00460 gene hemC 8509 9384 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_00460 9381 10850 gene locus_tag LOCUS_00470 9381 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence004 2046 829 gene locus_tag LOCUS_00480 2046 829 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_00480 2278 3816 gene locus_tag LOCUS_00490 2278 3816 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_00490 3877 4782 gene locus_tag LOCUS_00500 3877 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 4779 5051 gene locus_tag LOCUS_00510 4779 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 6284 5082 gene locus_tag LOCUS_00520 6284 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_00520 7813 6281 gene locus_tag LOCUS_00530 7813 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_00530 8044 9177 gene locus_tag LOCUS_00540 8044 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 9239 10900 gene locus_tag LOCUS_00550 9239 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 protein_id gnl|my_center|LOCUS_00550 >Feature sequence005 882 25 gene locus_tag LOCUS_00560 882 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 1624 887 gene locus_tag LOCUS_00570 1624 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2637 1621 gene locus_tag LOCUS_00580 2637 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4536 2794 gene locus_tag LOCUS_00590 4536 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4823 5170 gene locus_tag LOCUS_00600 4823 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 5122 5685 gene locus_tag LOCUS_00610 5122 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00610 5876 7783 gene locus_tag LOCUS_00620 5876 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7807 8082 gene locus_tag LOCUS_00630 7807 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 8079 9206 gene locus_tag LOCUS_00640 8079 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 9203 10762 gene locus_tag LOCUS_00650 9203 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 >Feature sequence006 418 1137 gene locus_tag LOCUS_00660 418 1137 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_00660 1273 1881 gene locus_tag LOCUS_00670 1273 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 3813 1924 gene locus_tag LOCUS_00680 3813 1924 CDS product vanomycin resistance protein VanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_00680 4022 5302 gene locus_tag LOCUS_00690 4022 5302 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703853.1 protein_id gnl|my_center|LOCUS_00690 5392 6264 gene locus_tag LOCUS_00700 gene mca 5392 6264 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_00700 7137 6307 gene locus_tag LOCUS_00710 7137 6307 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 protein_id gnl|my_center|LOCUS_00710 8363 7176 gene locus_tag LOCUS_00720 8363 7176 CDS product putative acetyl-CoA acetyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701364.1 protein_id gnl|my_center|LOCUS_00720 9482 8508 gene locus_tag LOCUS_00730 9482 8508 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921125.1 protein_id gnl|my_center|LOCUS_00730 10247 9519 gene locus_tag LOCUS_00740 10247 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 >Feature sequence007 633 866 gene locus_tag LOCUS_00750 633 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 926 2605 gene locus_tag LOCUS_00760 926 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 2691 3659 gene locus_tag LOCUS_00770 gene appB 2691 3659 CDS product oligopeptide transport system permease protein AppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42062 protein_id gnl|my_center|LOCUS_00770 3656 4621 gene locus_tag LOCUS_00780 3656 4621 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_00780 4618 5628 gene locus_tag LOCUS_00790 4618 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 5625 6632 gene locus_tag LOCUS_00800 5625 6632 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_00800 6824 8176 gene locus_tag LOCUS_00810 6824 8176 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_00810 8205 8291 gene locus_tag LOCUS_t00010 8205 8291 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8442 8633 gene locus_tag LOCUS_00820 8442 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 <10497 8814 gene locus_tag LOCUS_00830 <10497 8814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583543.1:DUF4900 domain-containing protein >Feature sequence008 1926 235 gene locus_tag LOCUS_00840 1926 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 2153 3436 gene locus_tag LOCUS_00850 2153 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 3619 4140 gene locus_tag LOCUS_00860 3619 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4429 5511 gene locus_tag LOCUS_00870 4429 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_00870 5574 6398 gene locus_tag LOCUS_00880 5574 6398 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_00880 7556 6450 gene locus_tag LOCUS_00890 7556 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 7843 7556 gene locus_tag LOCUS_00900 7843 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8797 7862 gene locus_tag LOCUS_00910 8797 7862 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_00910 10330 8828 gene locus_tag LOCUS_00920 10330 8828 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence009 <1 1961 gene locus_tag LOCUS_00930 <1 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DI96:transcription-repair-coupling factor 2039 3073 gene locus_tag LOCUS_00940 2039 3073 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814873.1 protein_id gnl|my_center|LOCUS_00940 3070 4533 gene locus_tag LOCUS_00950 3070 4533 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142588.1 protein_id gnl|my_center|LOCUS_00950 4577 5359 gene locus_tag LOCUS_00960 4577 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_00960 5356 6159 gene locus_tag LOCUS_00970 gene badH 5356 6159 CDS product 2-hydroxycyclohexanecarboxyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225712.1 protein_id gnl|my_center|LOCUS_00970 6410 7702 gene locus_tag LOCUS_00980 gene eno1 6410 7702 CDS product enolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Q3 protein_id gnl|my_center|LOCUS_00980 7702 8106 gene locus_tag LOCUS_00990 7702 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 8114 8599 gene locus_tag LOCUS_01000 8114 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8599 9525 gene locus_tag LOCUS_01010 8599 9525 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence010 2085 1669 gene locus_tag LOCUS_01020 2085 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 3642 2119 gene locus_tag LOCUS_01030 3642 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704555.1 protein_id gnl|my_center|LOCUS_01030 4474 3683 gene locus_tag LOCUS_01040 4474 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5206 4487 gene locus_tag LOCUS_01050 5206 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 5380 7140 gene locus_tag LOCUS_01060 5380 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7357 7686 gene locus_tag LOCUS_01070 7357 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 7724 8446 gene locus_tag LOCUS_01080 7724 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence011 364 1236 gene locus_tag LOCUS_01090 364 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 1240 1824 gene locus_tag LOCUS_01100 1240 1824 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550468.1 protein_id gnl|my_center|LOCUS_01100 2866 1826 gene locus_tag LOCUS_01110 gene mnmA 2866 1826 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHY7 protein_id gnl|my_center|LOCUS_01110 4089 2863 gene locus_tag LOCUS_01120 4089 2863 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_01120 4462 4656 gene locus_tag LOCUS_01130 4462 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4761 5918 gene locus_tag LOCUS_01140 4761 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 7619 5982 gene locus_tag LOCUS_01150 7619 5982 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_01150 7611 8393 gene locus_tag LOCUS_01160 gene cobB2 7611 8393 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_01160 8871 8545 gene locus_tag LOCUS_01170 8871 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9153 8875 gene locus_tag LOCUS_01180 9153 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 9587 9153 gene locus_tag LOCUS_01190 9587 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence012 <1 2041 gene locus_tag LOCUS_01200 <1 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030947.1:protein meaA 2051 2782 gene locus_tag LOCUS_01210 2051 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4601 2790 gene locus_tag LOCUS_01220 4601 2790 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 protein_id gnl|my_center|LOCUS_01220 6143 4983 gene locus_tag LOCUS_01230 6143 4983 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897714.1 protein_id gnl|my_center|LOCUS_01230 7292 6171 gene locus_tag LOCUS_01240 7292 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7525 7292 gene locus_tag LOCUS_01250 7525 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 9156 7522 gene locus_tag LOCUS_01260 9156 7522 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_01260 9624 9223 gene locus_tag LOCUS_01270 gene mceE 9624 9223 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence013 <1 1020 gene locus_tag LOCUS_01280 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877962.1:NADH oxidase 1093 2499 gene locus_tag LOCUS_01290 gene glcD 1093 2499 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_01290 2535 4091 gene locus_tag LOCUS_01300 gene ilvB 2535 4091 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_01300 5221 4118 gene locus_tag LOCUS_01310 gene menC 5221 4118 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2S6 protein_id gnl|my_center|LOCUS_01310 5538 5338 gene locus_tag LOCUS_01320 5538 5338 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_01320 5934 7625 gene locus_tag LOCUS_01330 5934 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 8616 7717 gene locus_tag LOCUS_01340 gene menB 8616 7717 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_01340 >Feature sequence014 1928 630 gene locus_tag LOCUS_01350 gene secY 1928 630 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46785 protein_id gnl|my_center|LOCUS_01350 2469 1978 gene locus_tag LOCUS_01360 gene rplO 2469 1978 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XW7 protein_id gnl|my_center|LOCUS_01360 2651 2469 gene locus_tag LOCUS_01370 gene rpmD 2651 2469 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD7 protein_id gnl|my_center|LOCUS_01370 3199 2651 gene locus_tag LOCUS_01380 gene rpsE 3199 2651 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_01380 3575 3219 gene locus_tag LOCUS_01390 gene rplR 3575 3219 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_01390 4134 3595 gene locus_tag LOCUS_01400 gene rplF 4134 3595 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH81 protein_id gnl|my_center|LOCUS_01400 4543 4139 gene locus_tag LOCUS_01410 gene rpsH 4543 4139 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49399 protein_id gnl|my_center|LOCUS_01410 5304 4747 gene locus_tag LOCUS_01420 gene rplE 5304 4747 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH83 protein_id gnl|my_center|LOCUS_01420 5609 5304 gene locus_tag LOCUS_01430 gene rplX 5609 5304 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PM1 protein_id gnl|my_center|LOCUS_01430 5977 5609 gene locus_tag LOCUS_01440 gene rplN 5977 5609 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSF9 protein_id gnl|my_center|LOCUS_01440 6340 5987 gene locus_tag LOCUS_01450 6340 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6573 6337 gene locus_tag LOCUS_01460 gene rpmC 6573 6337 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839F6 protein_id gnl|my_center|LOCUS_01460 6989 6573 gene locus_tag LOCUS_01470 gene rplP 6989 6573 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J9 protein_id gnl|my_center|LOCUS_01470 7924 6998 gene locus_tag LOCUS_01480 gene rpsC 7924 6998 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0D4 protein_id gnl|my_center|LOCUS_01480 8514 7924 gene locus_tag LOCUS_01490 8514 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8789 8511 gene locus_tag LOCUS_01500 gene rpsS 8789 8511 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66482 protein_id gnl|my_center|LOCUS_01500 <9340 8797 gene locus_tag LOCUS_01510 <9340 8797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QSD4:50S ribosomal protein L2 >Feature sequence015 1112 429 gene locus_tag LOCUS_01520 1112 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 1251 2348 gene locus_tag LOCUS_01530 1251 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 3089 2412 gene locus_tag LOCUS_01540 3089 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3210 3731 gene locus_tag LOCUS_01550 3210 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3793 5004 gene locus_tag LOCUS_01560 3793 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804258.1 protein_id gnl|my_center|LOCUS_01560 5356 5117 gene locus_tag LOCUS_01570 5356 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5262 6116 gene locus_tag LOCUS_01580 5262 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 6988 6146 gene locus_tag LOCUS_01590 gene purU 6988 6146 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUG6 protein_id gnl|my_center|LOCUS_01590 7548 6985 gene locus_tag LOCUS_01600 7548 6985 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_01600 7673 8239 gene locus_tag LOCUS_01610 7673 8239 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730621.1 protein_id gnl|my_center|LOCUS_01610 8246 8896 gene locus_tag LOCUS_01620 8246 8896 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907717.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence016 2499 2044 gene locus_tag LOCUS_01630 2499 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4318 2840 gene locus_tag LOCUS_01640 gene ahcY 4318 2840 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_01640 5540 4488 gene locus_tag LOCUS_01650 5540 4488 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_01650 5781 5545 gene locus_tag LOCUS_01660 5781 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7230 5866 gene locus_tag LOCUS_01670 gene manB 7230 5866 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence017 378 587 gene locus_tag LOCUS_01680 378 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 584 985 gene locus_tag LOCUS_01690 584 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1007 1150 gene locus_tag LOCUS_01700 1007 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 1458 1189 gene locus_tag LOCUS_01710 1458 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899012.1 protein_id gnl|my_center|LOCUS_01710 2102 1455 gene locus_tag LOCUS_01720 2102 1455 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_01720 2395 4026 gene locus_tag LOCUS_01730 2395 4026 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_01730 4317 4039 gene locus_tag LOCUS_01740 4317 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5456 4317 gene locus_tag LOCUS_01750 5456 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5724 6491 gene locus_tag LOCUS_01760 5724 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence018 1662 235 gene locus_tag LOCUS_01770 1662 235 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527142.1 protein_id gnl|my_center|LOCUS_01770 2855 1821 gene locus_tag LOCUS_01780 2855 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3085 4386 gene locus_tag LOCUS_01790 3085 4386 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJ80 protein_id gnl|my_center|LOCUS_01790 5895 4492 gene locus_tag LOCUS_01800 5895 4492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_01800 6845 5925 gene locus_tag LOCUS_01810 6845 5925 CDS product glycerol-3-phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635946.1 protein_id gnl|my_center|LOCUS_01810 7785 6835 gene locus_tag LOCUS_01820 7785 6835 CDS product glycerol-3-phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_01820 <8880 7782 gene locus_tag LOCUS_01830 <8880 7782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228038.1:sugar ABC transporter ATP-binding protein >Feature sequence019 <1 802 gene locus_tag LOCUS_01840 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086140.1:ABC transporter ATP-binding protein 945 2660 gene locus_tag LOCUS_01850 945 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3183 2716 gene locus_tag LOCUS_01860 3183 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3148 3339 gene locus_tag LOCUS_01870 3148 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3488 3772 gene locus_tag LOCUS_01880 3488 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3808 4647 gene locus_tag LOCUS_01890 3808 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5964 4750 gene locus_tag LOCUS_01900 5964 4750 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_01900 6630 6112 gene locus_tag LOCUS_01910 6630 6112 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_01910 6673 7494 gene locus_tag LOCUS_01920 6673 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67773 protein_id gnl|my_center|LOCUS_01920 7504 8427 gene locus_tag LOCUS_01930 7504 8427 CDS product putative cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704329.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence020 <1 516 gene locus_tag LOCUS_01940 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QVB8:30S ribosomal protein S2 519 1364 gene locus_tag LOCUS_01950 gene tsf 519 1364 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_01950 1418 2131 gene locus_tag LOCUS_01960 gene pyrH 1418 2131 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_01960 2133 2696 gene locus_tag LOCUS_01970 gene frr 2133 2696 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86770 protein_id gnl|my_center|LOCUS_01970 2785 4326 gene locus_tag LOCUS_01980 gene cdsA 2785 4326 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0E1 protein_id gnl|my_center|LOCUS_01980 4431 5534 gene locus_tag LOCUS_01990 gene dxr 4431 5534 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVH7 protein_id gnl|my_center|LOCUS_01990 5599 6813 gene locus_tag LOCUS_02000 gene rip1 5599 6813 CDS product zinc metalloprotease Rip1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHS3 protein_id gnl|my_center|LOCUS_02000 6878 8107 gene locus_tag LOCUS_02010 gene ispG1 6878 8107 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7W2 protein_id gnl|my_center|LOCUS_02010 >Feature sequence021 359 709 gene locus_tag LOCUS_02020 359 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 888 688 gene locus_tag LOCUS_02030 888 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 925 2382 gene locus_tag LOCUS_02040 925 2382 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224430.1 protein_id gnl|my_center|LOCUS_02040 2379 4412 gene locus_tag LOCUS_02050 2379 4412 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_02050 5094 4429 gene locus_tag LOCUS_02060 5094 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5384 6616 gene locus_tag LOCUS_02070 5384 6616 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_02070 6756 7775 gene locus_tag LOCUS_02080 6756 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8396 7938 gene locus_tag LOCUS_02090 8396 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence022 1622 546 gene locus_tag LOCUS_02100 gene pimA 1622 546 CDS product phosphatidyl-myo-inositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWG6 protein_id gnl|my_center|LOCUS_02100 2650 1619 gene locus_tag LOCUS_02110 2650 1619 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMB5 protein_id gnl|my_center|LOCUS_02110 3416 2625 gene locus_tag LOCUS_02120 3416 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4098 3553 gene locus_tag LOCUS_02130 4098 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4612 4100 gene locus_tag LOCUS_02140 4612 4100 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938941.1 protein_id gnl|my_center|LOCUS_02140 6659 4617 gene locus_tag LOCUS_02150 gene thrS 6659 4617 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L278 protein_id gnl|my_center|LOCUS_02150 7900 6692 gene locus_tag LOCUS_02160 gene cysS 7900 6692 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG64 protein_id gnl|my_center|LOCUS_02160 >Feature sequence023 1542 352 gene locus_tag LOCUS_02170 1542 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2433 1576 gene locus_tag LOCUS_02180 2433 1576 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_02180 3302 2433 gene locus_tag LOCUS_02190 3302 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4153 3299 gene locus_tag LOCUS_02200 4153 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4559 5482 gene locus_tag LOCUS_02210 4559 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5479 6414 gene locus_tag LOCUS_02220 5479 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7002 6466 gene locus_tag LOCUS_02230 gene cysE 7002 6466 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971715.1 protein_id gnl|my_center|LOCUS_02230 7142 7002 gene locus_tag LOCUS_02240 7142 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 >Feature sequence024 <1 723 gene locus_tag LOCUS_02250 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O06069:dihydroxy-acid dehydratase 832 2613 gene locus_tag LOCUS_02260 832 2613 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028953.1 protein_id gnl|my_center|LOCUS_02260 3001 4719 gene locus_tag LOCUS_02270 3001 4719 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z567 protein_id gnl|my_center|LOCUS_02270 4719 5246 gene locus_tag LOCUS_02280 gene ilvH 4719 5246 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_02280 5373 6401 gene locus_tag LOCUS_02290 gene ilvC 5373 6401 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJ03 protein_id gnl|my_center|LOCUS_02290 6854 6549 gene locus_tag LOCUS_02300 6854 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 7737 6946 gene locus_tag LOCUS_02310 gene tauD 7737 6946 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence025 244 768 gene locus_tag LOCUS_02320 244 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 1792 785 gene locus_tag LOCUS_02330 gene trpS 1792 785 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q49901 protein_id gnl|my_center|LOCUS_02330 1858 2832 gene locus_tag LOCUS_02340 1858 2832 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027965.1 protein_id gnl|my_center|LOCUS_02340 2829 3524 gene locus_tag LOCUS_02350 2829 3524 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_02350 3532 4341 gene locus_tag LOCUS_02360 gene rluB 3532 4341 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB4 protein_id gnl|my_center|LOCUS_02360 4347 4715 gene locus_tag LOCUS_02370 4347 4715 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_02370 4752 5801 gene locus_tag LOCUS_02380 4752 5801 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_02380 5798 7096 gene locus_tag LOCUS_02390 gene aroA 5798 7096 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIU4 protein_id gnl|my_center|LOCUS_02390 7096 7755 gene locus_tag LOCUS_02400 gene cmk 7096 7755 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYQ0 protein_id gnl|my_center|LOCUS_02400 >Feature sequence026 <1 744 gene locus_tag LOCUS_02410 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027530.1:ABC transporter substrate-binding protein 1265 792 gene locus_tag LOCUS_02420 gene purE 1265 792 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTF3 protein_id gnl|my_center|LOCUS_02420 1358 2329 gene locus_tag LOCUS_02430 1358 2329 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_02430 3326 2334 gene locus_tag LOCUS_02440 gene gmd 3326 2334 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVJ1 protein_id gnl|my_center|LOCUS_02440 3827 3387 gene locus_tag LOCUS_02450 3827 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029140.1 protein_id gnl|my_center|LOCUS_02450 3954 4691 gene locus_tag LOCUS_02460 3954 4691 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_02460 4688 5212 gene locus_tag LOCUS_02470 4688 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_02470 5152 5973 gene locus_tag LOCUS_02480 5152 5973 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027905.1 protein_id gnl|my_center|LOCUS_02480 6339 5998 gene locus_tag LOCUS_02490 6339 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 7601 6333 gene locus_tag LOCUS_02500 7601 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 >Feature sequence027 160 1038 gene locus_tag LOCUS_02510 160 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704001.1 protein_id gnl|my_center|LOCUS_02510 1134 2171 gene locus_tag LOCUS_02520 1134 2171 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_02520 2922 2206 gene locus_tag LOCUS_02530 2922 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3160 3942 gene locus_tag LOCUS_02540 3160 3942 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224716.1 protein_id gnl|my_center|LOCUS_02540 3939 4715 gene locus_tag LOCUS_02550 3939 4715 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_02550 6270 4795 gene locus_tag LOCUS_02560 6270 4795 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_02560 6444 7655 gene locus_tag LOCUS_02570 6444 7655 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence028 722 156 gene locus_tag LOCUS_02580 722 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 818 1687 gene locus_tag LOCUS_02590 gene ssuD 818 1687 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225079.1 protein_id gnl|my_center|LOCUS_02590 1757 4015 gene locus_tag LOCUS_02600 1757 4015 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_02600 5230 4226 gene locus_tag LOCUS_02610 5230 4226 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_02610 6659 5562 gene locus_tag LOCUS_02620 6659 5562 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729030.1 protein_id gnl|my_center|LOCUS_02620 7287 6826 gene locus_tag LOCUS_02630 7287 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence029 994 2028 gene locus_tag LOCUS_02640 994 2028 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_02640 3415 2078 gene locus_tag LOCUS_02650 gene fadD 3415 2078 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228959.1 protein_id gnl|my_center|LOCUS_02650 3532 3819 gene locus_tag LOCUS_02660 3532 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 3833 5422 gene locus_tag LOCUS_02670 3833 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5482 5850 gene locus_tag LOCUS_02680 5482 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5847 6578 gene locus_tag LOCUS_02690 5847 6578 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_02690 7488 6583 gene locus_tag LOCUS_02700 7488 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence030 <1 743 gene locus_tag LOCUS_02710 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK81:UDP-N-acetylmuramoylalanine--D-glutamate ligase 818 1969 gene locus_tag LOCUS_02720 818 1969 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_02720 1966 3141 gene locus_tag LOCUS_02730 gene murG 1966 3141 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK79 protein_id gnl|my_center|LOCUS_02730 3128 4516 gene locus_tag LOCUS_02740 gene murC 3128 4516 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_02740 4513 5481 gene locus_tag LOCUS_02750 gene murB 4513 5481 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H085 protein_id gnl|my_center|LOCUS_02750 5478 6395 gene locus_tag LOCUS_02760 5478 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence031 1063 2793 gene locus_tag LOCUS_02770 1063 2793 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_02770 2923 3903 gene locus_tag LOCUS_02780 2923 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4027 4599 gene locus_tag LOCUS_02790 4027 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_02790 4609 5052 gene locus_tag LOCUS_02800 4609 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5599 5132 gene locus_tag LOCUS_02810 5599 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5904 7127 gene locus_tag LOCUS_02820 5904 7127 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence032 594 118 gene locus_tag LOCUS_02830 594 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1161 643 gene locus_tag LOCUS_02840 1161 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1304 1585 gene locus_tag LOCUS_02850 1304 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3011 1725 gene locus_tag LOCUS_02860 3011 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4244 3405 gene locus_tag LOCUS_02870 4244 3405 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_02870 4534 4241 gene locus_tag LOCUS_02880 4534 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4445 4645 gene locus_tag LOCUS_02890 4445 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4869 6026 gene locus_tag LOCUS_02900 gene fadA 4869 6026 CDS product acetyl-CoA acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_02900 6054 6332 gene locus_tag LOCUS_02910 6054 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 6862 6509 gene locus_tag LOCUS_02920 6862 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence033 1932 718 gene locus_tag LOCUS_02930 gene acd 1932 718 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_02930 2560 2039 gene locus_tag LOCUS_02940 2560 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2687 3295 gene locus_tag LOCUS_02950 gene pdxH 2687 3295 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_02950 4161 3292 gene locus_tag LOCUS_02960 4161 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4425 5063 gene locus_tag LOCUS_02970 4425 5063 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902207.1 protein_id gnl|my_center|LOCUS_02970 5075 5329 gene locus_tag LOCUS_02980 5075 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 6023 5400 gene locus_tag LOCUS_02990 6023 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7103 6054 gene locus_tag LOCUS_03000 7103 6054 CDS product putative histidine kinase sensor of two-component system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702460.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence034 1770 1258 gene locus_tag LOCUS_03010 1770 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3156 1849 gene locus_tag LOCUS_03020 3156 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3713 3258 gene locus_tag LOCUS_03030 3713 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4334 4606 gene locus_tag LOCUS_03040 4334 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5400 4678 gene locus_tag LOCUS_03050 5400 4678 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_03050 5489 6916 gene locus_tag LOCUS_03060 gene leuC 5489 6916 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_03060 >Feature sequence035 2555 4396 gene locus_tag LOCUS_03070 2555 4396 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_03070 5618 4356 gene locus_tag LOCUS_03080 5618 4356 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_03080 6685 5615 gene locus_tag LOCUS_03090 gene solA 6685 5615 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58526 protein_id gnl|my_center|LOCUS_03090 <7366 6707 gene locus_tag LOCUS_03100 <7366 6707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQ57:RecBCD enzyme subunit RecD >Feature sequence036 183 971 gene locus_tag LOCUS_03110 183 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1871 999 gene locus_tag LOCUS_03120 1871 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3708 1909 gene locus_tag LOCUS_03130 3708 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3958 6171 gene locus_tag LOCUS_03140 3958 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence037 1738 242 gene locus_tag LOCUS_03150 1738 242 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_03150 3012 1828 gene locus_tag LOCUS_03160 3012 1828 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_03160 4076 3009 gene locus_tag LOCUS_03170 4076 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4308 4081 gene locus_tag LOCUS_03180 4308 4081 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_03180 5551 4409 gene locus_tag LOCUS_03190 5551 4409 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLM5 protein_id gnl|my_center|LOCUS_03190 5598 6383 gene locus_tag LOCUS_03200 5598 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence038 <1 2011 gene locus_tag LOCUS_03210 <1 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027893.1:helicase 2008 2703 gene locus_tag LOCUS_03220 2008 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2803 4404 gene locus_tag LOCUS_03230 2803 4404 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_03230 4891 5355 gene locus_tag LOCUS_03240 4891 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5439 7004 gene locus_tag LOCUS_03250 gene lnt 5439 7004 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EX26 protein_id gnl|my_center|LOCUS_03250 >Feature sequence039 398 150 gene locus_tag LOCUS_03260 398 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1756 758 gene locus_tag LOCUS_03270 gene mdh 1756 758 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_03270 2669 1869 gene locus_tag LOCUS_03280 2669 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3871 2669 gene locus_tag LOCUS_03290 3871 2669 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817F8 protein_id gnl|my_center|LOCUS_03290 4236 3991 gene locus_tag LOCUS_03300 4236 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5099 4233 gene locus_tag LOCUS_03310 gene folD 5099 4233 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J6 protein_id gnl|my_center|LOCUS_03310 6659 5160 gene locus_tag LOCUS_03320 gene purH 6659 5160 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN55 protein_id gnl|my_center|LOCUS_03320 7239 6679 gene locus_tag LOCUS_03330 gene purN 7239 6679 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS22 protein_id gnl|my_center|LOCUS_03330 >Feature sequence040 <1 763 gene locus_tag LOCUS_03340 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TWB7:long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase 775 1878 gene locus_tag LOCUS_03350 775 1878 CDS product putative adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705493.1 protein_id gnl|my_center|LOCUS_03350 3053 1899 gene locus_tag LOCUS_03360 3053 1899 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_03360 4020 3085 gene locus_tag LOCUS_03370 4020 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4903 4013 gene locus_tag LOCUS_03380 4903 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5771 4896 gene locus_tag LOCUS_03390 5771 4896 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_03390 5961 7178 gene locus_tag LOCUS_03400 5961 7178 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729321.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence041 405 205 gene locus_tag LOCUS_03410 405 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1537 509 gene locus_tag LOCUS_03420 1537 509 CDS product luciferase-like hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701714.1 protein_id gnl|my_center|LOCUS_03420 1623 2486 gene locus_tag LOCUS_03430 1623 2486 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_03430 2837 2541 gene locus_tag LOCUS_03440 2837 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3060 3560 gene locus_tag LOCUS_03450 3060 3560 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU7 protein_id gnl|my_center|LOCUS_03450 3961 3572 gene locus_tag LOCUS_03460 3961 3572 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172908.1 protein_id gnl|my_center|LOCUS_03460 5498 3951 gene locus_tag LOCUS_03470 5498 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7175 5730 gene locus_tag LOCUS_03480 7175 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence042 <1 512 gene locus_tag LOCUS_03490 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SI18:guanylate kinase 670 1014 gene locus_tag LOCUS_03500 670 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1019 2251 gene locus_tag LOCUS_03510 1019 2251 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027808.1 protein_id gnl|my_center|LOCUS_03510 2248 3441 gene locus_tag LOCUS_03520 gene metK 2248 3441 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9E3 protein_id gnl|my_center|LOCUS_03520 3454 5358 gene locus_tag LOCUS_03530 3454 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5368 5928 gene locus_tag LOCUS_03540 gene def 5368 5928 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_03540 5941 6822 gene locus_tag LOCUS_03550 gene fmt 5941 6822 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK24 protein_id gnl|my_center|LOCUS_03550 >Feature sequence043 <1 1704 gene locus_tag LOCUS_03560 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CZ44:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1701 2078 gene locus_tag LOCUS_03570 gene acpS 1701 2078 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI1 protein_id gnl|my_center|LOCUS_03570 2110 3720 gene locus_tag LOCUS_03580 2110 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3745 4209 gene locus_tag LOCUS_03590 3745 4209 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_03590 4206 5327 gene locus_tag LOCUS_03600 4206 5327 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_03600 5324 6319 gene locus_tag LOCUS_03610 5324 6319 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728105.1 protein_id gnl|my_center|LOCUS_03610 6342 6914 gene locus_tag LOCUS_03620 6342 6914 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200035.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence044 1804 503 gene locus_tag LOCUS_03630 1804 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1925 2173 gene locus_tag LOCUS_03640 1925 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2170 2481 gene locus_tag LOCUS_03650 2170 2481 CDS product toxin MazF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403376.1 protein_id gnl|my_center|LOCUS_03650 3600 2533 gene locus_tag LOCUS_03660 3600 2533 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_03660 4815 3652 gene locus_tag LOCUS_03670 4815 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4958 5878 gene locus_tag LOCUS_03680 4958 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 6247 5906 gene locus_tag LOCUS_03690 6247 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 <7018 6285 gene locus_tag LOCUS_03700 <7018 6285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056807.1:CDP-3, 6-dideoxy-D-glycero-L-glycero-4-hexulose-4-reductase >Feature sequence045 666 178 gene locus_tag LOCUS_03710 666 178 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_03710 1154 666 gene locus_tag LOCUS_03720 gene nuoI2 1154 666 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_03720 2182 1154 gene locus_tag LOCUS_03730 gene nuoH 2182 1154 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V9 protein_id gnl|my_center|LOCUS_03730 3417 2179 gene locus_tag LOCUS_03740 gene nuoD1 3417 2179 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_03740 4037 3414 gene locus_tag LOCUS_03750 gene nuoC 4037 3414 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL31 protein_id gnl|my_center|LOCUS_03750 4557 4030 gene locus_tag LOCUS_03760 4557 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4922 4548 gene locus_tag LOCUS_03770 4922 4548 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2W2 protein_id gnl|my_center|LOCUS_03770 6564 5056 gene locus_tag LOCUS_03780 gene nuoN-1 6564 5056 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_03780 >Feature sequence046 2744 1533 gene locus_tag LOCUS_03790 2744 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4131 2887 gene locus_tag LOCUS_03800 4131 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4146 5573 gene locus_tag LOCUS_03810 4146 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_03810 5575 6771 gene locus_tag LOCUS_03820 5575 6771 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063909.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence047 2198 1434 gene locus_tag LOCUS_03830 gene coaX 2198 1434 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_03830 3041 2199 gene locus_tag LOCUS_03840 3041 2199 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_03840 4681 3038 gene locus_tag LOCUS_03850 gene nadB 4681 3038 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N8 protein_id gnl|my_center|LOCUS_03850 5608 4691 gene locus_tag LOCUS_03860 gene panC 5608 4691 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_03860 6414 5605 gene locus_tag LOCUS_03870 6414 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence048 <1 734 gene locus_tag LOCUS_03880 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q725I1:glutamate-1-semialdehyde 2,1-aminomutase 772 2481 gene locus_tag LOCUS_03890 772 2481 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_03890 2481 4820 gene locus_tag LOCUS_03900 gene atsD 2481 4820 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_03900 4949 6253 gene locus_tag LOCUS_03910 4949 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence049 2392 1199 gene locus_tag LOCUS_03920 2392 1199 CDS product phosphoribosylglycinamide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_03920 2419 3048 gene locus_tag LOCUS_03930 2419 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3822 3097 gene locus_tag LOCUS_03940 3822 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4094 4020 gene locus_tag LOCUS_t00020 4094 4020 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4624 4154 gene locus_tag LOCUS_03950 4624 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5403 4897 gene locus_tag LOCUS_03960 gene moaC 5403 4897 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL3 protein_id gnl|my_center|LOCUS_03960 6378 5476 gene locus_tag LOCUS_03970 gene moaA 6378 5476 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_03970 >Feature sequence050 233 1990 gene locus_tag LOCUS_03980 233 1990 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_03980 2070 3305 gene locus_tag LOCUS_03990 2070 3305 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930559.1 protein_id gnl|my_center|LOCUS_03990 4546 3302 gene locus_tag LOCUS_04000 4546 3302 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028245.1 protein_id gnl|my_center|LOCUS_04000 5709 4552 gene locus_tag LOCUS_04010 5709 4552 CDS product putative phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705205.1 protein_id gnl|my_center|LOCUS_04010 5894 6421 gene locus_tag LOCUS_04020 5894 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704461.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence051 1727 957 gene locus_tag LOCUS_04030 1727 957 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709509.1 protein_id gnl|my_center|LOCUS_04030 1949 3427 gene locus_tag LOCUS_04040 1949 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459443.1 protein_id gnl|my_center|LOCUS_04040 3427 4224 gene locus_tag LOCUS_04050 3427 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4230 5441 gene locus_tag LOCUS_04060 gene lys1 4230 5441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_04060 5521 5931 gene locus_tag LOCUS_04070 5521 5931 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727520.1 protein_id gnl|my_center|LOCUS_04070 5934 6254 gene locus_tag LOCUS_04080 5934 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 6530 6297 gene locus_tag LOCUS_04090 6530 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence052 <1 1346 gene locus_tag LOCUS_04100 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228917.1:ABC transporter 1333 2061 gene locus_tag LOCUS_04110 gene livG 1333 2061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_04110 2058 2789 gene locus_tag LOCUS_04120 2058 2789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204918.1 protein_id gnl|my_center|LOCUS_04120 2789 3133 gene locus_tag LOCUS_04130 2789 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 3241 4416 gene locus_tag LOCUS_04140 3241 4416 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE3 protein_id gnl|my_center|LOCUS_04140 4591 5847 gene locus_tag LOCUS_04150 4591 5847 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803809.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence053 1386 583 gene locus_tag LOCUS_04160 1386 583 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_04160 1568 2329 gene locus_tag LOCUS_04170 1568 2329 CDS product putative enoyl-CoA hydratase EchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701358.1 protein_id gnl|my_center|LOCUS_04170 2353 3198 gene locus_tag LOCUS_04180 2353 3198 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_04180 3195 3950 gene locus_tag LOCUS_04190 3195 3950 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_04190 3947 5050 gene locus_tag LOCUS_04200 3947 5050 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_04200 5043 5528 gene locus_tag LOCUS_04210 5043 5528 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence054 91 972 gene locus_tag LOCUS_04220 91 972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_04220 2516 996 gene locus_tag LOCUS_04230 gene mmsA 2516 996 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_04230 3114 2536 gene locus_tag LOCUS_04240 3114 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4079 3237 gene locus_tag LOCUS_04250 4079 3237 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775740.1 protein_id gnl|my_center|LOCUS_04250 4801 4082 gene locus_tag LOCUS_04260 gene znuC 4801 4082 CDS product high-affinity zinc uptake system ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34946 protein_id gnl|my_center|LOCUS_04260 5088 4798 gene locus_tag LOCUS_04270 5088 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5003 5878 gene locus_tag LOCUS_04280 5003 5878 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_04280 6290 5868 gene locus_tag LOCUS_04290 6290 5868 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730854.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence055 <1 626 gene locus_tag LOCUS_04300 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729152.1:linalool 8-monooxygenase 626 1879 gene locus_tag LOCUS_04310 626 1879 CDS product S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_04310 1889 2599 gene locus_tag LOCUS_04320 1889 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3177 2623 gene locus_tag LOCUS_04330 3177 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3227 3466 gene locus_tag LOCUS_04340 3227 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3597 4793 gene locus_tag LOCUS_04350 3597 4793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_04350 5836 4838 gene locus_tag LOCUS_04360 5836 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence056 762 28 gene locus_tag LOCUS_04370 762 28 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_04370 1064 735 gene locus_tag LOCUS_04380 1064 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2480 1101 gene locus_tag LOCUS_04390 gene cysS 2480 1101 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QJ9 protein_id gnl|my_center|LOCUS_04390 3005 2511 gene locus_tag LOCUS_04400 gene ispF 3005 2511 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKE5 protein_id gnl|my_center|LOCUS_04400 3667 3002 gene locus_tag LOCUS_04410 3667 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04410 4758 3664 gene locus_tag LOCUS_04420 4758 3664 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_04420 5707 4925 gene locus_tag LOCUS_04430 5707 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence057 <1 644 gene locus_tag LOCUS_04440 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730669.1:cyclohexanecarboxylate-CoA ligase 651 1583 gene locus_tag LOCUS_04450 651 1583 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_04450 1580 2347 gene locus_tag LOCUS_04460 1580 2347 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_04460 3042 2377 gene locus_tag LOCUS_04470 gene smtA 3042 2377 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_04470 3776 3039 gene locus_tag LOCUS_04480 3776 3039 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_04480 5151 3778 gene locus_tag LOCUS_04490 gene glnA4-1 5151 3778 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223701.1 protein_id gnl|my_center|LOCUS_04490 5994 5218 gene locus_tag LOCUS_04500 5994 5218 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence058 <1 1690 gene locus_tag LOCUS_04510 <1 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393054.1:pilus-associated protein pilM 1687 2370 gene locus_tag LOCUS_04520 1687 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2381 2923 gene locus_tag LOCUS_04530 2381 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3045 4205 gene locus_tag LOCUS_04540 gene aroC 3045 4205 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ4 protein_id gnl|my_center|LOCUS_04540 4221 4763 gene locus_tag LOCUS_04550 4221 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4777 5868 gene locus_tag LOCUS_04560 gene aroB 4777 5868 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJF6 protein_id gnl|my_center|LOCUS_04560 5875 6318 gene locus_tag LOCUS_04570 gene aroQ 5875 6318 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI90 protein_id gnl|my_center|LOCUS_04570 >Feature sequence059 <1 789 gene locus_tag LOCUS_04580 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030077.1:succinyldiaminopimelate transaminase 1004 1780 gene locus_tag LOCUS_04590 gene dapD 1004 1780 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_04590 1780 2847 gene locus_tag LOCUS_04600 1780 2847 CDS product putative succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702078.1 protein_id gnl|my_center|LOCUS_04600 3584 2949 gene locus_tag LOCUS_04610 gene lexA 3584 2949 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_04610 4184 4378 gene locus_tag LOCUS_04620 4184 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4449 4976 gene locus_tag LOCUS_04630 gene nrdR 4449 4976 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D900 protein_id gnl|my_center|LOCUS_04630 >Feature sequence060 468 313 gene locus_tag LOCUS_04640 468 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 1630 734 gene locus_tag LOCUS_04650 1630 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2433 1627 gene locus_tag LOCUS_04660 gene proC 2433 1627 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUK5 protein_id gnl|my_center|LOCUS_04660 3164 2721 gene locus_tag LOCUS_04670 3164 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4434 3199 gene locus_tag LOCUS_04680 gene mshA 4434 3199 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQZ8 protein_id gnl|my_center|LOCUS_04680 4925 4431 gene locus_tag LOCUS_04690 4925 4431 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_04690 5444 4929 gene locus_tag LOCUS_04700 5444 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5652 5482 gene locus_tag LOCUS_04710 5652 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence061 453 758 gene locus_tag LOCUS_04720 453 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1192 755 gene locus_tag LOCUS_04730 1192 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1375 2157 gene locus_tag LOCUS_04740 1375 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2169 2366 gene locus_tag LOCUS_04750 gene rpmI 2169 2366 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLD0 protein_id gnl|my_center|LOCUS_04750 2378 2740 gene locus_tag LOCUS_04760 gene rplT 2378 2740 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDU8 protein_id gnl|my_center|LOCUS_04760 2746 3564 gene locus_tag LOCUS_04770 2746 3564 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729329.1 protein_id gnl|my_center|LOCUS_04770 3561 4607 gene locus_tag LOCUS_04780 gene pheS 3561 4607 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHN7 protein_id gnl|my_center|LOCUS_04780 >Feature sequence062 759 271 gene locus_tag LOCUS_04790 759 271 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030367.1 protein_id gnl|my_center|LOCUS_04790 1559 894 gene locus_tag LOCUS_04800 1559 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2680 1556 gene locus_tag LOCUS_04810 gene bioF 2680 1556 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_04810 3972 2677 gene locus_tag LOCUS_04820 gene bioA 3972 2677 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728P4 protein_id gnl|my_center|LOCUS_04820 5364 4006 gene locus_tag LOCUS_04830 5364 4006 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_04830 <6368 5430 gene locus_tag LOCUS_04840 <6368 5430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708697.1:gamma-aminobutyraldehyde dehydrogenase >Feature sequence063 743 2320 gene locus_tag LOCUS_04850 743 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2584 2973 gene locus_tag LOCUS_04860 2584 2973 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225753.1 protein_id gnl|my_center|LOCUS_04860 3291 3677 gene locus_tag LOCUS_04870 3291 3677 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225753.1 protein_id gnl|my_center|LOCUS_04870 3894 4697 gene locus_tag LOCUS_04880 3894 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895390.1 protein_id gnl|my_center|LOCUS_04880 4755 6329 gene locus_tag LOCUS_04890 4755 6329 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence064 662 87 gene locus_tag LOCUS_04900 662 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1948 716 gene locus_tag LOCUS_04910 1948 716 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYM0 protein_id gnl|my_center|LOCUS_04910 2520 1948 gene locus_tag LOCUS_04920 gene pgsA 2520 1948 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_04920 3824 2517 gene locus_tag LOCUS_04930 gene rimO 3824 2517 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK1 protein_id gnl|my_center|LOCUS_04930 <6332 3875 gene locus_tag LOCUS_04940 <6332 3875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228076.1:cell division protein FtsK >Feature sequence065 143 1048 gene locus_tag LOCUS_04950 143 1048 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_04950 2582 1122 gene locus_tag LOCUS_04960 2582 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2735 5038 gene locus_tag LOCUS_04970 2735 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5046 6005 gene locus_tag LOCUS_04980 5046 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence066 1615 2940 gene locus_tag LOCUS_04990 gene glnA2 1615 2940 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052524.1 protein_id gnl|my_center|LOCUS_04990 2950 3636 gene locus_tag LOCUS_05000 2950 3636 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701494.1 protein_id gnl|my_center|LOCUS_05000 3830 3687 gene locus_tag LOCUS_05010 3830 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 4232 3840 gene locus_tag LOCUS_05020 4232 3840 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_05020 5903 4335 gene locus_tag LOCUS_05030 5903 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence067 1870 35 gene locus_tag LOCUS_05040 1870 35 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_05040 2431 1943 gene locus_tag LOCUS_05050 2431 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2961 2704 gene locus_tag LOCUS_05060 2961 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2909 4108 gene locus_tag LOCUS_05070 2909 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4248 4712 gene locus_tag LOCUS_05080 4248 4712 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_05080 5637 4750 gene locus_tag LOCUS_05090 5637 4750 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_05090 5785 6204 gene locus_tag LOCUS_05100 5785 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence068 <1 953 gene locus_tag LOCUS_05110 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966352.1:glycosyl transferase 2069 966 gene locus_tag LOCUS_05120 2069 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3574 2066 gene locus_tag LOCUS_05130 3574 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3633 5060 gene locus_tag LOCUS_05140 3633 5060 CDS product exoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889293.1 protein_id gnl|my_center|LOCUS_05140 <6240 5140 gene locus_tag LOCUS_05150 <6240 5140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875981.1:succinoglycan biosynthesis transporter >Feature sequence069 2224 1139 gene locus_tag LOCUS_05160 2224 1139 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_05160 2886 2221 gene locus_tag LOCUS_05170 2886 2221 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_05170 3837 3076 gene locus_tag LOCUS_05180 3837 3076 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_05180 4062 4562 gene locus_tag LOCUS_05190 4062 4562 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227996.1 protein_id gnl|my_center|LOCUS_05190 4690 5874 gene locus_tag LOCUS_05200 4690 5874 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence070 396 100 gene locus_tag LOCUS_05210 396 100 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_05210 1053 406 gene locus_tag LOCUS_05220 gene mtnX 1053 406 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819E7 protein_id gnl|my_center|LOCUS_05220 2917 1193 gene locus_tag LOCUS_05230 gene amt-1 2917 1193 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF34 protein_id gnl|my_center|LOCUS_05230 3028 5790 gene locus_tag LOCUS_05240 3028 5790 CDS product glycosyl hydrolase family 38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989869.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence071 2023 1421 gene locus_tag LOCUS_05250 gene pth 2023 1421 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181A2 protein_id gnl|my_center|LOCUS_05250 2647 2027 gene locus_tag LOCUS_05260 gene rplY 2647 2027 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5L5 protein_id gnl|my_center|LOCUS_05260 3767 2778 gene locus_tag LOCUS_05270 gene prsA 3767 2778 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIH6 protein_id gnl|my_center|LOCUS_05270 5088 3769 gene locus_tag LOCUS_05280 gene glmU 5088 3769 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJX6 protein_id gnl|my_center|LOCUS_05280 5005 5241 gene locus_tag LOCUS_05290 5005 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 5472 5400 gene locus_tag LOCUS_t00030 5472 5400 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <6208 5695 gene locus_tag LOCUS_05300 <6208 5695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5K7:4-diphosphocytidyl-2-C-methyl-D-erythritol kinase >Feature sequence072 504 76 gene locus_tag LOCUS_05310 504 76 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_05310 604 1734 gene locus_tag LOCUS_05320 604 1734 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_05320 2061 5501 gene locus_tag LOCUS_05330 2061 5501 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBH4 protein_id gnl|my_center|LOCUS_05330 >Feature sequence073 <1 1112 gene locus_tag LOCUS_05340 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27902:chromosomal replication initiator protein DnaA 1323 2426 gene locus_tag LOCUS_05350 gene dnaN 1323 2426 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CU86 protein_id gnl|my_center|LOCUS_05350 2436 3545 gene locus_tag LOCUS_05360 gene recF 2436 3545 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUZ2 protein_id gnl|my_center|LOCUS_05360 3538 3882 gene locus_tag LOCUS_05370 3538 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence074 2214 991 gene locus_tag LOCUS_05380 2214 991 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028426.1 protein_id gnl|my_center|LOCUS_05380 2347 3453 gene locus_tag LOCUS_05390 2347 3453 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_05390 5244 3460 gene locus_tag LOCUS_05400 gene lepA 5244 3460 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDV2 protein_id gnl|my_center|LOCUS_05400 5434 5709 gene locus_tag LOCUS_05410 gene rpsT 5434 5709 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDM3 protein_id gnl|my_center|LOCUS_05410 >Feature sequence075 670 1596 gene locus_tag LOCUS_05420 670 1596 CDS product protein pafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_05420 1665 2327 gene locus_tag LOCUS_05430 1665 2327 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV2 protein_id gnl|my_center|LOCUS_05430 3099 2347 gene locus_tag LOCUS_05440 3099 2347 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015900.1 protein_id gnl|my_center|LOCUS_05440 3258 3602 gene locus_tag LOCUS_05450 3258 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3616 3852 gene locus_tag LOCUS_05460 3616 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3907 4359 gene locus_tag LOCUS_05470 3907 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4359 5132 gene locus_tag LOCUS_05480 gene tatC 4359 5132 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKH3 protein_id gnl|my_center|LOCUS_05480 >Feature sequence076 335 850 gene locus_tag LOCUS_05490 335 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 856 1293 gene locus_tag LOCUS_05500 856 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702717.1 protein_id gnl|my_center|LOCUS_05500 1309 1833 gene locus_tag LOCUS_05510 1309 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1830 2771 gene locus_tag LOCUS_05520 gene glkA 1830 2771 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4E1 protein_id gnl|my_center|LOCUS_05520 2768 3625 gene locus_tag LOCUS_05530 2768 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4299 3682 gene locus_tag LOCUS_05540 4299 3682 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_05540 5566 4307 gene locus_tag LOCUS_05550 5566 4307 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence077 1037 1987 gene locus_tag LOCUS_05560 1037 1987 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_05560 1980 3347 gene locus_tag LOCUS_05570 1980 3347 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_05570 3383 4144 gene locus_tag LOCUS_05580 3383 4144 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_05580 4196 4849 gene locus_tag LOCUS_05590 4196 4849 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 protein_id gnl|my_center|LOCUS_05590 <5993 4856 gene locus_tag LOCUS_05600 <5993 4856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027026.1:dioxygenase >Feature sequence078 1433 711 gene locus_tag LOCUS_05610 gene recO 1433 711 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCB6 protein_id gnl|my_center|LOCUS_05610 2232 1504 gene locus_tag LOCUS_05620 gene uppS 2232 1504 CDS product decaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60478 protein_id gnl|my_center|LOCUS_05620 2128 2355 gene locus_tag LOCUS_05630 2128 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2749 2366 gene locus_tag LOCUS_05640 2749 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3516 2746 gene locus_tag LOCUS_05650 3516 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 4374 3517 gene locus_tag LOCUS_05660 4374 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4763 4371 gene locus_tag LOCUS_05670 4763 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 5402 4773 gene locus_tag LOCUS_05680 5402 4773 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_05680 5864 5406 gene locus_tag LOCUS_05690 5864 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence079 458 156 gene locus_tag LOCUS_05700 gene acpP 458 156 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJI8 protein_id gnl|my_center|LOCUS_05700 1452 448 gene locus_tag LOCUS_05710 1452 448 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_05710 2272 1769 gene locus_tag LOCUS_05720 2272 1769 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775865.1 protein_id gnl|my_center|LOCUS_05720 3034 2486 gene locus_tag LOCUS_05730 3034 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3550 3062 gene locus_tag LOCUS_05740 gene coaD 3550 3062 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDL6 protein_id gnl|my_center|LOCUS_05740 4279 3686 gene locus_tag LOCUS_05750 4279 3686 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_05750 <5858 4279 gene locus_tag LOCUS_05760 <5858 4279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NL48:ATP-dependent DNA helicase RecG >Feature sequence080 61 1596 gene locus_tag LOCUS_05770 gene ppx 61 1596 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_05770 2293 1610 gene locus_tag LOCUS_05780 2293 1610 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_05780 2328 3299 gene locus_tag LOCUS_05790 2328 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3287 5398 gene locus_tag LOCUS_05800 3287 5398 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence081 563 111 gene locus_tag LOCUS_05810 563 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 696 622 gene locus_tag LOCUS_t00040 696 622 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1452 808 gene locus_tag LOCUS_05820 1452 808 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_05820 1758 2765 gene locus_tag LOCUS_05830 gene gutB 1758 2765 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_05830 2762 3511 gene locus_tag LOCUS_05840 2762 3511 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_05840 3520 4782 gene locus_tag LOCUS_05850 3520 4782 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence082 416 18 gene locus_tag LOCUS_05860 416 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 529 2730 gene locus_tag LOCUS_05870 529 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3619 2789 gene locus_tag LOCUS_05880 3619 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4400 3687 gene locus_tag LOCUS_05890 4400 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence083 1434 541 gene locus_tag LOCUS_05900 gene parB 1434 541 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_05900 2314 1409 gene locus_tag LOCUS_05910 gene soj 2314 1409 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37522 protein_id gnl|my_center|LOCUS_05910 2626 2333 gene locus_tag LOCUS_05920 2626 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3530 2895 gene locus_tag LOCUS_05930 gene rsmG 3530 2895 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7Z1 protein_id gnl|my_center|LOCUS_05930 4490 3543 gene locus_tag LOCUS_05940 4490 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5468 4491 gene locus_tag LOCUS_05950 5468 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence084 1700 597 gene locus_tag LOCUS_05960 1700 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2405 1797 gene locus_tag LOCUS_05970 2405 1797 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031668.1 protein_id gnl|my_center|LOCUS_05970 2470 3513 gene locus_tag LOCUS_05980 2470 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3653 4900 gene locus_tag LOCUS_05990 3653 4900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_05990 <5671 4961 gene locus_tag LOCUS_06000 <5671 4961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705083.1:putative monooxygenase >Feature sequence085 <1 879 gene locus_tag LOCUS_06010 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803809.1:HNH endonuclease 1716 928 gene locus_tag LOCUS_06020 1716 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1914 3785 gene locus_tag LOCUS_06030 1914 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4892 3843 gene locus_tag LOCUS_06040 4892 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 <5637 4946 gene locus_tag LOCUS_06050 <5637 4946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390848.1:HPr kinase >Feature sequence086 445 1578 gene locus_tag LOCUS_06060 445 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140792.1 protein_id gnl|my_center|LOCUS_06060 2245 1610 gene locus_tag LOCUS_06070 2245 1610 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_06070 2370 3686 gene locus_tag LOCUS_06080 2370 3686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_06080 3755 4177 gene locus_tag LOCUS_06090 3755 4177 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_06090 4188 4910 gene locus_tag LOCUS_06100 4188 4910 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence087 1303 356 gene locus_tag LOCUS_06110 1303 356 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227236.1 protein_id gnl|my_center|LOCUS_06110 1446 2339 gene locus_tag LOCUS_06120 gene ephC 1446 2339 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_06120 2336 2572 gene locus_tag LOCUS_06130 2336 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3136 2630 gene locus_tag LOCUS_06140 3136 2630 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_06140 3731 3243 gene locus_tag LOCUS_06150 3731 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5155 3977 gene locus_tag LOCUS_06160 5155 3977 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222986.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence088 1414 272 gene locus_tag LOCUS_06170 gene ribD 1414 272 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84735 protein_id gnl|my_center|LOCUS_06170 2318 1836 gene locus_tag LOCUS_06180 2318 1836 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_06180 2978 2322 gene locus_tag LOCUS_06190 2978 2322 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y681 protein_id gnl|my_center|LOCUS_06190 3118 4344 gene locus_tag LOCUS_06200 3118 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 <5543 4355 gene locus_tag LOCUS_06210 <5543 4355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK22:ribosomal RNA small subunit methyltransferase B >Feature sequence089 357 1655 gene locus_tag LOCUS_06220 357 1655 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_06220 1673 2809 gene locus_tag LOCUS_06230 gene metX 1673 2809 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHP2 protein_id gnl|my_center|LOCUS_06230 3438 2836 gene locus_tag LOCUS_06240 gene recR 3438 2836 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_06240 3776 3435 gene locus_tag LOCUS_06250 3776 3435 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814C9 protein_id gnl|my_center|LOCUS_06250 <5533 3900 gene locus_tag LOCUS_06260 <5533 3900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731177.1:DNA polymerase III subunit gamma/tau >Feature sequence090 1257 805 gene locus_tag LOCUS_06270 gene mec 1257 805 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHS1 protein_id gnl|my_center|LOCUS_06270 1415 1882 gene locus_tag LOCUS_06280 gene smpB 1415 1882 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXK4 protein_id gnl|my_center|LOCUS_06280 1905 2669 gene locus_tag LOCUS_06290 1905 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_06290 2787 3140 gene locus_tag LOCUS_tm00010 2787 3140 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4405 3458 gene locus_tag LOCUS_06300 4405 3458 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974799.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence091 973 161 gene locus_tag LOCUS_06310 gene paaG 973 161 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_06310 1198 2436 gene locus_tag LOCUS_06320 gene cyp125 1198 2436 CDS product steroid C26-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPP1 protein_id gnl|my_center|LOCUS_06320 2517 3500 gene locus_tag LOCUS_06330 2517 3500 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_06330 3500 4549 gene locus_tag LOCUS_06340 3500 4549 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419199.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence092 1904 276 gene locus_tag LOCUS_06350 1904 276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095721.1 protein_id gnl|my_center|LOCUS_06350 2314 2736 gene locus_tag LOCUS_06360 2314 2736 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_06360 2840 4351 gene locus_tag LOCUS_06370 2840 4351 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D289 protein_id gnl|my_center|LOCUS_06370 <5490 4474 gene locus_tag LOCUS_06380 <5490 4474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence093 625 3000 gene locus_tag LOCUS_06390 625 3000 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBE0 protein_id gnl|my_center|LOCUS_06390 3040 4857 gene locus_tag LOCUS_06400 gene pepF 3040 4857 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence094 966 400 gene locus_tag LOCUS_06410 gene dcd 966 400 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ98 protein_id gnl|my_center|LOCUS_06410 2251 1031 gene locus_tag LOCUS_06420 2251 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_06420 3306 2281 gene locus_tag LOCUS_06430 3306 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3412 3485 gene locus_tag LOCUS_t00050 3412 3485 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3749 4324 gene locus_tag LOCUS_06440 3749 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4406 5080 gene locus_tag LOCUS_06450 4406 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence095 368 1318 gene locus_tag LOCUS_06460 368 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1331 2986 gene locus_tag LOCUS_06470 1331 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3834 3097 gene locus_tag LOCUS_06480 gene ppm1 3834 3097 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZ12 protein_id gnl|my_center|LOCUS_06480 >Feature sequence096 <1 1068 gene locus_tag LOCUS_06490 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJW2:signal recognition particle receptor FtsY 1141 2475 gene locus_tag LOCUS_06500 1141 2475 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_06500 2744 3178 gene locus_tag LOCUS_06510 2744 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3175 3531 gene locus_tag LOCUS_06520 3175 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3537 4070 gene locus_tag LOCUS_06530 gene rimM 3537 4070 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4D3 protein_id gnl|my_center|LOCUS_06530 4127 4879 gene locus_tag LOCUS_06540 gene trmD 4127 4879 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_06540 5014 4856 gene locus_tag LOCUS_06550 5014 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence097 1162 311 gene locus_tag LOCUS_06560 gene metF 1162 311 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_06560 1236 1733 gene locus_tag LOCUS_06570 1236 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4031 1779 gene locus_tag LOCUS_06580 4031 1779 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228662.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence098 <1 1198 gene locus_tag LOCUS_06590 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803809.1:HNH endonuclease 3854 1455 gene locus_tag LOCUS_06600 gene hppA 3854 1455 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X913 protein_id gnl|my_center|LOCUS_06600 4016 4177 gene locus_tag LOCUS_06610 4016 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4541 4200 gene locus_tag LOCUS_06620 4541 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06620 <5220 4486 gene locus_tag LOCUS_06630 <5220 4486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256059.1:amino acid permease note possible pseudo, frameshifted >Feature sequence099 1428 931 gene locus_tag LOCUS_06640 1428 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3416 1428 gene locus_tag LOCUS_06650 gene acs 3416 1428 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHY2 protein_id gnl|my_center|LOCUS_06650 4625 3549 gene locus_tag LOCUS_06660 4625 3549 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_06660 5209 4676 gene locus_tag LOCUS_06670 5209 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence100 251 487 gene locus_tag LOCUS_06680 251 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1919 522 gene locus_tag LOCUS_06690 1919 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3805 1916 gene locus_tag LOCUS_06700 3805 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 <5180 3924 gene locus_tag LOCUS_06710 <5180 3924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RKT7:deoxyguanosinetriphosphate triphosphohydrolase-like protein >Feature sequence101 674 1867 gene locus_tag LOCUS_06720 674 1867 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 protein_id gnl|my_center|LOCUS_06720 3147 1906 gene locus_tag LOCUS_06730 3147 1906 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_06730 4751 3192 gene locus_tag LOCUS_06740 4751 3192 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence102 677 459 gene locus_tag LOCUS_06750 gene rpmE 677 459 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MK4 protein_id gnl|my_center|LOCUS_06750 2757 748 gene locus_tag LOCUS_06760 2757 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4327 3146 gene locus_tag LOCUS_06770 4327 3146 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence103 1211 645 gene locus_tag LOCUS_06780 1211 645 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_06780 2298 1213 gene locus_tag LOCUS_06790 2298 1213 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_06790 2711 4945 gene locus_tag LOCUS_06800 2711 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence104 1099 542 gene locus_tag LOCUS_06810 gene frnE 1099 542 CDS product polyketide biosynthesis dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448278.1 protein_id gnl|my_center|LOCUS_06810 2462 1104 gene locus_tag LOCUS_06820 2462 1104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_06820 2763 4829 gene locus_tag LOCUS_06830 gene ppk 2763 4829 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUZ3 protein_id gnl|my_center|LOCUS_06830 >Feature sequence105 2849 2478 gene locus_tag LOCUS_06840 2849 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4171 3380 gene locus_tag LOCUS_06850 gene suhB 4171 3380 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ07 protein_id gnl|my_center|LOCUS_06850 4911 4168 gene locus_tag LOCUS_06860 4911 4168 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence106 301 501 gene locus_tag LOCUS_06870 301 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 624 1430 gene locus_tag LOCUS_06880 624 1430 CDS product tRNA(Ile)-lysidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880854.1 protein_id gnl|my_center|LOCUS_06880 1433 2215 gene locus_tag LOCUS_06890 1433 2215 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_06890 2212 3414 gene locus_tag LOCUS_06900 2212 3414 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_06900 4692 3424 gene locus_tag LOCUS_06910 4692 3424 CDS product Mn transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence107 <1 1830 gene locus_tag LOCUS_06920 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085964.1:monooxygenase 1894 2376 gene locus_tag LOCUS_06930 1894 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3124 2498 gene locus_tag LOCUS_06940 3124 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4543 3359 gene locus_tag LOCUS_06950 gene atoB 4543 3359 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence108 1942 791 gene locus_tag LOCUS_06960 gene galK 1942 791 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRP1 protein_id gnl|my_center|LOCUS_06960 2945 1965 gene locus_tag LOCUS_06970 gene galT 2945 1965 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33836 protein_id gnl|my_center|LOCUS_06970 3878 2979 gene locus_tag LOCUS_06980 3878 2979 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728963.1 protein_id gnl|my_center|LOCUS_06980 3922 4761 gene locus_tag LOCUS_06990 3922 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence109 2182 416 gene locus_tag LOCUS_07000 gene dnaQ 2182 416 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_07000 2308 2580 gene locus_tag LOCUS_07010 2308 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2585 3964 gene locus_tag LOCUS_07020 2585 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4035 4361 gene locus_tag LOCUS_07030 4035 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4352 5038 gene locus_tag LOCUS_07040 4352 5038 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence110 825 100 gene locus_tag LOCUS_07050 825 100 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969479.1 protein_id gnl|my_center|LOCUS_07050 972 2321 gene locus_tag LOCUS_07060 gene miaB 972 2321 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69963 protein_id gnl|my_center|LOCUS_07060 2318 3361 gene locus_tag LOCUS_07070 gene miaA 2318 3361 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0N2 protein_id gnl|my_center|LOCUS_07070 3358 4272 gene locus_tag LOCUS_07080 3358 4272 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811895.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence111 786 385 gene locus_tag LOCUS_07090 gene rsfS 786 385 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBS8 protein_id gnl|my_center|LOCUS_07090 2018 783 gene locus_tag LOCUS_07100 2018 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2596 2015 gene locus_tag LOCUS_07110 gene nadD 2596 2015 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWE6 protein_id gnl|my_center|LOCUS_07110 2737 3432 gene locus_tag LOCUS_07120 2737 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704073.1 protein_id gnl|my_center|LOCUS_07120 3497 4843 gene locus_tag LOCUS_07130 3497 4843 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence112 3555 124 gene locus_tag LOCUS_07140 gene dnaE 3555 124 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX54 protein_id gnl|my_center|LOCUS_07140 4961 3729 gene locus_tag LOCUS_07150 4961 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence113 <1 669 gene locus_tag LOCUS_07160 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803738.1:alpha-L-fucosidase 1786 692 gene locus_tag LOCUS_07170 1786 692 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_07170 2508 1783 gene locus_tag LOCUS_07180 2508 1783 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_07180 3848 2508 gene locus_tag LOCUS_07190 3848 2508 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence114 376 1698 gene locus_tag LOCUS_07200 376 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1695 2024 gene locus_tag LOCUS_07210 1695 2024 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_07210 2028 3359 gene locus_tag LOCUS_07220 2028 3359 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064856.1 protein_id gnl|my_center|LOCUS_07220 3373 4803 gene locus_tag LOCUS_07230 3373 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089875.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence115 1301 1609 gene locus_tag LOCUS_07240 1301 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2135 1884 gene locus_tag LOCUS_07250 2135 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2599 2225 gene locus_tag LOCUS_07260 2599 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2866 3942 gene locus_tag LOCUS_07270 gene bioB 2866 3942 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX70 protein_id gnl|my_center|LOCUS_07270 4535 3954 gene locus_tag LOCUS_07280 4535 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence116 1409 891 gene locus_tag LOCUS_07290 1409 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705064.1 protein_id gnl|my_center|LOCUS_07290 1818 2107 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacatcgacggcgacggact 3903 2299 gene locus_tag LOCUS_07300 3903 2299 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_07300 <4864 3973 gene locus_tag LOCUS_07310 <4864 3973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730884.1:acyl-CoA dehydrogenase >Feature sequence117 1769 564 gene locus_tag LOCUS_07320 1769 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3058 1859 gene locus_tag LOCUS_07330 3058 1859 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_07330 3151 3525 gene locus_tag LOCUS_07340 3151 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776209.1 protein_id gnl|my_center|LOCUS_07340 4666 3500 gene locus_tag LOCUS_07350 4666 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence118 1411 233 gene locus_tag LOCUS_07360 1411 233 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704885.1 protein_id gnl|my_center|LOCUS_07360 1563 1478 gene locus_tag LOCUS_t00060 1563 1478 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2925 1672 gene locus_tag LOCUS_07370 gene serS 2925 1672 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBX1 protein_id gnl|my_center|LOCUS_07370 3998 2967 gene locus_tag LOCUS_07380 3998 2967 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence119 <1 677 gene locus_tag LOCUS_07390 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256486.1:thiol reductase thioredoxin 1276 701 gene locus_tag LOCUS_07400 1276 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1701 1354 gene locus_tag LOCUS_07410 gene erpA 1701 1354 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW5 protein_id gnl|my_center|LOCUS_07410 1966 3153 gene locus_tag LOCUS_07420 1966 3153 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MLM5 protein_id gnl|my_center|LOCUS_07420 3974 3150 gene locus_tag LOCUS_07430 3974 3150 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_07430 <4788 3975 gene locus_tag LOCUS_07440 <4788 3975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088086.1:NUDIX hydrolase >Feature sequence120 2397 1114 gene locus_tag LOCUS_07450 gene hisS 2397 1114 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWK7 protein_id gnl|my_center|LOCUS_07450 4668 2464 gene locus_tag LOCUS_07460 gene relA 4668 2464 CDS product putative GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66015 protein_id gnl|my_center|LOCUS_07460 >Feature sequence121 2072 960 gene locus_tag LOCUS_07470 2072 960 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_07470 2110 3246 gene locus_tag LOCUS_07480 2110 3246 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_07480 3356 3775 gene locus_tag LOCUS_07490 3356 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703331.1 protein_id gnl|my_center|LOCUS_07490 3945 4187 gene locus_tag LOCUS_07500 3945 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4245 4601 gene locus_tag LOCUS_07510 4245 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence122 1163 207 gene locus_tag LOCUS_07520 1163 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2074 1160 gene locus_tag LOCUS_07530 2074 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2850 2104 gene locus_tag LOCUS_07540 2850 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 4162 2858 gene locus_tag LOCUS_07550 4162 2858 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence123 <1 542 gene locus_tag LOCUS_07560 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P65847:tRNA pseudouridine synthase A 653 1699 gene locus_tag LOCUS_07570 653 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3185 1761 gene locus_tag LOCUS_07580 3185 1761 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_07580 4317 3187 gene locus_tag LOCUS_07590 4317 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence124 558 1016 gene locus_tag LOCUS_07600 558 1016 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_07600 1013 1753 gene locus_tag LOCUS_07610 1013 1753 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_07610 1945 2853 gene locus_tag LOCUS_07620 gene cysD 1945 2853 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1W4 protein_id gnl|my_center|LOCUS_07620 2853 4106 gene locus_tag LOCUS_07630 2853 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence125 538 182 gene locus_tag LOCUS_07640 538 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1486 602 gene locus_tag LOCUS_07650 1486 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1445 1888 gene locus_tag LOCUS_07660 gene fur 1445 1888 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294385.1 protein_id gnl|my_center|LOCUS_07660 3645 1894 gene locus_tag LOCUS_07670 3645 1894 CDS product transport integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence126 1312 173 gene locus_tag LOCUS_07680 1312 173 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_07680 1728 1309 gene locus_tag LOCUS_07690 1728 1309 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5H3 protein_id gnl|my_center|LOCUS_07690 4364 1725 gene locus_tag LOCUS_07700 gene alaS 4364 1725 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61701 protein_id gnl|my_center|LOCUS_07700 >Feature sequence127 116 1021 gene locus_tag LOCUS_07710 116 1021 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224861.1 protein_id gnl|my_center|LOCUS_07710 2053 1118 gene locus_tag LOCUS_07720 gene hmd 2053 1118 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229965.1 protein_id gnl|my_center|LOCUS_07720 2534 2100 gene locus_tag LOCUS_07730 gene dut 2534 2100 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_07730 2666 4159 gene locus_tag LOCUS_07740 gene gltB2 2666 4159 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_07740 <4717 4156 gene locus_tag LOCUS_07750 <4717 4156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34578:UPF0721 transmembrane protein YjnA >Feature sequence128 1452 283 gene locus_tag LOCUS_07760 1452 283 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_07760 2492 1533 gene locus_tag LOCUS_07770 gene etfA 2492 1533 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG9 protein_id gnl|my_center|LOCUS_07770 3356 2589 gene locus_tag LOCUS_07780 gene fixA 3356 2589 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_07780 4557 3505 gene locus_tag LOCUS_07790 4557 3505 CDS product hypothetical zinc-type alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701279.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence129 1476 289 gene locus_tag LOCUS_07800 gene pgk 1476 289 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI30 protein_id gnl|my_center|LOCUS_07800 2505 1480 gene locus_tag LOCUS_07810 gene gapA 2505 1480 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_07810 3604 2729 gene locus_tag LOCUS_07820 3604 2729 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_07820 4695 3601 gene locus_tag LOCUS_07830 4695 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence130 1059 3332 gene locus_tag LOCUS_07840 1059 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3405 4181 gene locus_tag LOCUS_07850 3405 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence131 823 287 gene locus_tag LOCUS_07860 823 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1653 814 gene locus_tag LOCUS_07870 1653 814 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3I0 protein_id gnl|my_center|LOCUS_07870 2300 1701 gene locus_tag LOCUS_07880 2300 1701 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_07880 2918 2379 gene locus_tag LOCUS_07890 2918 2379 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_07890 3892 2915 gene locus_tag LOCUS_07900 3892 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4107 3898 gene locus_tag LOCUS_07910 4107 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4504 4268 gene locus_tag LOCUS_07920 4504 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence132 290 1522 gene locus_tag LOCUS_07930 290 1522 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_07930 1541 2023 gene locus_tag LOCUS_07940 1541 2023 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_07940 2269 2448 gene locus_tag LOCUS_07950 2269 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2719 3756 gene locus_tag LOCUS_07960 2719 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4608 3808 gene locus_tag LOCUS_07970 gene ynhD 4608 3808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence133 3 1577 gene locus_tag LOCUS_07980 3 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1666 2481 gene locus_tag LOCUS_07990 gene budA 1666 2481 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705051.1 protein_id gnl|my_center|LOCUS_07990 3079 3603 gene locus_tag LOCUS_08000 3079 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3738 4418 gene locus_tag LOCUS_08010 3738 4418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence134 709 278 gene locus_tag LOCUS_08020 709 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 891 706 gene locus_tag LOCUS_08030 891 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1643 888 gene locus_tag LOCUS_08040 1643 888 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_08040 2314 1640 gene locus_tag LOCUS_08050 gene ccmB 2314 1640 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5F1 protein_id gnl|my_center|LOCUS_08050 2958 2311 gene locus_tag LOCUS_08060 2958 2311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_08060 3196 4020 gene locus_tag LOCUS_08070 3196 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 <4606 4071 gene locus_tag LOCUS_08080 <4606 4071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q50130:putative enoyl-CoA hydratase echA6 >Feature sequence135 929 144 gene locus_tag LOCUS_08090 929 144 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730852.1 protein_id gnl|my_center|LOCUS_08090 2142 931 gene locus_tag LOCUS_08100 2142 931 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701958.1 protein_id gnl|my_center|LOCUS_08100 2738 2139 gene locus_tag LOCUS_08110 2738 2139 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 protein_id gnl|my_center|LOCUS_08110 3518 2739 gene locus_tag LOCUS_08120 3518 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3594 4484 gene locus_tag LOCUS_08130 3594 4484 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730850.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence136 2507 1740 gene locus_tag LOCUS_08140 2507 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4049 2523 gene locus_tag LOCUS_08150 gene metG 4049 2523 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2I9 protein_id gnl|my_center|LOCUS_08150 4146 4400 gene locus_tag LOCUS_08160 4146 4400 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence137 3 1091 gene locus_tag LOCUS_08170 3 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1122 1610 gene locus_tag LOCUS_08180 1122 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1607 2590 gene locus_tag LOCUS_08190 1607 2590 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_08190 2612 3499 gene locus_tag LOCUS_08200 2612 3499 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_08200 3496 4464 gene locus_tag LOCUS_08210 3496 4464 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z530 protein_id gnl|my_center|LOCUS_08210 >Feature sequence138 <1 1817 gene locus_tag LOCUS_08220 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028569.1:ABC transporter ATP-binding protein 1814 3637 gene locus_tag LOCUS_08230 1814 3637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_08230 <4513 3669 gene locus_tag LOCUS_08240 <4513 3669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256891.1:membrane protein >Feature sequence139 97 1185 gene locus_tag LOCUS_08250 97 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2303 1191 gene locus_tag LOCUS_08260 2303 1191 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_08260 3749 2418 gene locus_tag LOCUS_08270 3749 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3806 4348 gene locus_tag LOCUS_08280 3806 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence140 711 118 gene locus_tag LOCUS_08290 711 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1222 785 gene locus_tag LOCUS_08300 1222 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2001 1252 gene locus_tag LOCUS_08310 2001 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3264 2131 gene locus_tag LOCUS_08320 3264 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3976 3338 gene locus_tag LOCUS_08330 3976 3338 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727134.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence141 315 1784 gene locus_tag LOCUS_08340 315 1784 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942823.1 protein_id gnl|my_center|LOCUS_08340 2663 1821 gene locus_tag LOCUS_08350 gene rsmI 2663 1821 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKD4 protein_id gnl|my_center|LOCUS_08350 2986 2660 gene locus_tag LOCUS_08360 2986 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4021 3002 gene locus_tag LOCUS_08370 gene ychF 4021 3002 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37518 protein_id gnl|my_center|LOCUS_08370 >Feature sequence142 187 1023 gene locus_tag LOCUS_08380 187 1023 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 protein_id gnl|my_center|LOCUS_08380 1299 1132 gene locus_tag LOCUS_08390 1299 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1551 2270 gene locus_tag LOCUS_08400 1551 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2433 3263 gene locus_tag LOCUS_08410 gene paaG 2433 3263 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_08410 4146 3406 gene locus_tag LOCUS_08420 4146 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence143 1586 699 gene locus_tag LOCUS_08430 1586 699 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701133.1 protein_id gnl|my_center|LOCUS_08430 3553 1706 gene locus_tag LOCUS_08440 3553 1706 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_08440 3757 4212 gene locus_tag LOCUS_08450 3757 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence144 1412 264 gene locus_tag LOCUS_08460 1412 264 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_08460 2530 1568 gene locus_tag LOCUS_08470 2530 1568 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701346.1 protein_id gnl|my_center|LOCUS_08470 3690 2548 gene locus_tag LOCUS_08480 3690 2548 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence145 <1 1864 gene locus_tag LOCUS_08490 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QU30:NADH-quinone oxidoreductase 1861 3060 gene locus_tag LOCUS_08500 gene nuoH 1861 3060 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU29 protein_id gnl|my_center|LOCUS_08500 3060 3647 gene locus_tag LOCUS_08510 gene nuoI1 3060 3647 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR2 protein_id gnl|my_center|LOCUS_08510 3647 4189 gene locus_tag LOCUS_08520 3647 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence146 2791 293 gene locus_tag LOCUS_08530 2791 293 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_08530 3019 4110 gene locus_tag LOCUS_08540 3019 4110 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence147 <1 663 gene locus_tag LOCUS_08550 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533106.1:glycosyl transferase family 1 660 1286 gene locus_tag LOCUS_08560 660 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1283 2242 gene locus_tag LOCUS_08570 1283 2242 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_08570 2243 3409 gene locus_tag LOCUS_08580 2243 3409 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_08580 4201 3416 gene locus_tag LOCUS_08590 4201 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence148 374 1147 gene locus_tag LOCUS_08600 374 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1144 1884 gene locus_tag LOCUS_08610 1144 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3708 1867 gene locus_tag LOCUS_08620 3708 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence149 664 1050 gene locus_tag LOCUS_08630 664 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1059 2291 gene locus_tag LOCUS_08640 1059 2291 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_08640 3712 2303 gene locus_tag LOCUS_08650 3712 2303 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730585.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence150 214 423 gene locus_tag LOCUS_08660 214 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2706 952 gene locus_tag LOCUS_08670 2706 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224201.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence151 <1 557 gene locus_tag LOCUS_08680 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZBQ7:ribonuclease 3 550 1389 gene locus_tag LOCUS_08690 gene mutM 550 1389 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_08690 1392 1685 gene locus_tag LOCUS_08700 1392 1685 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence152 567 238 gene locus_tag LOCUS_08710 567 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1674 748 gene locus_tag LOCUS_08720 gene trxB 1674 748 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_08720 1960 1667 gene locus_tag LOCUS_08730 1960 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2514 2071 gene locus_tag LOCUS_08740 2514 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3366 2530 gene locus_tag LOCUS_08750 3366 2530 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDL7 protein_id gnl|my_center|LOCUS_08750 <4262 3460 gene locus_tag LOCUS_08760 <4262 3460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7D1M9:putative lipid II flippase MurJ >Feature sequence153 <1 710 gene locus_tag LOCUS_08770 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228917.1:ABC transporter note possible pseudo, internal stop codon, frameshifted 707 1477 gene locus_tag LOCUS_08780 707 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08780 1474 2250 gene locus_tag LOCUS_08790 gene livF 1474 2250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228916.1 protein_id gnl|my_center|LOCUS_08790 2302 2775 gene locus_tag LOCUS_08800 gene greA 2302 2775 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEV2 protein_id gnl|my_center|LOCUS_08800 >Feature sequence154 925 476 gene locus_tag LOCUS_08810 925 476 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_08810 1119 1045 gene locus_tag LOCUS_t00070 1119 1045 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1219 1884 gene locus_tag LOCUS_08820 1219 1884 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_08820 2105 2308 gene locus_tag LOCUS_08830 2105 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 <4229 2315 gene locus_tag LOCUS_08840 <4229 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KY19:pyruvate dehydrogenase E1 component >Feature sequence155 <1 842 gene locus_tag LOCUS_08850 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P53532:chaperone protein ClpB 950 2242 gene locus_tag LOCUS_08860 gene purA 950 2242 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8P6 protein_id gnl|my_center|LOCUS_08860 2245 3534 gene locus_tag LOCUS_08870 gene purD 2245 3534 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP5 protein_id gnl|my_center|LOCUS_08870 >Feature sequence156 2146 599 gene locus_tag LOCUS_08880 2146 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2838 2143 gene locus_tag LOCUS_08890 2838 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702365.1 protein_id gnl|my_center|LOCUS_08890 <4202 3147 gene locus_tag LOCUS_08900 <4202 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DLD3:leucine--tRNA ligase >Feature sequence157 1276 263 gene locus_tag LOCUS_08910 1276 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_08910 1434 2267 gene locus_tag LOCUS_08920 1434 2267 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_08920 2720 2349 gene locus_tag LOCUS_08930 2720 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence158 1 147 gene locus_tag LOCUS_08940 1 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 157 624 gene locus_tag LOCUS_08950 157 624 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_08950 783 646 gene locus_tag LOCUS_08960 783 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2163 997 gene locus_tag LOCUS_08970 2163 997 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256780.1 protein_id gnl|my_center|LOCUS_08970 3790 2249 gene locus_tag LOCUS_08980 gene leuA 3790 2249 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG97 protein_id gnl|my_center|LOCUS_08980 >Feature sequence159 3251 1983 gene locus_tag LOCUS_08990 gene nusA 3251 1983 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM8 protein_id gnl|my_center|LOCUS_08990 3778 3248 gene locus_tag LOCUS_09000 gene rimP 3778 3248 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIY9 protein_id gnl|my_center|LOCUS_09000 >Feature sequence160 2353 1001 gene locus_tag LOCUS_09010 2353 1001 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_09010 4047 2365 gene locus_tag LOCUS_09020 4047 2365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022474.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence161 1927 290 gene locus_tag LOCUS_09030 gene groL2 1927 290 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_09030 2087 2746 gene locus_tag LOCUS_09040 gene ideR 2087 2746 CDS product iron-dependent repressor IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMH1 protein_id gnl|my_center|LOCUS_09040 2865 3266 gene locus_tag LOCUS_09050 2865 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3347 3763 gene locus_tag LOCUS_09060 3347 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence162 434 1525 gene locus_tag LOCUS_09070 gene ddlA 434 1525 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW3 protein_id gnl|my_center|LOCUS_09070 3327 1522 gene locus_tag LOCUS_09080 gene pckG 3327 1522 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QP32 protein_id gnl|my_center|LOCUS_09080 3783 3553 gene locus_tag LOCUS_09090 3783 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3976 3788 gene locus_tag LOCUS_09100 gene rpmB1 3976 3788 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_09100 >Feature sequence163 1981 539 gene locus_tag LOCUS_09110 1981 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_09110 2027 3094 gene locus_tag LOCUS_09120 gene ispH 2027 3094 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_09120 3097 3546 gene locus_tag LOCUS_09130 3097 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 <4136 3557 gene locus_tag LOCUS_09140 <4136 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCH0:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence164 825 1670 gene locus_tag LOCUS_09150 825 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3297 1708 gene locus_tag LOCUS_09160 3297 1708 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021994.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence165 486 962 gene locus_tag LOCUS_09170 486 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 962 1552 gene locus_tag LOCUS_09180 gene nuoB1 962 1552 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ5 protein_id gnl|my_center|LOCUS_09180 1560 2084 gene locus_tag LOCUS_09190 gene nuoC 1560 2084 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA6 protein_id gnl|my_center|LOCUS_09190 2081 3451 gene locus_tag LOCUS_09200 gene nuoD 2081 3451 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_09200 3451 3954 gene locus_tag LOCUS_09210 3451 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence166 1 345 gene locus_tag LOCUS_09220 1 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 350 1387 gene locus_tag LOCUS_09230 gene asd 350 1387 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2S1 protein_id gnl|my_center|LOCUS_09230 1598 3832 gene locus_tag LOCUS_09240 1598 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3975 3899 gene locus_tag LOCUS_t00080 3975 3899 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence167 276 7 gene locus_tag LOCUS_09250 276 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1865 501 gene locus_tag LOCUS_09260 1865 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3547 2162 gene locus_tag LOCUS_09270 gene mprB 3547 2162 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_09270 4104 3577 gene locus_tag LOCUS_09280 4104 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence168 1327 410 gene locus_tag LOCUS_09290 1327 410 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_09290 1386 2399 gene locus_tag LOCUS_09300 1386 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2396 3802 gene locus_tag LOCUS_09310 2396 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence169 1832 1047 gene locus_tag LOCUS_09320 gene hdhA 1832 1047 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_09320 1887 3089 gene locus_tag LOCUS_09330 gene cyp142 1887 3089 CDS product putative cytochrome P450 142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL5 protein_id gnl|my_center|LOCUS_09330 <4078 3173 gene locus_tag LOCUS_09340 <4078 3173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198121.1:NADP-dependent aryl-alcohol dehydrogenase >Feature sequence170 376 2271 gene locus_tag LOCUS_09350 376 2271 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265533.1 protein_id gnl|my_center|LOCUS_09350 2305 3237 gene locus_tag LOCUS_09360 2305 3237 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_09360 3971 3258 gene locus_tag LOCUS_09370 3971 3258 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence171 <1 885 gene locus_tag LOCUS_09380 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267796.1:MFS transporter 2168 918 gene locus_tag LOCUS_09390 2168 918 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_09390 2707 2303 gene locus_tag LOCUS_09400 2707 2303 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence172 <1 804 gene locus_tag LOCUS_09410 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259723.1:cell cycle protein 801 2255 gene locus_tag LOCUS_09420 801 2255 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence173 476 255 gene locus_tag LOCUS_09430 476 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 735 1277 gene locus_tag LOCUS_09440 735 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1403 1711 gene locus_tag LOCUS_09450 1403 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2149 1826 gene locus_tag LOCUS_09460 2149 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2394 2143 gene locus_tag LOCUS_09470 2394 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2875 2471 gene locus_tag LOCUS_09480 2875 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3274 2888 gene locus_tag LOCUS_09490 3274 2888 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_09490 3432 3265 gene locus_tag LOCUS_09500 3432 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3401 3811 gene locus_tag LOCUS_09510 3401 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence174 1320 2732 gene locus_tag LOCUS_09520 1320 2732 CDS product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028735.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence175 2075 2875 gene locus_tag LOCUS_09530 2075 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <3975 2907 gene locus_tag LOCUS_09540 <3975 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96843:3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase >Feature sequence176 <1 1916 gene locus_tag LOCUS_09550 <1 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin containing oxidoreductase 2541 1927 gene locus_tag LOCUS_09560 2541 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3967 2777 gene locus_tag LOCUS_09570 3967 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence177 904 1494 gene locus_tag LOCUS_09580 904 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1514 1816 gene locus_tag LOCUS_09590 1514 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2590 1898 gene locus_tag LOCUS_09600 2590 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3533 3024 gene locus_tag LOCUS_09610 3533 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence178 1731 1195 gene locus_tag LOCUS_09620 1731 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3360 1744 gene locus_tag LOCUS_09630 3360 1744 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_09630 <3919 3353 gene locus_tag LOCUS_09640 <3919 3353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004705670.1:branched chain amino acid aminotransferase >Feature sequence179 1366 314 gene locus_tag LOCUS_09650 gene trpD 1366 314 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCH7 protein_id gnl|my_center|LOCUS_09650 1790 1506 gene locus_tag LOCUS_09660 1790 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1960 2451 gene locus_tag LOCUS_09670 1960 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3825 2797 gene locus_tag LOCUS_09680 3825 2797 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence180 2031 1120 gene locus_tag LOCUS_09690 2031 1120 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227465.1 protein_id gnl|my_center|LOCUS_09690 2272 3276 gene locus_tag LOCUS_09700 gene pstC 2272 3276 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9U3 protein_id gnl|my_center|LOCUS_09700 >Feature sequence181 1739 246 gene locus_tag LOCUS_09710 gene glpK 1739 246 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I1 protein_id gnl|my_center|LOCUS_09710 1942 2970 gene locus_tag LOCUS_09720 gene pfk 1942 2970 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D256 protein_id gnl|my_center|LOCUS_09720 3007 3876 gene locus_tag LOCUS_09730 gene tesB 3007 3876 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence182 516 1868 gene locus_tag LOCUS_09740 516 1868 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887563.1 protein_id gnl|my_center|LOCUS_09740 2117 2773 gene locus_tag LOCUS_09750 2117 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence183 1928 378 gene locus_tag LOCUS_09760 1928 378 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976198.1 protein_id gnl|my_center|LOCUS_09760 2949 2083 gene locus_tag LOCUS_09770 2949 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence184 968 555 gene locus_tag LOCUS_09780 gene atpC 968 555 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH18 protein_id gnl|my_center|LOCUS_09780 2413 968 gene locus_tag LOCUS_09790 gene atpD 2413 968 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EEB5 protein_id gnl|my_center|LOCUS_09790 3440 2460 gene locus_tag LOCUS_09800 gene atpG 3440 2460 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DII3 protein_id gnl|my_center|LOCUS_09800 >Feature sequence185 467 75 gene locus_tag LOCUS_09810 467 75 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_09810 963 490 gene locus_tag LOCUS_09820 gene rplM 963 490 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ33 protein_id gnl|my_center|LOCUS_09820 >Feature sequence186 24 1454 gene locus_tag LOCUS_09830 24 1454 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702144.1 protein_id gnl|my_center|LOCUS_09830 2058 1591 gene locus_tag LOCUS_09840 2058 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920166.1 protein_id gnl|my_center|LOCUS_09840 2196 2651 gene locus_tag LOCUS_09850 2196 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3564 2665 gene locus_tag LOCUS_09860 3564 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence187 <1 1080 gene locus_tag LOCUS_09870 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WN29:bifunctional uridylyltransferase/uridylyl-removing enzyme 1102 1842 gene locus_tag LOCUS_09880 1102 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2386 1835 gene locus_tag LOCUS_09890 2386 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence188 528 1157 gene locus_tag LOCUS_09900 528 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1163 2233 gene locus_tag LOCUS_09910 1163 2233 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_09910 2311 2236 gene locus_tag LOCUS_t00090 2311 2236 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2960 2361 gene locus_tag LOCUS_09920 2960 2361 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_09920 3137 3727 gene locus_tag LOCUS_09930 gene rpoE 3137 3727 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence189 184 441 gene locus_tag LOCUS_09940 gene rpsO 184 441 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_09940 636 3074 gene locus_tag LOCUS_09950 gene pnp 636 3074 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CCF8 protein_id gnl|my_center|LOCUS_09950 >Feature sequence190 1414 953 gene locus_tag LOCUS_09960 1414 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704026.1 protein_id gnl|my_center|LOCUS_09960 1504 1950 gene locus_tag LOCUS_09970 1504 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2220 3269 gene locus_tag LOCUS_09980 2220 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031385.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence191 160 1056 gene locus_tag LOCUS_09990 160 1056 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_09990 1096 2481 gene locus_tag LOCUS_10000 1096 2481 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 protein_id gnl|my_center|LOCUS_10000 2478 3038 gene locus_tag LOCUS_10010 2478 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3046 3450 gene locus_tag LOCUS_10020 3046 3450 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028073.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence192 772 209 gene locus_tag LOCUS_10030 772 209 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_10030 837 1670 gene locus_tag LOCUS_10040 837 1670 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_10040 1766 2542 gene locus_tag LOCUS_10050 1766 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2539 3417 gene locus_tag LOCUS_10060 2539 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence193 <1 722 gene locus_tag LOCUS_10070 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728408.1:D-glycerate dehydrogenase 828 2048 gene locus_tag LOCUS_10080 828 2048 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803809.1 protein_id gnl|my_center|LOCUS_10080 2441 2350 gene locus_tag LOCUS_t00100 2441 2350 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence194 1498 2682 gene locus_tag LOCUS_10090 1498 2682 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence195 944 24 gene locus_tag LOCUS_10100 gene rarD 944 24 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941432.1 protein_id gnl|my_center|LOCUS_10100 1179 1742 gene locus_tag LOCUS_10110 1179 1742 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226087.1 protein_id gnl|my_center|LOCUS_10110 1792 3495 gene locus_tag LOCUS_10120 gene nadE2 1792 3495 CDS product putative glutamine-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y0 protein_id gnl|my_center|LOCUS_10120 >Feature sequence196 221 1201 gene locus_tag LOCUS_10130 221 1201 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_10130 1347 2741 gene locus_tag LOCUS_10140 1347 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence197 1269 1760 gene locus_tag LOCUS_10150 1269 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1764 2177 gene locus_tag LOCUS_10160 1764 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2268 3047 gene locus_tag LOCUS_10170 2268 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence198 2994 1822 gene locus_tag LOCUS_10180 gene sbcD 2994 1822 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93IW9 protein_id gnl|my_center|LOCUS_10180 >Feature sequence199 745 1122 gene locus_tag LOCUS_10190 745 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_10190 1347 1150 gene locus_tag LOCUS_10200 1347 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1462 2355 gene locus_tag LOCUS_10210 gene panB 1462 2355 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729A6 protein_id gnl|my_center|LOCUS_10210 3609 2398 gene locus_tag LOCUS_10220 3609 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence200 1995 628 gene locus_tag LOCUS_10230 1995 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2627 2202 gene locus_tag LOCUS_10240 2627 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 <3576 2745 gene locus_tag LOCUS_10250 <3576 2745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026923.1:histidine kinase >Feature sequence201 850 1428 gene locus_tag LOCUS_10260 850 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2989 1439 gene locus_tag LOCUS_10270 gene guaA 2989 1439 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_10270 <3562 3000 gene locus_tag LOCUS_10280 <3562 3000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058024.1:guanosine monophosphate reductase >Feature sequence202 1930 749 gene locus_tag LOCUS_10290 1930 749 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence203 1286 570 gene locus_tag LOCUS_10300 1286 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1434 2039 gene locus_tag LOCUS_10310 1434 2039 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867475.1 protein_id gnl|my_center|LOCUS_10310 2036 3511 gene locus_tag LOCUS_10320 2036 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence204 <1 809 gene locus_tag LOCUS_10330 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WB45:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase 939 2024 gene locus_tag LOCUS_10340 939 2024 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704178.1 protein_id gnl|my_center|LOCUS_10340 3341 2097 gene locus_tag LOCUS_10350 3341 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence205 1545 622 gene locus_tag LOCUS_10360 gene pyrB 1545 622 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR2 protein_id gnl|my_center|LOCUS_10360 2249 1542 gene locus_tag LOCUS_10370 2249 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2891 2379 gene locus_tag LOCUS_10380 2891 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3203 2910 gene locus_tag LOCUS_10390 gene clpS 3203 2910 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_10390 >Feature sequence206 1216 668 gene locus_tag LOCUS_10400 1216 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1226 1507 gene locus_tag LOCUS_10410 1226 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1838 1593 gene locus_tag LOCUS_10420 1838 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2665 1880 gene locus_tag LOCUS_10430 2665 1880 CDS product heme peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_869234.2 protein_id gnl|my_center|LOCUS_10430 >Feature sequence207 532 308 gene locus_tag LOCUS_10440 532 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1371 610 gene locus_tag LOCUS_10450 gene suhB 1371 610 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_10450 2562 1384 gene locus_tag LOCUS_10460 gene atoB 2562 1384 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228962.1 protein_id gnl|my_center|LOCUS_10460 3317 2676 gene locus_tag LOCUS_10470 3317 2676 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence208 <1 524 gene locus_tag LOCUS_10480 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876304.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS 652 1215 gene locus_tag LOCUS_10490 gene pdxT 652 1215 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_10490 1212 1961 gene locus_tag LOCUS_10500 1212 1961 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWH1 protein_id gnl|my_center|LOCUS_10500 1961 2419 gene locus_tag LOCUS_10510 1961 2419 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_10510 2573 3181 gene locus_tag LOCUS_10520 gene ruvC 2573 3181 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF2 protein_id gnl|my_center|LOCUS_10520 >Feature sequence209 540 1112 gene locus_tag LOCUS_10530 540 1112 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_10530 2769 1162 gene locus_tag LOCUS_10540 2769 1162 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_10540 <3458 2919 gene locus_tag LOCUS_10550 <3458 2919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P64302:haloalkane dehalogenase 1 >Feature sequence210 29 433 gene locus_tag LOCUS_10560 29 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1681 491 gene locus_tag LOCUS_10570 gene menE 1681 491 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222441.1 protein_id gnl|my_center|LOCUS_10570 1786 2655 gene locus_tag LOCUS_10580 gene menA 1786 2655 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFJ4 protein_id gnl|my_center|LOCUS_10580 3398 2703 gene locus_tag LOCUS_10590 gene menH 3398 2703 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_10590 >Feature sequence211 1060 356 gene locus_tag LOCUS_10600 gene pyrF 1060 356 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK39 protein_id gnl|my_center|LOCUS_10600 1944 1057 gene locus_tag LOCUS_10610 1944 1057 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460655.1 protein_id gnl|my_center|LOCUS_10610 <3430 2080 gene locus_tag LOCUS_10620 <3430 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QWS5:carbamoyl-phosphate synthase large chain >Feature sequence212 837 1502 gene locus_tag LOCUS_10630 gene nth 837 1502 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXM1 protein_id gnl|my_center|LOCUS_10630 1759 1553 gene locus_tag LOCUS_10640 1759 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1840 3132 gene locus_tag LOCUS_10650 1840 3132 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496833.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence213 928 1908 gene locus_tag LOCUS_10660 928 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1901 3091 gene locus_tag LOCUS_10670 1901 3091 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence214 <1 1811 gene locus_tag LOCUS_10680 <1 1811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229286.1:SAM-dependent methyltransferase 2996 1863 gene locus_tag LOCUS_10690 2996 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705206.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence215 2761 1796 gene locus_tag LOCUS_10700 2761 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 <3404 2758 gene locus_tag LOCUS_10710 <3404 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976192.1:rod shape-determining protein RodA >Feature sequence216 239 3280 gene locus_tag LOCUS_10720 239 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891934.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence217 <1 654 gene locus_tag LOCUS_10730 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7AKQ6:proteasome subunit alpha 710 2068 gene locus_tag LOCUS_10740 gene pafA 710 2068 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ61 protein_id gnl|my_center|LOCUS_10740 2068 3138 gene locus_tag LOCUS_10750 2068 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence218 <1 1765 gene locus_tag LOCUS_10760 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700922.1:putative N-acetymuramoyl-L-alanine amidase 2755 1784 gene locus_tag LOCUS_10770 2755 1784 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence219 2248 1778 gene locus_tag LOCUS_10780 2248 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 <3386 2327 gene locus_tag LOCUS_10790 <3386 2327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CZV4:ribonuclease D >Feature sequence220 1732 227 gene locus_tag LOCUS_10800 1732 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222726.1 protein_id gnl|my_center|LOCUS_10800 2420 1878 gene locus_tag LOCUS_10810 2420 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence221 269 1882 gene locus_tag LOCUS_10820 269 1882 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224430.1 protein_id gnl|my_center|LOCUS_10820 <3383 1982 gene locus_tag LOCUS_10830 <3383 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001032129.1:PAS domain-containing sensor histidine kinase >Feature sequence222 <1 1040 gene locus_tag LOCUS_10840 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HCU4:DNA polymerase 1049 1783 gene locus_tag LOCUS_10850 1049 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1892 3316 gene locus_tag LOCUS_10860 gene rpsA 1892 3316 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence223 123 1097 gene locus_tag LOCUS_10870 123 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1837 1121 gene locus_tag LOCUS_10880 1837 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1970 2809 gene locus_tag LOCUS_10890 1970 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence224 819 136 gene locus_tag LOCUS_10900 819 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 935 2422 gene locus_tag LOCUS_10910 935 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence225 811 119 gene locus_tag LOCUS_10920 811 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1980 1033 gene locus_tag LOCUS_10930 1980 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2987 2208 gene locus_tag LOCUS_10940 2987 2208 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726748.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence226 2044 287 gene locus_tag LOCUS_10950 gene arc 2044 287 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_10950 2261 2491 gene locus_tag LOCUS_10960 2261 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence227 198 1364 gene locus_tag LOCUS_10970 gene carA 198 1364 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH03 protein_id gnl|my_center|LOCUS_10970 >Feature sequence228 2526 1786 gene locus_tag LOCUS_10980 2526 1786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_10980 <3297 2561 gene locus_tag LOCUS_10990 <3297 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FBW3:prolipoprotein diacylglyceryl transferase 2 >Feature sequence229 642 28 gene locus_tag LOCUS_11000 642 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1842 901 gene locus_tag LOCUS_11010 1842 901 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_11010 2750 1917 gene locus_tag LOCUS_11020 2750 1917 CDS product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_11020 <3291 2769 gene locus_tag LOCUS_11030 <3291 2769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731379.1:acyl-CoA dehydrogenase >Feature sequence230 777 598 gene locus_tag LOCUS_11040 777 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11040 1980 793 gene locus_tag LOCUS_11050 1980 793 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_11050 2097 2732 gene locus_tag LOCUS_11060 2097 2732 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence231 639 331 gene locus_tag LOCUS_11070 gene groE 639 331 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVA7 protein_id gnl|my_center|LOCUS_11070 1923 922 gene locus_tag LOCUS_11080 1923 922 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_11080 2477 1920 gene locus_tag LOCUS_11090 2477 1920 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ2 protein_id gnl|my_center|LOCUS_11090 3187 2474 gene locus_tag LOCUS_11100 3187 2474 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546261.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence232 232 104 gene locus_tag LOCUS_11110 232 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 804 274 gene locus_tag LOCUS_11120 804 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2187 964 gene locus_tag LOCUS_11130 2187 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence233 816 55 gene locus_tag LOCUS_11140 816 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272208.1 protein_id gnl|my_center|LOCUS_11140 1443 2948 gene locus_tag LOCUS_11150 1443 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence234 >Feature sequence235 1842 2219 gene locus_tag LOCUS_11160 1842 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence236 581 1537 gene locus_tag LOCUS_11170 581 1537 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028049.1 protein_id gnl|my_center|LOCUS_11170 1534 2502 gene locus_tag LOCUS_11180 1534 2502 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250095.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence237 1562 1170 gene locus_tag LOCUS_11190 1562 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2905 1640 gene locus_tag LOCUS_11200 2905 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence238 1151 393 gene locus_tag LOCUS_11210 1151 393 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_11210 1626 1174 gene locus_tag LOCUS_11220 1626 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703696.1 protein_id gnl|my_center|LOCUS_11220 2404 1697 gene locus_tag LOCUS_11230 2404 1697 CDS product putative sensory transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704069.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence239 1417 32 gene locus_tag LOCUS_11240 1417 32 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_11240 2103 1414 gene locus_tag LOCUS_11250 2103 1414 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_11250 2323 2715 gene locus_tag LOCUS_11260 2323 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence240 2195 675 gene locus_tag LOCUS_11270 2195 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 <3181 2549 gene locus_tag LOCUS_11280 <3181 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921324.1:methyltransferase >Feature sequence241 <1 672 gene locus_tag LOCUS_11290 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228576.1:LLM class F420-dependent oxidoreductase 669 2162 gene locus_tag LOCUS_11300 669 2162 CDS product putative fumarate reductase/succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703124.1 protein_id gnl|my_center|LOCUS_11300 2947 2264 gene locus_tag LOCUS_11310 2947 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence242 1268 453 gene locus_tag LOCUS_11320 1268 453 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726668.1 protein_id gnl|my_center|LOCUS_11320 2554 1325 gene locus_tag LOCUS_11330 2554 1325 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_11330 <3179 2655 gene locus_tag LOCUS_11340 <3179 2655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975395.1:proteinase >Feature sequence243 <1 1353 gene locus_tag LOCUS_11350 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528031.1:FAD-dependent oxidoreductase >Feature sequence244 1632 1294 gene locus_tag LOCUS_11360 1632 1294 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_11360 2892 1648 gene locus_tag LOCUS_11370 gene amtB 2892 1648 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0Q9 protein_id gnl|my_center|LOCUS_11370 >Feature sequence245 1269 1829 gene locus_tag LOCUS_11380 1269 1829 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918615.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence246 1257 511 gene locus_tag LOCUS_11390 1257 511 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_11390 2732 1254 gene locus_tag LOCUS_11400 gene gatB 2732 1254 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_11400 >Feature sequence247 314 910 gene locus_tag LOCUS_11410 gene nasT 314 910 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_11410 966 1460 gene locus_tag LOCUS_11420 966 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11420 >Feature sequence248 554 886 gene locus_tag LOCUS_11430 554 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 883 2337 gene locus_tag LOCUS_11440 883 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence249 1845 175 gene locus_tag LOCUS_11450 1845 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703128.1 protein_id gnl|my_center|LOCUS_11450 2609 1896 gene locus_tag LOCUS_11460 2609 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence250 1166 705 gene locus_tag LOCUS_11470 1166 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_11470 1745 1257 gene locus_tag LOCUS_11480 1745 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1879 1998 gene locus_tag LOCUS_11490 1879 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3061 2072 gene locus_tag LOCUS_11500 3061 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence251 <1 1746 gene locus_tag LOCUS_11510 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257262.1:acetyl-CoA carboxylase biotin carboxylase subunit <3057 1919 gene locus_tag LOCUS_11520 <3057 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727859.1:NAD(P)H-quinone dehydrogenase >Feature sequence252 612 1400 gene locus_tag LOCUS_11530 612 1400 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250004.1 protein_id gnl|my_center|LOCUS_11530 1458 2378 gene locus_tag LOCUS_11540 1458 2378 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_11540 <3054 2452 gene locus_tag LOCUS_11550 <3054 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015900.1:glycerophosphoryl diester phosphodiesterase >Feature sequence253 324 248 gene locus_tag LOCUS_t00110 324 248 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1152 370 gene locus_tag LOCUS_11560 1152 370 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_11560 1583 1149 gene locus_tag LOCUS_11570 1583 1149 CDS product putative 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701963.1 protein_id gnl|my_center|LOCUS_11570 <3051 1580 gene locus_tag LOCUS_11580 <3051 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897260.1:aldehyde dehydrogenase >Feature sequence254 <1 535 gene locus_tag LOCUS_11590 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KF34:ammonium transporter 532 870 gene locus_tag LOCUS_11600 532 870 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_11600 2140 944 gene locus_tag LOCUS_11610 2140 944 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54099 protein_id gnl|my_center|LOCUS_11610 >Feature sequence255 334 1029 gene locus_tag LOCUS_11620 334 1029 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_11620 1175 1903 gene locus_tag LOCUS_11630 1175 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731508.1 protein_id gnl|my_center|LOCUS_11630 2187 2678 gene locus_tag LOCUS_11640 2187 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence256 584 970 gene locus_tag LOCUS_11650 584 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2406 997 gene locus_tag LOCUS_11660 2406 997 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1C8 protein_id gnl|my_center|LOCUS_11660 >Feature sequence257 1066 1962 gene locus_tag LOCUS_11670 1066 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence258 1231 449 gene locus_tag LOCUS_11680 gene paaG 1231 449 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_11680 1778 1329 gene locus_tag LOCUS_11690 1778 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2361 1885 gene locus_tag LOCUS_11700 2361 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 <3023 2409 gene locus_tag LOCUS_11710 <3023 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223478.1:LAO/AO transport system kinase >Feature sequence259 1795 1046 gene locus_tag LOCUS_11720 1795 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1948 2157 gene locus_tag LOCUS_11730 1948 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2186 2386 gene locus_tag LOCUS_11740 2186 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2387 2542 gene locus_tag LOCUS_11750 2387 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence260 2275 1148 gene locus_tag LOCUS_11760 2275 1148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030375.1 protein_id gnl|my_center|LOCUS_11760 <2982 2346 gene locus_tag LOCUS_11770 <2982 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QXF4:spermidine/putrescine import ATP-binding protein PotA >Feature sequence261 593 1879 gene locus_tag LOCUS_11780 593 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 <2980 2039 gene locus_tag LOCUS_11790 <2980 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863308.1:aconitate hydratase >Feature sequence262 648 145 gene locus_tag LOCUS_11800 648 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1196 654 gene locus_tag LOCUS_11810 1196 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 <2974 1193 gene locus_tag LOCUS_11820 <2974 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886991.1:cytochrome c biogenesis protein CcmF >Feature sequence263 3 395 gene locus_tag LOCUS_11830 3 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 438 1304 gene locus_tag LOCUS_11840 438 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence264 1898 714 gene locus_tag LOCUS_11850 1898 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2843 2058 gene locus_tag LOCUS_11860 2843 2058 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence265 1212 220 gene locus_tag LOCUS_11870 1212 220 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRT5 protein_id gnl|my_center|LOCUS_11870 2330 1233 gene locus_tag LOCUS_11880 2330 1233 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG6 protein_id gnl|my_center|LOCUS_11880 >Feature sequence266 <1 1056 gene locus_tag LOCUS_11890 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809114.1:GGDEF domain-containing protein 1198 1398 gene locus_tag LOCUS_11900 1198 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1468 1541 gene locus_tag LOCUS_t00120 1468 1541 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1634 1710 gene locus_tag LOCUS_t00130 1634 1710 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2684 1779 gene locus_tag LOCUS_11910 2684 1779 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028189.1 protein_id gnl|my_center|LOCUS_11910 2777 2853 gene locus_tag LOCUS_t00140 2777 2853 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 150 827 gene locus_tag LOCUS_11920 gene mprA 150 827 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_11920 852 2330 gene locus_tag LOCUS_11930 852 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence268 1581 361 gene locus_tag LOCUS_11940 gene pilC 1581 361 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_11940 <2904 1583 gene locus_tag LOCUS_11950 <2904 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583239.1:twitching motility protein PilT >Feature sequence269 1196 99 gene locus_tag LOCUS_11960 1196 99 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_11960 1308 1679 gene locus_tag LOCUS_11970 1308 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence270 852 316 gene locus_tag LOCUS_11980 852 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1349 969 gene locus_tag LOCUS_11990 gene gcvH 1349 969 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4L2 protein_id gnl|my_center|LOCUS_11990 2007 1405 gene locus_tag LOCUS_12000 gene pgsA 2007 1405 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_12000 2378 2043 gene locus_tag LOCUS_12010 2378 2043 CDS product stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728084.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence271 1923 1021 gene locus_tag LOCUS_12020 1923 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2511 1960 gene locus_tag LOCUS_12030 2511 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2709 2633 gene locus_tag LOCUS_t00150 2709 2633 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence272 31 699 gene locus_tag LOCUS_12040 31 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1241 939 gene locus_tag LOCUS_12050 1241 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1514 2854 gene locus_tag LOCUS_12060 1514 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence273 549 1472 gene locus_tag LOCUS_12070 549 1472 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_12070 1469 2380 gene locus_tag LOCUS_12080 1469 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2377 2844 gene locus_tag LOCUS_12090 2377 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence274 279 1064 gene locus_tag LOCUS_12100 gene tlyA 279 1064 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_12100 1061 1915 gene locus_tag LOCUS_12110 gene nadK 1061 1915 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence275 233 523 gene locus_tag LOCUS_12120 233 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1242 628 gene locus_tag LOCUS_12130 1242 628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_12130 1445 1885 gene locus_tag LOCUS_12140 gene mraZ 1445 1885 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2H2 protein_id gnl|my_center|LOCUS_12140 >Feature sequence276 1467 58 gene locus_tag LOCUS_12150 gene argH 1467 58 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEG1 protein_id gnl|my_center|LOCUS_12150 2687 1464 gene locus_tag LOCUS_12160 gene argG 2687 1464 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY7 protein_id gnl|my_center|LOCUS_12160 >Feature sequence277 1723 551 gene locus_tag LOCUS_12170 1723 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2457 1942 gene locus_tag LOCUS_12180 2457 1942 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence278 1223 621 gene locus_tag LOCUS_12190 1223 621 CDS product putative transcriptional regulator, TetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702779.1 protein_id gnl|my_center|LOCUS_12190 2026 1238 gene locus_tag LOCUS_12200 gene dapB 2026 1238 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBB5 protein_id gnl|my_center|LOCUS_12200 >Feature sequence279 442 1896 gene locus_tag LOCUS_12210 442 1896 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence280 1056 586 gene locus_tag LOCUS_12220 1056 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1079 2266 gene locus_tag LOCUS_12230 1079 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 <2810 2256 gene locus_tag LOCUS_12240 <2810 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919707.1:alpha-methylacyl-CoA racemase >Feature sequence281 612 259 gene locus_tag LOCUS_12250 612 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 661 1161 gene locus_tag LOCUS_12260 661 1161 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173948.1 protein_id gnl|my_center|LOCUS_12260 1180 2463 gene locus_tag LOCUS_12270 gene dinB 1180 2463 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence282 1865 837 gene locus_tag LOCUS_12280 gene gpsA2 1865 837 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H6 protein_id gnl|my_center|LOCUS_12280 2644 1862 gene locus_tag LOCUS_12290 2644 1862 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence283 <1 614 gene locus_tag LOCUS_12300 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55582:putative GMC-type oxidoreductase y4nJ 607 1644 gene locus_tag LOCUS_12310 607 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55584 protein_id gnl|my_center|LOCUS_12310 1614 2684 gene locus_tag LOCUS_12320 1614 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55579 protein_id gnl|my_center|LOCUS_12320 >Feature sequence284 1092 1712 gene locus_tag LOCUS_12330 1092 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2044 1733 gene locus_tag LOCUS_12340 2044 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence285 1600 503 gene locus_tag LOCUS_12350 1600 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 <2777 1754 gene locus_tag LOCUS_12360 <2777 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031376.1:ABC transporter ATP-binding protein >Feature sequence286 2040 1237 gene locus_tag LOCUS_12370 2040 1237 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence287 961 2349 gene locus_tag LOCUS_12380 961 2349 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM2 protein_id gnl|my_center|LOCUS_12380 >Feature sequence288 1047 412 gene locus_tag LOCUS_12390 gene clpP 1047 412 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_12390 2444 1044 gene locus_tag LOCUS_12400 gene tig 2444 1044 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_12400 >Feature sequence289 <1 1265 gene locus_tag LOCUS_12410 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DC86:UvrABC system protein A 1276 1998 gene locus_tag LOCUS_12420 1276 1998 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919712.1 protein_id gnl|my_center|LOCUS_12420 <2754 2032 gene locus_tag LOCUS_12430 <2754 2032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NRI0:quinolinate synthase A >Feature sequence290 1380 592 gene locus_tag LOCUS_12440 1380 592 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_12440 1950 1519 gene locus_tag LOCUS_12450 1950 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence291 1108 1464 gene locus_tag LOCUS_12460 1108 1464 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYW3 protein_id gnl|my_center|LOCUS_12460 >Feature sequence292 <2748 1420 gene locus_tag LOCUS_12470 <2748 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MG79:phosphoglucosamine mutase >Feature sequence293 <1 567 gene locus_tag LOCUS_12480 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NPL2:adenylosuccinate lyase 564 1442 gene locus_tag LOCUS_12490 gene purC 564 1442 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZB8 protein_id gnl|my_center|LOCUS_12490 1432 1713 gene locus_tag LOCUS_12500 gene purS 1432 1713 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX7 protein_id gnl|my_center|LOCUS_12500 1713 2414 gene locus_tag LOCUS_12510 gene purQ 1713 2414 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_12510 >Feature sequence294 675 2357 gene locus_tag LOCUS_12520 675 2357 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence295 1220 360 gene locus_tag LOCUS_12530 gene xerD 1220 360 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYQ5 protein_id gnl|my_center|LOCUS_12530 2007 1438 gene locus_tag LOCUS_12540 gene nudF 2007 1438 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 protein_id gnl|my_center|LOCUS_12540 <2738 2043 gene locus_tag LOCUS_12550 <2738 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D9T1:CTP synthase >Feature sequence296 <2735 1205 gene locus_tag LOCUS_12560 <2735 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030279.1:GGDEF-domain containing protein >Feature sequence297 15 731 gene locus_tag LOCUS_12570 15 731 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029519.1 protein_id gnl|my_center|LOCUS_12570 1206 745 gene locus_tag LOCUS_12580 1206 745 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_12580 2162 1371 gene locus_tag LOCUS_12590 gene surE 2162 1371 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731558.1 protein_id gnl|my_center|LOCUS_12590 2632 2162 gene locus_tag LOCUS_12600 2632 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 >Feature sequence298 <2711 1316 gene locus_tag LOCUS_12610 <2711 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926642.1:amidohydrolase >Feature sequence299 >Feature sequence300 302 1423 gene locus_tag LOCUS_12620 gene prfB 302 1423 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEU8 protein_id gnl|my_center|LOCUS_12620 1524 2210 gene locus_tag LOCUS_12630 1524 2210 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence301 >Feature sequence302 1069 119 gene locus_tag LOCUS_12640 1069 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_12640 2251 1091 gene locus_tag LOCUS_12650 2251 1091 CDS product thiamin pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence303 1668 283 gene locus_tag LOCUS_12660 1668 283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_12660 2676 1738 gene locus_tag LOCUS_12670 2676 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence304 619 431 gene locus_tag LOCUS_12680 gene csrA 619 431 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS3 protein_id gnl|my_center|LOCUS_12680 1809 793 gene locus_tag LOCUS_12690 1809 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1971 1897 gene locus_tag LOCUS_t00160 1971 1897 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence305 993 1547 gene locus_tag LOCUS_12700 993 1547 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_12700 <2665 1610 gene locus_tag LOCUS_12710 <2665 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964550.1:chromosome condensation regulator >Feature sequence306 1806 133 gene locus_tag LOCUS_12720 1806 133 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence307 2 937 gene locus_tag LOCUS_12730 2 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 943 1875 gene locus_tag LOCUS_12740 943 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence308 207 1457 gene locus_tag LOCUS_12750 207 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1492 1738 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcgagggtcacacgcagtagaggcgcgtggga 2424 1747 gene locus_tag LOCUS_12760 2424 1747 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031430.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence309 6 710 gene locus_tag LOCUS_12770 6 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 712 1743 gene locus_tag LOCUS_12780 712 1743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_12780 2550 1750 gene locus_tag LOCUS_12790 2550 1750 CDS product 3-ketodihydrosphingosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706792.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence310 449 790 gene locus_tag LOCUS_12800 gene rpsF 449 790 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH31 protein_id gnl|my_center|LOCUS_12800 794 1291 gene locus_tag LOCUS_12810 gene ssb 794 1291 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46390 protein_id gnl|my_center|LOCUS_12810 1330 1833 gene locus_tag LOCUS_12820 1330 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1836 2282 gene locus_tag LOCUS_12830 gene rplI 1836 2282 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM68 protein_id gnl|my_center|LOCUS_12830 >Feature sequence311 <1 956 gene locus_tag LOCUS_12840 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888715.1:glycerophosphoryl diester phosphodiesterase 978 1466 gene locus_tag LOCUS_12850 978 1466 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DVY1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence312 2106 2180 gene locus_tag LOCUS_t00170 2106 2180 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2554 2195 gene locus_tag LOCUS_12860 2554 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence313 <1 730 gene locus_tag LOCUS_12870 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 727 1836 gene locus_tag LOCUS_12880 727 1836 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence314 414 1289 gene locus_tag LOCUS_12890 414 1289 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_12890 <2582 1333 gene locus_tag LOCUS_12900 <2582 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001274139.1:acyl-CoA dehydrogenase >Feature sequence315 1966 461 gene locus_tag LOCUS_12910 1966 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence316 1317 2483 gene locus_tag LOCUS_12920 1317 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence317 154 633 gene locus_tag LOCUS_12930 154 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 734 1216 gene locus_tag LOCUS_12940 734 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_12940 1423 1986 gene locus_tag LOCUS_12950 1423 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence318 420 644 gene locus_tag LOCUS_12960 420 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 724 1551 gene locus_tag LOCUS_12970 724 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2437 1526 gene locus_tag LOCUS_12980 2437 1526 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence319 929 1014 gene locus_tag LOCUS_t00180 929 1014 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1102 1539 gene locus_tag LOCUS_12990 gene tadA 1102 1539 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035W4 protein_id gnl|my_center|LOCUS_12990 1565 1652 gene locus_tag LOCUS_t00190 1565 1652 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence320 <1 561 gene locus_tag LOCUS_13000 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730660.1:acyl-CoA dehydrogenase 558 1484 gene locus_tag LOCUS_13010 558 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence321 1076 375 gene locus_tag LOCUS_13020 1076 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1409 1161 gene locus_tag LOCUS_13030 1409 1161 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6C1 protein_id gnl|my_center|LOCUS_13030 2297 1515 gene locus_tag LOCUS_13040 gene atpB 2297 1515 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D8 protein_id gnl|my_center|LOCUS_13040 >Feature sequence322 <1 540 gene locus_tag LOCUS_13050 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228462.1:threonine synthase 537 809 gene locus_tag LOCUS_13060 537 809 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_13060 999 1844 gene locus_tag LOCUS_13070 999 1844 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence323 >Feature sequence324 <1 1558 gene locus_tag LOCUS_13080 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGU5:phosphoribosylformylglycinamidine synthase subunit PurL 2216 1587 gene locus_tag LOCUS_13090 gene cysC 2216 1587 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 protein_id gnl|my_center|LOCUS_13090 >Feature sequence325 623 120 gene locus_tag LOCUS_13100 gene mmyF 623 120 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_13100 1597 623 gene locus_tag LOCUS_13110 1597 623 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_13110 <2534 1728 gene locus_tag LOCUS_13120 <2534 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D852:transport permease protein >Feature sequence326 1889 954 gene locus_tag LOCUS_13130 1889 954 CDS product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336755.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence327 1 894 gene locus_tag LOCUS_13140 1 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2074 908 gene locus_tag LOCUS_13150 2074 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence328 169 531 gene locus_tag LOCUS_13160 169 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 622 1275 gene locus_tag LOCUS_13170 622 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1327 2160 gene locus_tag LOCUS_13180 gene uppP 1327 2160 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKY8 protein_id gnl|my_center|LOCUS_13180 >Feature sequence329 1690 926 gene locus_tag LOCUS_13190 1690 926 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_13190 <2524 1711 gene locus_tag LOCUS_13200 <2524 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000050920.1:succinate dehydrogenase flavoprotein subunit >Feature sequence330 1039 155 gene locus_tag LOCUS_13210 1039 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1369 1121 gene locus_tag LOCUS_13220 1369 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1936 1382 gene locus_tag LOCUS_13230 1936 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2520 2104 gene locus_tag LOCUS_13240 2520 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence331 1446 250 gene locus_tag LOCUS_13250 1446 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence332 452 1549 gene locus_tag LOCUS_13260 gene talA 452 1549 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z8 protein_id gnl|my_center|LOCUS_13260 >Feature sequence333 84 641 gene locus_tag LOCUS_13270 84 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence334 <1 1728 gene locus_tag LOCUS_13280 <1 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLV3:UvrABC system protein B >Feature sequence335 1382 213 gene locus_tag LOCUS_13290 gene lipL 1382 213 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence336 773 90 gene locus_tag LOCUS_13300 773 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 844 2469 gene locus_tag LOCUS_13310 844 2469 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704890.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence337 <1 556 gene locus_tag LOCUS_13320 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256416.1:type II secretion system protein E 553 2457 gene locus_tag LOCUS_13330 553 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence338 <1 558 gene locus_tag LOCUS_13340 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731408.1:dehydrogenase 671 1252 gene locus_tag LOCUS_13350 671 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence339 913 1749 gene locus_tag LOCUS_13360 913 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence340 878 36 gene locus_tag LOCUS_13370 gene folP 878 36 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S174 protein_id gnl|my_center|LOCUS_13370 877 1224 gene locus_tag LOCUS_13380 877 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1346 2452 gene locus_tag LOCUS_13390 1346 2452 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence341 599 192 gene locus_tag LOCUS_13400 599 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 753 670 gene locus_tag LOCUS_t00200 753 670 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1167 718 gene locus_tag LOCUS_13410 1167 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1308 2294 gene locus_tag LOCUS_13420 1308 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence342 1339 410 gene locus_tag LOCUS_13430 gene xerC 1339 410 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVB4 protein_id gnl|my_center|LOCUS_13430 >Feature sequence343 <2446 617 gene locus_tag LOCUS_13440 <2446 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010909022.1:membrane protein >Feature sequence344 1137 517 gene locus_tag LOCUS_13450 gene gph 1137 517 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230218.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence345 <2434 1046 gene locus_tag LOCUS_13460 <2434 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7AKK3:amidophosphoribosyltransferase >Feature sequence346 <1 547 gene locus_tag LOCUS_13470 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E008:serine hydroxymethyltransferase 557 1702 gene locus_tag LOCUS_13480 gene rfe 557 1702 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_13480 1858 2235 gene locus_tag LOCUS_13490 1858 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence347 1560 334 gene locus_tag LOCUS_13500 1560 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 <2420 1567 gene locus_tag LOCUS_13510 <2420 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VDC0:cytochrome b6-f complex iron-sulfur subunit >Feature sequence348 >Feature sequence349 163 1728 gene locus_tag LOCUS_13520 163 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence350 2399 891 gene locus_tag LOCUS_13530 2399 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence351 <1 622 gene locus_tag LOCUS_13540 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919667.1:acyl-CoA thioesterase 619 1578 gene locus_tag LOCUS_13550 619 1578 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_13550 1625 2257 gene locus_tag LOCUS_13560 1625 2257 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence352 2299 1919 gene locus_tag LOCUS_13570 gene hspR 2299 1919 CDS product putative heat shock protein HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40183 protein_id gnl|my_center|LOCUS_13570 >Feature sequence353 <1 720 gene locus_tag LOCUS_13580 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258753.1:NADH-quinone oxidoreductase subunit F >Feature sequence354 <1 1809 gene locus_tag LOCUS_13590 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJD6:UPF0182 protein >Feature sequence355 725 42 gene locus_tag LOCUS_13600 725 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1510 770 gene locus_tag LOCUS_13610 1510 770 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence356 1354 437 gene locus_tag LOCUS_13620 1354 437 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence357 458 1357 gene locus_tag LOCUS_13630 458 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence358 1549 641 gene locus_tag LOCUS_13640 1549 641 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence359 <2338 619 gene locus_tag LOCUS_13650 <2338 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141491.1:penicillin-binding protein >Feature sequence360 <2334 1282 gene locus_tag LOCUS_13660 <2334 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197126.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence361 1576 683 gene locus_tag LOCUS_13670 1576 683 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Q6 protein_id gnl|my_center|LOCUS_13670 <2333 1720 gene locus_tag LOCUS_13680 <2333 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIV5:glycerol-3-phosphate acyltransferase 2 >Feature sequence362 <1 1629 gene locus_tag LOCUS_13690 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJK6:ribonuclease J >Feature sequence363 362 1702 gene locus_tag LOCUS_13700 362 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence364 490 813 gene locus_tag LOCUS_13710 490 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1114 839 gene locus_tag LOCUS_13720 1114 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1133 1804 gene locus_tag LOCUS_13730 1133 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence365 1740 448 gene locus_tag LOCUS_13740 1740 448 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence366 106 480 gene locus_tag LOCUS_13750 106 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 617 533 gene locus_tag LOCUS_t00210 617 533 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1474 695 gene locus_tag LOCUS_13760 1474 695 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_13760 1537 2241 gene locus_tag LOCUS_13770 1537 2241 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence367 1795 554 gene locus_tag LOCUS_13780 1795 554 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_13780 2265 1792 gene locus_tag LOCUS_13790 2265 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence368 1039 464 gene locus_tag LOCUS_13800 1039 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2162 1080 gene locus_tag LOCUS_13810 2162 1080 CDS product inositol 1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence369 <1 687 gene locus_tag LOCUS_13820 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090548.1:ABC transporter ATP-binding protein 687 1568 gene locus_tag LOCUS_13830 687 1568 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887723.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence370 1385 246 gene locus_tag LOCUS_13840 1385 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence371 <2288 406 gene locus_tag LOCUS_13850 <2288 406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q05558:chaperone protein DnaK >Feature sequence372 <2285 1046 gene locus_tag LOCUS_13860 <2285 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QV25:chromosome partition protein Smc >Feature sequence373 646 83 gene locus_tag LOCUS_13870 646 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 835 1185 gene locus_tag LOCUS_13880 835 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence374 1799 615 gene locus_tag LOCUS_13890 1799 615 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence375 273 1988 gene locus_tag LOCUS_13900 273 1988 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence376 <1 636 gene locus_tag LOCUS_13910 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227931.1:branched chain amino acid ABC transporter substrate-binding protein 1007 666 gene locus_tag LOCUS_13920 1007 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence377 703 149 gene locus_tag LOCUS_13930 703 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1156 806 gene locus_tag LOCUS_13940 1156 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1545 1234 gene locus_tag LOCUS_13950 1545 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105135.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence378 <2253 1359 gene locus_tag LOCUS_13960 <2253 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F316:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence379 152 1441 gene locus_tag LOCUS_13970 152 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1548 1847 gene locus_tag LOCUS_13980 1548 1847 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI69 protein_id gnl|my_center|LOCUS_13980 >Feature sequence380 <1 819 gene locus_tag LOCUS_13990 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393377.1:LysR family transcriptional regulator 1605 844 gene locus_tag LOCUS_14000 1605 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 <2245 1666 gene locus_tag LOCUS_14010 <2245 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028214.1:inositol phosphorylceramide synthase >Feature sequence381 1192 452 gene locus_tag LOCUS_14020 1192 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2151 1189 gene locus_tag LOCUS_14030 2151 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence382 <1 587 gene locus_tag LOCUS_14040 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894024.1:enoyl-CoA hydratase 649 2052 gene locus_tag LOCUS_14050 649 2052 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729414.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence383 1392 589 gene locus_tag LOCUS_14060 1392 589 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence384 39 1259 gene locus_tag LOCUS_14070 39 1259 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence385 1380 1063 gene locus_tag LOCUS_14080 gene gatC 1380 1063 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUW9 protein_id gnl|my_center|LOCUS_14080 1842 1531 gene locus_tag LOCUS_14090 1842 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence386 >Feature sequence387 1322 384 gene locus_tag LOCUS_14100 1322 384 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_14100 1962 1465 gene locus_tag LOCUS_14110 1962 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence388 863 129 gene locus_tag LOCUS_14120 863 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1080 1430 gene locus_tag LOCUS_14130 1080 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence389 639 25 gene locus_tag LOCUS_14140 639 25 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404018.1 protein_id gnl|my_center|LOCUS_14140 936 1598 gene locus_tag LOCUS_14150 936 1598 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021023.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence390 591 76 gene locus_tag LOCUS_14160 591 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 780 1196 gene locus_tag LOCUS_14170 780 1196 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence391 1251 1937 gene locus_tag LOCUS_14180 1251 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence392 1038 127 gene locus_tag LOCUS_14190 gene prmC 1038 127 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJ33 protein_id gnl|my_center|LOCUS_14190 2111 1035 gene locus_tag LOCUS_14200 gene prfA 2111 1035 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFW0 protein_id gnl|my_center|LOCUS_14200 >Feature sequence393 1362 529 gene locus_tag LOCUS_14210 gene pstB 1362 529 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG27 protein_id gnl|my_center|LOCUS_14210 <2170 1359 gene locus_tag LOCUS_14220 <2170 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D8U7:phosphate transport system permease protein PstA >Feature sequence394 152 1855 gene locus_tag LOCUS_14230 152 1855 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence395 41 1000 gene locus_tag LOCUS_14240 41 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1129 1329 gene locus_tag LOCUS_14250 1129 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence396 >Feature sequence397 1448 81 gene locus_tag LOCUS_14260 1448 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1649 1723 gene locus_tag LOCUS_t00220 1649 1723 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1757 1832 gene locus_tag LOCUS_t00230 1757 1832 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1873 1947 gene locus_tag LOCUS_t00240 1873 1947 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence398 234 914 gene locus_tag LOCUS_14270 234 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1114 1272 gene locus_tag LOCUS_14280 1114 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1464 1841 gene locus_tag LOCUS_14290 gene rpsM 1464 1841 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS3 protein_id gnl|my_center|LOCUS_14290 >Feature sequence399 1326 118 gene locus_tag LOCUS_14300 1326 118 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_14300 <2131 1337 gene locus_tag LOCUS_14310 <2131 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D289:diacylglycerol O-acyltransferase >Feature sequence400 67 1260 gene locus_tag LOCUS_14320 67 1260 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228991.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence401 >Feature sequence402 <1 2095 gene locus_tag LOCUS_14330 <1 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583674.1:pyruvate, phosphate dikinase >Feature sequence403 736 1548 gene locus_tag LOCUS_14340 736 1548 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_14340 1637 2068 gene locus_tag LOCUS_14350 1637 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence404 648 214 gene locus_tag LOCUS_14360 648 214 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_14360 <2081 770 gene locus_tag LOCUS_14370 <2081 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490729.1:aminotransferase class III >Feature sequence405 312 557 gene locus_tag LOCUS_14380 312 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 560 802 gene locus_tag LOCUS_14390 560 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1422 1015 gene locus_tag LOCUS_14400 1422 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1745 1419 gene locus_tag LOCUS_14410 1745 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence406 >Feature sequence407 13 207 gene locus_tag LOCUS_14420 13 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 469 326 gene locus_tag LOCUS_14430 469 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 468 1511 gene locus_tag LOCUS_14440 468 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence408 764 222 gene locus_tag LOCUS_14450 764 222 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_14450 994 1227 gene locus_tag LOCUS_14460 994 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1599 1231 gene locus_tag LOCUS_14470 1599 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence409 >Feature sequence410 1392 25 gene locus_tag LOCUS_14480 1392 25 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_14480 <2035 1454 gene locus_tag LOCUS_14490 <2035 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393875.1:membrane protein >Feature sequence411 448 1755 gene locus_tag LOCUS_14500 448 1755 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888732.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence412 1565 849 gene locus_tag LOCUS_14510 1565 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence413 1705 845 gene locus_tag LOCUS_14520 gene nfo 1705 845 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2N2 protein_id gnl|my_center|LOCUS_14520 >Feature sequence414 <1 1026 gene locus_tag LOCUS_14530 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897870.1:dihydropyrimidine dehydrogenase subunit A 1078 1704 gene locus_tag LOCUS_14540 gene aat 1078 1704 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7C9 protein_id gnl|my_center|LOCUS_14540 >Feature sequence415 19 756 gene locus_tag LOCUS_14550 gene gpmA 19 756 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33158 protein_id gnl|my_center|LOCUS_14550 1220 765 gene locus_tag LOCUS_14560 1220 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence416 1241 288 gene locus_tag LOCUS_14570 1241 288 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_14570 <1978 1222 gene locus_tag LOCUS_14580 <1978 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939731.1:peptide ABC transporter permease >Feature sequence417 824 36 gene locus_tag LOCUS_14590 824 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1725 832 gene locus_tag LOCUS_14600 1725 832 CDS product putative dTDP-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704341.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence418 <1963 98 gene locus_tag LOCUS_14610 <1963 98 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028453.1:penicillin-binding protein 2 >Feature sequence419 <1 768 gene locus_tag LOCUS_14620 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9Z564:D-3-phosphoglycerate dehydrogenase <1955 856 gene locus_tag LOCUS_14630 <1955 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803809.1:HNH endonuclease >Feature sequence420 74 490 gene locus_tag LOCUS_14640 74 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 556 1833 gene locus_tag LOCUS_14650 556 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence421 <1 911 gene locus_tag LOCUS_14660 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815191.1:replicative DNA helicase 1602 943 gene locus_tag LOCUS_14670 gene nucS 1602 943 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1Z0 protein_id gnl|my_center|LOCUS_14670 1647 1901 gene locus_tag LOCUS_14680 1647 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence422 621 22 gene locus_tag LOCUS_14690 621 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1865 621 gene locus_tag LOCUS_14700 gene obg 1865 621 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817U6 protein_id gnl|my_center|LOCUS_14700 >Feature sequence423 <1 1518 gene locus_tag LOCUS_14710 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72CD8:proline--tRNA ligase >Feature sequence424 1703 1098 gene locus_tag LOCUS_14720 1703 1098 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence425 654 79 gene locus_tag LOCUS_14730 654 79 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 protein_id gnl|my_center|LOCUS_14730 823 1482 gene locus_tag LOCUS_14740 823 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence426 1005 277 gene locus_tag LOCUS_14750 1005 277 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC7 protein_id gnl|my_center|LOCUS_14750 <1929 1002 gene locus_tag LOCUS_14760 <1929 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407477.1:spermidine/putrescine ABC transporter ATP-binding protein >Feature sequence427 287 1357 gene locus_tag LOCUS_14770 gene disA 287 1357 CDS product DNA integrity scanning protein DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8L6 protein_id gnl|my_center|LOCUS_14770 >Feature sequence428 >Feature sequence429 <1 1209 gene locus_tag LOCUS_14780 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHS8:tyrosine--tRNA ligase 1446 1231 gene locus_tag LOCUS_14790 1446 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence430 <1912 87 gene locus_tag LOCUS_14800 <1912 87 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P96218:glutamate synthase [NADPH] large chain >Feature sequence431 >Feature sequence432 69 1106 gene locus_tag LOCUS_14810 gene argC 69 1106 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_14810 >Feature sequence433 <1 502 gene locus_tag LOCUS_14820 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976188.1:rod shape-determining protein 522 1367 gene locus_tag LOCUS_14830 gene mreC 522 1367 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG0 protein_id gnl|my_center|LOCUS_14830 1373 1885 gene locus_tag LOCUS_14840 1373 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence434 778 1650 gene locus_tag LOCUS_14850 778 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence435 >Feature sequence436 1276 260 gene locus_tag LOCUS_14860 1276 260 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_14860 <1898 1269 gene locus_tag LOCUS_14870 <1898 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029751.1:oxidoreductase >Feature sequence437 669 1196 gene locus_tag LOCUS_14880 669 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence438 >Feature sequence439 <1 1239 gene locus_tag LOCUS_14890 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence440 >Feature sequence441 224 1492 gene locus_tag LOCUS_14900 224 1492 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803809.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence442 225 1310 gene locus_tag LOCUS_14910 225 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1353 1676 gene locus_tag LOCUS_14920 1353 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence443 959 1735 gene locus_tag LOCUS_14930 959 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence444 1252 473 gene locus_tag LOCUS_14940 1252 473 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531889.1 protein_id gnl|my_center|LOCUS_14940 <1847 1257 gene locus_tag LOCUS_14950 <1847 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728080.1:dioxygenase >Feature sequence445 685 485 gene locus_tag LOCUS_14960 685 485 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_14960 <1833 685 gene locus_tag LOCUS_14970 <1833 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897264.1:cytochrome P450 >Feature sequence446 <1 1575 gene locus_tag LOCUS_14980 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027934.1:dehydrogenase >Feature sequence447 1091 1017 gene locus_tag LOCUS_t00250 1091 1017 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence448 <1 889 gene locus_tag LOCUS_14990 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK05:riboflavin biosynthesis protein RibBA 890 1372 gene locus_tag LOCUS_15000 gene ribH 890 1372 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61723 protein_id gnl|my_center|LOCUS_15000 >Feature sequence449 <1 675 gene locus_tag LOCUS_15010 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481647.1:long-chain-fatty-acid--CoA ligase 695 1315 gene locus_tag LOCUS_15020 695 1315 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728249.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence450 178 672 gene locus_tag LOCUS_15030 178 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 775 1602 gene locus_tag LOCUS_15040 gene rbsK 775 1602 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_15040 >Feature sequence451 946 788 gene locus_tag LOCUS_15050 946 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1111 1037 gene locus_tag LOCUS_t00260 1111 1037 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1590 1165 gene locus_tag LOCUS_15060 1590 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence452 >Feature sequence453 1269 772 gene locus_tag LOCUS_15070 gene bar 1269 772 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_15070 1320 1393 gene locus_tag LOCUS_t00270 1320 1393 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1430 1504 gene locus_tag LOCUS_t00280 1430 1504 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence454 >Feature sequence455 545 790 gene locus_tag LOCUS_15080 545 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1318 935 gene locus_tag LOCUS_15090 1318 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1437 1315 gene locus_tag LOCUS_15100 1437 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1701 1628 gene locus_tag LOCUS_t00290 1701 1628 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence456 922 182 gene locus_tag LOCUS_15110 922 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1346 915 gene locus_tag LOCUS_15120 1346 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence457 1720 119 gene locus_tag LOCUS_15130 1720 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence458 115 1224 gene locus_tag LOCUS_15140 gene pilT-1 115 1224 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence459 <1 515 gene locus_tag LOCUS_15150 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030361.1:iron ABC transporter permease 512 1618 gene locus_tag LOCUS_15160 512 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence460 55 1464 gene locus_tag LOCUS_15170 55 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence461 <1 1415 gene locus_tag LOCUS_15180 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009932001.1:acyltransferase >Feature sequence462 593 1135 gene locus_tag LOCUS_15190 593 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence463 84 1121 gene locus_tag LOCUS_15200 84 1121 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence464 513 148 gene locus_tag LOCUS_15210 513 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 586 1371 gene locus_tag LOCUS_15220 586 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence465 1307 411 gene locus_tag LOCUS_15230 1307 411 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_15230 1671 1309 gene locus_tag LOCUS_15240 1671 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence466 <1 1711 gene locus_tag LOCUS_15250 <1 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AK84:glycine dehydrogenase (decarboxylating) >Feature sequence467 <1753 1036 gene locus_tag LOCUS_15260 <1753 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925698.1:glycosyl transferase >Feature sequence468 1447 743 gene locus_tag LOCUS_15270 1447 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence469 28 1464 gene locus_tag LOCUS_15280 gene betB 28 1464 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086557.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence470 1311 964 gene locus_tag LOCUS_15290 1311 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence471 <1718 777 gene locus_tag LOCUS_15300 <1718 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257610.1:ABC transporter >Feature sequence472 <1 646 gene locus_tag LOCUS_15310 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NSA0:DNA helicase 1197 730 gene locus_tag LOCUS_15320 1197 730 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence473 204 4 gene locus_tag LOCUS_15330 204 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 268 936 gene locus_tag LOCUS_15340 gene rnhB 268 936 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_15340 1685 1008 gene locus_tag LOCUS_15350 1685 1008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence474 <1 1080 gene locus_tag LOCUS_15360 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402917.1:acyl-CoA synthetase >Feature sequence475 >Feature sequence476 315 1409 gene locus_tag LOCUS_15370 315 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence477 <1 1259 gene locus_tag LOCUS_15380 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WK91:lipoyl synthase >Feature sequence478 <1690 451 gene locus_tag LOCUS_15390 <1690 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q03B98:nuclease SbcCD subunit C >Feature sequence479 <1 1128 gene locus_tag LOCUS_15400 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144199.1:ATPase >Feature sequence480 630 1436 gene locus_tag LOCUS_15410 630 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence481 614 123 gene locus_tag LOCUS_15420 614 123 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_15420 <1681 701 gene locus_tag LOCUS_15430 <1681 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903488.1:general stress protein >Feature sequence482 <1 558 gene locus_tag LOCUS_15440 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RV0:glutamate 5-kinase >Feature sequence483 <1 629 gene locus_tag LOCUS_15450 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230190.1:ABC transporter permease >Feature sequence484 1063 590 gene locus_tag LOCUS_15460 1063 590 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF2 protein_id gnl|my_center|LOCUS_15460 >Feature sequence485 >Feature sequence486 865 1296 gene locus_tag LOCUS_15470 865 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence487 1454 717 gene locus_tag LOCUS_15480 1454 717 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence488 <1643 146 gene locus_tag LOCUS_15490 <1643 146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257530.1:ABC transporter >Feature sequence489 1091 282 gene locus_tag LOCUS_15500 1091 282 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence490 <1635 497 gene locus_tag LOCUS_15510 <1635 497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932477.1:nodulation protein NfeD >Feature sequence491 <1 873 gene locus_tag LOCUS_15520 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803809.1:HNH endonuclease >Feature sequence492 <1621 488 gene locus_tag LOCUS_15530 <1621 488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257610.1:ABC transporter >Feature sequence493 >Feature sequence494 <1 618 gene locus_tag LOCUS_15540 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R4C1:phosphate transport system permease protein PstA 615 1493 gene locus_tag LOCUS_15550 gene pstB 615 1493 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU7 protein_id gnl|my_center|LOCUS_15550 >Feature sequence495 1078 791 gene locus_tag LOCUS_15560 gene whiB1 1078 791 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P5R0 protein_id gnl|my_center|LOCUS_15560 >Feature sequence496 837 181 gene locus_tag LOCUS_15570 837 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_15570 <1596 972 gene locus_tag LOCUS_15580 <1596 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726834.1:aldehyde dehydrogenase >Feature sequence497 977 783 gene locus_tag LOCUS_15590 gene pup 977 783 CDS product prokaryotic ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBE0 protein_id gnl|my_center|LOCUS_15590 <1595 1007 gene locus_tag LOCUS_15600 <1595 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977179.1:proteasome accessory factor PafA2 >Feature sequence498 <1 523 gene locus_tag LOCUS_15610 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DEV6:beta-xylanase 1260 661 gene locus_tag LOCUS_15620 1260 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence499 <1 1007 gene locus_tag LOCUS_15630 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383451.1:alanine racemase >Feature sequence500 1248 196 gene locus_tag LOCUS_15640 1248 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence501 239 164 gene locus_tag LOCUS_t00300 239 164 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 394 1158 gene locus_tag LOCUS_15650 394 1158 CDS product enoyl CoA dehydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence502 <1 1476 gene locus_tag LOCUS_15660 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU03:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence503 >Feature sequence504 190 399 gene locus_tag LOCUS_15670 190 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1421 414 gene locus_tag LOCUS_15680 1421 414 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence505 425 1276 gene locus_tag LOCUS_15690 425 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence506 236 1405 gene locus_tag LOCUS_15700 236 1405 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701280.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence507 <1532 895 gene locus_tag LOCUS_15710 <1532 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938011.1:magnesium chelatase >Feature sequence508 4 414 gene locus_tag LOCUS_15720 4 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence509 <1 927 gene locus_tag LOCUS_15730 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878369.1:alkyldihydroxyacetonephosphate synthase >Feature sequence510 153 1388 gene locus_tag LOCUS_15740 153 1388 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence511 1333 221 gene locus_tag LOCUS_15750 1333 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_15750