>Feature sequence001 1277 402 gene locus_tag LOCUS_00010 1277 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 protein_id gnl|my_center|LOCUS_00010 3270 1306 gene locus_tag LOCUS_00020 3270 1306 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555312.1 protein_id gnl|my_center|LOCUS_00020 4661 3357 gene locus_tag LOCUS_00030 4661 3357 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCK6 protein_id gnl|my_center|LOCUS_00030 6149 4725 gene locus_tag LOCUS_00040 6149 4725 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 protein_id gnl|my_center|LOCUS_00040 6893 6153 gene locus_tag LOCUS_00050 6893 6153 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_00050 7138 8892 gene locus_tag LOCUS_00060 7138 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_00060 8924 9166 gene locus_tag LOCUS_00070 8924 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9219 9491 gene locus_tag LOCUS_00080 9219 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9502 10341 gene locus_tag LOCUS_00090 9502 10341 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_00090 10360 11547 gene locus_tag LOCUS_00100 gene metC 10360 11547 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_00100 12584 11526 gene locus_tag LOCUS_00110 12584 11526 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 protein_id gnl|my_center|LOCUS_00110 14205 12682 gene locus_tag LOCUS_00120 14205 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14523 15329 gene locus_tag LOCUS_00130 14523 15329 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_00130 15458 16378 gene locus_tag LOCUS_00140 15458 16378 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4C3 protein_id gnl|my_center|LOCUS_00140 16375 17130 gene locus_tag LOCUS_00150 16375 17130 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972637.1 protein_id gnl|my_center|LOCUS_00150 17235 18521 gene locus_tag LOCUS_00160 gene mdeA 17235 18521 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313410.1 protein_id gnl|my_center|LOCUS_00160 18662 20059 gene locus_tag LOCUS_00170 gene ahcY 18662 20059 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ7 protein_id gnl|my_center|LOCUS_00170 20237 22711 gene locus_tag LOCUS_00180 20237 22711 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_00180 22920 22729 gene locus_tag LOCUS_00190 22920 22729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22861 23163 gene locus_tag LOCUS_00200 22861 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 23148 24173 gene locus_tag LOCUS_00210 23148 24173 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_00210 24170 24925 gene locus_tag LOCUS_00220 24170 24925 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_00220 24918 27794 gene locus_tag LOCUS_00230 24918 27794 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_00230 27809 31132 gene locus_tag LOCUS_00240 27809 31132 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_00240 31253 31576 gene locus_tag LOCUS_00250 31253 31576 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_00250 31675 32199 gene locus_tag LOCUS_00260 31675 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32654 34207 gene locus_tag LOCUS_00270 32654 34207 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_00270 34204 35442 gene locus_tag LOCUS_00280 34204 35442 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_00280 35667 36305 gene locus_tag LOCUS_00290 35667 36305 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00290 36449 38047 gene locus_tag LOCUS_00300 36449 38047 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_00300 37086 36998 gene locus_tag LOCUS_t00010 37086 36998 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38075 38989 gene locus_tag LOCUS_00310 38075 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39009 40664 gene locus_tag LOCUS_00320 39009 40664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40937 42019 gene locus_tag LOCUS_00330 40937 42019 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_00330 42016 42867 gene locus_tag LOCUS_00340 42016 42867 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_00340 42854 43912 gene locus_tag LOCUS_00350 42854 43912 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_00350 43912 45156 gene locus_tag LOCUS_00360 43912 45156 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_00360 45153 46751 gene locus_tag LOCUS_00370 45153 46751 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_00370 46753 48678 gene locus_tag LOCUS_00380 46753 48678 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_00380 48675 49448 gene locus_tag LOCUS_00390 48675 49448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49687 49445 gene locus_tag LOCUS_00400 49687 49445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50763 50155 gene locus_tag LOCUS_00410 50763 50155 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_00410 50937 51125 gene locus_tag LOCUS_00420 50937 51125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52340 51051 gene locus_tag LOCUS_00430 52340 51051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54373 52337 gene locus_tag LOCUS_00440 54373 52337 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_00440 55077 54424 gene locus_tag LOCUS_00450 55077 54424 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_00450 56372 55074 gene locus_tag LOCUS_00460 56372 55074 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_00460 57503 56418 gene locus_tag LOCUS_00470 57503 56418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58770 57661 gene locus_tag LOCUS_00480 58770 57661 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_00480 60371 58767 gene locus_tag LOCUS_00490 60371 58767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 61022 60444 gene locus_tag LOCUS_00500 gene regA 61022 60444 CDS product photosynthetic apparatus regulatory protein RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53228 protein_id gnl|my_center|LOCUS_00500 62361 61039 gene locus_tag LOCUS_00510 62361 61039 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709892.1 protein_id gnl|my_center|LOCUS_00510 62972 62361 gene locus_tag LOCUS_00520 62972 62361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63076 63615 gene locus_tag LOCUS_00530 63076 63615 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_00530 63612 64049 gene locus_tag LOCUS_00540 63612 64049 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_00540 64099 64761 gene locus_tag LOCUS_00550 64099 64761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_00550 66696 64738 gene locus_tag LOCUS_00560 gene pbpC 66696 64738 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_00560 66885 67616 gene locus_tag LOCUS_00570 66885 67616 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABP2 protein_id gnl|my_center|LOCUS_00570 68111 67626 gene locus_tag LOCUS_00580 gene smpB 68111 67626 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH74 protein_id gnl|my_center|LOCUS_00580 68968 68132 gene locus_tag LOCUS_00590 gene dapA 68968 68132 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG9 protein_id gnl|my_center|LOCUS_00590 69051 71099 gene locus_tag LOCUS_00600 69051 71099 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_00600 71096 71638 gene locus_tag LOCUS_00610 gene greB 71096 71638 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_00610 71705 72097 gene locus_tag LOCUS_00620 71705 72097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_00620 74452 72233 gene locus_tag LOCUS_00630 gene pnp 74452 72233 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB3 protein_id gnl|my_center|LOCUS_00630 74945 74676 gene locus_tag LOCUS_00640 gene rpsO 74945 74676 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_00640 75883 74978 gene locus_tag LOCUS_00650 gene truB 75883 74978 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB1 protein_id gnl|my_center|LOCUS_00650 76561 76046 gene locus_tag LOCUS_00660 76561 76046 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918577.1 protein_id gnl|my_center|LOCUS_00660 76995 76591 gene locus_tag LOCUS_00670 gene rbfA 76995 76591 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 protein_id gnl|my_center|LOCUS_00670 79720 77018 gene locus_tag LOCUS_00680 79720 77018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80402 79725 gene locus_tag LOCUS_00690 80402 79725 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_00690 81938 80424 gene locus_tag LOCUS_00700 gene nusA 81938 80424 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_00700 82530 81943 gene locus_tag LOCUS_00710 gene rimP 82530 81943 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 protein_id gnl|my_center|LOCUS_00710 83630 82674 gene locus_tag LOCUS_00720 83630 82674 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PT3 protein_id gnl|my_center|LOCUS_00720 84460 83687 gene locus_tag LOCUS_00730 gene modA 84460 83687 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038306.1 protein_id gnl|my_center|LOCUS_00730 85528 84476 gene locus_tag LOCUS_00740 85528 84476 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59650 protein_id gnl|my_center|LOCUS_00740 86879 85692 gene locus_tag LOCUS_00750 86879 85692 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_00750 87182 88177 gene locus_tag LOCUS_00760 87182 88177 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_00760 88331 90175 gene locus_tag LOCUS_00770 88331 90175 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338624.1 protein_id gnl|my_center|LOCUS_00770 90175 90783 gene locus_tag LOCUS_00780 90175 90783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 90904 91368 gene locus_tag LOCUS_00790 90904 91368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 91518 92528 gene locus_tag LOCUS_00800 91518 92528 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 protein_id gnl|my_center|LOCUS_00800 92525 93319 gene locus_tag LOCUS_00810 92525 93319 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_00810 93316 95307 gene locus_tag LOCUS_00820 93316 95307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 97698 95608 gene locus_tag LOCUS_00830 gene ligA 97698 95608 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEL9 protein_id gnl|my_center|LOCUS_00830 99359 97698 gene locus_tag LOCUS_00840 gene recN 99359 97698 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FV6 protein_id gnl|my_center|LOCUS_00840 100226 99363 gene locus_tag LOCUS_00850 gene bamD 100226 99363 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_00850 100298 101473 gene locus_tag LOCUS_00860 100298 101473 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_00860 102496 101444 gene locus_tag LOCUS_00870 102496 101444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_00870 104282 102807 gene locus_tag LOCUS_00880 gene ftsZ 104282 102807 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H080 protein_id gnl|my_center|LOCUS_00880 105674 104361 gene locus_tag LOCUS_00890 gene ftsA 105674 104361 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_00890 106570 105671 gene locus_tag LOCUS_00900 106570 105671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 108411 106567 gene locus_tag LOCUS_00910 108411 106567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 109829 108408 gene locus_tag LOCUS_00920 gene murC 109829 108408 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 protein_id gnl|my_center|LOCUS_00920 110956 109826 gene locus_tag LOCUS_00930 gene murG 110956 109826 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_00930 112122 110953 gene locus_tag LOCUS_00940 112122 110953 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_00940 113477 112119 gene locus_tag LOCUS_00950 gene murD 113477 112119 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H096 protein_id gnl|my_center|LOCUS_00950 114573 113482 gene locus_tag LOCUS_00960 gene mraY 114573 113482 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_00960 115988 114567 gene locus_tag LOCUS_00970 gene murF 115988 114567 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K8 protein_id gnl|my_center|LOCUS_00970 117415 115985 gene locus_tag LOCUS_00980 gene murE 117415 115985 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_00980 119235 117412 gene locus_tag LOCUS_00990 119235 117412 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_00990 119750 119232 gene locus_tag LOCUS_01000 119750 119232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 120697 119747 gene locus_tag LOCUS_01010 gene rsmH 120697 119747 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_01010 121149 120694 gene locus_tag LOCUS_01020 121149 120694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 122207 121443 gene locus_tag LOCUS_01030 122207 121443 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 protein_id gnl|my_center|LOCUS_01030 122255 123586 gene locus_tag LOCUS_01040 gene pyrC 122255 123586 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 protein_id gnl|my_center|LOCUS_01040 123973 123668 gene locus_tag LOCUS_01050 123973 123668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 124041 124700 gene locus_tag LOCUS_01060 124041 124700 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887248.1 protein_id gnl|my_center|LOCUS_01060 124771 125406 gene locus_tag LOCUS_01070 124771 125406 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921299.1 protein_id gnl|my_center|LOCUS_01070 125517 128225 gene locus_tag LOCUS_01080 125517 128225 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_01080 128245 128694 gene locus_tag LOCUS_01090 gene cheW 128245 128694 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_01090 128761 129126 gene locus_tag LOCUS_01100 128761 129126 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 protein_id gnl|my_center|LOCUS_01100 129179 130378 gene locus_tag LOCUS_01110 gene cheB1 129179 130378 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_01110 130375 131217 gene locus_tag LOCUS_01120 130375 131217 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_01120 131279 132004 gene locus_tag LOCUS_01130 131279 132004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 132001 132894 gene locus_tag LOCUS_01140 132001 132894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 protein_id gnl|my_center|LOCUS_01140 132891 133601 gene locus_tag LOCUS_01150 132891 133601 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_01150 134405 133665 gene locus_tag LOCUS_01160 134405 133665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709723.1 protein_id gnl|my_center|LOCUS_01160 137134 134630 gene locus_tag LOCUS_01170 137134 134630 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 protein_id gnl|my_center|LOCUS_01170 137826 137134 gene locus_tag LOCUS_01180 137826 137134 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 protein_id gnl|my_center|LOCUS_01180 137889 138545 gene locus_tag LOCUS_01190 137889 138545 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 protein_id gnl|my_center|LOCUS_01190 138520 139092 gene locus_tag LOCUS_01200 138520 139092 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H57 protein_id gnl|my_center|LOCUS_01200 141169 139058 gene locus_tag LOCUS_01210 141169 139058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 142679 141282 gene locus_tag LOCUS_01220 gene pleD 142679 141282 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_01220 143063 142701 gene locus_tag LOCUS_01230 143063 142701 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 protein_id gnl|my_center|LOCUS_01230 143339 144013 gene locus_tag LOCUS_01240 143339 144013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 144159 144626 gene locus_tag LOCUS_01250 144159 144626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_01250 144685 145530 gene locus_tag LOCUS_01260 144685 145530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 145547 146677 gene locus_tag LOCUS_01270 145547 146677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383310.1 protein_id gnl|my_center|LOCUS_01270 148279 146903 gene locus_tag LOCUS_01280 148279 146903 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_01280 148769 148326 gene locus_tag LOCUS_01290 148769 148326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 149587 148766 gene locus_tag LOCUS_01300 149587 148766 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_01300 149737 150597 gene locus_tag LOCUS_01310 gene panC 149737 150597 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFK5 protein_id gnl|my_center|LOCUS_01310 150767 151816 gene locus_tag LOCUS_01320 150767 151816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 152100 152372 gene locus_tag LOCUS_01330 152100 152372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440874.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence002 642 211 gene locus_tag LOCUS_01340 642 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 1303 662 gene locus_tag LOCUS_01350 1303 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 1614 1300 gene locus_tag LOCUS_01360 1614 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2639 1617 gene locus_tag LOCUS_01370 2639 1617 CDS product minor capsid protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_01370 3124 2735 gene locus_tag LOCUS_01380 3124 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339610.1 protein_id gnl|my_center|LOCUS_01380 4506 3136 gene locus_tag LOCUS_01390 4506 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4855 4517 gene locus_tag LOCUS_01400 4855 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6338 4866 gene locus_tag LOCUS_01410 6338 4866 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_01410 6554 6342 gene locus_tag LOCUS_01420 6554 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723266.1 protein_id gnl|my_center|LOCUS_01420 8601 6565 gene locus_tag LOCUS_01430 8601 6565 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_01430 9109 8549 gene locus_tag LOCUS_01440 9109 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 9224 9448 gene locus_tag LOCUS_01450 9224 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9547 10092 gene locus_tag LOCUS_01460 9547 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10369 10145 gene locus_tag LOCUS_01470 10369 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11691 10366 gene locus_tag LOCUS_01480 11691 10366 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_01480 12640 12260 gene locus_tag LOCUS_01490 12640 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 12842 12633 gene locus_tag LOCUS_01500 12842 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 13366 12839 gene locus_tag LOCUS_01510 13366 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 16854 13363 gene locus_tag LOCUS_01520 16854 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 18055 17345 gene locus_tag LOCUS_01530 18055 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 18444 18899 gene locus_tag LOCUS_01540 18444 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_01540 18896 20206 gene locus_tag LOCUS_01550 18896 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 20203 20589 gene locus_tag LOCUS_01560 20203 20589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 20672 21265 gene locus_tag LOCUS_01570 20672 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 21262 22779 gene locus_tag LOCUS_01580 gene hsdM 21262 22779 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038026.1 protein_id gnl|my_center|LOCUS_01580 22772 23959 gene locus_tag LOCUS_01590 22772 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 23952 24683 gene locus_tag LOCUS_01600 23952 24683 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039050.1 protein_id gnl|my_center|LOCUS_01600 24826 28041 gene locus_tag LOCUS_01610 24826 28041 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_01610 28038 28754 gene locus_tag LOCUS_01620 28038 28754 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_01620 29110 29021 gene locus_tag LOCUS_t00020 29110 29021 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29192 30334 gene locus_tag LOCUS_01630 29192 30334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 30321 31034 gene locus_tag LOCUS_01640 30321 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 31063 32262 gene locus_tag LOCUS_01650 31063 32262 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_01650 32265 32873 gene locus_tag LOCUS_01660 gene tmk 32265 32873 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP2 protein_id gnl|my_center|LOCUS_01660 32870 33835 gene locus_tag LOCUS_01670 32870 33835 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 protein_id gnl|my_center|LOCUS_01670 33832 35379 gene locus_tag LOCUS_01680 gene metG 33832 35379 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LM7 protein_id gnl|my_center|LOCUS_01680 35376 36158 gene locus_tag LOCUS_01690 35376 36158 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_01690 36155 36919 gene locus_tag LOCUS_01700 36155 36919 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_01700 36916 37524 gene locus_tag LOCUS_01710 36916 37524 CDS product aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314021.1 protein_id gnl|my_center|LOCUS_01710 38812 37604 gene locus_tag LOCUS_01720 38812 37604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 39005 40369 gene locus_tag LOCUS_01730 39005 40369 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 protein_id gnl|my_center|LOCUS_01730 40554 41921 gene locus_tag LOCUS_01740 gene suc1 40554 41921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_01740 42896 41934 gene locus_tag LOCUS_01750 42896 41934 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919021.1 protein_id gnl|my_center|LOCUS_01750 43381 44157 gene locus_tag LOCUS_01760 43381 44157 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_01760 44950 44162 gene locus_tag LOCUS_01770 gene suhB 44950 44162 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973295.1 protein_id gnl|my_center|LOCUS_01770 45451 44960 gene locus_tag LOCUS_01780 45451 44960 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918290.1 protein_id gnl|my_center|LOCUS_01780 46021 45458 gene locus_tag LOCUS_01790 gene efp 46021 45458 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_01790 46129 46794 gene locus_tag LOCUS_01800 46129 46794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 47656 46745 gene locus_tag LOCUS_01810 47656 46745 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537711.1 protein_id gnl|my_center|LOCUS_01810 47798 48094 gene locus_tag LOCUS_01820 47798 48094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 48737 48084 gene locus_tag LOCUS_01830 gene thiE 48737 48084 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD41 protein_id gnl|my_center|LOCUS_01830 49666 48740 gene locus_tag LOCUS_01840 gene fbaB 49666 48740 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_01840 50447 49788 gene locus_tag LOCUS_01850 50447 49788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 51636 50440 gene locus_tag LOCUS_01860 gene pgk 51636 50440 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCV3 protein_id gnl|my_center|LOCUS_01860 52651 51647 gene locus_tag LOCUS_01870 52651 51647 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ0 protein_id gnl|my_center|LOCUS_01870 52883 53182 gene locus_tag LOCUS_01880 52883 53182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 53185 53490 gene locus_tag LOCUS_01890 53185 53490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 53676 54233 gene locus_tag LOCUS_01900 53676 54233 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG0 protein_id gnl|my_center|LOCUS_01900 54230 54646 gene locus_tag LOCUS_01910 54230 54646 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_01910 54643 54864 gene locus_tag LOCUS_01920 54643 54864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 54857 55165 gene locus_tag LOCUS_01930 54857 55165 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 protein_id gnl|my_center|LOCUS_01930 55388 56614 gene locus_tag LOCUS_01940 55388 56614 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_01940 59358 56665 gene locus_tag LOCUS_01950 gene alaS 59358 56665 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27866 protein_id gnl|my_center|LOCUS_01950 60513 59428 gene locus_tag LOCUS_01960 gene recA 60513 59428 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_01960 63116 60633 gene locus_tag LOCUS_01970 63116 60633 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_01970 64231 63149 gene locus_tag LOCUS_01980 gene flhB 64231 63149 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918961.1 protein_id gnl|my_center|LOCUS_01980 64993 64235 gene locus_tag LOCUS_01990 gene fliR 64993 64235 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 protein_id gnl|my_center|LOCUS_01990 65258 64995 gene locus_tag LOCUS_02000 gene fliQ 65258 64995 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_02000 65677 65354 gene locus_tag LOCUS_02010 gene fliE 65677 65354 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8E1 protein_id gnl|my_center|LOCUS_02010 66104 65691 gene locus_tag LOCUS_02020 66104 65691 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH3 protein_id gnl|my_center|LOCUS_02020 66538 66107 gene locus_tag LOCUS_02030 66538 66107 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH2 protein_id gnl|my_center|LOCUS_02030 66647 66934 gene locus_tag LOCUS_02040 66647 66934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390454.1 protein_id gnl|my_center|LOCUS_02040 66931 67242 gene locus_tag LOCUS_02050 66931 67242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 67436 68122 gene locus_tag LOCUS_02060 gene fliP 67436 68122 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG8 protein_id gnl|my_center|LOCUS_02060 71225 68268 gene locus_tag LOCUS_02070 71225 68268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 71734 71222 gene locus_tag LOCUS_02080 71734 71222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 72199 71738 gene locus_tag LOCUS_02090 72199 71738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 72862 72215 gene locus_tag LOCUS_02100 72862 72215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 73644 72964 gene locus_tag LOCUS_02110 73644 72964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 74063 73644 gene locus_tag LOCUS_02120 74063 73644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 75151 74063 gene locus_tag LOCUS_02130 75151 74063 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF8 protein_id gnl|my_center|LOCUS_02130 75771 75148 gene locus_tag LOCUS_02140 75771 75148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 76056 76796 gene locus_tag LOCUS_02150 76056 76796 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF6 protein_id gnl|my_center|LOCUS_02150 >Feature sequence003 1712 1263 gene locus_tag LOCUS_02160 1712 1263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_02160 2734 1715 gene locus_tag LOCUS_02170 gene hemE 2734 1715 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SK1 protein_id gnl|my_center|LOCUS_02170 3075 2776 gene locus_tag LOCUS_02180 3075 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3129 3677 gene locus_tag LOCUS_02190 3129 3677 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU7 protein_id gnl|my_center|LOCUS_02190 3674 4513 gene locus_tag LOCUS_02200 gene aroE 3674 4513 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_02200 4510 5124 gene locus_tag LOCUS_02210 gene coaE 4510 5124 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU5 protein_id gnl|my_center|LOCUS_02210 5117 5803 gene locus_tag LOCUS_02220 5117 5803 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_02220 5800 6114 gene locus_tag LOCUS_02230 gene hisE 5800 6114 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60536 protein_id gnl|my_center|LOCUS_02230 6123 6506 gene locus_tag LOCUS_02240 6123 6506 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_02240 6697 8100 gene locus_tag LOCUS_02250 gene yhdG 6697 8100 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_02250 9346 8180 gene locus_tag LOCUS_02260 9346 8180 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_02260 9477 11744 gene locus_tag LOCUS_02270 9477 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11741 12382 gene locus_tag LOCUS_02280 11741 12382 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ02 protein_id gnl|my_center|LOCUS_02280 12919 13707 gene locus_tag LOCUS_02290 gene xthA3 12919 13707 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_02290 13704 14780 gene locus_tag LOCUS_02300 13704 14780 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_02300 15479 14796 gene locus_tag LOCUS_02310 15479 14796 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_02310 15504 16055 gene locus_tag LOCUS_02320 15504 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 16711 16028 gene locus_tag LOCUS_02330 16711 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 16936 17358 gene locus_tag LOCUS_02340 16936 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 17362 19902 gene locus_tag LOCUS_02350 gene leuS 17362 19902 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBV2 protein_id gnl|my_center|LOCUS_02350 19899 20381 gene locus_tag LOCUS_02360 19899 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 20378 21394 gene locus_tag LOCUS_02370 gene holA 20378 21394 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709818.1 protein_id gnl|my_center|LOCUS_02370 22346 21438 gene locus_tag LOCUS_02380 22346 21438 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_02380 23131 22346 gene locus_tag LOCUS_02390 23131 22346 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_02390 23778 23128 gene locus_tag LOCUS_02400 gene rsmG 23778 23128 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_02400 25629 23779 gene locus_tag LOCUS_02410 gene mnmG 25629 23779 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 protein_id gnl|my_center|LOCUS_02410 27003 25696 gene locus_tag LOCUS_02420 gene mnmE 27003 25696 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 protein_id gnl|my_center|LOCUS_02420 27245 27003 gene locus_tag LOCUS_02430 27245 27003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_02430 27346 27804 gene locus_tag LOCUS_02440 27346 27804 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN80 protein_id gnl|my_center|LOCUS_02440 27844 28548 gene locus_tag LOCUS_02450 27844 28548 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_02450 28530 29447 gene locus_tag LOCUS_02460 28530 29447 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_02460 29510 29680 gene locus_tag LOCUS_02470 29510 29680 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJW6 protein_id gnl|my_center|LOCUS_02470 30531 29704 gene locus_tag LOCUS_02480 30531 29704 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919071.1 protein_id gnl|my_center|LOCUS_02480 30850 32724 gene locus_tag LOCUS_02490 30850 32724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 33931 33074 gene locus_tag LOCUS_02500 33931 33074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 34189 35850 gene locus_tag LOCUS_02510 gene dnaX 34189 35850 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_02510 35847 36167 gene locus_tag LOCUS_02520 gene YbaB 35847 36167 CDS product nucleoid-associated protein YbaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZZ7 protein_id gnl|my_center|LOCUS_02520 36203 38083 gene locus_tag LOCUS_02530 gene kefB1 36203 38083 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968833.1 protein_id gnl|my_center|LOCUS_02530 38952 38065 gene locus_tag LOCUS_02540 38952 38065 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974284.1 protein_id gnl|my_center|LOCUS_02540 39130 40377 gene locus_tag LOCUS_02550 39130 40377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_02550 40423 41343 gene locus_tag LOCUS_02560 gene cysK 40423 41343 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 protein_id gnl|my_center|LOCUS_02560 41455 42411 gene locus_tag LOCUS_02570 41455 42411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638800.2 protein_id gnl|my_center|LOCUS_02570 42535 43662 gene locus_tag LOCUS_02580 42535 43662 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_02580 43803 45413 gene locus_tag LOCUS_02590 43803 45413 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 protein_id gnl|my_center|LOCUS_02590 46540 45422 gene locus_tag LOCUS_02600 46540 45422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 47416 46571 gene locus_tag LOCUS_02610 47416 46571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_02610 47925 47584 gene locus_tag LOCUS_02620 gene atpC 47925 47584 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_02620 48473 48003 gene locus_tag LOCUS_02630 48473 48003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 49956 48514 gene locus_tag LOCUS_02640 gene atpD 49956 48514 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_02640 50858 49986 gene locus_tag LOCUS_02650 gene atpG 50858 49986 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK7 protein_id gnl|my_center|LOCUS_02650 52455 50926 gene locus_tag LOCUS_02660 gene atpA 52455 50926 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL31 protein_id gnl|my_center|LOCUS_02660 53060 52491 gene locus_tag LOCUS_02670 gene atpH 53060 52491 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL30 protein_id gnl|my_center|LOCUS_02670 55433 53229 gene locus_tag LOCUS_02680 gene priA 55433 53229 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB85 protein_id gnl|my_center|LOCUS_02680 55562 56098 gene locus_tag LOCUS_02690 gene SigD 55562 56098 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087693.1 protein_id gnl|my_center|LOCUS_02690 56095 56736 gene locus_tag LOCUS_02700 56095 56736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205048.1 protein_id gnl|my_center|LOCUS_02700 57091 57447 gene locus_tag LOCUS_02710 gene rnpA 57091 57447 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 protein_id gnl|my_center|LOCUS_02710 57713 59389 gene locus_tag LOCUS_02720 gene yidC 57713 59389 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_02720 59391 60041 gene locus_tag LOCUS_02730 gene engB 59391 60041 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY4 protein_id gnl|my_center|LOCUS_02730 60578 60048 gene locus_tag LOCUS_02740 60578 60048 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_02740 60740 61129 gene locus_tag LOCUS_02750 60740 61129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 61302 62024 gene locus_tag LOCUS_02760 61302 62024 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083847.1 protein_id gnl|my_center|LOCUS_02760 62081 64363 gene locus_tag LOCUS_02770 gene ptsP 62081 64363 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_02770 64518 65399 gene locus_tag LOCUS_02780 64518 65399 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257722.1 protein_id gnl|my_center|LOCUS_02780 65474 66583 gene locus_tag LOCUS_02790 gene ispG 65474 66583 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9W0 protein_id gnl|my_center|LOCUS_02790 66588 67226 gene locus_tag LOCUS_02800 66588 67226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 67336 67641 gene locus_tag LOCUS_02810 gene rplU 67336 67641 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9X5 protein_id gnl|my_center|LOCUS_02810 67654 67941 gene locus_tag LOCUS_02820 gene rpmA 67654 67941 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV03 protein_id gnl|my_center|LOCUS_02820 68847 68197 gene locus_tag LOCUS_02830 68847 68197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence004 92 961 gene locus_tag LOCUS_02840 gene avhB9 92 961 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974429.1 protein_id gnl|my_center|LOCUS_02840 961 2151 gene locus_tag LOCUS_02850 961 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2190 3161 gene locus_tag LOCUS_02860 gene virB11 2190 3161 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887135.1 protein_id gnl|my_center|LOCUS_02860 3133 4968 gene locus_tag LOCUS_02870 gene virD4 3133 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037620.1 protein_id gnl|my_center|LOCUS_02870 4961 5746 gene locus_tag LOCUS_02880 4961 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6198 5788 gene locus_tag LOCUS_02890 6198 5788 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_02890 6268 6912 gene locus_tag LOCUS_02900 6268 6912 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_02900 6909 7382 gene locus_tag LOCUS_02910 6909 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679517.1 protein_id gnl|my_center|LOCUS_02910 7379 7735 gene locus_tag LOCUS_02920 7379 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7772 8110 gene locus_tag LOCUS_02930 7772 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 8171 9379 gene locus_tag LOCUS_02940 8171 9379 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_02940 9391 10569 gene locus_tag LOCUS_02950 9391 10569 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_02950 10571 13825 gene locus_tag LOCUS_02960 10571 13825 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 protein_id gnl|my_center|LOCUS_02960 13838 14764 gene locus_tag LOCUS_02970 13838 14764 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_02970 15885 14830 gene locus_tag LOCUS_02980 15885 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 16450 15896 gene locus_tag LOCUS_02990 16450 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 17493 16813 gene locus_tag LOCUS_03000 17493 16813 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_03000 18215 17490 gene locus_tag LOCUS_03010 18215 17490 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919380.1 protein_id gnl|my_center|LOCUS_03010 18619 18212 gene locus_tag LOCUS_03020 18619 18212 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJK4 protein_id gnl|my_center|LOCUS_03020 19134 18616 gene locus_tag LOCUS_03030 19134 18616 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888243.1 protein_id gnl|my_center|LOCUS_03030 19520 19158 gene locus_tag LOCUS_03040 19520 19158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_03040 20006 19680 gene locus_tag LOCUS_03050 20006 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082889.1 protein_id gnl|my_center|LOCUS_03050 22566 20713 gene locus_tag LOCUS_03060 22566 20713 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533280.1 protein_id gnl|my_center|LOCUS_03060 23044 22652 gene locus_tag LOCUS_03070 23044 22652 CDS product single-stranded DNA endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533281.1 protein_id gnl|my_center|LOCUS_03070 23267 23058 gene locus_tag LOCUS_03080 23267 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 24238 23264 gene locus_tag LOCUS_03090 24238 23264 CDS product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_03090 25915 28212 gene locus_tag LOCUS_03100 25915 28212 CDS product plasma membrane H+-transporting two-sector ATPase C subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003681.1 protein_id gnl|my_center|LOCUS_03100 28218 29513 gene locus_tag LOCUS_03110 28218 29513 CDS product DUF2791 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_03110 29482 31707 gene locus_tag LOCUS_03120 29482 31707 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_03120 32836 31739 gene locus_tag LOCUS_03130 32836 31739 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_03130 33104 32907 gene locus_tag LOCUS_03140 33104 32907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 34434 33139 gene locus_tag LOCUS_03150 34434 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 35672 34587 gene locus_tag LOCUS_03160 35672 34587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_03160 38342 35700 gene locus_tag LOCUS_03170 gene pepN 38342 35700 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_03170 40263 38461 gene locus_tag LOCUS_03180 40263 38461 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_03180 41107 40352 gene locus_tag LOCUS_03190 41107 40352 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225205.1 protein_id gnl|my_center|LOCUS_03190 41711 41094 gene locus_tag LOCUS_03200 41711 41094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03200 42893 41724 gene locus_tag LOCUS_03210 42893 41724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 44043 43054 gene locus_tag LOCUS_03220 44043 43054 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 protein_id gnl|my_center|LOCUS_03220 45030 44053 gene locus_tag LOCUS_03230 45030 44053 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968385.1 protein_id gnl|my_center|LOCUS_03230 46750 45041 gene locus_tag LOCUS_03240 46750 45041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 47992 46754 gene locus_tag LOCUS_03250 47992 46754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 48667 48038 gene locus_tag LOCUS_03260 48667 48038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 50221 48677 gene locus_tag LOCUS_03270 gene cpaC 50221 48677 CDS product pilus assembly protein CpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920782.1 protein_id gnl|my_center|LOCUS_03270 51255 50224 gene locus_tag LOCUS_03280 51255 50224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 51798 51292 gene locus_tag LOCUS_03290 51798 51292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 51850 52785 gene locus_tag LOCUS_03300 gene pldB 51850 52785 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 protein_id gnl|my_center|LOCUS_03300 53194 52772 gene locus_tag LOCUS_03310 gene mscL 53194 52772 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH4 protein_id gnl|my_center|LOCUS_03310 53711 53265 gene locus_tag LOCUS_03320 gene rnhA 53711 53265 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VRX8 protein_id gnl|my_center|LOCUS_03320 54658 53708 gene locus_tag LOCUS_03330 gene thrB 54658 53708 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU4 protein_id gnl|my_center|LOCUS_03330 55602 54664 gene locus_tag LOCUS_03340 gene ispH 55602 54664 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8J6 protein_id gnl|my_center|LOCUS_03340 55789 56145 gene locus_tag LOCUS_03350 55789 56145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 56264 56608 gene locus_tag LOCUS_03360 56264 56608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 56809 57378 gene locus_tag LOCUS_03370 56809 57378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 58545 57382 gene locus_tag LOCUS_03380 58545 57382 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_03380 58747 60831 gene locus_tag LOCUS_03390 58747 60831 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640014.1 protein_id gnl|my_center|LOCUS_03390 62835 60835 gene locus_tag LOCUS_03400 62835 60835 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 protein_id gnl|my_center|LOCUS_03400 63619 62828 gene locus_tag LOCUS_03410 63619 62828 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_03410 65234 63630 gene locus_tag LOCUS_03420 65234 63630 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence005 612 136 gene locus_tag LOCUS_03430 612 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2677 623 gene locus_tag LOCUS_03440 gene rpoD 2677 623 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB6 protein_id gnl|my_center|LOCUS_03440 4535 2688 gene locus_tag LOCUS_03450 4535 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5011 4544 gene locus_tag LOCUS_03460 5011 4544 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_03460 5210 6379 gene locus_tag LOCUS_03470 gene carA 5210 6379 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_03470 6376 6714 gene locus_tag LOCUS_03480 6376 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6747 9974 gene locus_tag LOCUS_03490 6747 9974 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_03490 10082 10561 gene locus_tag LOCUS_03500 gene greA 10082 10561 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4I3 protein_id gnl|my_center|LOCUS_03500 10670 12838 gene locus_tag LOCUS_03510 10670 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 13041 13721 gene locus_tag LOCUS_03520 13041 13721 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_03520 13988 13755 gene locus_tag LOCUS_03530 13988 13755 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_03530 15005 14010 gene locus_tag LOCUS_03540 15005 14010 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975705.1 protein_id gnl|my_center|LOCUS_03540 15652 15005 gene locus_tag LOCUS_03550 15652 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 16141 15674 gene locus_tag LOCUS_03560 16141 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 16335 17459 gene locus_tag LOCUS_03570 16335 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_03570 19921 17519 gene locus_tag LOCUS_03580 19921 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 20145 20492 gene locus_tag LOCUS_03590 20145 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 20604 21152 gene locus_tag LOCUS_03600 20604 21152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_03600 21145 21654 gene locus_tag LOCUS_03610 21145 21654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_03610 21657 22871 gene locus_tag LOCUS_03620 21657 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 23173 22868 gene locus_tag LOCUS_03630 23173 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 23076 25193 gene locus_tag LOCUS_03640 gene flaN 23076 25193 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 protein_id gnl|my_center|LOCUS_03640 25208 26131 gene locus_tag LOCUS_03650 25208 26131 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9R5 protein_id gnl|my_center|LOCUS_03650 26570 27694 gene locus_tag LOCUS_03660 26570 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_03660 27684 29294 gene locus_tag LOCUS_03670 27684 29294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 29395 30342 gene locus_tag LOCUS_03680 29395 30342 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_03680 30359 31285 gene locus_tag LOCUS_03690 30359 31285 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_03690 31282 32328 gene locus_tag LOCUS_03700 31282 32328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03700 32389 35010 gene locus_tag LOCUS_03710 32389 35010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03710 35082 36266 gene locus_tag LOCUS_03720 35082 36266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 37716 36220 gene locus_tag LOCUS_03730 37716 36220 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_03730 38228 37713 gene locus_tag LOCUS_03740 38228 37713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 39358 38225 gene locus_tag LOCUS_03750 39358 38225 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_03750 40119 39397 gene locus_tag LOCUS_03760 gene ate 40119 39397 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K72 protein_id gnl|my_center|LOCUS_03760 41160 40249 gene locus_tag LOCUS_03770 41160 40249 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_03770 42449 41223 gene locus_tag LOCUS_03780 42449 41223 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_03780 42540 43412 gene locus_tag LOCUS_03790 42540 43412 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_03790 45639 43396 gene locus_tag LOCUS_03800 45639 43396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089325.1 protein_id gnl|my_center|LOCUS_03800 46685 45702 gene locus_tag LOCUS_03810 46685 45702 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTA8 protein_id gnl|my_center|LOCUS_03810 46755 47267 gene locus_tag LOCUS_03820 46755 47267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 47295 48080 gene locus_tag LOCUS_03830 gene murI 47295 48080 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF2 protein_id gnl|my_center|LOCUS_03830 48251 49465 gene locus_tag LOCUS_03840 gene hemA 48251 49465 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08262 protein_id gnl|my_center|LOCUS_03840 49671 50114 gene locus_tag LOCUS_03850 49671 50114 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_03850 50153 51454 gene locus_tag LOCUS_03860 gene glyA 50153 51454 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_03860 51813 52307 gene locus_tag LOCUS_03870 gene nrdR 51813 52307 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W6 protein_id gnl|my_center|LOCUS_03870 52300 53319 gene locus_tag LOCUS_03880 52300 53319 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_03880 53329 53937 gene locus_tag LOCUS_03890 53329 53937 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_03890 54008 55297 gene locus_tag LOCUS_03900 54008 55297 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_03900 55323 55772 gene locus_tag LOCUS_03910 gene ribH1 55323 55772 CDS product 6,7-dimethyl-8-ribityllumazine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QU0 protein_id gnl|my_center|LOCUS_03910 55765 56244 gene locus_tag LOCUS_03920 gene nusB 55765 56244 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J3 protein_id gnl|my_center|LOCUS_03920 56247 57233 gene locus_tag LOCUS_03930 gene thiL 56247 57233 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K82 protein_id gnl|my_center|LOCUS_03930 57202 57753 gene locus_tag LOCUS_03940 57202 57753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence006 705 2207 gene locus_tag LOCUS_03950 705 2207 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_03950 2216 3091 gene locus_tag LOCUS_03960 2216 3091 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J9 protein_id gnl|my_center|LOCUS_03960 3208 3843 gene locus_tag LOCUS_03970 3208 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3840 4976 gene locus_tag LOCUS_03980 3840 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_03980 5040 7082 gene locus_tag LOCUS_03990 5040 7082 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_03990 8359 7190 gene locus_tag LOCUS_04000 gene wecB 8359 7190 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_04000 8978 8448 gene locus_tag LOCUS_04010 8978 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9792 9187 gene locus_tag LOCUS_04020 9792 9187 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_04020 11995 9836 gene locus_tag LOCUS_04030 11995 9836 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_04030 12150 12755 gene locus_tag LOCUS_04040 12150 12755 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 protein_id gnl|my_center|LOCUS_04040 14312 13092 gene locus_tag LOCUS_04050 14312 13092 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_04050 14419 15702 gene locus_tag LOCUS_04060 14419 15702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 15699 16850 gene locus_tag LOCUS_04070 15699 16850 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KZ0 protein_id gnl|my_center|LOCUS_04070 16968 18707 gene locus_tag LOCUS_04080 gene argS 16968 18707 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG6 protein_id gnl|my_center|LOCUS_04080 18707 19645 gene locus_tag LOCUS_04090 18707 19645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 19642 20652 gene locus_tag LOCUS_04100 19642 20652 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_04100 20649 21407 gene locus_tag LOCUS_04110 gene scpA 20649 21407 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385004.1 protein_id gnl|my_center|LOCUS_04110 21404 21985 gene locus_tag LOCUS_04120 21404 21985 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH1 protein_id gnl|my_center|LOCUS_04120 22163 22405 gene locus_tag LOCUS_04130 gene tatA 22163 22405 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEP9 protein_id gnl|my_center|LOCUS_04130 22429 22806 gene locus_tag LOCUS_04140 22429 22806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 22803 23621 gene locus_tag LOCUS_04150 gene tatC 22803 23621 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_04150 23618 24319 gene locus_tag LOCUS_04160 23618 24319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 24316 25170 gene locus_tag LOCUS_04170 24316 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 25264 25725 gene locus_tag LOCUS_04180 25264 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_04180 25753 26253 gene locus_tag LOCUS_04190 25753 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_04190 26253 27095 gene locus_tag LOCUS_04200 26253 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 27732 27115 gene locus_tag LOCUS_04210 27732 27115 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 protein_id gnl|my_center|LOCUS_04210 27921 28238 gene locus_tag LOCUS_04220 27921 28238 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887567.1 protein_id gnl|my_center|LOCUS_04220 28595 28266 gene locus_tag LOCUS_04230 28595 28266 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAH6 protein_id gnl|my_center|LOCUS_04230 28903 28667 gene locus_tag LOCUS_04240 28903 28667 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_04240 29228 28905 gene locus_tag LOCUS_04250 29228 28905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920348.1 protein_id gnl|my_center|LOCUS_04250 30060 29302 gene locus_tag LOCUS_04260 30060 29302 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709510.1 protein_id gnl|my_center|LOCUS_04260 30160 31299 gene locus_tag LOCUS_04270 30160 31299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 32665 31670 gene locus_tag LOCUS_04280 32665 31670 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_04280 32963 33352 gene locus_tag LOCUS_04290 gene sdhC 32963 33352 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531169.1 protein_id gnl|my_center|LOCUS_04290 33436 33753 gene locus_tag LOCUS_04300 33436 33753 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_04300 33796 35583 gene locus_tag LOCUS_04310 gene sdhA 33796 35583 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 protein_id gnl|my_center|LOCUS_04310 35965 36429 gene locus_tag LOCUS_04320 35965 36429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 36503 37528 gene locus_tag LOCUS_04330 gene obg 36503 37528 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_04330 37530 38657 gene locus_tag LOCUS_04340 gene proB1 37530 38657 CDS product glutamate 5-kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB3 protein_id gnl|my_center|LOCUS_04340 38654 39913 gene locus_tag LOCUS_04350 gene proA 38654 39913 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Y1 protein_id gnl|my_center|LOCUS_04350 39978 41783 gene locus_tag LOCUS_04360 39978 41783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 43213 41807 gene locus_tag LOCUS_04370 gene norM 43213 41807 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4E6 protein_id gnl|my_center|LOCUS_04370 44141 43275 gene locus_tag LOCUS_04380 44141 43275 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_04380 44930 44157 gene locus_tag LOCUS_04390 44930 44157 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918285.1 protein_id gnl|my_center|LOCUS_04390 46612 44927 gene locus_tag LOCUS_04400 46612 44927 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_04400 47942 46830 gene locus_tag LOCUS_04410 47942 46830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_04410 48610 48119 gene locus_tag LOCUS_04420 48610 48119 CDS product aromatic compound degradation protein PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224846.1 protein_id gnl|my_center|LOCUS_04420 48831 49247 gene locus_tag LOCUS_04430 48831 49247 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917970.1 protein_id gnl|my_center|LOCUS_04430 49308 51101 gene locus_tag LOCUS_04440 49308 51101 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_04440 51176 52387 gene locus_tag LOCUS_04450 51176 52387 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_04450 52460 54649 gene locus_tag LOCUS_04460 52460 54649 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_04460 54966 57575 gene locus_tag LOCUS_04470 54966 57575 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence007 205 4248 gene locus_tag LOCUS_04480 205 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4245 4484 gene locus_tag LOCUS_04490 4245 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5144 4590 gene locus_tag LOCUS_04500 5144 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6132 5146 gene locus_tag LOCUS_04510 6132 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 6626 6871 gene locus_tag LOCUS_04520 6626 6871 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK01 protein_id gnl|my_center|LOCUS_04520 6871 7269 gene locus_tag LOCUS_04530 gene vapC 6871 7269 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV54 protein_id gnl|my_center|LOCUS_04530 7978 7454 gene locus_tag LOCUS_04540 7978 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9546 7975 gene locus_tag LOCUS_04550 9546 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9834 9556 gene locus_tag LOCUS_04560 9834 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10084 9827 gene locus_tag LOCUS_04570 10084 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 10963 10223 gene locus_tag LOCUS_04580 10963 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 11845 10964 gene locus_tag LOCUS_04590 11845 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 11844 12239 gene locus_tag LOCUS_04600 11844 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12435 13862 gene locus_tag LOCUS_04610 12435 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 14129 13827 gene locus_tag LOCUS_04620 14129 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14358 14176 gene locus_tag LOCUS_04630 14358 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15702 14443 gene locus_tag LOCUS_04640 15702 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 16018 16206 gene locus_tag LOCUS_04650 16018 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 17681 16272 gene locus_tag LOCUS_04660 17681 16272 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533405.1 protein_id gnl|my_center|LOCUS_04660 18076 17678 gene locus_tag LOCUS_04670 18076 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18459 18082 gene locus_tag LOCUS_04680 18459 18082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 18603 18983 gene locus_tag LOCUS_04690 18603 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 18983 19903 gene locus_tag LOCUS_04700 18983 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 20177 20710 gene locus_tag LOCUS_04710 20177 20710 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021204.1 protein_id gnl|my_center|LOCUS_04710 20712 21008 gene locus_tag LOCUS_04720 20712 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 21932 21243 gene locus_tag LOCUS_04730 gene gpmA 21932 21243 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR0 protein_id gnl|my_center|LOCUS_04730 23808 22129 gene locus_tag LOCUS_04740 23808 22129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 protein_id gnl|my_center|LOCUS_04740 25303 23873 gene locus_tag LOCUS_04750 25303 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_04750 25696 26199 gene locus_tag LOCUS_04760 25696 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 27127 26531 gene locus_tag LOCUS_04770 27127 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 28364 27171 gene locus_tag LOCUS_04780 28364 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 29758 28364 gene locus_tag LOCUS_04790 29758 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 29870 30664 gene locus_tag LOCUS_04800 gene thyA 29870 30664 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G35 protein_id gnl|my_center|LOCUS_04800 30664 31167 gene locus_tag LOCUS_04810 gene folA 30664 31167 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 protein_id gnl|my_center|LOCUS_04810 31893 31465 gene locus_tag LOCUS_04820 31893 31465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_706888.1 protein_id gnl|my_center|LOCUS_04820 34032 31993 gene locus_tag LOCUS_04830 gene glyS 34032 31993 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S69 protein_id gnl|my_center|LOCUS_04830 34933 34034 gene locus_tag LOCUS_04840 gene glyQ 34933 34034 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_04840 36279 35128 gene locus_tag LOCUS_04850 36279 35128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 37030 36272 gene locus_tag LOCUS_04860 gene surE 37030 36272 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX52 protein_id gnl|my_center|LOCUS_04860 38355 37027 gene locus_tag LOCUS_04870 gene serS 38355 37027 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEQ2 protein_id gnl|my_center|LOCUS_04870 39831 38422 gene locus_tag LOCUS_04880 39831 38422 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_04880 41802 40000 gene locus_tag LOCUS_04890 41802 40000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_04890 42203 43447 gene locus_tag LOCUS_04900 42203 43447 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533232.1 protein_id gnl|my_center|LOCUS_04900 46229 43479 gene locus_tag LOCUS_04910 gene secA 46229 43479 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK0 protein_id gnl|my_center|LOCUS_04910 46789 46340 gene locus_tag LOCUS_04920 46789 46340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 46891 46815 gene locus_tag LOCUS_t00030 46891 46815 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 48617 47010 gene locus_tag LOCUS_04930 48617 47010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04930 49817 48666 gene locus_tag LOCUS_04940 49817 48666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 51272 49917 gene locus_tag LOCUS_04950 51272 49917 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_04950 53365 51272 gene locus_tag LOCUS_04960 53365 51272 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_04960 54782 53394 gene locus_tag LOCUS_04970 54782 53394 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_04970 55131 55316 gene locus_tag LOCUS_04980 55131 55316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 55313 56701 gene locus_tag LOCUS_04990 55313 56701 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_04990 56710 57096 gene locus_tag LOCUS_05000 56710 57096 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206200.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence008 241 894 gene locus_tag LOCUS_05010 gene tal 241 894 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F0 protein_id gnl|my_center|LOCUS_05010 2079 1003 gene locus_tag LOCUS_05020 2079 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2233 2799 gene locus_tag LOCUS_05030 2233 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2796 3704 gene locus_tag LOCUS_05040 gene xerC 2796 3704 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 protein_id gnl|my_center|LOCUS_05040 3982 3731 gene locus_tag LOCUS_05050 3982 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4220 3993 gene locus_tag LOCUS_05060 4220 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4548 4258 gene locus_tag LOCUS_05070 4548 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4891 4568 gene locus_tag LOCUS_05080 4891 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5302 4922 gene locus_tag LOCUS_05090 5302 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 5690 5430 gene locus_tag LOCUS_05100 5690 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6368 5703 gene locus_tag LOCUS_05110 gene pspA 6368 5703 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_05110 6775 7797 gene locus_tag LOCUS_05120 6775 7797 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_05120 7990 9234 gene locus_tag LOCUS_05130 7990 9234 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_05130 10127 9354 gene locus_tag LOCUS_05140 10127 9354 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 protein_id gnl|my_center|LOCUS_05140 11311 10124 gene locus_tag LOCUS_05150 gene ackA 11311 10124 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P762 protein_id gnl|my_center|LOCUS_05150 12749 11325 gene locus_tag LOCUS_05160 12749 11325 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_05160 14549 12753 gene locus_tag LOCUS_05170 gene phbC 14549 12753 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088814.1 protein_id gnl|my_center|LOCUS_05170 16390 14546 gene locus_tag LOCUS_05180 gene atpA 16390 14546 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M28 protein_id gnl|my_center|LOCUS_05180 16953 16387 gene locus_tag LOCUS_05190 16953 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 17582 16950 gene locus_tag LOCUS_05200 17582 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 18037 17579 gene locus_tag LOCUS_05210 gene atpK 18037 17579 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882742.1 protein_id gnl|my_center|LOCUS_05210 19779 18034 gene locus_tag LOCUS_05220 19779 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 20381 19776 gene locus_tag LOCUS_05230 20381 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 21724 20378 gene locus_tag LOCUS_05240 gene atpB 21724 20378 CDS product V-type ATP synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M29 protein_id gnl|my_center|LOCUS_05240 22445 21726 gene locus_tag LOCUS_05250 22445 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 22846 22442 gene locus_tag LOCUS_05260 gene exbD2 22846 22442 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_05260 24590 22830 gene locus_tag LOCUS_05270 gene exbB2 24590 22830 CDS product transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_05270 26023 25025 gene locus_tag LOCUS_05280 26023 25025 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 protein_id gnl|my_center|LOCUS_05280 27420 26020 gene locus_tag LOCUS_05290 27420 26020 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974382.1 protein_id gnl|my_center|LOCUS_05290 28234 27452 gene locus_tag LOCUS_05300 28234 27452 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4H2 protein_id gnl|my_center|LOCUS_05300 29813 28236 gene locus_tag LOCUS_05310 29813 28236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_05310 30253 29813 gene locus_tag LOCUS_05320 30253 29813 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389405.1 protein_id gnl|my_center|LOCUS_05320 30693 30253 gene locus_tag LOCUS_05330 30693 30253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389406.1 protein_id gnl|my_center|LOCUS_05330 31604 30690 gene locus_tag LOCUS_05340 31604 30690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769516.1 protein_id gnl|my_center|LOCUS_05340 31697 32320 gene locus_tag LOCUS_05350 31697 32320 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_05350 32317 32685 gene locus_tag LOCUS_05360 32317 32685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 33370 33059 gene locus_tag LOCUS_05370 33370 33059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 33628 33371 gene locus_tag LOCUS_05380 33628 33371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 34174 34099 gene locus_tag LOCUS_t00040 34174 34099 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 34448 34260 gene locus_tag LOCUS_05390 34448 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 35406 34420 gene locus_tag LOCUS_05400 35406 34420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 35975 35403 gene locus_tag LOCUS_05410 35975 35403 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V5 protein_id gnl|my_center|LOCUS_05410 36202 35984 gene locus_tag LOCUS_05420 gene infA 36202 35984 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 protein_id gnl|my_center|LOCUS_05420 36381 37073 gene locus_tag LOCUS_05430 gene hisG 36381 37073 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_05430 37057 38361 gene locus_tag LOCUS_05440 gene hisD 37057 38361 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_05440 38671 38745 gene locus_tag LOCUS_t00050 38671 38745 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 39945 38770 gene locus_tag LOCUS_05450 39945 38770 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918779.1 protein_id gnl|my_center|LOCUS_05450 41733 39976 gene locus_tag LOCUS_05460 gene mnmC 41733 39976 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4L6 protein_id gnl|my_center|LOCUS_05460 43550 42063 gene locus_tag LOCUS_05470 43550 42063 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 protein_id gnl|my_center|LOCUS_05470 44573 43554 gene locus_tag LOCUS_05480 44573 43554 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640116.1 protein_id gnl|my_center|LOCUS_05480 45286 44570 gene locus_tag LOCUS_05490 45286 44570 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640115.1 protein_id gnl|my_center|LOCUS_05490 48436 45359 gene locus_tag LOCUS_05500 48436 45359 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918883.1 protein_id gnl|my_center|LOCUS_05500 48949 50010 gene locus_tag LOCUS_05510 48949 50010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338941.1 protein_id gnl|my_center|LOCUS_05510 50586 50134 gene locus_tag LOCUS_05520 50586 50134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 51726 51091 gene locus_tag LOCUS_05530 51726 51091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 52525 51833 gene locus_tag LOCUS_05540 52525 51833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 53252 52617 gene locus_tag LOCUS_05550 53252 52617 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_05550 <54112 53338 gene locus_tag LOCUS_05560 <54112 53338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205497.1:sodium/hydrogen exchanger family protein >Feature sequence009 <1 1116 gene locus_tag LOCUS_05570 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPA2:chromosome partition protein Smc 1381 1695 gene locus_tag LOCUS_05580 1381 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1760 2527 gene locus_tag LOCUS_05590 gene atpB 1760 2527 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89V68 protein_id gnl|my_center|LOCUS_05590 2624 2845 gene locus_tag LOCUS_05600 2624 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2913 3407 gene locus_tag LOCUS_05610 2913 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3411 3944 gene locus_tag LOCUS_05620 3411 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4019 5122 gene locus_tag LOCUS_05630 4019 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 5165 6946 gene locus_tag LOCUS_05640 5165 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639935.1 protein_id gnl|my_center|LOCUS_05640 7522 6959 gene locus_tag LOCUS_05650 7522 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_05650 8848 7559 gene locus_tag LOCUS_05660 gene purA 8848 7559 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9F8 protein_id gnl|my_center|LOCUS_05660 8968 9969 gene locus_tag LOCUS_05670 8968 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 11098 9971 gene locus_tag LOCUS_05680 gene hisZ 11098 9971 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_05680 12699 11110 gene locus_tag LOCUS_05690 gene serA 12699 11110 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_05690 14037 12838 gene locus_tag LOCUS_05700 14037 12838 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_05700 15186 14167 gene locus_tag LOCUS_05710 15186 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 15089 15910 gene locus_tag LOCUS_05720 15089 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 15963 16334 gene locus_tag LOCUS_05730 15963 16334 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706975.1 protein_id gnl|my_center|LOCUS_05730 17094 16309 gene locus_tag LOCUS_05740 17094 16309 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_05740 18434 17091 gene locus_tag LOCUS_05750 gene glmM 18434 17091 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L9 protein_id gnl|my_center|LOCUS_05750 18545 19933 gene locus_tag LOCUS_05760 18545 19933 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_05760 21319 19982 gene locus_tag LOCUS_05770 21319 19982 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_05770 22764 21316 gene locus_tag LOCUS_05780 22764 21316 CDS product imidazolonepropionase related amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265753.1 protein_id gnl|my_center|LOCUS_05780 24575 22779 gene locus_tag LOCUS_05790 24575 22779 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_05790 24768 25373 gene locus_tag LOCUS_05800 24768 25373 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707822.1 protein_id gnl|my_center|LOCUS_05800 25863 25366 gene locus_tag LOCUS_05810 25863 25366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 protein_id gnl|my_center|LOCUS_05810 26022 26384 gene locus_tag LOCUS_05820 26022 26384 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_05820 27140 26367 gene locus_tag LOCUS_05830 27140 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 27757 27137 gene locus_tag LOCUS_05840 gene eda 27757 27137 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163029.1 protein_id gnl|my_center|LOCUS_05840 28724 27750 gene locus_tag LOCUS_05850 gene glk 28724 27750 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXA8 protein_id gnl|my_center|LOCUS_05850 30550 28721 gene locus_tag LOCUS_05860 gene edd 30550 28721 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_05860 31270 30566 gene locus_tag LOCUS_05870 gene pgl 31270 30566 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2N2 protein_id gnl|my_center|LOCUS_05870 32726 31263 gene locus_tag LOCUS_05880 gene zwf 32726 31263 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S2 protein_id gnl|my_center|LOCUS_05880 33823 32822 gene locus_tag LOCUS_05890 33823 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973193.1 protein_id gnl|my_center|LOCUS_05890 35679 33820 gene locus_tag LOCUS_05900 gene cobT 35679 33820 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_05900 35919 36719 gene locus_tag LOCUS_05910 35919 36719 CDS product cobalamin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383527.1 protein_id gnl|my_center|LOCUS_05910 36716 37687 gene locus_tag LOCUS_05920 36716 37687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 37684 38466 gene locus_tag LOCUS_05930 37684 38466 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_05930 39420 38461 gene locus_tag LOCUS_05940 gene corA 39420 38461 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI47 protein_id gnl|my_center|LOCUS_05940 40916 39420 gene locus_tag LOCUS_05950 gene der 40916 39420 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD28 protein_id gnl|my_center|LOCUS_05950 42246 40921 gene locus_tag LOCUS_05960 gene bamB 42246 40921 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E769 protein_id gnl|my_center|LOCUS_05960 43001 42243 gene locus_tag LOCUS_05970 43001 42243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532849.1 protein_id gnl|my_center|LOCUS_05970 43961 43107 gene locus_tag LOCUS_05980 gene panB 43961 43107 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP30 protein_id gnl|my_center|LOCUS_05980 44337 44035 gene locus_tag LOCUS_05990 44337 44035 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N13 protein_id gnl|my_center|LOCUS_05990 45123 44353 gene locus_tag LOCUS_06000 45123 44353 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_06000 45211 45729 gene locus_tag LOCUS_06010 45211 45729 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090707.1 protein_id gnl|my_center|LOCUS_06010 45825 46688 gene locus_tag LOCUS_06020 45825 46688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 46798 47553 gene locus_tag LOCUS_06030 46798 47553 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 protein_id gnl|my_center|LOCUS_06030 47850 49304 gene locus_tag LOCUS_06040 gene ffh 47850 49304 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV60 protein_id gnl|my_center|LOCUS_06040 49340 49855 gene locus_tag LOCUS_06050 49340 49855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 50038 50538 gene locus_tag LOCUS_06060 gene rimM 50038 50538 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 protein_id gnl|my_center|LOCUS_06060 50705 50965 gene locus_tag LOCUS_06070 50705 50965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 51031 51615 gene locus_tag LOCUS_06080 51031 51615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence010 1358 216 gene locus_tag LOCUS_06090 1358 216 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_06090 3313 1379 gene locus_tag LOCUS_06100 gene ftsH 3313 1379 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3H8 protein_id gnl|my_center|LOCUS_06100 4754 3480 gene locus_tag LOCUS_06110 gene tilS 4754 3480 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 protein_id gnl|my_center|LOCUS_06110 5616 4747 gene locus_tag LOCUS_06120 5616 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6311 5751 gene locus_tag LOCUS_06130 6311 5751 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_06130 7830 6433 gene locus_tag LOCUS_06140 gene tolB 7830 6433 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_06140 8610 7834 gene locus_tag LOCUS_06150 8610 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 9080 8616 gene locus_tag LOCUS_06160 gene tolR 9080 8616 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_06160 9784 9083 gene locus_tag LOCUS_06170 gene tolQ 9784 9083 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709286.1 protein_id gnl|my_center|LOCUS_06170 10276 9794 gene locus_tag LOCUS_06180 10276 9794 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709289.1 protein_id gnl|my_center|LOCUS_06180 11295 10276 gene locus_tag LOCUS_06190 gene ruvB 11295 10276 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U80 protein_id gnl|my_center|LOCUS_06190 12008 11337 gene locus_tag LOCUS_06200 12008 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 12779 12177 gene locus_tag LOCUS_06210 gene ruvA 12779 12177 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCT8 protein_id gnl|my_center|LOCUS_06210 13885 12764 gene locus_tag LOCUS_06220 13885 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 14415 13900 gene locus_tag LOCUS_06230 gene ruvC 14415 13900 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 protein_id gnl|my_center|LOCUS_06230 14637 14816 gene locus_tag LOCUS_06240 14637 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 14890 16437 gene locus_tag LOCUS_06250 gene guaA 14890 16437 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SQ3 protein_id gnl|my_center|LOCUS_06250 17545 16919 gene locus_tag LOCUS_06260 17545 16919 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_06260 17675 17965 gene locus_tag LOCUS_06270 17675 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_06270 17995 18549 gene locus_tag LOCUS_06280 17995 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 18721 19122 gene locus_tag LOCUS_06290 18721 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 19119 19946 gene locus_tag LOCUS_06300 19119 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 20276 20202 gene locus_tag LOCUS_t00060 20276 20202 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20862 20401 gene locus_tag LOCUS_06310 gene bamE 20862 20401 CDS product SmpA/OmlA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640219.1 protein_id gnl|my_center|LOCUS_06310 21003 21530 gene locus_tag LOCUS_06320 21003 21530 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087784.1 protein_id gnl|my_center|LOCUS_06320 21527 22054 gene locus_tag LOCUS_06330 21527 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 22452 23501 gene locus_tag LOCUS_06340 gene plsX 22452 23501 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 protein_id gnl|my_center|LOCUS_06340 23503 24474 gene locus_tag LOCUS_06350 gene fabH 23503 24474 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS8 protein_id gnl|my_center|LOCUS_06350 24531 24833 gene locus_tag LOCUS_06360 gene ihfA 24531 24833 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THC4 protein_id gnl|my_center|LOCUS_06360 24917 25375 gene locus_tag LOCUS_06370 24917 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 26693 25425 gene locus_tag LOCUS_06380 gene dinB 26693 25425 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 protein_id gnl|my_center|LOCUS_06380 27303 27917 gene locus_tag LOCUS_06390 gene rplY 27303 27917 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV5 protein_id gnl|my_center|LOCUS_06390 27963 28553 gene locus_tag LOCUS_06400 gene pth 27963 28553 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C8 protein_id gnl|my_center|LOCUS_06400 29859 28516 gene locus_tag LOCUS_06410 gene accC 29859 28516 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971547.1 protein_id gnl|my_center|LOCUS_06410 30339 29860 gene locus_tag LOCUS_06420 gene accB 30339 29860 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384520.1 protein_id gnl|my_center|LOCUS_06420 30798 30355 gene locus_tag LOCUS_06430 gene aroQ1 30798 30355 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFR5 protein_id gnl|my_center|LOCUS_06430 30957 31937 gene locus_tag LOCUS_06440 gene thiG 30957 31937 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_06440 33515 32184 gene locus_tag LOCUS_06450 33515 32184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 34482 33703 gene locus_tag LOCUS_06460 34482 33703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 35900 34500 gene locus_tag LOCUS_06470 35900 34500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919744.1 protein_id gnl|my_center|LOCUS_06470 38622 36034 gene locus_tag LOCUS_06480 38622 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 38625 39068 gene locus_tag LOCUS_06490 38625 39068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 39190 40542 gene locus_tag LOCUS_06500 39190 40542 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389997.1 protein_id gnl|my_center|LOCUS_06500 40641 43100 gene locus_tag LOCUS_06510 40641 43100 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_06510 43155 43655 gene locus_tag LOCUS_06520 43155 43655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 43726 44814 gene locus_tag LOCUS_06530 gene prfB 43726 44814 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLD6 protein_id gnl|my_center|LOCUS_06530 44963 47287 gene locus_tag LOCUS_06540 44963 47287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 47664 47284 gene locus_tag LOCUS_06550 47664 47284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 48038 47661 gene locus_tag LOCUS_06560 48038 47661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence011 1129 305 gene locus_tag LOCUS_06570 1129 305 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527908.1 protein_id gnl|my_center|LOCUS_06570 1590 1144 gene locus_tag LOCUS_06580 1590 1144 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_06580 2182 1625 gene locus_tag LOCUS_06590 2182 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3375 2179 gene locus_tag LOCUS_06600 gene dapE 3375 2179 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM1 protein_id gnl|my_center|LOCUS_06600 3756 4388 gene locus_tag LOCUS_06610 3756 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5278 4442 gene locus_tag LOCUS_06620 gene dapD 5278 4442 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM2 protein_id gnl|my_center|LOCUS_06620 5994 5275 gene locus_tag LOCUS_06630 5994 5275 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391090.1 protein_id gnl|my_center|LOCUS_06630 6131 7708 gene locus_tag LOCUS_06640 6131 7708 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_06640 7705 8964 gene locus_tag LOCUS_06650 7705 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 9908 8949 gene locus_tag LOCUS_06660 gene argB 9908 8949 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_06660 10472 9981 gene locus_tag LOCUS_06670 10472 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12181 10559 gene locus_tag LOCUS_06680 12181 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12519 13253 gene locus_tag LOCUS_06690 gene ubiE 12519 13253 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WD0 protein_id gnl|my_center|LOCUS_06690 13253 14458 gene locus_tag LOCUS_06700 13253 14458 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_06700 14455 14901 gene locus_tag LOCUS_06710 gene dut 14455 14901 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T772 protein_id gnl|my_center|LOCUS_06710 14898 15650 gene locus_tag LOCUS_06720 gene moeB 14898 15650 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923352.1 protein_id gnl|my_center|LOCUS_06720 15629 16009 gene locus_tag LOCUS_06730 15629 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16331 16116 gene locus_tag LOCUS_06740 16331 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 16218 16877 gene locus_tag LOCUS_06750 16218 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 17256 17924 gene locus_tag LOCUS_06760 17256 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 19212 17980 gene locus_tag LOCUS_06770 19212 17980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_06770 22031 19626 gene locus_tag LOCUS_06780 gene fhuA 22031 19626 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_06780 25155 22084 gene locus_tag LOCUS_06790 25155 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 26341 25325 gene locus_tag LOCUS_06800 26341 25325 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037601.1 protein_id gnl|my_center|LOCUS_06800 26998 28053 gene locus_tag LOCUS_06810 26998 28053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946587.1 protein_id gnl|my_center|LOCUS_06810 28050 29294 gene locus_tag LOCUS_06820 28050 29294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946586.1 protein_id gnl|my_center|LOCUS_06820 29294 29971 gene locus_tag LOCUS_06830 29294 29971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946585.1 protein_id gnl|my_center|LOCUS_06830 32314 30197 gene locus_tag LOCUS_06840 gene glcB 32314 30197 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA82 protein_id gnl|my_center|LOCUS_06840 33352 32408 gene locus_tag LOCUS_06850 gene accA 33352 32408 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_06850 34270 33362 gene locus_tag LOCUS_06860 gene xerD 34270 33362 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME3 protein_id gnl|my_center|LOCUS_06860 36000 34267 gene locus_tag LOCUS_06870 36000 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 36213 36770 gene locus_tag LOCUS_06880 gene aroK 36213 36770 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H331 protein_id gnl|my_center|LOCUS_06880 36767 37870 gene locus_tag LOCUS_06890 gene aroB 36767 37870 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_06890 37927 39231 gene locus_tag LOCUS_06900 37927 39231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 protein_id gnl|my_center|LOCUS_06900 39250 39326 gene locus_tag LOCUS_t00070 39250 39326 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40811 39360 gene locus_tag LOCUS_06910 gene amn 40811 39360 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA5 protein_id gnl|my_center|LOCUS_06910 41054 40812 gene locus_tag LOCUS_06920 41054 40812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 41044 41808 gene locus_tag LOCUS_06930 41044 41808 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_06930 41805 42485 gene locus_tag LOCUS_06940 gene rnc 41805 42485 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69161 protein_id gnl|my_center|LOCUS_06940 42482 43405 gene locus_tag LOCUS_06950 gene era 42482 43405 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 protein_id gnl|my_center|LOCUS_06950 43477 43549 gene locus_tag LOCUS_t00080 43477 43549 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 2147 198 gene locus_tag LOCUS_06960 2147 198 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039172.1 protein_id gnl|my_center|LOCUS_06960 3009 2140 gene locus_tag LOCUS_06970 gene xylC 3009 2140 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 protein_id gnl|my_center|LOCUS_06970 3797 3009 gene locus_tag LOCUS_06980 3797 3009 CDS product D-xylose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918706.1 protein_id gnl|my_center|LOCUS_06980 5232 3802 gene locus_tag LOCUS_06990 gene xylA 5232 3802 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918707.1 protein_id gnl|my_center|LOCUS_06990 6392 5247 gene locus_tag LOCUS_07000 6392 5247 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918708.1 protein_id gnl|my_center|LOCUS_07000 6617 8299 gene locus_tag LOCUS_07010 6617 8299 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_07010 8418 9944 gene locus_tag LOCUS_07020 8418 9944 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_07020 9944 10357 gene locus_tag LOCUS_07030 9944 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 10360 12198 gene locus_tag LOCUS_07040 10360 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12806 12150 gene locus_tag LOCUS_07050 12806 12150 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 protein_id gnl|my_center|LOCUS_07050 13701 12796 gene locus_tag LOCUS_07060 gene folD 13701 12796 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_07060 13994 13698 gene locus_tag LOCUS_07070 13994 13698 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH5 protein_id gnl|my_center|LOCUS_07070 14309 13998 gene locus_tag LOCUS_07080 14309 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265985.1 protein_id gnl|my_center|LOCUS_07080 14436 17315 gene locus_tag LOCUS_07090 14436 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 17315 17713 gene locus_tag LOCUS_07100 17315 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 17752 20367 gene locus_tag LOCUS_07110 gene mutS 17752 20367 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_07110 21390 20464 gene locus_tag LOCUS_07120 21390 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 22121 21393 gene locus_tag LOCUS_07130 22121 21393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 22911 22609 gene locus_tag LOCUS_07140 22911 22609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 24043 22922 gene locus_tag LOCUS_07150 24043 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 25129 24062 gene locus_tag LOCUS_07160 gene cheB 25129 24062 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZU5 protein_id gnl|my_center|LOCUS_07160 25786 25139 gene locus_tag LOCUS_07170 gene cheD1 25786 25139 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_07170 26613 25783 gene locus_tag LOCUS_07180 gene cheR 26613 25783 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG03 protein_id gnl|my_center|LOCUS_07180 29064 26644 gene locus_tag LOCUS_07190 29064 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 29637 29119 gene locus_tag LOCUS_07200 29637 29119 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974446.1 protein_id gnl|my_center|LOCUS_07200 31712 29652 gene locus_tag LOCUS_07210 gene cheA 31712 29652 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 protein_id gnl|my_center|LOCUS_07210 32093 31728 gene locus_tag LOCUS_07220 gene cheY34H-1 32093 31728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_07220 32930 34153 gene locus_tag LOCUS_07230 32930 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 34450 35508 gene locus_tag LOCUS_07240 34450 35508 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_07240 35512 36897 gene locus_tag LOCUS_07250 35512 36897 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_07250 36890 38233 gene locus_tag LOCUS_07260 36890 38233 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_07260 38248 39018 gene locus_tag LOCUS_07270 gene pstB 38248 39018 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8C2 protein_id gnl|my_center|LOCUS_07270 39207 39926 gene locus_tag LOCUS_07280 39207 39926 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_07280 39934 40659 gene locus_tag LOCUS_07290 gene phoB 39934 40659 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence013 3088 1853 gene locus_tag LOCUS_07300 3088 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4311 3085 gene locus_tag LOCUS_07310 4311 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4657 4391 gene locus_tag LOCUS_07320 4657 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5097 4726 gene locus_tag LOCUS_07330 5097 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 7170 5158 gene locus_tag LOCUS_07340 7170 5158 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_07340 8552 7659 gene locus_tag LOCUS_07350 8552 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 11692 8576 gene locus_tag LOCUS_07360 11692 8576 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_07360 13146 11695 gene locus_tag LOCUS_07370 13146 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 14555 13332 gene locus_tag LOCUS_07380 14555 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 15091 14624 gene locus_tag LOCUS_07390 15091 14624 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942748.1 protein_id gnl|my_center|LOCUS_07390 15713 15141 gene locus_tag LOCUS_07400 15713 15141 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_07400 16153 15710 gene locus_tag LOCUS_07410 16153 15710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 16419 16150 gene locus_tag LOCUS_07420 16419 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 16620 17321 gene locus_tag LOCUS_07430 16620 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17890 17456 gene locus_tag LOCUS_07440 17890 17456 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530143.1 protein_id gnl|my_center|LOCUS_07440 18136 17942 gene locus_tag LOCUS_07450 18136 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 18093 18362 gene locus_tag LOCUS_07460 18093 18362 CDS product mercuric transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_07460 18375 18701 gene locus_tag LOCUS_07470 18375 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 18740 20197 gene locus_tag LOCUS_07480 gene merA 18740 20197 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0E4 protein_id gnl|my_center|LOCUS_07480 20491 20415 gene locus_tag LOCUS_t00090 20491 20415 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20582 20983 gene locus_tag LOCUS_07490 20582 20983 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_07490 20983 21531 gene locus_tag LOCUS_07500 20983 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 21721 22143 gene locus_tag LOCUS_07510 21721 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 22164 22673 gene locus_tag LOCUS_07520 22164 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 23015 23512 gene locus_tag LOCUS_07530 23015 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_07530 23516 24370 gene locus_tag LOCUS_07540 23516 24370 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_07540 27555 24454 gene locus_tag LOCUS_07550 gene putA 27555 24454 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_07550 28744 27677 gene locus_tag LOCUS_07560 28744 27677 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_07560 29646 28741 gene locus_tag LOCUS_07570 gene ycsN 29646 28741 CDS product putative oxidoreductase YcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42972 protein_id gnl|my_center|LOCUS_07570 30716 29643 gene locus_tag LOCUS_07580 30716 29643 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_07580 32748 30709 gene locus_tag LOCUS_07590 32748 30709 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 protein_id gnl|my_center|LOCUS_07590 33123 35459 gene locus_tag LOCUS_07600 gene fyuA 33123 35459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_07600 36821 35583 gene locus_tag LOCUS_07610 gene exuT 36821 35583 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 protein_id gnl|my_center|LOCUS_07610 36922 37983 gene locus_tag LOCUS_07620 36922 37983 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207160.1 protein_id gnl|my_center|LOCUS_07620 37980 39521 gene locus_tag LOCUS_07630 gene glpD 37980 39521 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SG4 protein_id gnl|my_center|LOCUS_07630 39469 40029 gene locus_tag LOCUS_07640 39469 40029 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528729.1 protein_id gnl|my_center|LOCUS_07640 40026 40646 gene locus_tag LOCUS_07650 40026 40646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence014 221 583 gene locus_tag LOCUS_07660 221 583 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_07660 632 1894 gene locus_tag LOCUS_07670 gene hisS 632 1894 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_07670 1904 2995 gene locus_tag LOCUS_07680 gene prfA 1904 2995 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8B8 protein_id gnl|my_center|LOCUS_07680 2992 3849 gene locus_tag LOCUS_07690 gene prmC 2992 3849 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE0 protein_id gnl|my_center|LOCUS_07690 5095 3914 gene locus_tag LOCUS_07700 gene metK 5095 3914 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917940.1 protein_id gnl|my_center|LOCUS_07700 5668 5264 gene locus_tag LOCUS_07710 5668 5264 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917941.1 protein_id gnl|my_center|LOCUS_07710 7316 5736 gene locus_tag LOCUS_07720 gene lnt 7316 5736 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_07720 8250 7324 gene locus_tag LOCUS_07730 gene corC 8250 7324 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_07730 8743 8240 gene locus_tag LOCUS_07740 gene ybeY 8743 8240 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS9 protein_id gnl|my_center|LOCUS_07740 9770 8745 gene locus_tag LOCUS_07750 9770 8745 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 protein_id gnl|my_center|LOCUS_07750 11131 9767 gene locus_tag LOCUS_07760 gene miaB 11131 9767 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW0 protein_id gnl|my_center|LOCUS_07760 11506 11222 gene locus_tag LOCUS_07770 11506 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_07770 11639 12136 gene locus_tag LOCUS_07780 11639 12136 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_07780 13169 12354 gene locus_tag LOCUS_07790 13169 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 13555 13268 gene locus_tag LOCUS_07800 13555 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 13764 13552 gene locus_tag LOCUS_07810 13764 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 15204 13888 gene locus_tag LOCUS_07820 15204 13888 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NQ6 protein_id gnl|my_center|LOCUS_07820 16733 15384 gene locus_tag LOCUS_07830 gene gor 16733 15384 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_07830 18142 16823 gene locus_tag LOCUS_07840 18142 16823 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704508.1 protein_id gnl|my_center|LOCUS_07840 20234 18153 gene locus_tag LOCUS_07850 20234 18153 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390148.1 protein_id gnl|my_center|LOCUS_07850 20686 20297 gene locus_tag LOCUS_07860 20686 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 20897 20718 gene locus_tag LOCUS_07870 20897 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22835 21012 gene locus_tag LOCUS_07880 gene glmS 22835 21012 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 protein_id gnl|my_center|LOCUS_07880 22963 23712 gene locus_tag LOCUS_07890 22963 23712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 24289 24107 gene locus_tag LOCUS_07900 24289 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 24510 24277 gene locus_tag LOCUS_07910 24510 24277 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388816.1 protein_id gnl|my_center|LOCUS_07910 25920 24538 gene locus_tag LOCUS_07920 gene glmU 25920 24538 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_07920 26011 26691 gene locus_tag LOCUS_07930 26011 26691 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708236.1 protein_id gnl|my_center|LOCUS_07930 26753 26995 gene locus_tag LOCUS_07940 26753 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 26995 27393 gene locus_tag LOCUS_07950 26995 27393 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_07950 28708 29022 gene locus_tag LOCUS_07960 28708 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 29015 29218 gene locus_tag LOCUS_07970 29015 29218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 29238 31169 gene locus_tag LOCUS_07980 29238 31169 CDS product peptidase S9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140278.1 protein_id gnl|my_center|LOCUS_07980 31166 32815 gene locus_tag LOCUS_07990 31166 32815 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_07990 33170 32829 gene locus_tag LOCUS_08000 33170 32829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 33901 33167 gene locus_tag LOCUS_08010 33901 33167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 34350 33979 gene locus_tag LOCUS_08020 34350 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_08020 35384 34392 gene locus_tag LOCUS_08030 35384 34392 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 protein_id gnl|my_center|LOCUS_08030 35590 37203 gene locus_tag LOCUS_08040 35590 37203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887466.1 protein_id gnl|my_center|LOCUS_08040 37555 39660 gene locus_tag LOCUS_08050 37555 39660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence015 1224 538 gene locus_tag LOCUS_08060 gene queC 1224 538 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_08060 1662 2264 gene locus_tag LOCUS_08070 1662 2264 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI5 protein_id gnl|my_center|LOCUS_08070 2320 3249 gene locus_tag LOCUS_08080 2320 3249 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366688.1 protein_id gnl|my_center|LOCUS_08080 3368 3850 gene locus_tag LOCUS_08090 3368 3850 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 protein_id gnl|my_center|LOCUS_08090 3889 4476 gene locus_tag LOCUS_08100 3889 4476 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 protein_id gnl|my_center|LOCUS_08100 4482 4868 gene locus_tag LOCUS_08110 4482 4868 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640293.1 protein_id gnl|my_center|LOCUS_08110 5814 4903 gene locus_tag LOCUS_08120 gene gpsA 5814 4903 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_08120 6965 5895 gene locus_tag LOCUS_08130 gene tsaD 6965 5895 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_08130 7036 7947 gene locus_tag LOCUS_08140 gene hemC 7036 7947 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J029 protein_id gnl|my_center|LOCUS_08140 7947 8663 gene locus_tag LOCUS_08150 7947 8663 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083395.1 protein_id gnl|my_center|LOCUS_08150 8644 9741 gene locus_tag LOCUS_08160 8644 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 9738 10964 gene locus_tag LOCUS_08170 9738 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10961 11995 gene locus_tag LOCUS_08180 10961 11995 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527614.1 protein_id gnl|my_center|LOCUS_08180 13575 12001 gene locus_tag LOCUS_08190 gene lysS 13575 12001 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VB4 protein_id gnl|my_center|LOCUS_08190 14530 13652 gene locus_tag LOCUS_08200 14530 13652 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259006.1 protein_id gnl|my_center|LOCUS_08200 16570 14534 gene locus_tag LOCUS_08210 gene aglA 16570 14534 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_08210 18261 16642 gene locus_tag LOCUS_08220 18261 16642 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 protein_id gnl|my_center|LOCUS_08220 20060 18258 gene locus_tag LOCUS_08230 20060 18258 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265787.1 protein_id gnl|my_center|LOCUS_08230 21562 20057 gene locus_tag LOCUS_08240 21562 20057 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_08240 22713 21628 gene locus_tag LOCUS_08250 22713 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08250 24438 22750 gene locus_tag LOCUS_08260 24438 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08260 24615 25670 gene locus_tag LOCUS_08270 gene malR 24615 25670 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_08270 27473 25959 gene locus_tag LOCUS_08280 27473 25959 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920648.1 protein_id gnl|my_center|LOCUS_08280 28140 27463 gene locus_tag LOCUS_08290 28140 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 28289 29755 gene locus_tag LOCUS_08300 gene malY 28289 29755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265786.1 protein_id gnl|my_center|LOCUS_08300 28400 28496 gene locus_tag LOCUS_t00100 28400 28496 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32839 29759 gene locus_tag LOCUS_08310 32839 29759 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140808.1 protein_id gnl|my_center|LOCUS_08310 34091 32844 gene locus_tag LOCUS_08320 34091 32844 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709005.1 protein_id gnl|my_center|LOCUS_08320 35086 34433 gene locus_tag LOCUS_08330 gene msrQ 35086 34433 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 protein_id gnl|my_center|LOCUS_08330 36051 35086 gene locus_tag LOCUS_08340 gene msrP 36051 35086 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB06 protein_id gnl|my_center|LOCUS_08340 37334 36132 gene locus_tag LOCUS_08350 37334 36132 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8I0 protein_id gnl|my_center|LOCUS_08350 37682 38689 gene locus_tag LOCUS_08360 37682 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence016 826 203 gene locus_tag LOCUS_08370 826 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1197 823 gene locus_tag LOCUS_08380 1197 823 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920600.1 protein_id gnl|my_center|LOCUS_08380 1736 1200 gene locus_tag LOCUS_08390 1736 1200 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 protein_id gnl|my_center|LOCUS_08390 3692 1746 gene locus_tag LOCUS_08400 gene ccmF 3692 1746 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 protein_id gnl|my_center|LOCUS_08400 4135 3689 gene locus_tag LOCUS_08410 gene ccmE 4135 3689 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMN7 protein_id gnl|my_center|LOCUS_08410 4299 4135 gene locus_tag LOCUS_08420 4299 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5039 4296 gene locus_tag LOCUS_08430 5039 4296 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_08430 5781 5137 gene locus_tag LOCUS_08440 gene ccmB 5781 5137 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJ17 protein_id gnl|my_center|LOCUS_08440 6359 5778 gene locus_tag LOCUS_08450 gene ccmA 6359 5778 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJZ1 protein_id gnl|my_center|LOCUS_08450 7009 6359 gene locus_tag LOCUS_08460 7009 6359 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L49 protein_id gnl|my_center|LOCUS_08460 7444 7082 gene locus_tag LOCUS_08470 7444 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921255.1 protein_id gnl|my_center|LOCUS_08470 7513 8151 gene locus_tag LOCUS_08480 7513 8151 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_08480 8155 8799 gene locus_tag LOCUS_08490 gene chrR 8155 8799 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_08490 8802 9515 gene locus_tag LOCUS_08500 8802 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 9512 10273 gene locus_tag LOCUS_08510 9512 10273 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_08510 10740 10270 gene locus_tag LOCUS_08520 gene rppH 10740 10270 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_08520 10773 11678 gene locus_tag LOCUS_08530 10773 11678 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_08530 11842 13716 gene locus_tag LOCUS_08540 11842 13716 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403201.1 protein_id gnl|my_center|LOCUS_08540 13916 14320 gene locus_tag LOCUS_08550 13916 14320 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969659.1 protein_id gnl|my_center|LOCUS_08550 14344 15369 gene locus_tag LOCUS_08560 14344 15369 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_08560 15465 16031 gene locus_tag LOCUS_08570 15465 16031 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_08570 16028 16519 gene locus_tag LOCUS_08580 16028 16519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 16519 16998 gene locus_tag LOCUS_08590 16519 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 17231 18628 gene locus_tag LOCUS_08600 17231 18628 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_08600 18630 19913 gene locus_tag LOCUS_08610 18630 19913 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_08610 19913 20671 gene locus_tag LOCUS_08620 19913 20671 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_08620 20664 21932 gene locus_tag LOCUS_08630 20664 21932 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_08630 24415 22004 gene locus_tag LOCUS_08640 gene gyrB 24415 22004 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKT5 protein_id gnl|my_center|LOCUS_08640 25559 24429 gene locus_tag LOCUS_08650 gene recF 25559 24429 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 protein_id gnl|my_center|LOCUS_08650 25788 26843 gene locus_tag LOCUS_08660 25788 26843 CDS product O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553740.1 protein_id gnl|my_center|LOCUS_08660 26840 27505 gene locus_tag LOCUS_08670 26840 27505 CDS product prolyl 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918594.1 protein_id gnl|my_center|LOCUS_08670 28200 27523 gene locus_tag LOCUS_08680 28200 27523 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_08680 29306 28197 gene locus_tag LOCUS_08690 29306 28197 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_08690 29828 29454 gene locus_tag LOCUS_08700 29828 29454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919329.1 protein_id gnl|my_center|LOCUS_08700 30615 29950 gene locus_tag LOCUS_08710 30615 29950 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_08710 31337 30633 gene locus_tag LOCUS_08720 31337 30633 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 protein_id gnl|my_center|LOCUS_08720 31477 32151 gene locus_tag LOCUS_08730 31477 32151 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919228.1 protein_id gnl|my_center|LOCUS_08730 32141 32647 gene locus_tag LOCUS_08740 32141 32647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_08740 32967 34493 gene locus_tag LOCUS_08750 32967 34493 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104168.1 protein_id gnl|my_center|LOCUS_08750 35270 34500 gene locus_tag LOCUS_08760 35270 34500 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_08760 36297 35326 gene locus_tag LOCUS_08770 36297 35326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_08770 36412 37014 gene locus_tag LOCUS_08780 36412 37014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931294.1 protein_id gnl|my_center|LOCUS_08780 37017 37481 gene locus_tag LOCUS_08790 37017 37481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_08790 38023 37478 gene locus_tag LOCUS_08800 38023 37478 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036074.1 protein_id gnl|my_center|LOCUS_08800 38188 38439 gene locus_tag LOCUS_08810 38188 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence017 392 1132 gene locus_tag LOCUS_08820 gene recO 392 1132 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A802 protein_id gnl|my_center|LOCUS_08820 1184 3445 gene locus_tag LOCUS_08830 gene parC 1184 3445 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_08830 4238 3480 gene locus_tag LOCUS_08840 4238 3480 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_08840 5517 4585 gene locus_tag LOCUS_08850 5517 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525527.1 protein_id gnl|my_center|LOCUS_08850 6947 5517 gene locus_tag LOCUS_08860 6947 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003579.1 protein_id gnl|my_center|LOCUS_08860 7647 7081 gene locus_tag LOCUS_08870 7647 7081 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_08870 7850 7653 gene locus_tag LOCUS_08880 7850 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8680 7907 gene locus_tag LOCUS_08890 8680 7907 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_08890 9016 9582 gene locus_tag LOCUS_08900 9016 9582 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533486.1 protein_id gnl|my_center|LOCUS_08900 10998 9757 gene locus_tag LOCUS_08910 10998 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11206 11132 gene locus_tag LOCUS_t00110 11206 11132 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11429 11608 gene locus_tag LOCUS_08920 11429 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 11841 12605 gene locus_tag LOCUS_08930 11841 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 14656 12848 gene locus_tag LOCUS_08940 14656 12848 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_08940 14827 17016 gene locus_tag LOCUS_08950 gene ptrB 14827 17016 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_08950 17982 17074 gene locus_tag LOCUS_08960 17982 17074 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_08960 18193 18429 gene locus_tag LOCUS_08970 18193 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 18650 18979 gene locus_tag LOCUS_08980 18650 18979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 18976 19224 gene locus_tag LOCUS_08990 18976 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 19263 20681 gene locus_tag LOCUS_09000 19263 20681 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_09000 20916 20737 gene locus_tag LOCUS_09010 20916 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 21949 20972 gene locus_tag LOCUS_09020 21949 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 23370 21961 gene locus_tag LOCUS_09030 gene lpdA 23370 21961 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X65 protein_id gnl|my_center|LOCUS_09030 23644 23408 gene locus_tag LOCUS_09040 23644 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709019.1 protein_id gnl|my_center|LOCUS_09040 24431 23649 gene locus_tag LOCUS_09050 24431 23649 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_09050 25681 24440 gene locus_tag LOCUS_09060 gene sucB 25681 24440 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LJ6 protein_id gnl|my_center|LOCUS_09060 26194 25694 gene locus_tag LOCUS_09070 26194 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 29115 26191 gene locus_tag LOCUS_09080 gene sucA 29115 26191 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382958.1 protein_id gnl|my_center|LOCUS_09080 30136 29252 gene locus_tag LOCUS_09090 gene sucD 30136 29252 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918227.1 protein_id gnl|my_center|LOCUS_09090 31352 30153 gene locus_tag LOCUS_09100 gene sucC 31352 30153 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYZ1 protein_id gnl|my_center|LOCUS_09100 32393 31431 gene locus_tag LOCUS_09110 gene mdh 32393 31431 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 protein_id gnl|my_center|LOCUS_09110 32798 35062 gene locus_tag LOCUS_09120 gene purL 32798 35062 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 protein_id gnl|my_center|LOCUS_09120 35064 35480 gene locus_tag LOCUS_09130 35064 35480 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_09130 36592 35663 gene locus_tag LOCUS_09140 36592 35663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071996.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence018 1865 93 gene locus_tag LOCUS_09150 gene aspS 1865 93 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 protein_id gnl|my_center|LOCUS_09150 2108 3289 gene locus_tag LOCUS_09160 gene rnd 2108 3289 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_09160 4787 3255 gene locus_tag LOCUS_09170 4787 3255 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_09170 7009 4784 gene locus_tag LOCUS_09180 gene ppk 7009 4784 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 protein_id gnl|my_center|LOCUS_09180 7702 7019 gene locus_tag LOCUS_09190 7702 7019 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_09190 9060 7705 gene locus_tag LOCUS_09200 9060 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 9332 10435 gene locus_tag LOCUS_09210 gene purM 9332 10435 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG8 protein_id gnl|my_center|LOCUS_09210 10425 11042 gene locus_tag LOCUS_09220 gene purN 10425 11042 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 protein_id gnl|my_center|LOCUS_09220 11505 11083 gene locus_tag LOCUS_09230 gene ndk 11505 11083 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2D0 protein_id gnl|my_center|LOCUS_09230 12067 11615 gene locus_tag LOCUS_09240 gene holC 12067 11615 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971400.1 protein_id gnl|my_center|LOCUS_09240 13554 12064 gene locus_tag LOCUS_09250 gene pepA 13554 12064 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_09250 13710 15917 gene locus_tag LOCUS_09260 gene ostA 13710 15917 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJH2 protein_id gnl|my_center|LOCUS_09260 16000 17310 gene locus_tag LOCUS_09270 16000 17310 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8Y4 protein_id gnl|my_center|LOCUS_09270 17294 18214 gene locus_tag LOCUS_09280 gene pdxA 17294 18214 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X3 protein_id gnl|my_center|LOCUS_09280 18193 19053 gene locus_tag LOCUS_09290 gene rsmA 18193 19053 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN4 protein_id gnl|my_center|LOCUS_09290 19525 19043 gene locus_tag LOCUS_09300 19525 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 20830 19571 gene locus_tag LOCUS_09310 20830 19571 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_09310 22376 20907 gene locus_tag LOCUS_09320 gene guaB 22376 20907 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N70 protein_id gnl|my_center|LOCUS_09320 23162 22455 gene locus_tag LOCUS_09330 gene rlmE 23162 22455 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 protein_id gnl|my_center|LOCUS_09330 24187 23159 gene locus_tag LOCUS_09340 24187 23159 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086746.1 protein_id gnl|my_center|LOCUS_09340 24846 24358 gene locus_tag LOCUS_09350 24846 24358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 25457 24846 gene locus_tag LOCUS_09360 25457 24846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113265.1 protein_id gnl|my_center|LOCUS_09360 26061 25543 gene locus_tag LOCUS_09370 26061 25543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 26098 26733 gene locus_tag LOCUS_09380 26098 26733 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_09380 27540 26800 gene locus_tag LOCUS_09390 27540 26800 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_09390 28097 27540 gene locus_tag LOCUS_09400 28097 27540 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UY8 protein_id gnl|my_center|LOCUS_09400 28391 28119 gene locus_tag LOCUS_09410 28391 28119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29467 28529 gene locus_tag LOCUS_09420 29467 28529 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_09420 30430 29585 gene locus_tag LOCUS_09430 30430 29585 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_09430 31458 30427 gene locus_tag LOCUS_09440 31458 30427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141680.1 protein_id gnl|my_center|LOCUS_09440 31956 31552 gene locus_tag LOCUS_09450 gene flaF 31956 31552 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_09450 32341 31916 gene locus_tag LOCUS_09460 gene flbT 32341 31916 CDS product putative flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5S2 protein_id gnl|my_center|LOCUS_09460 33727 32441 gene locus_tag LOCUS_09470 33727 32441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 34922 34014 gene locus_tag LOCUS_09480 gene fljJ 34922 34014 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 protein_id gnl|my_center|LOCUS_09480 35535 35119 gene locus_tag LOCUS_09490 35535 35119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence019 1536 892 gene locus_tag LOCUS_09500 1536 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2770 1808 gene locus_tag LOCUS_09510 2770 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3125 2784 gene locus_tag LOCUS_09520 3125 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4792 3230 gene locus_tag LOCUS_09530 4792 3230 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HS4 protein_id gnl|my_center|LOCUS_09530 4887 5984 gene locus_tag LOCUS_09540 4887 5984 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_09540 6004 7026 gene locus_tag LOCUS_09550 6004 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7023 7985 gene locus_tag LOCUS_09560 7023 7985 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089304.1 protein_id gnl|my_center|LOCUS_09560 9378 7963 gene locus_tag LOCUS_09570 9378 7963 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_09570 9785 9375 gene locus_tag LOCUS_09580 9785 9375 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_09580 10715 9813 gene locus_tag LOCUS_09590 10715 9813 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_09590 12197 10767 gene locus_tag LOCUS_09600 12197 10767 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU9 protein_id gnl|my_center|LOCUS_09600 12499 12212 gene locus_tag LOCUS_09610 12499 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 12972 12487 gene locus_tag LOCUS_09620 12972 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14218 13088 gene locus_tag LOCUS_09630 14218 13088 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_09630 15824 14478 gene locus_tag LOCUS_09640 15824 14478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_09640 16108 17562 gene locus_tag LOCUS_09650 gene tacA 16108 17562 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_09650 17624 18109 gene locus_tag LOCUS_09660 17624 18109 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_09660 18175 18666 gene locus_tag LOCUS_09670 18175 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 18928 19713 gene locus_tag LOCUS_09680 18928 19713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385411.1 protein_id gnl|my_center|LOCUS_09680 19777 21330 gene locus_tag LOCUS_09690 gene rpoN2 19777 21330 CDS product RNA polymerase sigma-54 factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30333 protein_id gnl|my_center|LOCUS_09690 21435 22034 gene locus_tag LOCUS_09700 21435 22034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974229.1 protein_id gnl|my_center|LOCUS_09700 22182 22646 gene locus_tag LOCUS_09710 gene PtsN 22182 22646 CDS product PTS lactose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721599.1 protein_id gnl|my_center|LOCUS_09710 23672 22647 gene locus_tag LOCUS_09720 23672 22647 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_09720 24620 23715 gene locus_tag LOCUS_09730 24620 23715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_09730 25885 24896 gene locus_tag LOCUS_09740 25885 24896 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 protein_id gnl|my_center|LOCUS_09740 25972 26664 gene locus_tag LOCUS_09750 25972 26664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 protein_id gnl|my_center|LOCUS_09750 26985 27401 gene locus_tag LOCUS_09760 26985 27401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 27412 29124 gene locus_tag LOCUS_09770 27412 29124 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 protein_id gnl|my_center|LOCUS_09770 30090 29293 gene locus_tag LOCUS_09780 gene cysH 30090 29293 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_09780 30614 30087 gene locus_tag LOCUS_09790 30614 30087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 32310 30607 gene locus_tag LOCUS_09800 32310 30607 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969242.1 protein_id gnl|my_center|LOCUS_09800 32606 32307 gene locus_tag LOCUS_09810 32606 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 33408 32608 gene locus_tag LOCUS_09820 33408 32608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 33586 34122 gene locus_tag LOCUS_09830 33586 34122 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521881.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence020 371 838 gene locus_tag LOCUS_09840 371 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 849 1643 gene locus_tag LOCUS_09850 849 1643 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_09850 1658 1978 gene locus_tag LOCUS_09860 gene ybjQ 1658 1978 CDS product UPF0145 protein YbjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NPG3 protein_id gnl|my_center|LOCUS_09860 2087 2830 gene locus_tag LOCUS_09870 2087 2830 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K1 protein_id gnl|my_center|LOCUS_09870 2931 3470 gene locus_tag LOCUS_09880 2931 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4298 3534 gene locus_tag LOCUS_09890 4298 3534 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_09890 4361 5062 gene locus_tag LOCUS_09900 gene sfsA 4361 5062 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_09900 5074 5895 gene locus_tag LOCUS_09910 gene map 5074 5895 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9X3 protein_id gnl|my_center|LOCUS_09910 5885 6568 gene locus_tag LOCUS_09920 gene radC 5885 6568 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_09920 7346 6591 gene locus_tag LOCUS_09930 gene truA 7346 6591 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_09930 8254 7346 gene locus_tag LOCUS_09940 gene fmt 8254 7346 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K0 protein_id gnl|my_center|LOCUS_09940 8776 8261 gene locus_tag LOCUS_09950 gene def 8776 8261 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_09950 9428 8832 gene locus_tag LOCUS_09960 gene recR 9428 8832 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_09960 9795 9415 gene locus_tag LOCUS_09970 9795 9415 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H2 protein_id gnl|my_center|LOCUS_09970 10263 9826 gene locus_tag LOCUS_09980 gene nifU 10263 9826 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_09980 11720 10302 gene locus_tag LOCUS_09990 gene cysS 11720 10302 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS3 protein_id gnl|my_center|LOCUS_09990 12390 11746 gene locus_tag LOCUS_10000 12390 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 13773 12400 gene locus_tag LOCUS_10010 gene radA 13773 12400 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_10010 14784 13801 gene locus_tag LOCUS_10020 14784 13801 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_10020 18084 14899 gene locus_tag LOCUS_10030 gene mexF 18084 14899 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709300.1 protein_id gnl|my_center|LOCUS_10030 19281 18088 gene locus_tag LOCUS_10040 19281 18088 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_10040 20228 19455 gene locus_tag LOCUS_10050 gene rrm2 20228 19455 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y8 protein_id gnl|my_center|LOCUS_10050 20709 20377 gene locus_tag LOCUS_10060 20709 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 22032 20713 gene locus_tag LOCUS_10070 gene gltX 22032 20713 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 protein_id gnl|my_center|LOCUS_10070 22545 22216 gene locus_tag LOCUS_10080 22545 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 22704 23108 gene locus_tag LOCUS_10090 22704 23108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_10090 24770 23109 gene locus_tag LOCUS_10100 gene nadE 24770 23109 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_10100 24866 25501 gene locus_tag LOCUS_10110 gene plsY 24866 25501 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAX7 protein_id gnl|my_center|LOCUS_10110 25677 26783 gene locus_tag LOCUS_10120 25677 26783 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_10120 26871 29564 gene locus_tag LOCUS_10130 gene topA 26871 29564 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA12 protein_id gnl|my_center|LOCUS_10130 29561 31786 gene locus_tag LOCUS_10140 gene rnr 29561 31786 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYS4 protein_id gnl|my_center|LOCUS_10140 31863 33359 gene locus_tag LOCUS_10150 31863 33359 CDS product outer membrane protein in capsule/EPS biosynthesis locus inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence021 3 356 gene locus_tag LOCUS_10160 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 360 2213 gene locus_tag LOCUS_10170 gene pbpA 360 2213 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_10170 2210 3334 gene locus_tag LOCUS_10180 2210 3334 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_10180 3468 3543 gene locus_tag LOCUS_t00120 3468 3543 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4148 3786 gene locus_tag LOCUS_10190 4148 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4368 4138 gene locus_tag LOCUS_10200 4368 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4703 4374 gene locus_tag LOCUS_10210 4703 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5115 4693 gene locus_tag LOCUS_10220 5115 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5702 5196 gene locus_tag LOCUS_10230 5702 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 6433 5732 gene locus_tag LOCUS_10240 6433 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6671 7333 gene locus_tag LOCUS_10250 6671 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703843.1 protein_id gnl|my_center|LOCUS_10250 9112 7598 gene locus_tag LOCUS_10260 9112 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 9562 9314 gene locus_tag LOCUS_10270 9562 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11439 10141 gene locus_tag LOCUS_10280 11439 10141 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_10280 11849 12157 gene locus_tag LOCUS_10290 11849 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 12147 13235 gene locus_tag LOCUS_10300 12147 13235 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_10300 14122 13232 gene locus_tag LOCUS_10310 14122 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 15179 14148 gene locus_tag LOCUS_10320 15179 14148 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528318.1 protein_id gnl|my_center|LOCUS_10320 16560 15688 gene locus_tag LOCUS_10330 16560 15688 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_10330 17503 16898 gene locus_tag LOCUS_10340 gene azoR3 17503 16898 CDS product FMN-dependent NADH-azoreductase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ17 protein_id gnl|my_center|LOCUS_10340 17606 18586 gene locus_tag LOCUS_10350 17606 18586 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_10350 19281 18643 gene locus_tag LOCUS_10360 19281 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 20842 19526 gene locus_tag LOCUS_10370 20842 19526 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967075.1 protein_id gnl|my_center|LOCUS_10370 20950 21474 gene locus_tag LOCUS_10380 20950 21474 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_10380 21474 22220 gene locus_tag LOCUS_10390 21474 22220 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970029.1 protein_id gnl|my_center|LOCUS_10390 22230 23090 gene locus_tag LOCUS_10400 22230 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941135.1 protein_id gnl|my_center|LOCUS_10400 23400 26405 gene locus_tag LOCUS_10410 23400 26405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 27971 26472 gene locus_tag LOCUS_10420 27971 26472 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_10420 28902 28099 gene locus_tag LOCUS_10430 28902 28099 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_10430 29937 28915 gene locus_tag LOCUS_10440 29937 28915 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_10440 30043 31119 gene locus_tag LOCUS_10450 30043 31119 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6L9 protein_id gnl|my_center|LOCUS_10450 >Feature sequence022 1452 163 gene locus_tag LOCUS_10460 gene gltA 1452 163 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBR5 protein_id gnl|my_center|LOCUS_10460 2943 1495 gene locus_tag LOCUS_10470 gene gltX2 2943 1495 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_10470 2985 5132 gene locus_tag LOCUS_10480 2985 5132 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_10480 5737 5126 gene locus_tag LOCUS_10490 gene lexA 5737 5126 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PW3 protein_id gnl|my_center|LOCUS_10490 7106 5886 gene locus_tag LOCUS_10500 gene moeA 7106 5886 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_10500 7573 7106 gene locus_tag LOCUS_10510 gene moaC 7573 7106 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC52 protein_id gnl|my_center|LOCUS_10510 8355 7570 gene locus_tag LOCUS_10520 gene trpC 8355 7570 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94327 protein_id gnl|my_center|LOCUS_10520 9371 8352 gene locus_tag LOCUS_10530 gene trpD 9371 8352 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X8 protein_id gnl|my_center|LOCUS_10530 9964 9368 gene locus_tag LOCUS_10540 gene trpG 9964 9368 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_10540 10068 11036 gene locus_tag LOCUS_10550 10068 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 12509 11037 gene locus_tag LOCUS_10560 12509 11037 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_10560 14443 12512 gene locus_tag LOCUS_10570 gene ybaU 14443 12512 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337149.1 protein_id gnl|my_center|LOCUS_10570 14579 15337 gene locus_tag LOCUS_10580 gene tpiA 14579 15337 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_10580 15543 15992 gene locus_tag LOCUS_10590 15543 15992 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531735.1 protein_id gnl|my_center|LOCUS_10590 16072 17700 gene locus_tag LOCUS_10600 gene pyrG 16072 17700 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E2 protein_id gnl|my_center|LOCUS_10600 18818 17718 gene locus_tag LOCUS_10610 18818 17718 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968856.1 protein_id gnl|my_center|LOCUS_10610 18873 19835 gene locus_tag LOCUS_10620 18873 19835 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_10620 21391 19832 gene locus_tag LOCUS_10630 gene leuA 21391 19832 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H607 protein_id gnl|my_center|LOCUS_10630 23310 21745 gene locus_tag LOCUS_10640 23310 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_10640 24074 23460 gene locus_tag LOCUS_10650 gene rpsD 24074 23460 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFE0 protein_id gnl|my_center|LOCUS_10650 24834 24358 gene locus_tag LOCUS_10660 24834 24358 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_10660 26036 24831 gene locus_tag LOCUS_10670 26036 24831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 26283 26585 gene locus_tag LOCUS_10680 gene gatC 26283 26585 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 protein_id gnl|my_center|LOCUS_10680 26585 28060 gene locus_tag LOCUS_10690 gene gatA 26585 28060 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 protein_id gnl|my_center|LOCUS_10690 28187 28663 gene locus_tag LOCUS_10700 28187 28663 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729805.1 protein_id gnl|my_center|LOCUS_10700 28799 30322 gene locus_tag LOCUS_10710 gene gatB 28799 30322 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH5 protein_id gnl|my_center|LOCUS_10710 >Feature sequence023 <1 707 gene locus_tag LOCUS_10720 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387814.1:methylmalonyl-CoA carboxyltransferase 1100 3085 gene locus_tag LOCUS_10730 gene pccA 1100 3085 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140126.1 protein_id gnl|my_center|LOCUS_10730 3072 3368 gene locus_tag LOCUS_10740 gene acyP 3072 3368 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ4 protein_id gnl|my_center|LOCUS_10740 3437 4309 gene locus_tag LOCUS_10750 gene motA 3437 4309 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_10750 5408 4692 gene locus_tag LOCUS_10760 5408 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5637 6680 gene locus_tag LOCUS_10770 gene argC 5637 6680 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRM4 protein_id gnl|my_center|LOCUS_10770 6712 7236 gene locus_tag LOCUS_10780 6712 7236 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_10780 7233 8456 gene locus_tag LOCUS_10790 7233 8456 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 protein_id gnl|my_center|LOCUS_10790 10334 8445 gene locus_tag LOCUS_10800 gene sppA 10334 8445 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG2 protein_id gnl|my_center|LOCUS_10800 10477 11541 gene locus_tag LOCUS_10810 10477 11541 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331258.1 protein_id gnl|my_center|LOCUS_10810 11726 12013 gene locus_tag LOCUS_10820 gene groES1 11726 12013 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1D4 protein_id gnl|my_center|LOCUS_10820 12053 13696 gene locus_tag LOCUS_10830 gene groL2 12053 13696 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 protein_id gnl|my_center|LOCUS_10830 14002 14460 gene locus_tag LOCUS_10840 14002 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 15134 15523 gene locus_tag LOCUS_10850 15134 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44031 protein_id gnl|my_center|LOCUS_10850 15516 15797 gene locus_tag LOCUS_10860 15516 15797 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103157.1 protein_id gnl|my_center|LOCUS_10860 17163 15994 gene locus_tag LOCUS_10870 17163 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_10870 17388 17582 gene locus_tag LOCUS_10880 17388 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 17582 19009 gene locus_tag LOCUS_10890 17582 19009 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_10890 19009 19233 gene locus_tag LOCUS_10900 19009 19233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 19353 19790 gene locus_tag LOCUS_10910 19353 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 19796 20605 gene locus_tag LOCUS_10920 19796 20605 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531984.1 protein_id gnl|my_center|LOCUS_10920 20857 21195 gene locus_tag LOCUS_10930 20857 21195 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388885.1 protein_id gnl|my_center|LOCUS_10930 21212 22645 gene locus_tag LOCUS_10940 gene amtB 21212 22645 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WR5 protein_id gnl|my_center|LOCUS_10940 22825 23166 gene locus_tag LOCUS_10950 gene glnK 22825 23166 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083440.1 protein_id gnl|my_center|LOCUS_10950 23829 23467 gene locus_tag LOCUS_10960 gene ybaA 23829 23467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAQ9 protein_id gnl|my_center|LOCUS_10960 24486 23932 gene locus_tag LOCUS_10970 24486 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 25112 24483 gene locus_tag LOCUS_10980 25112 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 25747 25133 gene locus_tag LOCUS_10990 25747 25133 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_10990 25832 26782 gene locus_tag LOCUS_11000 25832 26782 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_11000 26782 27216 gene locus_tag LOCUS_11010 26782 27216 CDS product putative 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704983.1 protein_id gnl|my_center|LOCUS_11010 27456 28043 gene locus_tag LOCUS_11020 gene mobA 27456 28043 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKR0 protein_id gnl|my_center|LOCUS_11020 28160 28741 gene locus_tag LOCUS_11030 28160 28741 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence024 3 2429 gene locus_tag LOCUS_11040 gene glnD 3 2429 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_11040 2434 3561 gene locus_tag LOCUS_11050 2434 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3571 3996 gene locus_tag LOCUS_11060 gene rlmH 3571 3996 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Y4 protein_id gnl|my_center|LOCUS_11060 3993 5246 gene locus_tag LOCUS_11070 3993 5246 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_11070 5270 6661 gene locus_tag LOCUS_11080 gene ctpA 5270 6661 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_11080 6674 7930 gene locus_tag LOCUS_11090 6674 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7927 8424 gene locus_tag LOCUS_11100 7927 8424 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_11100 8421 8924 gene locus_tag LOCUS_11110 gene coq7 8421 8924 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_11110 8921 9910 gene locus_tag LOCUS_11120 gene asg 8921 9910 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405465.1 protein_id gnl|my_center|LOCUS_11120 9953 10786 gene locus_tag LOCUS_11130 gene dapF 9953 10786 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_11130 10776 11387 gene locus_tag LOCUS_11140 10776 11387 CDS product 2OG-Fe(II) oxygenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_11140 11565 11368 gene locus_tag LOCUS_11150 11565 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11959 11612 gene locus_tag LOCUS_11160 11959 11612 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_11160 12306 11956 gene locus_tag LOCUS_11170 12306 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 13956 12442 gene locus_tag LOCUS_11180 13956 12442 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_11180 14603 13971 gene locus_tag LOCUS_11190 gene gmk 14603 13971 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_11190 16002 14605 gene locus_tag LOCUS_11200 gene fumC 16002 14605 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PB6 protein_id gnl|my_center|LOCUS_11200 16523 16020 gene locus_tag LOCUS_11210 16523 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708585.1 protein_id gnl|my_center|LOCUS_11210 17351 16575 gene locus_tag LOCUS_11220 17351 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 17627 18145 gene locus_tag LOCUS_11230 17627 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 18729 18319 gene locus_tag LOCUS_11240 18729 18319 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_11240 18971 18729 gene locus_tag LOCUS_11250 18971 18729 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK01 protein_id gnl|my_center|LOCUS_11250 19093 19836 gene locus_tag LOCUS_11260 19093 19836 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_11260 19833 20645 gene locus_tag LOCUS_11270 19833 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 21793 20636 gene locus_tag LOCUS_11280 21793 20636 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204681.1 protein_id gnl|my_center|LOCUS_11280 21853 22728 gene locus_tag LOCUS_11290 21853 22728 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_11290 22725 23588 gene locus_tag LOCUS_11300 22725 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 23585 24856 gene locus_tag LOCUS_11310 23585 24856 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_11310 25051 26025 gene locus_tag LOCUS_11320 gene ispH 25051 26025 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD1 protein_id gnl|my_center|LOCUS_11320 26205 27362 gene locus_tag LOCUS_11330 26205 27362 CDS product hopanoid biosynthesis associated radical SAM protein HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085790.1 protein_id gnl|my_center|LOCUS_11330 27569 27414 gene locus_tag LOCUS_11340 27569 27414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence025 606 1049 gene locus_tag LOCUS_11350 606 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1039 1395 gene locus_tag LOCUS_11360 1039 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1392 2180 gene locus_tag LOCUS_11370 1392 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2463 2681 gene locus_tag LOCUS_11380 2463 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2861 3514 gene locus_tag LOCUS_11390 2861 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3549 3752 gene locus_tag LOCUS_11400 3549 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3982 5346 gene locus_tag LOCUS_11410 3982 5346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 protein_id gnl|my_center|LOCUS_11410 7255 5780 gene locus_tag LOCUS_11420 7255 5780 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W90 protein_id gnl|my_center|LOCUS_11420 7725 7252 gene locus_tag LOCUS_11430 gene secB 7725 7252 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJC2 protein_id gnl|my_center|LOCUS_11430 7956 8594 gene locus_tag LOCUS_11440 7956 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_11440 8594 9877 gene locus_tag LOCUS_11450 8594 9877 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_11450 9874 10392 gene locus_tag LOCUS_11460 9874 10392 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338814.1 protein_id gnl|my_center|LOCUS_11460 10605 12560 gene locus_tag LOCUS_11470 10605 12560 CDS product squalene-hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_11470 12567 13220 gene locus_tag LOCUS_11480 12567 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14293 13385 gene locus_tag LOCUS_11490 14293 13385 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919958.1 protein_id gnl|my_center|LOCUS_11490 14292 15260 gene locus_tag LOCUS_11500 gene miaA 14292 15260 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G43 protein_id gnl|my_center|LOCUS_11500 15318 17081 gene locus_tag LOCUS_11510 15318 17081 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6J3 protein_id gnl|my_center|LOCUS_11510 17086 17634 gene locus_tag LOCUS_11520 gene ilvH 17086 17634 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 protein_id gnl|my_center|LOCUS_11520 17637 18656 gene locus_tag LOCUS_11530 gene ilvC 17637 18656 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 protein_id gnl|my_center|LOCUS_11530 19191 18730 gene locus_tag LOCUS_11540 19191 18730 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_11540 20603 19200 gene locus_tag LOCUS_11550 20603 19200 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919056.1 protein_id gnl|my_center|LOCUS_11550 20999 20766 gene locus_tag LOCUS_11560 20999 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 21129 21725 gene locus_tag LOCUS_11570 gene lipB 21129 21725 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA5 protein_id gnl|my_center|LOCUS_11570 21786 23588 gene locus_tag LOCUS_11580 21786 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 24812 23625 gene locus_tag LOCUS_11590 24812 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 25249 25521 gene locus_tag LOCUS_11600 25249 25521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 26206 27039 gene locus_tag LOCUS_11610 26206 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 27056 27394 gene locus_tag LOCUS_11620 27056 27394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence026 1977 844 gene locus_tag LOCUS_11630 1977 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3006 2041 gene locus_tag LOCUS_11640 3006 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3565 3020 gene locus_tag LOCUS_11650 3565 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4982 6298 gene locus_tag LOCUS_11660 4982 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6327 7031 gene locus_tag LOCUS_11670 6327 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7300 7225 gene locus_tag LOCUS_t00130 7300 7225 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7713 7390 gene locus_tag LOCUS_11680 7713 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 8047 9390 gene locus_tag LOCUS_11690 gene aroA 8047 9390 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_11690 9387 10064 gene locus_tag LOCUS_11700 gene cmk 9387 10064 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E0 protein_id gnl|my_center|LOCUS_11700 10216 11949 gene locus_tag LOCUS_11710 10216 11949 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9B0 protein_id gnl|my_center|LOCUS_11710 12226 12504 gene locus_tag LOCUS_11720 gene ihfB 12226 12504 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C3 protein_id gnl|my_center|LOCUS_11720 12567 12914 gene locus_tag LOCUS_11730 12567 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12934 13641 gene locus_tag LOCUS_11740 gene pyrF 12934 13641 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_11740 13638 14288 gene locus_tag LOCUS_11750 gene trpF 13638 14288 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE6 protein_id gnl|my_center|LOCUS_11750 14372 15565 gene locus_tag LOCUS_11760 gene trpB 14372 15565 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB99 protein_id gnl|my_center|LOCUS_11760 15565 16386 gene locus_tag LOCUS_11770 gene trpA 15565 16386 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07344 protein_id gnl|my_center|LOCUS_11770 16383 17261 gene locus_tag LOCUS_11780 gene accD 16383 17261 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC3 protein_id gnl|my_center|LOCUS_11780 17273 18574 gene locus_tag LOCUS_11790 17273 18574 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_11790 19439 18576 gene locus_tag LOCUS_11800 19439 18576 CDS product ornithine-acyl ACP N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_11800 20879 19581 gene locus_tag LOCUS_11810 20879 19581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_11810 21477 21043 gene locus_tag LOCUS_11820 21477 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 21929 21552 gene locus_tag LOCUS_11830 21929 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921381.1 protein_id gnl|my_center|LOCUS_11830 22149 21946 gene locus_tag LOCUS_11840 22149 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389318.1 protein_id gnl|my_center|LOCUS_11840 25265 22296 gene locus_tag LOCUS_11850 25265 22296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 25669 25304 gene locus_tag LOCUS_11860 25669 25304 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_11860 25916 25662 gene locus_tag LOCUS_11870 25916 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 26072 26506 gene locus_tag LOCUS_11880 26072 26506 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_11880 26626 27330 gene locus_tag LOCUS_11890 26626 27330 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence027 719 162 gene locus_tag LOCUS_11900 719 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 817 1431 gene locus_tag LOCUS_11910 817 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1438 1890 gene locus_tag LOCUS_11920 1438 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1941 2363 gene locus_tag LOCUS_11930 1941 2363 CDS product glyoxalase/bleomycin resistance protein/dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527755.1 protein_id gnl|my_center|LOCUS_11930 2826 3941 gene locus_tag LOCUS_11940 gene gcvT2 2826 3941 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I140 protein_id gnl|my_center|LOCUS_11940 3945 4319 gene locus_tag LOCUS_11950 gene gcvH 3945 4319 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V5 protein_id gnl|my_center|LOCUS_11950 4319 5089 gene locus_tag LOCUS_11960 4319 5089 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 protein_id gnl|my_center|LOCUS_11960 5105 6472 gene locus_tag LOCUS_11970 gene gcvPA 5105 6472 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A353 protein_id gnl|my_center|LOCUS_11970 6469 8040 gene locus_tag LOCUS_11980 6469 8040 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 protein_id gnl|my_center|LOCUS_11980 8817 8200 gene locus_tag LOCUS_11990 8817 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9007 9543 gene locus_tag LOCUS_12000 gene msrA 9007 9543 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_12000 10135 9524 gene locus_tag LOCUS_12010 10135 9524 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_12010 10251 10538 gene locus_tag LOCUS_12020 10251 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_12020 10776 12158 gene locus_tag LOCUS_12030 10776 12158 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_12030 12196 12269 gene locus_tag LOCUS_t00140 12196 12269 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 14439 12709 gene locus_tag LOCUS_12040 gene ilvD 14439 12709 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_12040 15048 14713 gene locus_tag LOCUS_12050 gene erpA 15048 14713 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD57 protein_id gnl|my_center|LOCUS_12050 15523 15101 gene locus_tag LOCUS_12060 15523 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 16628 15465 gene locus_tag LOCUS_12070 16628 15465 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 protein_id gnl|my_center|LOCUS_12070 17562 16759 gene locus_tag LOCUS_12080 17562 16759 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971897.1 protein_id gnl|my_center|LOCUS_12080 18026 17559 gene locus_tag LOCUS_12090 18026 17559 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_12090 20872 18056 gene locus_tag LOCUS_12100 gene glnE 20872 18056 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 22100 20874 gene locus_tag LOCUS_12110 gene tyrS 22100 20874 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 protein_id gnl|my_center|LOCUS_12110 22443 23594 gene locus_tag LOCUS_12120 gene anmK 22443 23594 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 protein_id gnl|my_center|LOCUS_12120 24208 23561 gene locus_tag LOCUS_12130 24208 23561 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_12130 24349 25428 gene locus_tag LOCUS_12140 gene nifS 24349 25428 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence028 1527 901 gene locus_tag LOCUS_12150 gene clpP2 1527 901 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFY6 protein_id gnl|my_center|LOCUS_12150 3095 1575 gene locus_tag LOCUS_12160 gene tig 3095 1575 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE53 protein_id gnl|my_center|LOCUS_12160 3223 3139 gene locus_tag LOCUS_t00150 3223 3139 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3375 3551 gene locus_tag LOCUS_12170 3375 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3548 4480 gene locus_tag LOCUS_12180 3548 4480 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_12180 4586 5611 gene locus_tag LOCUS_12190 4586 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5624 6319 gene locus_tag LOCUS_12200 gene tptC 5624 6319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_12200 6316 7473 gene locus_tag LOCUS_12210 6316 7473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_12210 7486 8664 gene locus_tag LOCUS_12220 7486 8664 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_12220 9060 8668 gene locus_tag LOCUS_12230 9060 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 10134 9349 gene locus_tag LOCUS_12240 10134 9349 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_12240 10823 10134 gene locus_tag LOCUS_12250 gene psd 10823 10134 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NP2 protein_id gnl|my_center|LOCUS_12250 10979 11482 gene locus_tag LOCUS_12260 10979 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 12767 11523 gene locus_tag LOCUS_12270 12767 11523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_12270 15231 12889 gene locus_tag LOCUS_12280 15231 12889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_12280 16175 15249 gene locus_tag LOCUS_12290 16175 15249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_12290 17359 16289 gene locus_tag LOCUS_12300 17359 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 17548 17871 gene locus_tag LOCUS_12310 17548 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 17910 19577 gene locus_tag LOCUS_12320 gene fixN 17910 19577 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03073 protein_id gnl|my_center|LOCUS_12320 19590 20318 gene locus_tag LOCUS_12330 19590 20318 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525001.1 protein_id gnl|my_center|LOCUS_12330 20329 20484 gene locus_tag LOCUS_12340 20329 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 20490 21434 gene locus_tag LOCUS_12350 gene fixP 20490 21434 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIY8 protein_id gnl|my_center|LOCUS_12350 21437 22873 gene locus_tag LOCUS_12360 gene rdxB 21437 22873 CDS product protein RdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54932 protein_id gnl|my_center|LOCUS_12360 22870 23364 gene locus_tag LOCUS_12370 gene fixH 22870 23364 CDS product nitrogen fixation protein FixH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085553.1 protein_id gnl|my_center|LOCUS_12370 23361 25460 gene locus_tag LOCUS_12380 23361 25460 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_12380 25457 25612 gene locus_tag LOCUS_12390 25457 25612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence029 95 1372 gene locus_tag LOCUS_12400 gene glpK 95 1372 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RST6 protein_id gnl|my_center|LOCUS_12400 1486 1412 gene locus_tag LOCUS_t00160 1486 1412 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1909 1550 gene locus_tag LOCUS_12410 1909 1550 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_12410 2156 2917 gene locus_tag LOCUS_12420 2156 2917 CDS product formiminoglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918629.1 protein_id gnl|my_center|LOCUS_12420 3287 4159 gene locus_tag LOCUS_12430 3287 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4178 5242 gene locus_tag LOCUS_12440 4178 5242 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_12440 5933 5265 gene locus_tag LOCUS_12450 5933 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 6013 7158 gene locus_tag LOCUS_12460 6013 7158 CDS product toluene ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531885.1 protein_id gnl|my_center|LOCUS_12460 7158 7922 gene locus_tag LOCUS_12470 7158 7922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_12470 7926 8879 gene locus_tag LOCUS_12480 7926 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 8902 9447 gene locus_tag LOCUS_12490 8902 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 9952 9512 gene locus_tag LOCUS_12500 9952 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 10149 11540 gene locus_tag LOCUS_12510 10149 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_12510 12421 11555 gene locus_tag LOCUS_12520 12421 11555 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_12520 14777 12519 gene locus_tag LOCUS_12530 14777 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 16052 14781 gene locus_tag LOCUS_12540 gene lysA 16052 14781 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9L4 protein_id gnl|my_center|LOCUS_12540 16306 16052 gene locus_tag LOCUS_12550 16306 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 17694 16303 gene locus_tag LOCUS_12560 gene argH 17694 16303 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 protein_id gnl|my_center|LOCUS_12560 18359 17691 gene locus_tag LOCUS_12570 18359 17691 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_12570 19259 18372 gene locus_tag LOCUS_12580 gene hbdA 19259 18372 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709198.1 protein_id gnl|my_center|LOCUS_12580 19726 21858 gene locus_tag LOCUS_12590 19726 21858 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_12590 23096 22164 gene locus_tag LOCUS_12600 23096 22164 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_12600 23842 23093 gene locus_tag LOCUS_12610 gene etfB 23842 23093 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53575 protein_id gnl|my_center|LOCUS_12610 >Feature sequence030 13757 267 gene locus_tag LOCUS_12620 13757 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14486 13797 gene locus_tag LOCUS_12630 14486 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 16354 14489 gene locus_tag LOCUS_12640 16354 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_12640 17100 16393 gene locus_tag LOCUS_12650 17100 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 17520 17104 gene locus_tag LOCUS_12660 gene exbD2 17520 17104 CDS product transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_12660 19348 17537 gene locus_tag LOCUS_12670 gene exbB2 19348 17537 CDS product transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_12670 21042 19351 gene locus_tag LOCUS_12680 21042 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 protein_id gnl|my_center|LOCUS_12680 21387 22754 gene locus_tag LOCUS_12690 gene trmFO 21387 22754 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_12690 22805 22880 gene locus_tag LOCUS_t00170 22805 22880 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23706 23185 gene locus_tag LOCUS_12700 23706 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 23816 24475 gene locus_tag LOCUS_12710 23816 24475 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence031 2630 240 gene locus_tag LOCUS_12720 gene pheT 2630 240 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WI2 protein_id gnl|my_center|LOCUS_12720 3710 2634 gene locus_tag LOCUS_12730 gene pheS 3710 2634 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_12730 4144 3755 gene locus_tag LOCUS_12740 gene rplT 4144 3755 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCP9 protein_id gnl|my_center|LOCUS_12740 4396 4196 gene locus_tag LOCUS_12750 gene rpmI 4396 4196 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E2 protein_id gnl|my_center|LOCUS_12750 4845 5759 gene locus_tag LOCUS_12760 4845 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_12760 6565 5765 gene locus_tag LOCUS_12770 6565 5765 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_12770 6757 8082 gene locus_tag LOCUS_12780 6757 8082 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_12780 8773 8096 gene locus_tag LOCUS_12790 8773 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_12790 9221 8784 gene locus_tag LOCUS_12800 9221 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390640.1 protein_id gnl|my_center|LOCUS_12800 9459 10622 gene locus_tag LOCUS_12810 9459 10622 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918642.1 protein_id gnl|my_center|LOCUS_12810 10928 10698 gene locus_tag LOCUS_12820 10928 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 10830 12029 gene locus_tag LOCUS_12830 10830 12029 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265617.1 protein_id gnl|my_center|LOCUS_12830 12032 12967 gene locus_tag LOCUS_12840 12032 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403057.1 protein_id gnl|my_center|LOCUS_12840 12981 13529 gene locus_tag LOCUS_12850 12981 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 13786 15216 gene locus_tag LOCUS_12860 13786 15216 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090493.1 protein_id gnl|my_center|LOCUS_12860 15209 16927 gene locus_tag LOCUS_12870 gene rtxB 15209 16927 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263952.1 protein_id gnl|my_center|LOCUS_12870 16927 18237 gene locus_tag LOCUS_12880 16927 18237 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_12880 18979 18209 gene locus_tag LOCUS_12890 18979 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_12890 20091 18982 gene locus_tag LOCUS_12900 20091 18982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_12900 20682 20095 gene locus_tag LOCUS_12910 20682 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 21998 20682 gene locus_tag LOCUS_12920 21998 20682 CDS product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_12920 22774 22232 gene locus_tag LOCUS_12930 22774 22232 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTP9 protein_id gnl|my_center|LOCUS_12930 22974 23609 gene locus_tag LOCUS_12940 22974 23609 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886699.1 protein_id gnl|my_center|LOCUS_12940 23609 24187 gene locus_tag LOCUS_12950 23609 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_12950 24249 24488 gene locus_tag LOCUS_12960 gene purS 24249 24488 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence032 421 143 gene locus_tag LOCUS_12970 421 143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530925.1 protein_id gnl|my_center|LOCUS_12970 738 7139 gene locus_tag LOCUS_12980 738 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7226 8599 gene locus_tag LOCUS_12990 7226 8599 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731109.1 protein_id gnl|my_center|LOCUS_12990 9164 8586 gene locus_tag LOCUS_13000 9164 8586 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_13000 11492 9375 gene locus_tag LOCUS_13010 gene flhA 11492 9375 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_13010 12869 11496 gene locus_tag LOCUS_13020 12869 11496 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_13020 13658 12900 gene locus_tag LOCUS_13030 13658 12900 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_13030 14023 13658 gene locus_tag LOCUS_13040 14023 13658 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_13040 14670 14023 gene locus_tag LOCUS_13050 14670 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 15682 14660 gene locus_tag LOCUS_13060 gene fliG 15682 14660 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6V1 protein_id gnl|my_center|LOCUS_13060 17396 15702 gene locus_tag LOCUS_13070 17396 15702 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ6 protein_id gnl|my_center|LOCUS_13070 17900 17613 gene locus_tag LOCUS_13080 17900 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 protein_id gnl|my_center|LOCUS_13080 19419 18076 gene locus_tag LOCUS_13090 gene flgE 19419 18076 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY3 protein_id gnl|my_center|LOCUS_13090 20113 19448 gene locus_tag LOCUS_13100 20113 19448 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 protein_id gnl|my_center|LOCUS_13100 21749 20130 gene locus_tag LOCUS_13110 21749 20130 CDS product flagellar hook-length control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 protein_id gnl|my_center|LOCUS_13110 21961 23091 gene locus_tag LOCUS_13120 gene mnmA 21961 23091 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_13120 <24615 23097 gene locus_tag LOCUS_13130 <24615 23097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039175.1:glucan 1,4-alpha-glucosidase >Feature sequence033 748 413 gene locus_tag LOCUS_13140 748 413 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_13140 1209 835 gene locus_tag LOCUS_13150 1209 835 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709748.1 protein_id gnl|my_center|LOCUS_13150 3793 1244 gene locus_tag LOCUS_13160 3793 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4073 5566 gene locus_tag LOCUS_13170 4073 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 6264 5569 gene locus_tag LOCUS_13180 6264 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 6884 6423 gene locus_tag LOCUS_13190 6884 6423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709362.1 protein_id gnl|my_center|LOCUS_13190 7849 6917 gene locus_tag LOCUS_13200 gene qmcA 7849 6917 CDS product protein QmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA55 protein_id gnl|my_center|LOCUS_13200 8044 8385 gene locus_tag LOCUS_13210 8044 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_13210 9223 8390 gene locus_tag LOCUS_13220 gene ampR 9223 8390 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972737.1 protein_id gnl|my_center|LOCUS_13220 11191 9422 gene locus_tag LOCUS_13230 gene mcp40H-7 11191 9422 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941695.1 protein_id gnl|my_center|LOCUS_13230 11237 12145 gene locus_tag LOCUS_13240 11237 12145 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_13240 12142 12585 gene locus_tag LOCUS_13250 12142 12585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722406.1 protein_id gnl|my_center|LOCUS_13250 14067 12766 gene locus_tag LOCUS_13260 14067 12766 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887141.1 protein_id gnl|my_center|LOCUS_13260 14250 16055 gene locus_tag LOCUS_13270 gene lepA 14250 16055 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9F4 protein_id gnl|my_center|LOCUS_13270 19768 16658 gene locus_tag LOCUS_13280 19768 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 20036 21865 gene locus_tag LOCUS_13290 20036 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265756.1 protein_id gnl|my_center|LOCUS_13290 22240 23202 gene locus_tag LOCUS_13300 22240 23202 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_13300 23493 24002 gene locus_tag LOCUS_13310 23493 24002 CDS product PHB granule-associated protein phasin2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640421.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence034 <1 2868 gene locus_tag LOCUS_13320 <1 2868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920570.1:cation transporter 2969 3469 gene locus_tag LOCUS_13330 2969 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3462 4070 gene locus_tag LOCUS_13340 3462 4070 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_13340 4067 6598 gene locus_tag LOCUS_13350 4067 6598 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_13350 6620 7543 gene locus_tag LOCUS_13360 6620 7543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090981.1 protein_id gnl|my_center|LOCUS_13360 7575 7883 gene locus_tag LOCUS_13370 7575 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8122 7898 gene locus_tag LOCUS_13380 8122 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_13380 9336 8119 gene locus_tag LOCUS_13390 9336 8119 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_13390 10349 9333 gene locus_tag LOCUS_13400 gene trbG 10349 9333 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_13400 11029 10346 gene locus_tag LOCUS_13410 11029 10346 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 protein_id gnl|my_center|LOCUS_13410 12340 11036 gene locus_tag LOCUS_13420 gene trbL1 12340 11036 CDS product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 protein_id gnl|my_center|LOCUS_13420 12647 12342 gene locus_tag LOCUS_13430 12647 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 protein_id gnl|my_center|LOCUS_13430 13411 12653 gene locus_tag LOCUS_13440 13411 12653 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_13440 15897 13408 gene locus_tag LOCUS_13450 gene trbE 15897 13408 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_13450 16175 15894 gene locus_tag LOCUS_13460 gene trbD 16175 15894 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090994.1 protein_id gnl|my_center|LOCUS_13460 16558 16172 gene locus_tag LOCUS_13470 16558 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 17541 16558 gene locus_tag LOCUS_13480 gene trbB1 17541 16558 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_13480 18138 17713 gene locus_tag LOCUS_13490 18138 17713 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_13490 20121 18148 gene locus_tag LOCUS_13500 gene traG 20121 18148 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082875.1 protein_id gnl|my_center|LOCUS_13500 20642 20136 gene locus_tag LOCUS_13510 20642 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 21151 20714 gene locus_tag LOCUS_13520 21151 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 22438 21167 gene locus_tag LOCUS_13530 22438 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 22606 22827 gene locus_tag LOCUS_13540 22606 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 22847 23062 gene locus_tag LOCUS_13550 22847 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 23086 23793 gene locus_tag LOCUS_13560 23086 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 23841 24080 gene locus_tag LOCUS_13570 23841 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence035 848 231 gene locus_tag LOCUS_13580 848 231 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_13580 3046 1043 gene locus_tag LOCUS_13590 gene thrS 3046 1043 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_13590 3284 4363 gene locus_tag LOCUS_13600 3284 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4363 5445 gene locus_tag LOCUS_13610 4363 5445 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 protein_id gnl|my_center|LOCUS_13610 5656 6405 gene locus_tag LOCUS_13620 5656 6405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_13620 8422 6602 gene locus_tag LOCUS_13630 8422 6602 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_13630 8618 9490 gene locus_tag LOCUS_13640 8618 9490 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_13640 9493 9699 gene locus_tag LOCUS_13650 9493 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 10015 9830 gene locus_tag LOCUS_13660 10015 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 10699 10280 gene locus_tag LOCUS_13670 10699 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 12045 10696 gene locus_tag LOCUS_13680 gene fliI 12045 10696 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_13680 12238 12951 gene locus_tag LOCUS_13690 gene ctrA 12238 12951 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314973.1 protein_id gnl|my_center|LOCUS_13690 13489 13133 gene locus_tag LOCUS_13700 13489 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_13700 14376 13687 gene locus_tag LOCUS_13710 gene cysE-1 14376 13687 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A19 protein_id gnl|my_center|LOCUS_13710 15730 14471 gene locus_tag LOCUS_13720 15730 14471 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918152.1 protein_id gnl|my_center|LOCUS_13720 15928 16668 gene locus_tag LOCUS_13730 15928 16668 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE5 protein_id gnl|my_center|LOCUS_13730 18175 17039 gene locus_tag LOCUS_13740 18175 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_13740 18875 18318 gene locus_tag LOCUS_13750 18875 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 20472 19192 gene locus_tag LOCUS_13760 20472 19192 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974516.1 protein_id gnl|my_center|LOCUS_13760 20759 22249 gene locus_tag LOCUS_13770 20759 22249 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_13770 23513 22773 gene locus_tag LOCUS_13780 23513 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence036 1014 817 gene locus_tag LOCUS_13790 1014 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1331 3646 gene locus_tag LOCUS_13800 1331 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_13800 3695 4402 gene locus_tag LOCUS_13810 3695 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4490 5098 gene locus_tag LOCUS_13820 4490 5098 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_13820 5187 6425 gene locus_tag LOCUS_13830 5187 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 protein_id gnl|my_center|LOCUS_13830 6449 7894 gene locus_tag LOCUS_13840 6449 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389246.1 protein_id gnl|my_center|LOCUS_13840 8339 9073 gene locus_tag LOCUS_13850 8339 9073 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528120.1 protein_id gnl|my_center|LOCUS_13850 10290 9136 gene locus_tag LOCUS_13860 10290 9136 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_13860 10687 10298 gene locus_tag LOCUS_13870 10687 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886681.1 protein_id gnl|my_center|LOCUS_13870 10834 12069 gene locus_tag LOCUS_13880 gene dadA 10834 12069 CDS product D-amino acid dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_13880 12368 13369 gene locus_tag LOCUS_13890 gene cysD 12368 13369 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNR3 protein_id gnl|my_center|LOCUS_13890 13369 15264 gene locus_tag LOCUS_13900 13369 15264 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_13900 15274 16092 gene locus_tag LOCUS_13910 15274 16092 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_13910 16138 17190 gene locus_tag LOCUS_13920 gene exoZ 16138 17190 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972679.1 protein_id gnl|my_center|LOCUS_13920 17187 18068 gene locus_tag LOCUS_13930 17187 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 18065 19429 gene locus_tag LOCUS_13940 18065 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 19426 20349 gene locus_tag LOCUS_13950 19426 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 20346 21449 gene locus_tag LOCUS_13960 20346 21449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 21446 22636 gene locus_tag LOCUS_13970 21446 22636 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104562.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence037 807 178 gene locus_tag LOCUS_13980 807 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1238 1154 gene locus_tag LOCUS_t00180 1238 1154 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1530 1946 gene locus_tag LOCUS_13990 1530 1946 CDS product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525768.1 protein_id gnl|my_center|LOCUS_13990 1950 4157 gene locus_tag LOCUS_14000 1950 4157 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_14000 4324 5388 gene locus_tag LOCUS_14010 gene alr 4324 5388 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q9 protein_id gnl|my_center|LOCUS_14010 5385 6167 gene locus_tag LOCUS_14020 5385 6167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_14020 6164 6937 gene locus_tag LOCUS_14030 6164 6937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_14030 7567 6959 gene locus_tag LOCUS_14040 7567 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 10182 7567 gene locus_tag LOCUS_14050 10182 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_14050 10319 11311 gene locus_tag LOCUS_14060 gene pyrB 10319 11311 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ49 protein_id gnl|my_center|LOCUS_14060 11308 12549 gene locus_tag LOCUS_14070 gene pyrC 11308 12549 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 protein_id gnl|my_center|LOCUS_14070 13870 12557 gene locus_tag LOCUS_14080 13870 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 14322 13867 gene locus_tag LOCUS_14090 14322 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 15039 14332 gene locus_tag LOCUS_14100 15039 14332 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_14100 15362 15105 gene locus_tag LOCUS_14110 15362 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 15246 16142 gene locus_tag LOCUS_14120 15246 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 16218 16559 gene locus_tag LOCUS_14130 16218 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 16581 17603 gene locus_tag LOCUS_14140 16581 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 17638 18384 gene locus_tag LOCUS_14150 17638 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 18403 18588 gene locus_tag LOCUS_14160 18403 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 19279 18779 gene locus_tag LOCUS_14170 19279 18779 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_14170 19673 19287 gene locus_tag LOCUS_14180 19673 19287 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence038 1170 211 gene locus_tag LOCUS_14190 1170 211 CDS product bactoprenol glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_14190 2167 1220 gene locus_tag LOCUS_14200 gene gshB 2167 1220 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_14200 3057 2242 gene locus_tag LOCUS_14210 3057 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3413 3057 gene locus_tag LOCUS_14220 3413 3057 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK9 protein_id gnl|my_center|LOCUS_14220 4255 3410 gene locus_tag LOCUS_14230 gene rsmI 4255 3410 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN08 protein_id gnl|my_center|LOCUS_14230 4432 5694 gene locus_tag LOCUS_14240 4432 5694 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391441.1 protein_id gnl|my_center|LOCUS_14240 8333 5730 gene locus_tag LOCUS_14250 gene pepN 8333 5730 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_14250 8452 9303 gene locus_tag LOCUS_14260 8452 9303 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_14260 9300 11579 gene locus_tag LOCUS_14270 9300 11579 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532625.1 protein_id gnl|my_center|LOCUS_14270 11585 12127 gene locus_tag LOCUS_14280 11585 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 12987 12124 gene locus_tag LOCUS_14290 12987 12124 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_14290 14623 13238 gene locus_tag LOCUS_14300 gene dnaA 14623 13238 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_14300 15456 15193 gene locus_tag LOCUS_14310 gene rpsT 15456 15193 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY62 protein_id gnl|my_center|LOCUS_14310 15918 15562 gene locus_tag LOCUS_14320 15918 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 16730 15915 gene locus_tag LOCUS_14330 gene mutM 16730 15915 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_14330 16807 17814 gene locus_tag LOCUS_14340 gene trpS 16807 17814 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_14340 17893 18564 gene locus_tag LOCUS_14350 17893 18564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064127.1 protein_id gnl|my_center|LOCUS_14350 18651 19676 gene locus_tag LOCUS_14360 18651 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391281.1 protein_id gnl|my_center|LOCUS_14360 19728 20210 gene locus_tag LOCUS_14370 19728 20210 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706625.1 protein_id gnl|my_center|LOCUS_14370 20290 20844 gene locus_tag LOCUS_14380 20290 20844 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_14380 20880 21470 gene locus_tag LOCUS_14390 20880 21470 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58792 protein_id gnl|my_center|LOCUS_14390 21486 22106 gene locus_tag LOCUS_14400 21486 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 22103 22579 gene locus_tag LOCUS_14410 gene rimI 22103 22579 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence039 646 224 gene locus_tag LOCUS_14420 646 224 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_14420 1558 785 gene locus_tag LOCUS_14430 gene xthA 1558 785 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 protein_id gnl|my_center|LOCUS_14430 2376 1645 gene locus_tag LOCUS_14440 2376 1645 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_14440 5248 2444 gene locus_tag LOCUS_14450 gene valS 5248 2444 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 protein_id gnl|my_center|LOCUS_14450 5367 5762 gene locus_tag LOCUS_14460 5367 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6246 5773 gene locus_tag LOCUS_14470 gene popZ 6246 5773 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_14470 7909 6512 gene locus_tag LOCUS_14480 7909 6512 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_14480 8598 7945 gene locus_tag LOCUS_14490 gene pcm 8598 7945 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087244.1 protein_id gnl|my_center|LOCUS_14490 8914 9405 gene locus_tag LOCUS_14500 8914 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 9508 10155 gene locus_tag LOCUS_14510 9508 10155 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_14510 10407 10213 gene locus_tag LOCUS_14520 10407 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10684 10472 gene locus_tag LOCUS_14530 10684 10472 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532639.1 protein_id gnl|my_center|LOCUS_14530 11478 11071 gene locus_tag LOCUS_14540 11478 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338374.1 protein_id gnl|my_center|LOCUS_14540 13641 11626 gene locus_tag LOCUS_14550 13641 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_14550 16232 13638 gene locus_tag LOCUS_14560 16232 13638 CDS product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338666.1 protein_id gnl|my_center|LOCUS_14560 17050 16229 gene locus_tag LOCUS_14570 17050 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537859.1 protein_id gnl|my_center|LOCUS_14570 18032 17040 gene locus_tag LOCUS_14580 18032 17040 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338668.1 protein_id gnl|my_center|LOCUS_14580 18083 18685 gene locus_tag LOCUS_14590 18083 18685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085253.1 protein_id gnl|my_center|LOCUS_14590 18636 19913 gene locus_tag LOCUS_14600 18636 19913 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969879.1 protein_id gnl|my_center|LOCUS_14600 20908 20129 gene locus_tag LOCUS_14610 20908 20129 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_14610 21615 20905 gene locus_tag LOCUS_14620 21615 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 21884 21612 gene locus_tag LOCUS_14630 21884 21612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 21934 22650 gene locus_tag LOCUS_14640 21934 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence040 516 440 gene locus_tag LOCUS_t00190 516 440 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 702 1427 gene locus_tag LOCUS_14650 702 1427 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_14650 1427 1846 gene locus_tag LOCUS_14660 1427 1846 CDS product sugar translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229535.1 protein_id gnl|my_center|LOCUS_14660 3174 1894 gene locus_tag LOCUS_14670 gene murA 3174 1894 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J077 protein_id gnl|my_center|LOCUS_14670 3504 4199 gene locus_tag LOCUS_14680 3504 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4429 5241 gene locus_tag LOCUS_14690 4429 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5388 5464 gene locus_tag LOCUS_t00200 5388 5464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8077 5528 gene locus_tag LOCUS_14700 8077 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8256 9143 gene locus_tag LOCUS_14710 8256 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 10052 9171 gene locus_tag LOCUS_14720 10052 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 10986 10108 gene locus_tag LOCUS_14730 10986 10108 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_14730 12248 10983 gene locus_tag LOCUS_14740 12248 10983 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 protein_id gnl|my_center|LOCUS_14740 13633 12245 gene locus_tag LOCUS_14750 13633 12245 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_14750 13920 15830 gene locus_tag LOCUS_14760 13920 15830 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_14760 16448 15846 gene locus_tag LOCUS_14770 16448 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 16812 16438 gene locus_tag LOCUS_14780 16812 16438 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_14780 17694 16816 gene locus_tag LOCUS_14790 gene coxC 17694 16816 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_14790 18326 17718 gene locus_tag LOCUS_14800 gene ctaG 18326 17718 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_14800 18457 18323 gene locus_tag LOCUS_14810 18457 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 19362 18454 gene locus_tag LOCUS_14820 gene ctaB 19362 18454 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ3 protein_id gnl|my_center|LOCUS_14820 21048 19420 gene locus_tag LOCUS_14830 21048 19420 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A300 protein_id gnl|my_center|LOCUS_14830 21921 21073 gene locus_tag LOCUS_14840 21921 21073 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2Z9 protein_id gnl|my_center|LOCUS_14840 >Feature sequence041 1964 24 gene locus_tag LOCUS_14850 gene acsA 1964 24 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_14850 2161 2631 gene locus_tag LOCUS_14860 2161 2631 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_14860 2870 2658 gene locus_tag LOCUS_14870 2870 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_14870 3383 3547 gene locus_tag LOCUS_14880 3383 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4213 3563 gene locus_tag LOCUS_14890 4213 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_14890 4931 4317 gene locus_tag LOCUS_14900 4931 4317 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_14900 5953 4955 gene locus_tag LOCUS_14910 5953 4955 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_14910 5993 6232 gene locus_tag LOCUS_14920 5993 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 6324 6905 gene locus_tag LOCUS_14930 6324 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7732 6890 gene locus_tag LOCUS_14940 7732 6890 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_14940 8488 8081 gene locus_tag LOCUS_14950 8488 8081 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_14950 8739 8485 gene locus_tag LOCUS_14960 8739 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 9761 8757 gene locus_tag LOCUS_14970 gene nadA 9761 8757 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_14970 9913 10371 gene locus_tag LOCUS_14980 9913 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 10540 11517 gene locus_tag LOCUS_14990 10540 11517 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_14990 12596 11670 gene locus_tag LOCUS_15000 12596 11670 CDS product drug/metabolite exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640277.1 protein_id gnl|my_center|LOCUS_15000 13660 12593 gene locus_tag LOCUS_15010 gene purK 13660 12593 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_15010 14145 13657 gene locus_tag LOCUS_15020 gene purE 14145 13657 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFL8 protein_id gnl|my_center|LOCUS_15020 14330 15064 gene locus_tag LOCUS_15030 gene dgcA 14330 15064 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_15030 15546 17051 gene locus_tag LOCUS_15040 15546 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 17533 17745 gene locus_tag LOCUS_15050 17533 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 18096 17791 gene locus_tag LOCUS_15060 18096 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 18297 19124 gene locus_tag LOCUS_15070 18297 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 19556 19125 gene locus_tag LOCUS_15080 19556 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 19726 19556 gene locus_tag LOCUS_15090 19726 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 19964 20554 gene locus_tag LOCUS_15100 19964 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence042 1182 115 gene locus_tag LOCUS_15110 1182 115 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_15110 1325 3739 gene locus_tag LOCUS_15120 1325 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4449 3940 gene locus_tag LOCUS_15130 4449 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5195 4449 gene locus_tag LOCUS_15140 gene cobS 5195 4449 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWM3 protein_id gnl|my_center|LOCUS_15140 6187 5192 gene locus_tag LOCUS_15150 gene cobT 6187 5192 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R064 protein_id gnl|my_center|LOCUS_15150 7616 6180 gene locus_tag LOCUS_15160 gene cobQ 7616 6180 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBF6 protein_id gnl|my_center|LOCUS_15160 8218 7613 gene locus_tag LOCUS_15170 gene cobO 8218 7613 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337767.1 protein_id gnl|my_center|LOCUS_15170 10155 8233 gene locus_tag LOCUS_15180 10155 8233 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_15180 10525 11076 gene locus_tag LOCUS_15190 10525 11076 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388428.1 protein_id gnl|my_center|LOCUS_15190 11789 12283 gene locus_tag LOCUS_15200 11789 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 12376 13410 gene locus_tag LOCUS_15210 12376 13410 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_15210 13407 14351 gene locus_tag LOCUS_15220 13407 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 14399 14764 gene locus_tag LOCUS_15230 14399 14764 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967779.1 protein_id gnl|my_center|LOCUS_15230 15178 14771 gene locus_tag LOCUS_15240 15178 14771 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_15240 15447 17273 gene locus_tag LOCUS_15250 15447 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 17391 18353 gene locus_tag LOCUS_15260 gene trxB1 17391 18353 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W175 protein_id gnl|my_center|LOCUS_15260 18359 19258 gene locus_tag LOCUS_15270 18359 19258 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_15270 19444 19785 gene locus_tag LOCUS_15280 19444 19785 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 protein_id gnl|my_center|LOCUS_15280 19792 21042 gene locus_tag LOCUS_15290 19792 21042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038930.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence043 754 344 gene locus_tag LOCUS_15300 754 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1255 842 gene locus_tag LOCUS_15310 1255 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2097 1327 gene locus_tag LOCUS_15320 2097 1327 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBQ6 protein_id gnl|my_center|LOCUS_15320 2597 2073 gene locus_tag LOCUS_15330 2597 2073 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_15330 3628 2594 gene locus_tag LOCUS_15340 3628 2594 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_15340 4452 3625 gene locus_tag LOCUS_15350 gene lgt 4452 3625 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 protein_id gnl|my_center|LOCUS_15350 5239 4517 gene locus_tag LOCUS_15360 5239 4517 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_15360 6366 5350 gene locus_tag LOCUS_15370 gene hemH 6366 5350 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIN3 protein_id gnl|my_center|LOCUS_15370 8577 6400 gene locus_tag LOCUS_15380 8577 6400 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_15380 9169 8651 gene locus_tag LOCUS_15390 9169 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_15390 10650 9280 gene locus_tag LOCUS_15400 10650 9280 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_15400 10799 12478 gene locus_tag LOCUS_15410 10799 12478 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_15410 12772 15228 gene locus_tag LOCUS_15420 12772 15228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 18769 15263 gene locus_tag LOCUS_15430 18769 15263 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_15430 18922 20127 gene locus_tag LOCUS_15440 gene metZ 18922 20127 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S95 protein_id gnl|my_center|LOCUS_15440 20142 20558 gene locus_tag LOCUS_15450 gene apaG 20142 20558 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB9 protein_id gnl|my_center|LOCUS_15450 >Feature sequence044 426 797 gene locus_tag LOCUS_15460 gene rpsL 426 797 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J79 protein_id gnl|my_center|LOCUS_15460 825 1295 gene locus_tag LOCUS_15470 gene rpsG 825 1295 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S6 protein_id gnl|my_center|LOCUS_15470 1322 3394 gene locus_tag LOCUS_15480 gene fusA 1322 3394 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV7 protein_id gnl|my_center|LOCUS_15480 3454 4644 gene locus_tag LOCUS_15490 gene tuf1 3454 4644 CDS product elongation factor Tu 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV8 protein_id gnl|my_center|LOCUS_15490 4861 5175 gene locus_tag LOCUS_15500 gene rpsJ 4861 5175 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_15500 5410 6165 gene locus_tag LOCUS_15510 gene rplC 5410 6165 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC4 protein_id gnl|my_center|LOCUS_15510 6168 6791 gene locus_tag LOCUS_15520 gene rplD 6168 6791 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC5 protein_id gnl|my_center|LOCUS_15520 6784 7086 gene locus_tag LOCUS_15530 gene rplW 6784 7086 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V1 protein_id gnl|my_center|LOCUS_15530 7105 7938 gene locus_tag LOCUS_15540 gene rplB 7105 7938 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC7 protein_id gnl|my_center|LOCUS_15540 7942 8223 gene locus_tag LOCUS_15550 gene rpsS 7942 8223 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_15550 8225 8605 gene locus_tag LOCUS_15560 gene rplV 8225 8605 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 protein_id gnl|my_center|LOCUS_15560 8605 9318 gene locus_tag LOCUS_15570 gene rpsC 8605 9318 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD0 protein_id gnl|my_center|LOCUS_15570 9331 9756 gene locus_tag LOCUS_15580 gene rplP 9331 9756 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_15580 9761 9964 gene locus_tag LOCUS_15590 gene rpmC 9761 9964 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW8 protein_id gnl|my_center|LOCUS_15590 9977 10252 gene locus_tag LOCUS_15600 gene rpsQ 9977 10252 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8U4 protein_id gnl|my_center|LOCUS_15600 10249 10617 gene locus_tag LOCUS_15610 gene rplN 10249 10617 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE28 protein_id gnl|my_center|LOCUS_15610 10617 10940 gene locus_tag LOCUS_15620 gene rplX 10617 10940 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_15620 10933 11523 gene locus_tag LOCUS_15630 gene rplE 10933 11523 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J96 protein_id gnl|my_center|LOCUS_15630 11542 11847 gene locus_tag LOCUS_15640 gene rpsN 11542 11847 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIG1 protein_id gnl|my_center|LOCUS_15640 11863 12261 gene locus_tag LOCUS_15650 gene rpsH 11863 12261 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_15650 12276 12812 gene locus_tag LOCUS_15660 gene rplF 12276 12812 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q7 protein_id gnl|my_center|LOCUS_15660 12825 13181 gene locus_tag LOCUS_15670 gene rplR 12825 13181 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME0 protein_id gnl|my_center|LOCUS_15670 13185 13787 gene locus_tag LOCUS_15680 gene rpsE 13185 13787 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME1 protein_id gnl|my_center|LOCUS_15680 13796 13987 gene locus_tag LOCUS_15690 gene rpmD 13796 13987 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 protein_id gnl|my_center|LOCUS_15690 14025 14507 gene locus_tag LOCUS_15700 gene rplO 14025 14507 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ8 protein_id gnl|my_center|LOCUS_15700 14511 15875 gene locus_tag LOCUS_15710 gene secY 14511 15875 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_15710 15872 16537 gene locus_tag LOCUS_15720 gene adk 15872 16537 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 protein_id gnl|my_center|LOCUS_15720 16705 17073 gene locus_tag LOCUS_15730 gene rpsM 16705 17073 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 protein_id gnl|my_center|LOCUS_15730 17110 17505 gene locus_tag LOCUS_15740 gene rpsK 17110 17505 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_15740 17589 18608 gene locus_tag LOCUS_15750 gene rpoA 17589 18608 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_15750 18700 19110 gene locus_tag LOCUS_15760 gene rplQ 18700 19110 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8S8 protein_id gnl|my_center|LOCUS_15760 19930 19166 gene locus_tag LOCUS_15770 19930 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence045 1566 253 gene locus_tag LOCUS_15780 gene astB2 1566 253 CDS product N-succinylarginine dihydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7W1 protein_id gnl|my_center|LOCUS_15780 2978 1563 gene locus_tag LOCUS_15790 gene astD 2978 1563 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C459 protein_id gnl|my_center|LOCUS_15790 4008 2965 gene locus_tag LOCUS_15800 4008 2965 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918468.1 protein_id gnl|my_center|LOCUS_15800 5246 4005 gene locus_tag LOCUS_15810 5246 4005 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_15810 5992 5243 gene locus_tag LOCUS_15820 gene ubiG 5992 5243 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y662 protein_id gnl|my_center|LOCUS_15820 6115 7347 gene locus_tag LOCUS_15830 6115 7347 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_15830 7344 8351 gene locus_tag LOCUS_15840 7344 8351 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_15840 11157 8386 gene locus_tag LOCUS_15850 11157 8386 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338672.1 protein_id gnl|my_center|LOCUS_15850 11372 11605 gene locus_tag LOCUS_15860 11372 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 11694 12074 gene locus_tag LOCUS_15870 11694 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 12384 12088 gene locus_tag LOCUS_15880 12384 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088538.1 protein_id gnl|my_center|LOCUS_15880 12563 14629 gene locus_tag LOCUS_15890 12563 14629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918103.1 protein_id gnl|my_center|LOCUS_15890 16958 14607 gene locus_tag LOCUS_15900 gene acyII 16958 14607 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036584.1 protein_id gnl|my_center|LOCUS_15900 17036 18472 gene locus_tag LOCUS_15910 17036 18472 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 protein_id gnl|my_center|LOCUS_15910 18575 18760 gene locus_tag LOCUS_15920 18575 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 18830 19312 gene locus_tag LOCUS_15930 gene bfrB 18830 19312 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_15930 >Feature sequence046 753 166 gene locus_tag LOCUS_15940 gene grpE 753 166 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV1 protein_id gnl|my_center|LOCUS_15940 1802 750 gene locus_tag LOCUS_15950 gene hrcA 1802 750 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_15950 2595 1900 gene locus_tag LOCUS_15960 2595 1900 CDS product fumarylpyruvate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_15960 3300 2608 gene locus_tag LOCUS_15970 3300 2608 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 protein_id gnl|my_center|LOCUS_15970 3705 3304 gene locus_tag LOCUS_15980 3705 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4211 3708 gene locus_tag LOCUS_15990 gene lspA 4211 3708 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DF7 protein_id gnl|my_center|LOCUS_15990 7236 4204 gene locus_tag LOCUS_16000 gene ileS 7236 4204 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E2 protein_id gnl|my_center|LOCUS_16000 7373 8788 gene locus_tag LOCUS_16010 7373 8788 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887609.1 protein_id gnl|my_center|LOCUS_16010 9871 8927 gene locus_tag LOCUS_16020 gene bioB 9871 8927 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF0 protein_id gnl|my_center|LOCUS_16020 10882 9875 gene locus_tag LOCUS_16030 10882 9875 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_16030 11056 11442 gene locus_tag LOCUS_16040 11056 11442 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_16040 11543 12850 gene locus_tag LOCUS_16050 11543 12850 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706992.1 protein_id gnl|my_center|LOCUS_16050 13123 12824 gene locus_tag LOCUS_16060 13123 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 13303 13127 gene locus_tag LOCUS_16070 13303 13127 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_16070 13968 13303 gene locus_tag LOCUS_16080 13968 13303 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_16080 14918 14007 gene locus_tag LOCUS_16090 14918 14007 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528773.1 protein_id gnl|my_center|LOCUS_16090 15170 15244 gene locus_tag LOCUS_t00210 15170 15244 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15433 15723 gene locus_tag LOCUS_16100 15433 15723 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_16100 15748 16065 gene locus_tag LOCUS_16110 15748 16065 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_16110 16384 16250 gene locus_tag LOCUS_16120 16384 16250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 16503 17864 gene locus_tag LOCUS_16130 16503 17864 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_16130 17876 18970 gene locus_tag LOCUS_16140 17876 18970 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867673.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence047 1433 312 gene locus_tag LOCUS_16150 1433 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1599 1674 gene locus_tag LOCUS_t00220 1599 1674 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2741 1698 gene locus_tag LOCUS_16160 gene cysA 2741 1698 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE18 protein_id gnl|my_center|LOCUS_16160 3594 2755 gene locus_tag LOCUS_16170 gene cysW 3594 2755 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_16170 4493 3597 gene locus_tag LOCUS_16180 4493 3597 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_16180 5911 4520 gene locus_tag LOCUS_16190 5911 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 6963 5995 gene locus_tag LOCUS_16200 gene cysP 6963 5995 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_16200 7588 7154 gene locus_tag LOCUS_16210 7588 7154 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_16210 7990 8069 gene locus_tag LOCUS_t00230 7990 8069 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12264 8419 gene locus_tag LOCUS_16220 12264 8419 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 protein_id gnl|my_center|LOCUS_16220 12463 15156 gene locus_tag LOCUS_16230 gene gyrA 12463 15156 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_16230 15312 16067 gene locus_tag LOCUS_16240 15312 16067 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528770.1 protein_id gnl|my_center|LOCUS_16240 16294 16836 gene locus_tag LOCUS_16250 16294 16836 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772008.1 protein_id gnl|my_center|LOCUS_16250 16941 17468 gene locus_tag LOCUS_16260 gene ahpD 16941 17468 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ANL0 protein_id gnl|my_center|LOCUS_16260 17571 17495 gene locus_tag LOCUS_t00240 17571 17495 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 <1 858 gene locus_tag LOCUS_16270 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T9J1:homoserine O-acetyltransferase 855 1445 gene locus_tag LOCUS_16280 855 1445 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_16280 1446 2417 gene locus_tag LOCUS_16290 1446 2417 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_16290 3106 2414 gene locus_tag LOCUS_16300 3106 2414 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_16300 4288 3116 gene locus_tag LOCUS_16310 4288 3116 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918398.1 protein_id gnl|my_center|LOCUS_16310 5409 4531 gene locus_tag LOCUS_16320 5409 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5668 6222 gene locus_tag LOCUS_16330 5668 6222 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_16330 6639 7460 gene locus_tag LOCUS_16340 gene rpsB 6639 7460 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A703 protein_id gnl|my_center|LOCUS_16340 7603 8532 gene locus_tag LOCUS_16350 gene tsf 7603 8532 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_16350 8618 9376 gene locus_tag LOCUS_16360 gene pyrH 8618 9376 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C997 protein_id gnl|my_center|LOCUS_16360 9405 9962 gene locus_tag LOCUS_16370 gene frr 9405 9962 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM0 protein_id gnl|my_center|LOCUS_16370 9977 10699 gene locus_tag LOCUS_16380 9977 10699 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z8 protein_id gnl|my_center|LOCUS_16380 10686 11519 gene locus_tag LOCUS_16390 10686 11519 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 protein_id gnl|my_center|LOCUS_16390 11523 12683 gene locus_tag LOCUS_16400 gene dxr 11523 12683 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_16400 12683 13822 gene locus_tag LOCUS_16410 12683 13822 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_16410 13825 16407 gene locus_tag LOCUS_16420 gene bamA 13825 16407 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A711 protein_id gnl|my_center|LOCUS_16420 16410 16994 gene locus_tag LOCUS_16430 16410 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 16999 17463 gene locus_tag LOCUS_16440 gene fabZ 16999 17463 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_16440 17554 18456 gene locus_tag LOCUS_16450 17554 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence049 3378 4463 gene locus_tag LOCUS_16460 3378 4463 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919086.1 protein_id gnl|my_center|LOCUS_16460 4476 7598 gene locus_tag LOCUS_16470 4476 7598 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_16470 7616 8176 gene locus_tag LOCUS_16480 7616 8176 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_16480 8198 8542 gene locus_tag LOCUS_16490 8198 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 8724 9233 gene locus_tag LOCUS_16500 8724 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 protein_id gnl|my_center|LOCUS_16500 9230 10021 gene locus_tag LOCUS_16510 gene proC 9230 10021 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP69 protein_id gnl|my_center|LOCUS_16510 10036 10626 gene locus_tag LOCUS_16520 10036 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_16520 11059 10631 gene locus_tag LOCUS_16530 11059 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16530 11274 12158 gene locus_tag LOCUS_16540 11274 12158 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_16540 14623 12698 gene locus_tag LOCUS_16550 14623 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 16840 14735 gene locus_tag LOCUS_16560 gene hppA 16840 14735 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K83 protein_id gnl|my_center|LOCUS_16560 >Feature sequence050 976 389 gene locus_tag LOCUS_16570 gene rplI 976 389 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q3 protein_id gnl|my_center|LOCUS_16570 1213 989 gene locus_tag LOCUS_16580 gene rpsR 1213 989 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI9 protein_id gnl|my_center|LOCUS_16580 1678 1238 gene locus_tag LOCUS_16590 1678 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2955 1819 gene locus_tag LOCUS_16600 2955 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3272 4213 gene locus_tag LOCUS_16610 3272 4213 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7P6 protein_id gnl|my_center|LOCUS_16610 4240 4980 gene locus_tag LOCUS_16620 gene fabG 4240 4980 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_16620 5488 5270 gene locus_tag LOCUS_16630 5488 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 6056 6397 gene locus_tag LOCUS_16640 6056 6397 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389518.1 protein_id gnl|my_center|LOCUS_16640 6437 8056 gene locus_tag LOCUS_16650 6437 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16650 8069 9025 gene locus_tag LOCUS_16660 8069 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16660 9025 9393 gene locus_tag LOCUS_16670 9025 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_16670 10132 10221 gene locus_tag LOCUS_t00250 10132 10221 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10481 10251 gene locus_tag LOCUS_16680 gene rpmE 10481 10251 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ07 protein_id gnl|my_center|LOCUS_16680 10992 10699 gene locus_tag LOCUS_16690 gene ptsH 10992 10699 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 protein_id gnl|my_center|LOCUS_16690 11393 10989 gene locus_tag LOCUS_16700 11393 10989 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_16700 12334 11390 gene locus_tag LOCUS_16710 12334 11390 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_16710 12753 12331 gene locus_tag LOCUS_16720 gene hprK 12753 12331 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383057.1 protein_id gnl|my_center|LOCUS_16720 14372 12753 gene locus_tag LOCUS_16730 14372 12753 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_16730 15048 14341 gene locus_tag LOCUS_16740 15048 14341 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_16740 15926 15045 gene locus_tag LOCUS_16750 15926 15045 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_16750 16518 15982 gene locus_tag LOCUS_16760 gene infC 16518 15982 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_16760 >Feature sequence051 <1 615 gene locus_tag LOCUS_16770 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096623.1:isomerase 659 1831 gene locus_tag LOCUS_16780 gene yhfN 659 1831 CDS product putative metalloprotease YhfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40769 protein_id gnl|my_center|LOCUS_16780 2304 1852 gene locus_tag LOCUS_16790 gene moaE 2304 1852 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090206.1 protein_id gnl|my_center|LOCUS_16790 2555 2301 gene locus_tag LOCUS_16800 gene moaD 2555 2301 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7K6 protein_id gnl|my_center|LOCUS_16800 3046 2552 gene locus_tag LOCUS_16810 3046 2552 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886775.1 protein_id gnl|my_center|LOCUS_16810 3599 3039 gene locus_tag LOCUS_16820 gene pgsA 3599 3039 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707493.1 protein_id gnl|my_center|LOCUS_16820 4293 3646 gene locus_tag LOCUS_16830 4293 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704137.1 protein_id gnl|my_center|LOCUS_16830 6243 4324 gene locus_tag LOCUS_16840 gene uvrC 6243 4324 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 protein_id gnl|my_center|LOCUS_16840 7426 6674 gene locus_tag LOCUS_16850 7426 6674 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_16850 8259 7423 gene locus_tag LOCUS_16860 8259 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8374 9414 gene locus_tag LOCUS_16870 8374 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 9951 10625 gene locus_tag LOCUS_16880 9951 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10722 11459 gene locus_tag LOCUS_16890 10722 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 11500 11952 gene locus_tag LOCUS_16900 gene exbD1 11500 11952 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_16900 12010 12435 gene locus_tag LOCUS_16910 12010 12435 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269072.1 protein_id gnl|my_center|LOCUS_16910 12591 13880 gene locus_tag LOCUS_16920 12591 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 14192 15397 gene locus_tag LOCUS_16930 14192 15397 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4F1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence052 1431 292 gene locus_tag LOCUS_16940 1431 292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_16940 2064 1579 gene locus_tag LOCUS_16950 2064 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4351 2075 gene locus_tag LOCUS_16960 4351 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4800 4354 gene locus_tag LOCUS_16970 4800 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5989 5153 gene locus_tag LOCUS_16980 5989 5153 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383958.1 protein_id gnl|my_center|LOCUS_16980 8344 5993 gene locus_tag LOCUS_16990 8344 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8922 8344 gene locus_tag LOCUS_17000 8922 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9077 8919 gene locus_tag LOCUS_17010 9077 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 9415 9107 gene locus_tag LOCUS_17020 9415 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 9819 9412 gene locus_tag LOCUS_17030 9819 9412 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383953.1 protein_id gnl|my_center|LOCUS_17030 10479 10078 gene locus_tag LOCUS_17040 10479 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10763 10476 gene locus_tag LOCUS_17050 10763 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 11083 10760 gene locus_tag LOCUS_17060 11083 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 11586 11080 gene locus_tag LOCUS_17070 11586 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 11900 11625 gene locus_tag LOCUS_17080 11900 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 13632 12133 gene locus_tag LOCUS_17090 13632 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 13740 14669 gene locus_tag LOCUS_17100 13740 14669 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_17100 14666 15985 gene locus_tag LOCUS_17110 14666 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence053 635 1102 gene locus_tag LOCUS_17120 635 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1086 1559 gene locus_tag LOCUS_17130 1086 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3322 1520 gene locus_tag LOCUS_17140 3322 1520 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084324.1 protein_id gnl|my_center|LOCUS_17140 4898 3474 gene locus_tag LOCUS_17150 4898 3474 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529846.1 protein_id gnl|my_center|LOCUS_17150 7123 4895 gene locus_tag LOCUS_17160 7123 4895 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_17160 8844 7120 gene locus_tag LOCUS_17170 8844 7120 CDS product toxin ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 protein_id gnl|my_center|LOCUS_17170 9089 13315 gene locus_tag LOCUS_17180 9089 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 15629 13704 gene locus_tag LOCUS_17190 gene dxs 15629 13704 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T825 protein_id gnl|my_center|LOCUS_17190 >Feature sequence054 333 142 gene locus_tag LOCUS_17200 333 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 311 1402 gene locus_tag LOCUS_17210 gene hisC 311 1402 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J2 protein_id gnl|my_center|LOCUS_17210 1387 2307 gene locus_tag LOCUS_17220 1387 2307 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_17220 3289 2252 gene locus_tag LOCUS_17230 3289 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3999 3286 gene locus_tag LOCUS_17240 3999 3286 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_17240 4556 3996 gene locus_tag LOCUS_17250 4556 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5452 4553 gene locus_tag LOCUS_17260 gene FtsX 5452 4553 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084208.1 protein_id gnl|my_center|LOCUS_17260 6171 5452 gene locus_tag LOCUS_17270 6171 5452 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 protein_id gnl|my_center|LOCUS_17270 6539 7432 gene locus_tag LOCUS_17280 6539 7432 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084206.1 protein_id gnl|my_center|LOCUS_17280 7491 7856 gene locus_tag LOCUS_17290 7491 7856 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066761.1 protein_id gnl|my_center|LOCUS_17290 8312 7929 gene locus_tag LOCUS_17300 8312 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708831.1 protein_id gnl|my_center|LOCUS_17300 9268 8468 gene locus_tag LOCUS_17310 9268 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 10012 9413 gene locus_tag LOCUS_17320 10012 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17320 10923 10009 gene locus_tag LOCUS_17330 10923 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17330 11986 11063 gene locus_tag LOCUS_17340 11986 11063 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976388.1 protein_id gnl|my_center|LOCUS_17340 12448 12185 gene locus_tag LOCUS_17350 12448 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 13791 12469 gene locus_tag LOCUS_17360 13791 12469 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265852.1 protein_id gnl|my_center|LOCUS_17360 15403 13856 gene locus_tag LOCUS_17370 15403 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 15713 15384 gene locus_tag LOCUS_17380 15713 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence055 846 163 gene locus_tag LOCUS_17390 846 163 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63L05 protein_id gnl|my_center|LOCUS_17390 3137 849 gene locus_tag LOCUS_17400 3137 849 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086681.1 protein_id gnl|my_center|LOCUS_17400 3315 4328 gene locus_tag LOCUS_17410 3315 4328 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS46 protein_id gnl|my_center|LOCUS_17410 4325 5221 gene locus_tag LOCUS_17420 4325 5221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927237.1 protein_id gnl|my_center|LOCUS_17420 5270 6778 gene locus_tag LOCUS_17430 5270 6778 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_17430 7054 6806 gene locus_tag LOCUS_17440 7054 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918376.1 protein_id gnl|my_center|LOCUS_17440 7337 7011 gene locus_tag LOCUS_17450 gene brnT 7337 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918377.1 protein_id gnl|my_center|LOCUS_17450 7429 8820 gene locus_tag LOCUS_17460 7429 8820 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_17460 8817 10199 gene locus_tag LOCUS_17470 8817 10199 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143676.1 protein_id gnl|my_center|LOCUS_17470 11491 10223 gene locus_tag LOCUS_17480 11491 10223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219025.1 protein_id gnl|my_center|LOCUS_17480 11960 11481 gene locus_tag LOCUS_17490 11960 11481 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 protein_id gnl|my_center|LOCUS_17490 12289 13749 gene locus_tag LOCUS_17500 12289 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 14049 13855 gene locus_tag LOCUS_17510 14049 13855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 14138 15034 gene locus_tag LOCUS_17520 gene htpX 14138 15034 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KX3 protein_id gnl|my_center|LOCUS_17520 15031 15465 gene locus_tag LOCUS_17530 15031 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence056 407 1063 gene locus_tag LOCUS_17540 407 1063 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529325.1 protein_id gnl|my_center|LOCUS_17540 1060 1839 gene locus_tag LOCUS_17550 1060 1839 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEW2 protein_id gnl|my_center|LOCUS_17550 2611 1904 gene locus_tag LOCUS_17560 2611 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3611 2856 gene locus_tag LOCUS_17570 gene hisF 3611 2856 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 protein_id gnl|my_center|LOCUS_17570 4348 3611 gene locus_tag LOCUS_17580 gene hisA 4348 3611 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_17580 4974 4345 gene locus_tag LOCUS_17590 gene hisH 4974 4345 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33565 protein_id gnl|my_center|LOCUS_17590 5584 4979 gene locus_tag LOCUS_17600 gene hisB 5584 4979 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 protein_id gnl|my_center|LOCUS_17600 5647 8412 gene locus_tag LOCUS_17610 5647 8412 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_17610 8409 8840 gene locus_tag LOCUS_17620 8409 8840 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383671.1 protein_id gnl|my_center|LOCUS_17620 8846 9391 gene locus_tag LOCUS_17630 8846 9391 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_17630 10144 9464 gene locus_tag LOCUS_17640 10144 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 10208 12118 gene locus_tag LOCUS_17650 10208 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 12537 12064 gene locus_tag LOCUS_17660 gene mmcB 12537 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_17660 14006 12594 gene locus_tag LOCUS_17670 14006 12594 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN18 protein_id gnl|my_center|LOCUS_17670 14135 15247 gene locus_tag LOCUS_17680 14135 15247 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QP6 protein_id gnl|my_center|LOCUS_17680 >Feature sequence057 543 974 gene locus_tag LOCUS_17690 gene codA 543 974 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ0 protein_id gnl|my_center|LOCUS_17690 1059 1553 gene locus_tag LOCUS_17700 1059 1553 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM8 protein_id gnl|my_center|LOCUS_17700 3115 1961 gene locus_tag LOCUS_17710 3115 1961 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_17710 4301 3405 gene locus_tag LOCUS_17720 4301 3405 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_17720 5292 4510 gene locus_tag LOCUS_17730 gene sdhB 5292 4510 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_17730 5715 5425 gene locus_tag LOCUS_17740 5715 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6736 5726 gene locus_tag LOCUS_17750 6736 5726 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920388.1 protein_id gnl|my_center|LOCUS_17750 7382 6738 gene locus_tag LOCUS_17760 7382 6738 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531255.1 protein_id gnl|my_center|LOCUS_17760 7923 7366 gene locus_tag LOCUS_17770 7923 7366 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_17770 9005 7920 gene locus_tag LOCUS_17780 9005 7920 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 protein_id gnl|my_center|LOCUS_17780 9882 9034 gene locus_tag LOCUS_17790 9882 9034 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_17790 10001 10474 gene locus_tag LOCUS_17800 10001 10474 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551900.1 protein_id gnl|my_center|LOCUS_17800 10506 10898 gene locus_tag LOCUS_17810 10506 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 10946 11620 gene locus_tag LOCUS_17820 10946 11620 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_17820 11601 12785 gene locus_tag LOCUS_17830 gene queG 11601 12785 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_17830 12960 14945 gene locus_tag LOCUS_17840 gene cbbT 12960 14945 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6U6 protein_id gnl|my_center|LOCUS_17840 >Feature sequence058 573 154 gene locus_tag LOCUS_17850 573 154 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 protein_id gnl|my_center|LOCUS_17850 2950 629 gene locus_tag LOCUS_17860 2950 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3473 2922 gene locus_tag LOCUS_17870 3473 2922 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_17870 3627 3552 gene locus_tag LOCUS_t00260 3627 3552 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4420 3680 gene locus_tag LOCUS_17880 gene mtgA 4420 3680 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABA6 protein_id gnl|my_center|LOCUS_17880 6988 4820 gene locus_tag LOCUS_17890 6988 4820 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973897.1 protein_id gnl|my_center|LOCUS_17890 7105 8775 gene locus_tag LOCUS_17900 7105 8775 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_17900 8772 9356 gene locus_tag LOCUS_17910 8772 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 9371 9679 gene locus_tag LOCUS_17920 9371 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 10447 13155 gene locus_tag LOCUS_17930 gene ppc 10447 13155 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W75 protein_id gnl|my_center|LOCUS_17930 13319 13735 gene locus_tag LOCUS_17940 13319 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 13756 14469 gene locus_tag LOCUS_17950 13756 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 14466 15071 gene locus_tag LOCUS_17960 14466 15071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence059 206 2401 gene locus_tag LOCUS_17970 206 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2404 2592 gene locus_tag LOCUS_17980 2404 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2747 3472 gene locus_tag LOCUS_17990 2747 3472 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_17990 3465 4037 gene locus_tag LOCUS_18000 3465 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229093.1 protein_id gnl|my_center|LOCUS_18000 4131 4523 gene locus_tag LOCUS_18010 4131 4523 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971000.1 protein_id gnl|my_center|LOCUS_18010 7035 4612 gene locus_tag LOCUS_18020 7035 4612 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919069.1 protein_id gnl|my_center|LOCUS_18020 8058 7039 gene locus_tag LOCUS_18030 8058 7039 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_18030 8295 8579 gene locus_tag LOCUS_18040 8295 8579 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528801.1 protein_id gnl|my_center|LOCUS_18040 8654 9649 gene locus_tag LOCUS_18050 8654 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 9884 11557 gene locus_tag LOCUS_18060 9884 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 11567 12151 gene locus_tag LOCUS_18070 11567 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 12165 12794 gene locus_tag LOCUS_18080 12165 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 12885 12811 gene locus_tag LOCUS_t00270 12885 12811 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13962 12928 gene locus_tag LOCUS_18090 gene rfe 13962 12928 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8H1 protein_id gnl|my_center|LOCUS_18090 14228 14986 gene locus_tag LOCUS_18100 14228 14986 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087743.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence060 719 886 gene locus_tag LOCUS_18110 gene rpmG 719 886 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA88 protein_id gnl|my_center|LOCUS_18110 3033 946 gene locus_tag LOCUS_18120 3033 946 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_18120 3579 3052 gene locus_tag LOCUS_18130 3579 3052 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_18130 5272 3569 gene locus_tag LOCUS_18140 5272 3569 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_18140 6030 5269 gene locus_tag LOCUS_18150 6030 5269 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_18150 6196 7830 gene locus_tag LOCUS_18160 gene fzeA 6196 7830 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_18160 8042 9718 gene locus_tag LOCUS_18170 8042 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971025.1 protein_id gnl|my_center|LOCUS_18170 9730 10590 gene locus_tag LOCUS_18180 gene ispE 9730 10590 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H510 protein_id gnl|my_center|LOCUS_18180 10722 13487 gene locus_tag LOCUS_18190 10722 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 13539 14843 gene locus_tag LOCUS_18200 13539 14843 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence061 77 1741 gene locus_tag LOCUS_18210 gene dnaK 77 1741 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TER2 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18210 1829 2965 gene locus_tag LOCUS_18220 gene dnaJ 1829 2965 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY1 protein_id gnl|my_center|LOCUS_18220 3144 3326 gene locus_tag LOCUS_18230 3144 3326 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_18230 3762 3394 gene locus_tag LOCUS_18240 3762 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3867 4322 gene locus_tag LOCUS_18250 3867 4322 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_18250 4326 5795 gene locus_tag LOCUS_18260 4326 5795 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_18260 5792 6370 gene locus_tag LOCUS_18270 5792 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 6388 7128 gene locus_tag LOCUS_18280 gene sufC 6388 7128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537716.1 protein_id gnl|my_center|LOCUS_18280 7128 8039 gene locus_tag LOCUS_18290 7128 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 8036 9259 gene locus_tag LOCUS_18300 gene sufS 8036 9259 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRS0 protein_id gnl|my_center|LOCUS_18300 9256 9630 gene locus_tag LOCUS_18310 9256 9630 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384190.1 protein_id gnl|my_center|LOCUS_18310 9633 9968 gene locus_tag LOCUS_18320 9633 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_18320 10150 11448 gene locus_tag LOCUS_18330 10150 11448 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_18330 12676 11453 gene locus_tag LOCUS_18340 12676 11453 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8M7 protein_id gnl|my_center|LOCUS_18340 13626 12874 gene locus_tag LOCUS_18350 13626 12874 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_18350 14614 13691 gene locus_tag LOCUS_18360 14614 13691 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence062 184 1662 gene locus_tag LOCUS_18370 gene purF 184 1662 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ7 protein_id gnl|my_center|LOCUS_18370 1659 2393 gene locus_tag LOCUS_18380 1659 2393 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_18380 2703 3164 gene locus_tag LOCUS_18390 2703 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087415.1 protein_id gnl|my_center|LOCUS_18390 4405 3188 gene locus_tag LOCUS_18400 4405 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4559 5029 gene locus_tag LOCUS_18410 4559 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5061 5399 gene locus_tag LOCUS_18420 gene sugE 5061 5399 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_18420 6048 5611 gene locus_tag LOCUS_18430 6048 5611 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_18430 6617 6045 gene locus_tag LOCUS_18440 6617 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 9002 6645 gene locus_tag LOCUS_18450 gene clpA 9002 6645 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969251.1 protein_id gnl|my_center|LOCUS_18450 9567 9193 gene locus_tag LOCUS_18460 gene clpS 9567 9193 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 protein_id gnl|my_center|LOCUS_18460 10675 9794 gene locus_tag LOCUS_18470 gene hemF 10675 9794 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZX1 protein_id gnl|my_center|LOCUS_18470 11149 10691 gene locus_tag LOCUS_18480 gene trmL 11149 10691 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH5 protein_id gnl|my_center|LOCUS_18480 12570 11146 gene locus_tag LOCUS_18490 12570 11146 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803944.1 protein_id gnl|my_center|LOCUS_18490 12849 13376 gene locus_tag LOCUS_18500 gene petA 12849 13376 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDQ5 protein_id gnl|my_center|LOCUS_18500 13382 14659 gene locus_tag LOCUS_18510 gene fbcB 13382 14659 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE7 protein_id gnl|my_center|LOCUS_18510 >Feature sequence063 1513 308 gene locus_tag LOCUS_18520 1513 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2969 1755 gene locus_tag LOCUS_18530 2969 1755 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_18530 3223 2984 gene locus_tag LOCUS_18540 3223 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4186 3290 gene locus_tag LOCUS_18550 4186 3290 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919048.1 protein_id gnl|my_center|LOCUS_18550 6032 4236 gene locus_tag LOCUS_18560 6032 4236 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_18560 6156 6695 gene locus_tag LOCUS_18570 6156 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 8283 6685 gene locus_tag LOCUS_18580 8283 6685 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_18580 9224 8280 gene locus_tag LOCUS_18590 9224 8280 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_18590 9759 9217 gene locus_tag LOCUS_18600 9759 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 9978 10574 gene locus_tag LOCUS_18610 9978 10574 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975604.1 protein_id gnl|my_center|LOCUS_18610 10577 11101 gene locus_tag LOCUS_18620 10577 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_18620 11180 12457 gene locus_tag LOCUS_18630 gene eno 11180 12457 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ9 protein_id gnl|my_center|LOCUS_18630 14410 12467 gene locus_tag LOCUS_18640 14410 12467 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence064 1956 1414 gene locus_tag LOCUS_18650 1956 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2615 1956 gene locus_tag LOCUS_18660 2615 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3241 2612 gene locus_tag LOCUS_18670 3241 2612 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_18670 3698 3294 gene locus_tag LOCUS_18680 3698 3294 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_18680 3999 5249 gene locus_tag LOCUS_18690 3999 5249 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_18690 5254 6402 gene locus_tag LOCUS_18700 5254 6402 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_18700 6406 9630 gene locus_tag LOCUS_18710 6406 9630 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 protein_id gnl|my_center|LOCUS_18710 9726 10670 gene locus_tag LOCUS_18720 9726 10670 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090981.1 protein_id gnl|my_center|LOCUS_18720 10675 10983 gene locus_tag LOCUS_18730 10675 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 11222 10998 gene locus_tag LOCUS_18740 11222 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_18740 12439 11219 gene locus_tag LOCUS_18750 12439 11219 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_18750 13452 12436 gene locus_tag LOCUS_18760 gene trbG 13452 12436 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_18760 14132 13449 gene locus_tag LOCUS_18770 gene trbF 14132 13449 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090989.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence065 35 532 gene locus_tag LOCUS_18780 35 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 542 1360 gene locus_tag LOCUS_18790 gene flgH1 542 1360 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 protein_id gnl|my_center|LOCUS_18790 1816 1370 gene locus_tag LOCUS_18800 gene dksA 1816 1370 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC05 protein_id gnl|my_center|LOCUS_18800 2360 1935 gene locus_tag LOCUS_18810 2360 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2485 3645 gene locus_tag LOCUS_18820 gene flgI 2485 3645 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE9 protein_id gnl|my_center|LOCUS_18820 3645 4022 gene locus_tag LOCUS_18830 3645 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 4019 4492 gene locus_tag LOCUS_18840 4019 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4590 5030 gene locus_tag LOCUS_18850 4590 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6449 5043 gene locus_tag LOCUS_18860 6449 5043 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_18860 7592 6558 gene locus_tag LOCUS_18870 7592 6558 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U9 protein_id gnl|my_center|LOCUS_18870 8209 7598 gene locus_tag LOCUS_18880 8209 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8600 8211 gene locus_tag LOCUS_18890 8600 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 10767 8863 gene locus_tag LOCUS_18900 10767 8863 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC10 protein_id gnl|my_center|LOCUS_18900 11175 11636 gene locus_tag LOCUS_18910 11175 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 11799 12494 gene locus_tag LOCUS_18920 11799 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 13298 12495 gene locus_tag LOCUS_18930 13298 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 14044 13295 gene locus_tag LOCUS_18940 14044 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence066 755 204 gene locus_tag LOCUS_18950 gene ppa 755 204 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4C9 protein_id gnl|my_center|LOCUS_18950 890 2710 gene locus_tag LOCUS_18960 890 2710 CDS product tetratricopeptide repeat-containing 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265854.1 protein_id gnl|my_center|LOCUS_18960 2707 3519 gene locus_tag LOCUS_18970 2707 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6556 3572 gene locus_tag LOCUS_18980 6556 3572 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_18980 7847 6957 gene locus_tag LOCUS_18990 7847 6957 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_18990 8083 7877 gene locus_tag LOCUS_19000 8083 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968840.1 protein_id gnl|my_center|LOCUS_19000 9505 8111 gene locus_tag LOCUS_19010 gene xseA 9505 8111 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G2 protein_id gnl|my_center|LOCUS_19010 9534 10832 gene locus_tag LOCUS_19020 gene purD 9534 10832 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 protein_id gnl|my_center|LOCUS_19020 11397 12821 gene locus_tag LOCUS_19030 11397 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence067 135 1700 gene locus_tag LOCUS_19040 135 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1780 1705 gene locus_tag LOCUS_t00280 1780 1705 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1864 2652 gene locus_tag LOCUS_19050 gene trmD 1864 2652 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_19050 2649 3029 gene locus_tag LOCUS_19060 2649 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3167 3646 gene locus_tag LOCUS_19070 3167 3646 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888412.1 protein_id gnl|my_center|LOCUS_19070 3701 5128 gene locus_tag LOCUS_19080 gene leuC 3701 5128 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 protein_id gnl|my_center|LOCUS_19080 5133 5732 gene locus_tag LOCUS_19090 gene leuD 5133 5732 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LA1 protein_id gnl|my_center|LOCUS_19090 5735 6202 gene locus_tag LOCUS_19100 5735 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6199 6474 gene locus_tag LOCUS_19110 6199 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6536 7651 gene locus_tag LOCUS_19120 gene leuB 6536 7651 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ3 protein_id gnl|my_center|LOCUS_19120 7660 8343 gene locus_tag LOCUS_19130 7660 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 8340 9002 gene locus_tag LOCUS_19140 8340 9002 CDS product glycerol uptake transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888242.1 protein_id gnl|my_center|LOCUS_19140 9013 9426 gene locus_tag LOCUS_19150 gene arsC 9013 9426 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641672.1 protein_id gnl|my_center|LOCUS_19150 9499 10542 gene locus_tag LOCUS_19160 gene asd 9499 10542 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY28 protein_id gnl|my_center|LOCUS_19160 10833 12173 gene locus_tag LOCUS_19170 10833 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12239 13243 gene locus_tag LOCUS_19180 12239 13243 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528763.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence068 1102 524 gene locus_tag LOCUS_19190 1102 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1748 1122 gene locus_tag LOCUS_19200 1748 1122 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_19200 2573 2073 gene locus_tag LOCUS_19210 2573 2073 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918539.1 protein_id gnl|my_center|LOCUS_19210 3405 3007 gene locus_tag LOCUS_19220 3405 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887731.1 protein_id gnl|my_center|LOCUS_19220 5005 3383 gene locus_tag LOCUS_19230 5005 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5173 5100 gene locus_tag LOCUS_t00290 5173 5100 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6057 5209 gene locus_tag LOCUS_19240 gene fghA 6057 5209 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WS1 protein_id gnl|my_center|LOCUS_19240 7169 6057 gene locus_tag LOCUS_19250 gene adhC2 7169 6057 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KKH9 protein_id gnl|my_center|LOCUS_19250 8576 7179 gene locus_tag LOCUS_19260 8576 7179 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT67 protein_id gnl|my_center|LOCUS_19260 9928 8669 gene locus_tag LOCUS_19270 9928 8669 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT66 protein_id gnl|my_center|LOCUS_19270 11313 9961 gene locus_tag LOCUS_19280 11313 9961 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383964.1 protein_id gnl|my_center|LOCUS_19280 12389 11313 gene locus_tag LOCUS_19290 gene pdhA 12389 11313 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT64 protein_id gnl|my_center|LOCUS_19290 >Feature sequence069 1264 1731 gene locus_tag LOCUS_19300 1264 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1746 2048 gene locus_tag LOCUS_19310 1746 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2054 2923 gene locus_tag LOCUS_19320 2054 2923 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_19320 2913 3962 gene locus_tag LOCUS_19330 2913 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_19330 4745 4263 gene locus_tag LOCUS_19340 4745 4263 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_19340 4918 5478 gene locus_tag LOCUS_19350 4918 5478 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_19350 5602 6093 gene locus_tag LOCUS_19360 5602 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6980 6519 gene locus_tag LOCUS_19370 6980 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_19370 8650 7049 gene locus_tag LOCUS_19380 gene pckA 8650 7049 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43086 protein_id gnl|my_center|LOCUS_19380 9594 8944 gene locus_tag LOCUS_19390 9594 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 9780 10697 gene locus_tag LOCUS_19400 9780 10697 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_19400 11923 10688 gene locus_tag LOCUS_19410 11923 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 <12684 12037 gene locus_tag LOCUS_19420 <12684 12037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K0V0:transferrin-binding protein 2 >Feature sequence070 222 136 gene locus_tag LOCUS_t00300 222 136 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 352 1296 gene locus_tag LOCUS_19430 352 1296 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_19430 1325 2131 gene locus_tag LOCUS_19440 gene uppP1 1325 2131 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58740 protein_id gnl|my_center|LOCUS_19440 2344 3786 gene locus_tag LOCUS_19450 gene gltD 2344 3786 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_19450 3818 4381 gene locus_tag LOCUS_19460 3818 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4378 4899 gene locus_tag LOCUS_19470 4378 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4910 5251 gene locus_tag LOCUS_19480 4910 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5248 5733 gene locus_tag LOCUS_19490 5248 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5743 10251 gene locus_tag LOCUS_19500 5743 10251 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_19500 10407 12263 gene locus_tag LOCUS_19510 10407 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence071 1816 521 gene locus_tag LOCUS_19520 1816 521 CDS product large terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 protein_id gnl|my_center|LOCUS_19520 2289 1813 gene locus_tag LOCUS_19530 2289 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3042 2347 gene locus_tag LOCUS_19540 3042 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3299 3862 gene locus_tag LOCUS_19550 3299 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4528 3857 gene locus_tag LOCUS_19560 4528 3857 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_19560 4576 6450 gene locus_tag LOCUS_19570 4576 6450 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_19570 6459 7388 gene locus_tag LOCUS_19580 6459 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 7385 7954 gene locus_tag LOCUS_19590 7385 7954 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938823.1 protein_id gnl|my_center|LOCUS_19590 8103 8669 gene locus_tag LOCUS_19600 8103 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 8935 11190 gene locus_tag LOCUS_19610 8935 11190 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N8 protein_id gnl|my_center|LOCUS_19610 11187 12146 gene locus_tag LOCUS_19620 gene prmA 11187 12146 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDP9 protein_id gnl|my_center|LOCUS_19620 >Feature sequence072 2306 378 gene locus_tag LOCUS_19630 gene kup 2306 378 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y19 protein_id gnl|my_center|LOCUS_19630 3656 2727 gene locus_tag LOCUS_19640 gene ftsY 3656 2727 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X49 protein_id gnl|my_center|LOCUS_19640 4906 3653 gene locus_tag LOCUS_19650 4906 3653 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338605.1 protein_id gnl|my_center|LOCUS_19650 5024 6607 gene locus_tag LOCUS_19660 5024 6607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703646.1 protein_id gnl|my_center|LOCUS_19660 6604 7338 gene locus_tag LOCUS_19670 gene trmB 6604 7338 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_19670 7476 9356 gene locus_tag LOCUS_19680 7476 9356 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 protein_id gnl|my_center|LOCUS_19680 9985 9353 gene locus_tag LOCUS_19690 gene nth 9985 9353 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 protein_id gnl|my_center|LOCUS_19690 10075 10554 gene locus_tag LOCUS_19700 10075 10554 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_19700 11252 10524 gene locus_tag LOCUS_19710 gene dapB 11252 10524 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_19710 11298 12011 gene locus_tag LOCUS_19720 gene cobB 11298 12011 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN56 protein_id gnl|my_center|LOCUS_19720 >Feature sequence073 1168 1488 gene locus_tag LOCUS_19730 1168 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2133 1729 gene locus_tag LOCUS_19740 gene acpS 2133 1729 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A807 protein_id gnl|my_center|LOCUS_19740 2852 2130 gene locus_tag LOCUS_19750 gene pdxJ 2852 2130 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_19750 3429 2854 gene locus_tag LOCUS_19760 gene pyrE 3429 2854 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 protein_id gnl|my_center|LOCUS_19760 5566 3437 gene locus_tag LOCUS_19770 5566 3437 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_19770 6002 5658 gene locus_tag LOCUS_19780 6002 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 6254 6895 gene locus_tag LOCUS_19790 6254 6895 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_19790 6892 7707 gene locus_tag LOCUS_19800 gene mcl2 6892 7707 CDS product (3S)-malyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3JV05 protein_id gnl|my_center|LOCUS_19800 7712 8248 gene locus_tag LOCUS_19810 gene apt 7712 8248 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB5 protein_id gnl|my_center|LOCUS_19810 8248 8664 gene locus_tag LOCUS_19820 8248 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8812 8902 gene locus_tag LOCUS_t00310 8812 8902 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9051 10385 gene locus_tag LOCUS_19830 9051 10385 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_19830 10385 10795 gene locus_tag LOCUS_19840 10385 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 10876 11112 gene locus_tag LOCUS_19850 10876 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence074 487 347 gene locus_tag LOCUS_19860 487 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 2045 783 gene locus_tag LOCUS_19870 gene fabF 2045 783 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 protein_id gnl|my_center|LOCUS_19870 2389 2150 gene locus_tag LOCUS_19880 gene acpP 2389 2150 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_19880 2623 3141 gene locus_tag LOCUS_19890 2623 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527882.1 protein_id gnl|my_center|LOCUS_19890 4001 3138 gene locus_tag LOCUS_19900 4001 3138 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_19900 4669 4115 gene locus_tag LOCUS_19910 4669 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6289 4679 gene locus_tag LOCUS_19920 gene nadB 6289 4679 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_19920 7214 6282 gene locus_tag LOCUS_19930 7214 6282 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_19930 8483 7374 gene locus_tag LOCUS_19940 8483 7374 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390873.1 protein_id gnl|my_center|LOCUS_19940 10615 8486 gene locus_tag LOCUS_19950 10615 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 11060 10734 gene locus_tag LOCUS_19960 11060 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence075 54 380 gene locus_tag LOCUS_19970 54 380 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 protein_id gnl|my_center|LOCUS_19970 377 1282 gene locus_tag LOCUS_19980 377 1282 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011379034.1 protein_id gnl|my_center|LOCUS_19980 2658 1246 gene locus_tag LOCUS_19990 2658 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3081 4271 gene locus_tag LOCUS_20000 3081 4271 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_20000 4301 5914 gene locus_tag LOCUS_20010 4301 5914 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_20010 7204 5870 gene locus_tag LOCUS_20020 7204 5870 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920962.1 protein_id gnl|my_center|LOCUS_20020 8280 7201 gene locus_tag LOCUS_20030 8280 7201 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704973.1 protein_id gnl|my_center|LOCUS_20030 10655 8280 gene locus_tag LOCUS_20040 10655 8280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence076 980 660 gene locus_tag LOCUS_20050 980 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2429 1041 gene locus_tag LOCUS_20060 2429 1041 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531496.1 protein_id gnl|my_center|LOCUS_20060 4569 2419 gene locus_tag LOCUS_20070 4569 2419 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_20070 6276 4822 gene locus_tag LOCUS_20080 6276 4822 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_20080 7355 6273 gene locus_tag LOCUS_20090 gene ntrB 7355 6273 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_20090 8347 7352 gene locus_tag LOCUS_20100 gene dus 8347 7352 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_20100 8707 9801 gene locus_tag LOCUS_20110 gene mauG 8707 9801 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_20110 9873 10202 gene locus_tag LOCUS_20120 9873 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 10218 11201 gene locus_tag LOCUS_20130 10218 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence077 1714 32 gene locus_tag LOCUS_20140 1714 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_20140 2651 1839 gene locus_tag LOCUS_20150 2651 1839 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_20150 4000 2651 gene locus_tag LOCUS_20160 4000 2651 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 protein_id gnl|my_center|LOCUS_20160 5034 3997 gene locus_tag LOCUS_20170 5034 3997 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946407.1 protein_id gnl|my_center|LOCUS_20170 6335 5031 gene locus_tag LOCUS_20180 gene ndh 6335 5031 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083871.1 protein_id gnl|my_center|LOCUS_20180 7164 6361 gene locus_tag LOCUS_20190 7164 6361 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_20190 7341 7793 gene locus_tag LOCUS_20200 7341 7793 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886665.1 protein_id gnl|my_center|LOCUS_20200 7859 9073 gene locus_tag LOCUS_20210 7859 9073 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085555.1 protein_id gnl|my_center|LOCUS_20210 9113 9817 gene locus_tag LOCUS_20220 9113 9817 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 protein_id gnl|my_center|LOCUS_20220 10702 9779 gene locus_tag LOCUS_20230 10702 9779 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085559.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence078 1269 187 gene locus_tag LOCUS_20240 1269 187 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6L6 protein_id gnl|my_center|LOCUS_20240 2085 1477 gene locus_tag LOCUS_20250 gene rnhB 2085 1477 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHC0 protein_id gnl|my_center|LOCUS_20250 2845 2078 gene locus_tag LOCUS_20260 2845 2078 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073517.1 protein_id gnl|my_center|LOCUS_20260 4814 2838 gene locus_tag LOCUS_20270 gene parE 4814 2838 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQT8 protein_id gnl|my_center|LOCUS_20270 5352 4864 gene locus_tag LOCUS_20280 5352 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6270 6986 gene locus_tag LOCUS_20290 6270 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8618 7206 gene locus_tag LOCUS_20300 gene glnA3 8618 7206 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCG7 protein_id gnl|my_center|LOCUS_20300 9055 8663 gene locus_tag LOCUS_20310 gene glnB 9055 8663 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_20310 10577 9195 gene locus_tag LOCUS_20320 gene sdaA 10577 9195 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_20320 10866 10942 gene locus_tag LOCUS_t00320 10866 10942 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 233 78 gene locus_tag LOCUS_20330 233 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 759 226 gene locus_tag LOCUS_20340 759 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1229 756 gene locus_tag LOCUS_20350 1229 756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969348.1 protein_id gnl|my_center|LOCUS_20350 2442 1222 gene locus_tag LOCUS_20360 2442 1222 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969347.1 protein_id gnl|my_center|LOCUS_20360 2779 2453 gene locus_tag LOCUS_20370 2779 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2924 4669 gene locus_tag LOCUS_20380 2924 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4666 5991 gene locus_tag LOCUS_20390 4666 5991 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_20390 6510 6719 gene locus_tag LOCUS_20400 6510 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7310 6690 gene locus_tag LOCUS_20410 7310 6690 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264144.1 protein_id gnl|my_center|LOCUS_20410 7432 8871 gene locus_tag LOCUS_20420 7432 8871 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 protein_id gnl|my_center|LOCUS_20420 8884 10059 gene locus_tag LOCUS_20430 8884 10059 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889654.1 protein_id gnl|my_center|LOCUS_20430 10089 10298 gene locus_tag LOCUS_20440 10089 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence080 771 2474 gene locus_tag LOCUS_20450 771 2474 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268252.1 protein_id gnl|my_center|LOCUS_20450 2477 3694 gene locus_tag LOCUS_20460 gene gspF 2477 3694 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_20460 3897 4307 gene locus_tag LOCUS_20470 gene gspG 3897 4307 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708825.1 protein_id gnl|my_center|LOCUS_20470 4309 4746 gene locus_tag LOCUS_20480 4309 4746 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533579.1 protein_id gnl|my_center|LOCUS_20480 4743 5120 gene locus_tag LOCUS_20490 4743 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 5117 5800 gene locus_tag LOCUS_20500 5117 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5800 6849 gene locus_tag LOCUS_20510 5800 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 6846 7397 gene locus_tag LOCUS_20520 6846 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7375 7890 gene locus_tag LOCUS_20530 7375 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 7887 9986 gene locus_tag LOCUS_20540 7887 9986 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence081 1627 908 gene locus_tag LOCUS_20550 1627 908 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_20550 1833 1624 gene locus_tag LOCUS_20560 1833 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2525 1821 gene locus_tag LOCUS_20570 2525 1821 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_20570 3639 2491 gene locus_tag LOCUS_20580 3639 2491 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_20580 4028 3636 gene locus_tag LOCUS_20590 gene crcB 4028 3636 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_20590 5114 4182 gene locus_tag LOCUS_20600 5114 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5342 6523 gene locus_tag LOCUS_20610 gene rlmN 5342 6523 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAJ1 protein_id gnl|my_center|LOCUS_20610 6594 7235 gene locus_tag LOCUS_20620 6594 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 7383 9542 gene locus_tag LOCUS_20630 7383 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 9539 10090 gene locus_tag LOCUS_20640 9539 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence082 23 417 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcagccccgcgtgtgcggggaacag 800 507 gene locus_tag LOCUS_20650 800 507 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387927.1 protein_id gnl|my_center|LOCUS_20650 1959 1006 gene locus_tag LOCUS_20660 gene cas1 1959 1006 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DC4 protein_id gnl|my_center|LOCUS_20660 2651 1956 gene locus_tag LOCUS_20670 2651 1956 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387929.1 protein_id gnl|my_center|LOCUS_20670 3406 2648 gene locus_tag LOCUS_20680 3406 2648 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387930.1 protein_id gnl|my_center|LOCUS_20680 4511 3399 gene locus_tag LOCUS_20690 4511 3399 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387931.1 protein_id gnl|my_center|LOCUS_20690 5130 4543 gene locus_tag LOCUS_20700 5130 4543 CDS product CRISPR-associated protein Cse2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387932.1 protein_id gnl|my_center|LOCUS_20700 6833 5127 gene locus_tag LOCUS_20710 6833 5127 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387933.1 protein_id gnl|my_center|LOCUS_20710 6718 9678 gene locus_tag LOCUS_20720 6718 9678 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387934.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence083 77 2 gene locus_tag LOCUS_t00330 77 2 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1926 151 gene locus_tag LOCUS_20730 1926 151 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_20730 2922 1927 gene locus_tag LOCUS_20740 gene glpX 2922 1927 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4U0 protein_id gnl|my_center|LOCUS_20740 4216 2924 gene locus_tag LOCUS_20750 4216 2924 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_20750 4583 6211 gene locus_tag LOCUS_20760 4583 6211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106293.1 protein_id gnl|my_center|LOCUS_20760 7527 6316 gene locus_tag LOCUS_20770 7527 6316 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_20770 7862 9643 gene locus_tag LOCUS_20780 7862 9643 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence084 1399 320 gene locus_tag LOCUS_20790 gene ldh 1399 320 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_20790 1945 1643 gene locus_tag LOCUS_20800 1945 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3177 2116 gene locus_tag LOCUS_20810 gene tgt 3177 2116 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5I3 protein_id gnl|my_center|LOCUS_20810 4277 3240 gene locus_tag LOCUS_20820 gene queA 4277 3240 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PY5 protein_id gnl|my_center|LOCUS_20820 4796 4284 gene locus_tag LOCUS_20830 4796 4284 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y5 protein_id gnl|my_center|LOCUS_20830 5401 4889 gene locus_tag LOCUS_20840 gene coaD 5401 4889 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58103 protein_id gnl|my_center|LOCUS_20840 6332 5433 gene locus_tag LOCUS_20850 6332 5433 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_20850 6589 6329 gene locus_tag LOCUS_20860 6589 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence085 2578 56 gene locus_tag LOCUS_20870 gene celD 2578 56 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_20870 2570 2881 gene locus_tag LOCUS_20880 2570 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2878 3813 gene locus_tag LOCUS_20890 2878 3813 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640156.1 protein_id gnl|my_center|LOCUS_20890 3963 5189 gene locus_tag LOCUS_20900 gene xylR 3963 5189 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974049.1 protein_id gnl|my_center|LOCUS_20900 6394 5186 gene locus_tag LOCUS_20910 6394 5186 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887566.1 protein_id gnl|my_center|LOCUS_20910 6729 9482 gene locus_tag LOCUS_20920 6729 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence086 1868 348 gene locus_tag LOCUS_20930 1868 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_20930 2627 1965 gene locus_tag LOCUS_20940 2627 1965 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919946.1 protein_id gnl|my_center|LOCUS_20940 3122 2748 gene locus_tag LOCUS_20950 3122 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5404 3188 gene locus_tag LOCUS_20960 gene katG2 5404 3188 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_20960 8083 5552 gene locus_tag LOCUS_20970 8083 5552 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_20970 8386 8249 gene locus_tag LOCUS_20980 8386 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 8951 8403 gene locus_tag LOCUS_20990 8951 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933869.1 protein_id gnl|my_center|LOCUS_20990 9589 8978 gene locus_tag LOCUS_21000 9589 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence087 1566 184 gene locus_tag LOCUS_21010 1566 184 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_21010 2215 1547 gene locus_tag LOCUS_21020 2215 1547 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_21020 2680 2348 gene locus_tag LOCUS_21030 2680 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2753 4558 gene locus_tag LOCUS_21040 2753 4558 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_21040 6880 4736 gene locus_tag LOCUS_21050 6880 4736 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_21050 7633 7016 gene locus_tag LOCUS_21060 7633 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 7710 9044 gene locus_tag LOCUS_21070 gene rimO 7710 9044 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI7 protein_id gnl|my_center|LOCUS_21070 >Feature sequence088 889 2004 gene locus_tag LOCUS_21080 gene nhaA 889 2004 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG3 protein_id gnl|my_center|LOCUS_21080 2236 3885 gene locus_tag LOCUS_21090 2236 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 4017 8795 gene locus_tag LOCUS_21100 4017 8795 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_21100 9088 8951 gene locus_tag LOCUS_21110 9088 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence089 1953 949 gene locus_tag LOCUS_21120 1953 949 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_21120 2191 2421 gene locus_tag LOCUS_21130 2191 2421 CDS product antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557549.1 protein_id gnl|my_center|LOCUS_21130 2421 2822 gene locus_tag LOCUS_21140 gene mvpA 2421 2822 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERI7 protein_id gnl|my_center|LOCUS_21140 2819 4576 gene locus_tag LOCUS_21150 gene mutL 2819 4576 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYV3 protein_id gnl|my_center|LOCUS_21150 5435 4965 gene locus_tag LOCUS_21160 gene rcdA 5435 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_21160 5606 6079 gene locus_tag LOCUS_21170 5606 6079 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_21170 6238 8922 gene locus_tag LOCUS_21180 6238 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence090 4289 1572 gene locus_tag LOCUS_21190 4289 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 4754 5395 gene locus_tag LOCUS_21200 gene ftrB 4754 5395 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 protein_id gnl|my_center|LOCUS_21200 6395 5403 gene locus_tag LOCUS_21210 gene moaA 6395 5403 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 protein_id gnl|my_center|LOCUS_21210 7792 6596 gene locus_tag LOCUS_21220 7792 6596 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_21220 <8613 7813 gene locus_tag LOCUS_21230 <8613 7813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339403.1:ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent >Feature sequence091 96 12 gene locus_tag LOCUS_t00340 96 12 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1291 110 gene locus_tag LOCUS_21240 1291 110 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921444.1 protein_id gnl|my_center|LOCUS_21240 2388 1543 gene locus_tag LOCUS_21250 2388 1543 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_21250 2642 2385 gene locus_tag LOCUS_21260 gene grxC 2642 2385 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164717.1 protein_id gnl|my_center|LOCUS_21260 3530 2781 gene locus_tag LOCUS_21270 gene comF 3530 2781 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_21270 3573 4436 gene locus_tag LOCUS_21280 gene bioC 3573 4436 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_21280 4564 4749 gene locus_tag LOCUS_21290 4564 4749 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939393.1 protein_id gnl|my_center|LOCUS_21290 5265 4819 gene locus_tag LOCUS_21300 5265 4819 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388152.1 protein_id gnl|my_center|LOCUS_21300 5353 5541 gene locus_tag LOCUS_21310 5353 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5685 5870 gene locus_tag LOCUS_21320 5685 5870 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939393.1 protein_id gnl|my_center|LOCUS_21320 7404 5938 gene locus_tag LOCUS_21330 7404 5938 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709743.1 protein_id gnl|my_center|LOCUS_21330 8239 8140 gene locus_tag LOCUS_t00350 8239 8140 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 <1 2221 gene locus_tag LOCUS_21340 <1 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU43:Lon protease 2375 2647 gene locus_tag LOCUS_21350 2375 2647 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_21350 2769 2843 gene locus_tag LOCUS_t00360 2769 2843 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2880 3251 gene locus_tag LOCUS_21360 2880 3251 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_21360 3253 4107 gene locus_tag LOCUS_21370 gene purU 3253 4107 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BU4 protein_id gnl|my_center|LOCUS_21370 4336 4412 gene locus_tag LOCUS_t00370 4336 4412 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4648 6060 gene locus_tag LOCUS_21380 4648 6060 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199804.1 protein_id gnl|my_center|LOCUS_21380 7121 6291 gene locus_tag LOCUS_21390 7121 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 7941 7498 gene locus_tag LOCUS_21400 7941 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence093 2693 1509 gene locus_tag LOCUS_21410 2693 1509 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 protein_id gnl|my_center|LOCUS_21410 3079 2690 gene locus_tag LOCUS_21420 gene moaC 3079 2690 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9C6 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 3725 3180 gene locus_tag LOCUS_21430 3725 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3879 3703 gene locus_tag LOCUS_21440 3879 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4366 3890 gene locus_tag LOCUS_21450 4366 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4611 4372 gene locus_tag LOCUS_21460 4611 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 5307 4651 gene locus_tag LOCUS_21470 5307 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338145.1 protein_id gnl|my_center|LOCUS_21470 5249 5467 gene locus_tag LOCUS_21480 5249 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5811 5626 gene locus_tag LOCUS_21490 5811 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 5738 6142 gene locus_tag LOCUS_21500 5738 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7058 6153 gene locus_tag LOCUS_21510 7058 6153 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011379034.1 protein_id gnl|my_center|LOCUS_21510 7254 8075 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcagccccgcgtgtgcggggaacag >Feature sequence094 1128 169 gene locus_tag LOCUS_21520 1128 169 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_21520 1700 1125 gene locus_tag LOCUS_21530 gene pdxH 1700 1125 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_21530 1814 2752 gene locus_tag LOCUS_21540 1814 2752 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920613.1 protein_id gnl|my_center|LOCUS_21540 2823 3626 gene locus_tag LOCUS_21550 gene fabI-2 2823 3626 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U2 protein_id gnl|my_center|LOCUS_21550 3654 4727 gene locus_tag LOCUS_21560 gene aroC 3654 4727 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHI8 protein_id gnl|my_center|LOCUS_21560 4724 5350 gene locus_tag LOCUS_21570 4724 5350 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence095 1005 4 gene locus_tag LOCUS_21580 1005 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1309 1007 gene locus_tag LOCUS_21590 1309 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 protein_id gnl|my_center|LOCUS_21590 2073 1315 gene locus_tag LOCUS_21600 2073 1315 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_21600 4559 2070 gene locus_tag LOCUS_21610 gene trbE 4559 2070 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_21610 4837 4556 gene locus_tag LOCUS_21620 gene trbD 4837 4556 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090994.1 protein_id gnl|my_center|LOCUS_21620 5202 4834 gene locus_tag LOCUS_21630 5202 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 6137 5199 gene locus_tag LOCUS_21640 gene trbB 6137 5199 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_21640 6786 6358 gene locus_tag LOCUS_21650 6786 6358 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_21650 <7953 6793 gene locus_tag LOCUS_21660 <7953 6793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368406.1:conjugal transfer protein TraG >Feature sequence096 2571 706 gene locus_tag LOCUS_21670 2571 706 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_21670 3332 2607 gene locus_tag LOCUS_21680 gene gloB 3332 2607 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_21680 3817 3332 gene locus_tag LOCUS_21690 3817 3332 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_21690 4683 3853 gene locus_tag LOCUS_21700 4683 3853 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919002.1 protein_id gnl|my_center|LOCUS_21700 7297 4676 gene locus_tag LOCUS_21710 7297 4676 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_21710 7674 7294 gene locus_tag LOCUS_21720 7674 7294 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918502.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence097 4399 191 gene locus_tag LOCUS_21730 4399 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640286.1 protein_id gnl|my_center|LOCUS_21730 6281 4401 gene locus_tag LOCUS_21740 6281 4401 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_21740 6556 6341 gene locus_tag LOCUS_21750 6556 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 6729 6911 gene locus_tag LOCUS_21760 6729 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7637 6969 gene locus_tag LOCUS_21770 7637 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence098 154 768 gene locus_tag LOCUS_21780 154 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 992 2647 gene locus_tag LOCUS_21790 992 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_21790 2644 4059 gene locus_tag LOCUS_21800 2644 4059 CDS product nuclease PIN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942012.1 protein_id gnl|my_center|LOCUS_21800 4806 6074 gene locus_tag LOCUS_21810 4806 6074 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_21810 6071 7243 gene locus_tag LOCUS_21820 6071 7243 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence099 234 52 gene locus_tag LOCUS_21830 234 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 802 380 gene locus_tag LOCUS_21840 gene vapC 802 380 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK03 protein_id gnl|my_center|LOCUS_21840 1047 799 gene locus_tag LOCUS_21850 1047 799 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706329.1 protein_id gnl|my_center|LOCUS_21850 1507 3558 gene locus_tag LOCUS_21860 1507 3558 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082897.1 protein_id gnl|my_center|LOCUS_21860 4461 3706 gene locus_tag LOCUS_21870 4461 3706 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969942.1 protein_id gnl|my_center|LOCUS_21870 5531 4458 gene locus_tag LOCUS_21880 5531 4458 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085869.1 protein_id gnl|my_center|LOCUS_21880 5960 5535 gene locus_tag LOCUS_21890 5960 5535 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJK4 protein_id gnl|my_center|LOCUS_21890 6487 5957 gene locus_tag LOCUS_21900 6487 5957 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_21900 6831 6499 gene locus_tag LOCUS_21910 6831 6499 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_21910 7038 7295 gene locus_tag LOCUS_21920 7038 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 7297 7596 gene locus_tag LOCUS_21930 7297 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55425 protein_id gnl|my_center|LOCUS_21930 >Feature sequence100 843 768 gene locus_tag LOCUS_t00380 843 768 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1870 956 gene locus_tag LOCUS_21940 1870 956 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 protein_id gnl|my_center|LOCUS_21940 3095 2094 gene locus_tag LOCUS_21950 3095 2094 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_21950 3793 3161 gene locus_tag LOCUS_21960 3793 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4132 3863 gene locus_tag LOCUS_21970 4132 3863 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_21970 4168 4815 gene locus_tag LOCUS_21980 4168 4815 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709225.1 protein_id gnl|my_center|LOCUS_21980 4858 5862 gene locus_tag LOCUS_21990 4858 5862 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_21990 <7607 5872 gene locus_tag LOCUS_22000 <7607 5872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_233096.2:sensor protein TorS >Feature sequence101 1147 740 gene locus_tag LOCUS_22010 1147 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_22010 2754 1144 gene locus_tag LOCUS_22020 2754 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4508 2751 gene locus_tag LOCUS_22030 4508 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203819.1 protein_id gnl|my_center|LOCUS_22030 6430 4505 gene locus_tag LOCUS_22040 6430 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203819.1 protein_id gnl|my_center|LOCUS_22040 7388 6606 gene locus_tag LOCUS_22050 gene purC 7388 6606 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD65 protein_id gnl|my_center|LOCUS_22050 >Feature sequence102 <1 1043 gene locus_tag LOCUS_22060 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J2M4:transcription-repair-coupling factor 2545 1241 gene locus_tag LOCUS_22070 2545 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4771 2711 gene locus_tag LOCUS_22080 4771 2711 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_22080 5005 5331 gene locus_tag LOCUS_22090 5005 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 5415 6452 gene locus_tag LOCUS_22100 gene moaA 5415 6452 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 protein_id gnl|my_center|LOCUS_22100 6454 7251 gene locus_tag LOCUS_22110 gene nadK 6454 7251 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_22110 >Feature sequence103 690 604 gene locus_tag LOCUS_t00390 690 604 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 780 1577 gene locus_tag LOCUS_22120 780 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1767 3053 gene locus_tag LOCUS_22130 1767 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3050 3631 gene locus_tag LOCUS_22140 gene hslV 3050 3631 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA2 protein_id gnl|my_center|LOCUS_22140 3624 4961 gene locus_tag LOCUS_22150 gene hslU 3624 4961 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEL0 protein_id gnl|my_center|LOCUS_22150 5145 7394 gene locus_tag LOCUS_22160 5145 7394 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921290.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence104 466 158 gene locus_tag LOCUS_22170 466 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 720 463 gene locus_tag LOCUS_22180 720 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1734 811 gene locus_tag LOCUS_22190 1734 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1820 2959 gene locus_tag LOCUS_22200 1820 2959 CDS product LPS biosynthesis RfbU related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875812.1 protein_id gnl|my_center|LOCUS_22200 2995 4212 gene locus_tag LOCUS_22210 2995 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4212 5582 gene locus_tag LOCUS_22220 4212 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5680 6615 gene locus_tag LOCUS_22230 gene prs 5680 6615 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N73 protein_id gnl|my_center|LOCUS_22230 6633 6878 gene locus_tag LOCUS_22240 6633 6878 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9H0 protein_id gnl|my_center|LOCUS_22240 >Feature sequence105 982 566 gene locus_tag LOCUS_22250 982 566 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_22250 1517 1092 gene locus_tag LOCUS_22260 1517 1092 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_22260 2355 1600 gene locus_tag LOCUS_22270 2355 1600 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_22270 4059 2521 gene locus_tag LOCUS_22280 gene emrB 4059 2521 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_22280 5193 4063 gene locus_tag LOCUS_22290 5193 4063 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889654.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence106 1606 275 gene locus_tag LOCUS_22300 1606 275 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_22300 3168 2074 gene locus_tag LOCUS_22310 gene ubiA 3168 2074 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DB8 protein_id gnl|my_center|LOCUS_22310 3079 3804 gene locus_tag LOCUS_22320 3079 3804 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_22320 3889 5259 gene locus_tag LOCUS_22330 gene gsh1 3889 5259 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_22330 <6960 5487 gene locus_tag LOCUS_22340 <6960 5487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein >Feature sequence107 <1 2157 gene locus_tag LOCUS_22350 <1 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096515.1:nitrate reductase subunit alpha 2154 3683 gene locus_tag LOCUS_22360 gene narH 2154 3683 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_22360 3686 4348 gene locus_tag LOCUS_22370 gene narJ 3686 4348 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_22370 4431 5201 gene locus_tag LOCUS_22380 gene narI 4431 5201 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_22380 5198 6331 gene locus_tag LOCUS_22390 5198 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence108 <1 580 gene locus_tag LOCUS_22400 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188120.1:ABC transporter permease 584 1300 gene locus_tag LOCUS_22410 584 1300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_22410 1284 2291 gene locus_tag LOCUS_22420 1284 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2294 3652 gene locus_tag LOCUS_22430 2294 3652 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919653.1 protein_id gnl|my_center|LOCUS_22430 3778 3659 gene locus_tag LOCUS_22440 3778 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4036 3839 gene locus_tag LOCUS_22450 4036 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4240 4575 gene locus_tag LOCUS_22460 4240 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5232 4687 gene locus_tag LOCUS_22470 5232 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 <6659 5305 gene locus_tag LOCUS_22480 <6659 5305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143506.1:Xaa-Pro dipeptidase >Feature sequence109 3072 1849 gene locus_tag LOCUS_22490 3072 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3935 3132 gene locus_tag LOCUS_22500 3935 3132 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530459.1 protein_id gnl|my_center|LOCUS_22500 4901 3966 gene locus_tag LOCUS_22510 gene nrtB 4901 3966 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887599.1 protein_id gnl|my_center|LOCUS_22510 6239 4926 gene locus_tag LOCUS_22520 gene ntrA 6239 4926 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973417.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence110 974 1573 gene locus_tag LOCUS_22530 974 1573 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_22530 1570 2304 gene locus_tag LOCUS_22540 1570 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2291 2902 gene locus_tag LOCUS_22550 2291 2902 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923284.1 protein_id gnl|my_center|LOCUS_22550 3208 2906 gene locus_tag LOCUS_22560 3208 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709340.1 protein_id gnl|my_center|LOCUS_22560 3281 4723 gene locus_tag LOCUS_22570 gene pykA 3281 4723 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EE7 protein_id gnl|my_center|LOCUS_22570 5118 4888 gene locus_tag LOCUS_22580 5118 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 5379 6164 gene locus_tag LOCUS_22590 5379 6164 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence111 1178 207 gene locus_tag LOCUS_22600 1178 207 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339022.1 protein_id gnl|my_center|LOCUS_22600 2371 1175 gene locus_tag LOCUS_22610 2371 1175 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_22610 4962 2527 gene locus_tag LOCUS_22620 4962 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6315 5080 gene locus_tag LOCUS_22630 gene argJ 6315 5080 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_22630 >Feature sequence112 640 1623 gene locus_tag LOCUS_22640 640 1623 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932637.1 protein_id gnl|my_center|LOCUS_22640 1889 1635 gene locus_tag LOCUS_22650 1889 1635 CDS product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 protein_id gnl|my_center|LOCUS_22650 3196 1886 gene locus_tag LOCUS_22660 3196 1886 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_22660 3316 4695 gene locus_tag LOCUS_22670 3316 4695 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_22670 4787 5182 gene locus_tag LOCUS_22680 4787 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 5217 6053 gene locus_tag LOCUS_22690 5217 6053 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence113 626 168 gene locus_tag LOCUS_22700 626 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 759 1415 gene locus_tag LOCUS_22710 759 1415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_22710 3424 1367 gene locus_tag LOCUS_22720 gene recG 3424 1367 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9B7 protein_id gnl|my_center|LOCUS_22720 3562 3756 gene locus_tag LOCUS_22730 3562 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence114 <1 1342 gene locus_tag LOCUS_22740 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3KRJ1:potassium-transporting ATPase ATP-binding subunit 1353 1973 gene locus_tag LOCUS_22750 gene kdpC 1353 1973 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9E0 protein_id gnl|my_center|LOCUS_22750 1970 4606 gene locus_tag LOCUS_22760 gene kdpD 1970 4606 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973320.1 protein_id gnl|my_center|LOCUS_22760 4603 5283 gene locus_tag LOCUS_22770 4603 5283 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_22770 5906 5514 gene locus_tag LOCUS_22780 5906 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence115 389 1009 gene locus_tag LOCUS_22790 389 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1009 1449 gene locus_tag LOCUS_22800 gene hisI 1009 1449 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MB44 protein_id gnl|my_center|LOCUS_22800 2462 1455 gene locus_tag LOCUS_22810 2462 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3777 2551 gene locus_tag LOCUS_22820 3777 2551 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 protein_id gnl|my_center|LOCUS_22820 3991 4815 gene locus_tag LOCUS_22830 gene bdhA 3991 4815 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_22830 4950 5663 gene locus_tag LOCUS_22840 4950 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence116 403 2154 gene locus_tag LOCUS_22850 gene ggt 403 2154 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339171.1 protein_id gnl|my_center|LOCUS_22850 2144 3979 gene locus_tag LOCUS_22860 2144 3979 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_22860 4704 3988 gene locus_tag LOCUS_22870 4704 3988 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_22870 4810 5637 gene locus_tag LOCUS_22880 4810 5637 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967600.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence117 2757 187 gene locus_tag LOCUS_22890 gene clpB 2757 187 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ2 protein_id gnl|my_center|LOCUS_22890 3925 2834 gene locus_tag LOCUS_22900 gene modC 3925 2834 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4C1 protein_id gnl|my_center|LOCUS_22900 4247 3957 gene locus_tag LOCUS_22910 gene rpmB 4247 3957 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9V8 protein_id gnl|my_center|LOCUS_22910 4483 5160 gene locus_tag LOCUS_22920 4483 5160 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence118 <1 877 gene locus_tag LOCUS_22930 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917991.1:rRNA methyltransferase 926 1630 gene locus_tag LOCUS_22940 926 1630 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4H5 protein_id gnl|my_center|LOCUS_22940 1627 3372 gene locus_tag LOCUS_22950 1627 3372 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 protein_id gnl|my_center|LOCUS_22950 3389 4984 gene locus_tag LOCUS_22960 gene purH 3389 4984 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 protein_id gnl|my_center|LOCUS_22960 >Feature sequence119 <1 1567 gene locus_tag LOCUS_22970 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888158.1:methylmalonyl-CoA mutase 1583 2368 gene locus_tag LOCUS_22980 1583 2368 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_22980 2379 3152 gene locus_tag LOCUS_22990 2379 3152 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_22990 3236 3994 gene locus_tag LOCUS_23000 3236 3994 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23000 4217 4954 gene locus_tag LOCUS_23010 4217 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence120 2157 934 gene locus_tag LOCUS_23020 2157 934 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391080.1 protein_id gnl|my_center|LOCUS_23020 2328 4073 gene locus_tag LOCUS_23030 2328 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 <4903 4080 gene locus_tag LOCUS_23040 <4903 4080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036061.1:histidine kinase >Feature sequence121 2590 2213 gene locus_tag LOCUS_23050 2590 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2693 4267 gene locus_tag LOCUS_23060 2693 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085897.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence122 714 115 gene locus_tag LOCUS_23070 714 115 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZF61 protein_id gnl|my_center|LOCUS_23070 1312 830 gene locus_tag LOCUS_23080 gene queF 1312 830 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFQ1 protein_id gnl|my_center|LOCUS_23080 2355 1393 gene locus_tag LOCUS_23090 2355 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919590.1 protein_id gnl|my_center|LOCUS_23090 3576 2434 gene locus_tag LOCUS_23100 3576 2434 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_23100 4181 3573 gene locus_tag LOCUS_23110 4181 3573 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_23110 4864 4178 gene locus_tag LOCUS_23120 gene rph 4864 4178 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN60 protein_id gnl|my_center|LOCUS_23120 >Feature sequence123 1139 1849 gene locus_tag LOCUS_23130 1139 1849 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_23130 1962 2195 gene locus_tag LOCUS_23140 1962 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2461 4155 gene locus_tag LOCUS_23150 gene kdpA 2461 4155 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDR1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence124 1268 615 gene locus_tag LOCUS_23160 1268 615 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_23160 1447 2796 gene locus_tag LOCUS_23170 1447 2796 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE1 protein_id gnl|my_center|LOCUS_23170 2910 3590 gene locus_tag LOCUS_23180 gene fnr 2910 3590 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 protein_id gnl|my_center|LOCUS_23180 4281 3637 gene locus_tag LOCUS_23190 4281 3637 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence125 476 1408 gene locus_tag LOCUS_23200 476 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1641 1405 gene locus_tag LOCUS_23210 gene cspA2 1641 1405 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533862.1 protein_id gnl|my_center|LOCUS_23210 2074 1670 gene locus_tag LOCUS_23220 2074 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2138 3118 gene locus_tag LOCUS_23230 2138 3118 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 protein_id gnl|my_center|LOCUS_23230 3211 4101 gene locus_tag LOCUS_23240 gene rpoH2 3211 4101 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6K8 protein_id gnl|my_center|LOCUS_23240 >Feature sequence126 302 213 gene locus_tag LOCUS_t00400 302 213 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 885 394 gene locus_tag LOCUS_23250 885 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1199 993 gene locus_tag LOCUS_23260 1199 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1307 2011 gene locus_tag LOCUS_23270 1307 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_23270 2106 2366 gene locus_tag LOCUS_23280 2106 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2363 4201 gene locus_tag LOCUS_23290 2363 4201 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence127 106 549 gene locus_tag LOCUS_23300 106 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23300 553 966 gene locus_tag LOCUS_23310 553 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 980 2173 gene locus_tag LOCUS_23320 gene gcdH 980 2173 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085402.1 protein_id gnl|my_center|LOCUS_23320 3332 2646 gene locus_tag LOCUS_23330 3332 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence128 2277 1726 gene locus_tag LOCUS_23340 gene dcd 2277 1726 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC9 protein_id gnl|my_center|LOCUS_23340 3145 2285 gene locus_tag LOCUS_23350 3145 2285 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_23350 3367 3819 gene locus_tag LOCUS_23360 3367 3819 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence129 <1 564 gene locus_tag LOCUS_23370 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958022.1:IscS subfamily cysteine desulfurase 518 853 gene locus_tag LOCUS_23380 gene fdxB 518 853 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDW6 protein_id gnl|my_center|LOCUS_23380 1776 856 gene locus_tag LOCUS_23390 1776 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3432 2035 gene locus_tag LOCUS_23400 gene rhlE 3432 2035 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087120.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence130 262 561 gene locus_tag LOCUS_23410 262 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 691 1698 gene locus_tag LOCUS_23420 691 1698 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_23420 1751 3073 gene locus_tag LOCUS_23430 gene rkpK 1751 3073 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54068 protein_id gnl|my_center|LOCUS_23430 3527 3138 gene locus_tag LOCUS_23440 3527 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence131 <1 906 gene locus_tag LOCUS_23450 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390213.1:chemotaxis sensory transducer 1935 868 gene locus_tag LOCUS_23460 gene ctaA 1935 868 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_23460 2055 2429 gene locus_tag LOCUS_23470 2055 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2481 2933 gene locus_tag LOCUS_23480 2481 2933 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083756.1 protein_id gnl|my_center|LOCUS_23480 2909 3556 gene locus_tag LOCUS_23490 2909 3556 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence132 368 1558 gene locus_tag LOCUS_23500 gene argD 368 1558 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB6 protein_id gnl|my_center|LOCUS_23500 1583 2509 gene locus_tag LOCUS_23510 gene argF 1583 2509 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP74 protein_id gnl|my_center|LOCUS_23510 2488 3447 gene locus_tag LOCUS_23520 2488 3447 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS8 protein_id gnl|my_center|LOCUS_23520 >Feature sequence133 1303 164 gene locus_tag LOCUS_23530 1303 164 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337509.1 protein_id gnl|my_center|LOCUS_23530 1395 1904 gene locus_tag LOCUS_23540 1395 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2552 2124 gene locus_tag LOCUS_23550 2552 2124 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_23550 2797 2552 gene locus_tag LOCUS_23560 2797 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence134 608 2374 gene locus_tag LOCUS_23570 608 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2832 2467 gene locus_tag LOCUS_23580 2832 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3266 2937 gene locus_tag LOCUS_23590 3266 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence135 184 531 gene locus_tag LOCUS_23600 184 531 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368395.1 protein_id gnl|my_center|LOCUS_23600 552 941 gene locus_tag LOCUS_23610 552 941 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368396.1 protein_id gnl|my_center|LOCUS_23610 1337 951 gene locus_tag LOCUS_23620 1337 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23620 1720 1355 gene locus_tag LOCUS_23630 1720 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23630 1888 2274 gene locus_tag LOCUS_23640 gene TRm10-1a 1888 2274 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975501.1 protein_id gnl|my_center|LOCUS_23640 2514 2837 gene locus_tag LOCUS_23650 2514 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3279 2896 gene locus_tag LOCUS_23660 3279 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence136 456 1451 gene locus_tag LOCUS_23670 456 1451 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061907.1 protein_id gnl|my_center|LOCUS_23670 1432 2994 gene locus_tag LOCUS_23680 gene pgi 1432 2994 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUF4 protein_id gnl|my_center|LOCUS_23680 >Feature sequence137 1364 1705 gene locus_tag LOCUS_23690 1364 1705 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918415.1 protein_id gnl|my_center|LOCUS_23690 1696 2745 gene locus_tag LOCUS_23700 gene pyrD 1696 2745 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_23700 >Feature sequence138 <1 723 gene locus_tag LOCUS_23710 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942568.1:LPS export ABC transporter permease LptG 800 1591 gene locus_tag LOCUS_23720 800 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1588 2730 gene locus_tag LOCUS_23730 1588 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence139 889 293 gene locus_tag LOCUS_23740 889 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_23740 2337 1000 gene locus_tag LOCUS_23750 2337 1000 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence140 366 911 gene locus_tag LOCUS_23760 366 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1407 940 gene locus_tag LOCUS_23770 1407 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140954.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence141 1215 55 gene locus_tag LOCUS_23780 1215 55 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640585.1 protein_id gnl|my_center|LOCUS_23780