COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..309966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..1905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 tRNA complement(2012..2088) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(2200..3231) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLB9 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene tdh CDS complement(3228..4442) product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV5 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene kbl CDS complement(4640..5209) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5335..5865 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5998..7062 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7377..9815 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene fyuA CDS 9977..12280 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(12404..13138) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(13244..14620) product multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(14813..14941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(15157..15798) product UPF0056 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRY9 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(15804..16688) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene folD CDS complement(16685..17008) product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC38 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(17018..17308) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(17472..19376) product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYB8 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene htpG CDS complement(19475..20164) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene ligE CDS 20568..20936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 21264..21812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(21882..23516) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene nadB CDS complement(23599..24687) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 24919..25137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 25275..28052 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921293.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(28504..28665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 28762..29232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 29232..29717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(29865..32573) product TonB system transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(32829..33218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(33325..33762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(34510..37305) product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15345 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene flaEY CDS complement(37604..38350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 38545..39414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(39433..40173) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 40309..42000 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 41997..42173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(42244..44928) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 45349..47430 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 47623..47853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 48020..48655 product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIT8 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene ccmA CDS 48652..49320 product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(49379..49663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 49917..50648 product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 50662..50868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 50865..51380 product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45401 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene ccmE CDS 51377..53428 product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 53418..53948 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene ccmG CDS 53945..54475 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 54472..55629 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 55851..56135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 56179..56745 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(56870..57430) product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L49 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(57465..58403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(58413..59720) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(59720..60604) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene dapF CDS complement(60695..62119) product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(62234..62917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 63372..64739 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG5 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene ffh CDS 64848..65264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 65270..65878 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW7 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene rimM CDS 65882..66634 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV57 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene trmD CDS 66876..67271 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X35 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene rplS CDS 67450..68847 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene leuC CDS 68863..69480 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDX5 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene leuD CDS 69560..70675 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene leuB CDS 70720..71739 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X21 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene asd CDS 71919..73748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 73870..75675 product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 75997..76971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(77263..78045) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIY6 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(78063..79850) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene sdhA CDS complement(79876..80250) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(80264..80650) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene sdhC CDS complement(80857..81798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(81806..82201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(82361..83458) product beta-methylmalyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC34 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene mch CDS complement(83461..84354) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 84711..86081 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 86158..86622 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(86873..87094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(87319..87531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 87877..89013 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 89466..90428 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene mdh CDS 90545..91714 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene sucC CDS 91714..92589 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 92637..95579 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene sucA CDS 95768..97378 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene sucB CDS 97400..98806 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK0 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene lpdA2 CDS complement(98893..100500) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(100629..101588) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene xerC CDS complement(101567..102289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(102333..102986) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM7 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene tal CDS 103213..105411 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL6 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene priA CDS 105659..106243 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM4 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene atpH CDS 106240..107772 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC74 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene atpA CDS 107813..108691 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK7 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene atpG CDS 108769..110160 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene atpD CDS 110187..110597 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL34 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene atpC CDS 111126..111461 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 111463..111936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 112027..112476 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(112538..114007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(114206..114904) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(114916..115362) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 115471..115839 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(115836..116690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(116744..117568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(117610..118155) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene rppH CDS 118296..119003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(119047..120330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(120453..121787) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(121788..123125) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(123112..124722) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene gpmI CDS complement(124927..125397) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X82 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene rlmH CDS complement(125407..125850) product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLZ3 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene rsfS CDS complement(125874..126371) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS2 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene nadD CDS complement(126508..127776) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene proA CDS complement(127896..129026) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS0 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene proB CDS complement(129023..129256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(129150..130175) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV6 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene obg CDS 130068..130265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(130423..130680) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV03 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene rpmA CDS complement(130684..131205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(131439..132209) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 132668..133114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(133257..135344) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(135497..136084) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene tlpA CDS 136120..137547 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene argH CDS 137704..137916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 137801..138460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(138642..139028) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 139214..139411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 139428..140699 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MG9 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene lysA CDS 140744..142807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(142875..143249) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(143378..144301) product MJ0042 family finger-like domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 144474..145214 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 145217..146098 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 146118..146696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 146847..147560 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 147672..148751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(148910..149851) product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970109.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene tyrC CDS complement(149853..150944) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9W3 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene hisC CDS 151183..152346 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene metX CDS 152343..152975 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(153059..153862) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(153852..155372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 155675..156748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 157032..159314 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 159385..160359 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(160296..161099) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(161315..162037) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(162197..162376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(162300..163475) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709751.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(163745..164821) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 note possible pseudo, frameshifted CDS complement(165200..165610) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(165928..166125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 166393..167016 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 167074..169134 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene pepO CDS complement(169330..169836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(169939..170532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 170690..170854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(171200..173605) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 173682..173864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(174103..175908) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCA2 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene lepA CDS complement(175981..176955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(176970..177983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(178122..180023) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene cobT CDS complement(180093..181100) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(181097..181702) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 181842..182105 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(182498..183373) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(183373..184275) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 184487..186094 product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene mccB CDS 186098..186904 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 186911..188896 product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene accC CDS 188893..189789 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 189913..191079 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 191293..191637 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(191677..192765) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(192964..194925) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(195006..195953) product Galanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(196012..196572) product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(196616..197314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(197426..197836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(197838..198284) product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(198274..198960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(199458..199781) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(199781..200185) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(200218..201135) product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(201242..201670) product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(201754..203403) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(203430..204134) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 204534..205031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 205184..206779 product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(206857..207366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(207424..207816) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 208102..209397 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene ahcY CDS 209641..212109 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 212214..212732 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 212725..217590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 217587..221009 product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 221118..221438 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L8 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(221641..222948) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene folC CDS complement(222969..223850) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7R7 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene accD CDS complement(223918..224757) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500R5 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene trpA CDS complement(224770..225993) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS4 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene trpB CDS complement(226021..226671) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E3 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene trpF CDS complement(226675..227397) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene pyrF CDS complement(227459..227767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(228009..228290) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCQ1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene ihfB CDS complement(228314..229222) product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene sppA tRNA 228885..228973 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 229559..231628 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 tRNA complement(231733..231808) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(231933..232271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 232623..233945 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene aroA CDS 233942..234595 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene cmk CDS 234766..236478 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW5 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(236885..238195) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH6 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene hslU CDS complement(238192..238746) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA2 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene hslV CDS 238971..239582 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene hisB CDS 239603..240013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 240195..240782 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene hisH CDS 240839..241384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 241385..242125 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene hisA CDS 242125..242883 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene hisF CDS 242904..243245 product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA8 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene hisE CDS 243287..243646 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 243740..244198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(244505..244915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(244930..245940) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 246219..246974 product cysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 246971..247525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(247455..248099) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene nth CDS 248289..248783 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 248899..249291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 249487..249720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(249853..250068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(250143..250676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(250873..251688) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene dapB CDS 251875..252399 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(252378..252641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(252681..254954) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(254951..255475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(255531..257099) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene fixG CDS complement(257273..258136) product Cbb3-type cytochrome c oxidase subunit FixP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03075 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene fixP CDS complement(258139..258294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(258330..259055) product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene fixO CDS complement(259073..260746) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03073 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene fixN CDS 261589..261762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 262776..263447 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 263444..264817 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene ttpC CDS 264820..265347 product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene exbB CDS 265358..265762 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 265759..266364 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene tonB2 CDS 266379..267779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(268025..268510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 268709..269950 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene tipF CDS complement(270225..271262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(271262..271648) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 271916..272347 product (R)-specific enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ36 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene phaJ CDS 272429..273427 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 273580..276441 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene ileS CDS 276441..276950 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DF7 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene lspA CDS 277021..277236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 277337..278752 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 278749..280176 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(280199..280396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 280613..282553 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ52 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene mutL CDS complement(282578..282784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(282883..283446) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(283443..284465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 284678..285133 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DE3 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene tadA CDS 285182..285754 product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 285796..287154 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(287175..287405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(287421..288560) product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene nptA CDS complement(288723..290003) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHE2 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene purD CDS 290086..291693 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCQ9 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene xseA CDS 291720..292520 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(292533..293534) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 293687..294295 product putative transcription regulator, AraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 294545..295255 product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(295463..296824) product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 297338..297661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(297782..299284) product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(299358..299891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 note possible pseudo, frameshifted CDS complement(299773..301788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 note possible pseudo, frameshifted CDS complement(302009..302554) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WY0 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene ppa CDS 302754..304739 product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene hppA1 CDS 304900..306273 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 306242..307480 product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(307562..307990) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 308194..309057 product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 309156..309428 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 309435..309731 product RelE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 sequence02 source 1..240738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1083 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705166.1:glutaryl-CoA dehydrogenase locus_tag LOCUS_02950 CDS complement(1187..1375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(1386..2531) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(2628..3488) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 3863..4594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(5248..5622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(5768..6436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(6436..7392) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 7777..8460 product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(8448..9569) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 9696..11339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(11583..11777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(11826..13436) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(13617..14570) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(14737..15573) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 15675..16004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(15986..16918) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(16923..17558) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(17563..17721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 17855..18412 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(18543..18950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 note possible pseudo, frameshifted CDS complement(18947..19309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 note possible pseudo, frameshifted CDS 19665..19952 product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene groS5 CDS 19992..21632 product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY28 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene groL1 CDS 21781..22551 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(22683..24185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 24531..26195 product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene cysI CDS 26176..26655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 26909..28207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 28365..28880 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 28958..29593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 29606..30256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 30256..31467 product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(31609..32481) product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAT8 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene hemF CDS complement(32542..32994) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE3 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene trmL CDS 33077..34078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 34122..35231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(35235..36314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 36455..37546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(37789..38733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 39033..39563 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 39573..40841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 note possible pseudo, frameshifted CDS 40846..41685 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 41779..42699 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene mtnP CDS 42696..43226 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB5 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene apt CDS 43229..43981 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(44046..44522) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 44708..45940 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(45999..47102) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ychF CDS complement(47106..47759) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C8 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene pth CDS complement(47786..48430) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene rplY CDS complement(48620..49552) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene prs CDS complement(49814..50572) product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ3 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(50575..51690) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(51739..52557) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene lgt CDS 52694..52984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 52981..53487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 53549..54394 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWW7 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene proC CDS complement(54364..55200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(55799..56302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(56295..56444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 56443..57324 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(57433..57888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(58001..59695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(60037..60954) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(61161..61313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(61472..61930) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene moaE CDS complement(61934..62185) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKK2 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene moaD CDS complement(62195..62746) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(62854..64698) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene uvrC CDS complement(65191..65619) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(65749..66702) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene yrbG CDS complement(66812..67984) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(68009..69892) product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(70081..71013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 71217..72170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(72182..72574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 72567..72788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 72853..73224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 73338..73895 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 73882..74289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 74628..75209 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED83 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene sodB CDS complement(75332..75976) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(75979..76695) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 77056..77586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 77656..78852 product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X03 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rlmN CDS 79062..80537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 80538..81710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 81871..82509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(82521..83624) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(83621..84952) product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 85098..85295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 85285..86295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(86298..88052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(88069..88947) product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(88961..89833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(89859..90110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(90221..91285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(91329..92456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 92792..94384 product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 94433..95665 product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 95675..97534 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 97812..98438 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 98533..100116 product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 100150..101094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 101123..102556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 102565..103620 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 103626..104534 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 104525..105559 product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 105774..107252 product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 107334..108125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(108196..108459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(108760..109449) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(109458..110183) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(110230..111039) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene pstB CDS complement(111045..112382) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(112375..113613) product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(113859..114896) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(115087..116412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 116783..117196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 117296..117610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 117700..118650 product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 118657..119739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(119720..120433) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEY9 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene gph CDS 120590..121942 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene glmU CDS 121964..123790 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene glmS CDS 123872..125695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(125739..127229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 127378..128730 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene gor CDS 128900..130279 product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 130301..131983 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971777.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene nadE CDS 132223..133560 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene gltX CDS 133557..134912 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene cysS CDS 134919..135641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 135662..136483 product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene trmJ CDS 136755..137369 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J446 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rpsD CDS 137550..139658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 139854..140456 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(140573..141418) product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF3 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene flgH CDS complement(141441..142433) product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene flgA CDS complement(142448..143233) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06172 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene flgG CDS complement(143261..144007) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF6 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 144429..144953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 144962..146047 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF8 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 146052..146462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 146546..147247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 147348..147989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 148095..148853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 148846..149571 product OmpA/MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 149655..152588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(152608..153390) product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG8 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene fliP CDS complement(153390..153740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(153741..154115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 154445..154861 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I25 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene flgB CDS 154893..155300 product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I26 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene flgC CDS 155326..155667 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52945 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene fliE CDS 155713..155979 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45974 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene fliQ CDS 155972..156730 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene fliR CDS 156752..157861 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene flhB CDS 158058..160574 product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 160854..161924 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33156 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene recA CDS 162343..164997 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI0 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene alaS CDS 165053..166252 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 note possible pseudo, internal stop codon CDS complement(166312..167526) product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0R6 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(167674..168258) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 168635..169651 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(169714..170193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 170405..172195 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 172278..172973 product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene psd CDS 172970..173794 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(173849..177085) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(177082..178173) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 178401..179054 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919941.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(179094..179642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(179852..181261) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(181328..181666) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene glnB tRNA 182019..182095 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 182282..184141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 184428..185984 product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 transl_table 11 codon_start 1 locus_tag LOCUS_04720 tRNA 186082..186166 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 186289..187887 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG0 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene tig CDS 188051..188680 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene clpP CDS 189176..190444 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFY5 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene clpX CDS 190707..193061 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene lon CDS 193265..193603 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 tRNA 193731..193806 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 193915..193991 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 194490..194855 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene nuoA CDS 194846..195427 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W4 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene nuoB CDS 195443..196087 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6X2 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene nuoC CDS 196087..197265 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJA9 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene nuoD CDS 197262..197897 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 197897..199174 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 199184..201244 product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 201237..202289 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene nuoH CDS 202305..202793 product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA65 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene nuoI CDS 202803..203414 product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 203430..203738 product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene nuoK1 CDS 203744..205669 product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 205673..207181 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 207213..208670 product NADH-quinone oxidoreductase subunit N 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QN9 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene nuoN1 CDS 208716..209471 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 209483..210277 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene coaX CDS 210280..211959 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 211975..212400 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 212417..212665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 213050..213493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 213576..214886 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWT1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene proS CDS 215089..216345 product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 216358..217110 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA77 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene lolD CDS 217176..217580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 217610..221125 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 221269..222087 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 222646..223455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 224008..224892 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rpsB CDS 225000..225926 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM2 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene tsf CDS 226119..226844 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene pyrH CDS 226847..227407 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K5 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene frr CDS 227431..228180 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 228252..228989 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 229003..230184 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene dxr CDS 230194..231303 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 231350..233674 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene bamA CDS 233674..234249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 234397..234861 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene fabZ CDS 234896..235288 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene gloA CDS complement(235428..236744) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33915 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene gltA CDS complement(236903..238321) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR5 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene gltX CDS 238480..240702 product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 sequence03 source 1..202486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(132..206) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 393..992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(1040..2629) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene prfC CDS complement(2850..3194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 3687..4322 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(4315..4863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(4909..5193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(5506..6732) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 6945..7751 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(8055..9035) product ArgK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(9055..9483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(9506..12172) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(12247..14301) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S69 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene glyS CDS complement(14294..15232) product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene glyQ CDS complement(15352..15639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(15725..16606) product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene sohB CDS complement(16641..17411) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(17483..17683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 17938..18981 product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(18994..19959) product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene dusC CDS complement(19971..20654) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene rluA CDS complement(20668..22083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(22244..23437) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 23590..24477 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 24591..25895 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene dinB CDS 26046..27077 product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene nadA CDS 27085..27948 product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(27930..29078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(29086..30189) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 30167..30334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 30402..31289 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(31431..33014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(33055..33183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 33274..33975 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(34127..34612) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(34627..34776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 34976..35830 product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(35858..37210) product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene trmFO CDS complement(37737..38915) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 39037..39513 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene def CDS 39533..40465 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH6 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene fmt CDS 40462..41220 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ8 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene truA CDS complement(41295..41906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(41939..43096) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene dapE CDS complement(43100..43957) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene dapD CDS complement(44060..44800) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 44983..46806 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 46803..48056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(48181..49098) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene argB CDS complement(49169..49819) product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene engB CDS complement(49880..51628) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene yidC CDS complement(51721..51993) product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F4W4 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(51990..52469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 52984..53745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 note possible pseudo, frameshifted CDS 53742..55196 product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene merA1 CDS 55202..56611 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(56690..57331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 tRNA 57548..57624 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(57762..58991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(59040..59492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(59495..60178) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene narV CDS complement(60188..60883) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene narJ CDS complement(60883..62436) product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene narH CDS complement(62448..66206) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene narG CDS complement(66231..67874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(67915..69327) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 69493..71160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 71342..72319 product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene moaA CDS 72392..73660 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene moeA CDS complement(73769..74587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(74612..76102) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(76111..77301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(77346..78863) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(78892..79752) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(79918..80685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(80682..81986) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(82116..84425) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 84370..84519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 84808..85422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(85549..87816) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 88101..88667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 88978..91242 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(91288..92298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 92495..93259 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 93515..94726 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(94732..95502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(95499..97358) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene copA CDS complement(97466..97918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(98171..99754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 100005..101138 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(101150..102394) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(102453..103655) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(103758..106526) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(106596..107954) product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(107964..110069) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(110075..111463) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 112155..112916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(113039..115066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(115082..117907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(118034..118837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 119163..119864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(119901..120500) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(120490..121338) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 121545..122975 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 123170..125536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 125581..127359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 127435..129066 product bacteriophage N4 adsorption protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene nfrB CDS complement(129253..129393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 129356..130507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(130575..133232) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene pepN CDS complement(133288..134421) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(134551..135975) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(136075..136434) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 136620..137480 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(137537..138826) product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene capL CDS complement(138992..141361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(141502..144348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(144510..145415) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS7 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene ispE CDS complement(145396..147120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(147130..148800) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 149092..150015 product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 150012..151997 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 151984..152505 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(152521..153126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(153123..153785) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 153898..155013 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 155103..155753 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H3 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene rnhB CDS 155809..156987 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 157287..159074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 159145..160479 product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene amaA CDS 160490..160918 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 160921..161844 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 162045..162608 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1B4 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene efp CDS 162658..163476 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 163537..163989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 164145..165407 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 165407..166492 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(166564..167148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(167342..169150) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 169341..169565 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rpmE CDS complement(169651..170133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 170444..170908 product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(171048..171242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 171352..172353 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(172577..174733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(175003..176667) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 177187..177816 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(177895..179328) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7A4 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 179666..180487 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 180567..180872 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 180981..181235 product UPF0335 protein R02793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M59 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(181300..181530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(181655..183175) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene tacA CDS 183382..185109 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 185660..186841 product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene pntAA CDS 186841..187206 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 187222..188640 product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene pntB CDS complement(188858..189331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(189480..189764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(189777..190031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 190285..191181 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 191270..192268 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 192319..193179 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 193281..194045 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(194124..194423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(194420..195175) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN56 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene cobB CDS 195328..195819 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ptpA CDS 196006..196749 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 tRNA 197054..197130 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 197882..201001 product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX87 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene cas9 CDS 201003..201911 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene cas1 CDS 201916..202245 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene cas2 repeat_region 202318..>202486 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcatagcatttcagaaattgaggtccagctgcaac sequence04 source 1..162092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(1109..3406) product malic protein NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 3685..6540 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene mutS CDS 6533..9340 product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene glnD CDS 9361..10914 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 11064..12074 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene trpS CDS 12159..12782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 12870..13835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 13956..14447 product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 14541..15095 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(15111..16199) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 16461..17057 product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCJ9 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 17082..17801 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 17806..18273 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 18421..18831 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 18924..19748 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 19868..21259 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene miaB CDS 21276..22334 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 22337..22894 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID9 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene ybeY CDS 22928..23893 product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 23883..25520 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene lnt CDS 25629..26051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 26258..27328 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene pyrD CDS complement(27474..27953) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene bfrB CDS complement(28088..28336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 28570..28917 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCJ8 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene yfgD CDS complement(29043..30464) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene dinF CDS 30833..32707 product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene korA CDS 32704..33720 product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 33972..34571 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMV6 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 34568..34915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 34912..35415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(35562..36068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 36176..37105 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(37048..39288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(39555..41732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 41846..43048 product aspartate aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02635 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene aatA CDS complement(43076..43771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(43916..44416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 44762..45229 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 45317..45958 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(46041..46226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(46440..47324) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(47477..48082) product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene tsaA CDS 48482..50134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 50319..51272 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 51426..52196 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 52348..52707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(52737..53555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(54002..54850) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(54863..55861) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 tRNA 56053..56127 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 56443..59169 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene acoK CDS 59356..61524 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 61648..63735 product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 63739..65412 product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 65419..67092 product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 67089..68408 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 68415..70112 product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene huyB CDS 70109..71491 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 71556..71936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 72086..73057 product FeaR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 73210..75483 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene fyuA CDS 75576..77186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 77230..77547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 77594..78646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(78809..79780) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 79895..80848 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 80899..82626 product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 82619..83227 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 83224..84456 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 84462..85664 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene fadA CDS complement(85711..87045) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(87156..87683) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 88849..91506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(91662..92345) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040661.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 92782..94248 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 94395..95888 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809852.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 96083..96823 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 97036..97404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 97466..97942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 98137..98688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(98767..99192) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 99452..100054 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 100120..101544 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 101659..104550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(104779..106233) product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene davD CDS complement(106330..107931) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(108091..109761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 110191..111096 product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rimK CDS 111093..112139 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(112216..113241) product methyltransferase/methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(113318..113638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 113607..115391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037549.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(115373..116350) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(116372..117418) product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(117479..118738) product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 118995..119903 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 119969..120970 product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 121061..122503 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 122549..123217 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene hypR CDS 123295..123507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 123719..123976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 123951..124199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(124699..125187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(125475..125912) product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene nsrR CDS complement(126102..129242) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(129235..130680) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(130673..131926) product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(132022..132276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 132827..133246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 133342..133668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 133665..134111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 134116..134664 product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 134828..135181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 135387..135611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 135807..137075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 137096..137389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 137386..137745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 137921..138487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 138559..139092 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDQ5 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene petA CDS complement(139175..140524) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(140644..143076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(143263..145971) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(146110..146574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 147169..149136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(149106..149297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 149484..150362 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 150487..152856 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 152929..154527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 154524..156398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 156551..156736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 156733..157974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 158089..159507 product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 159663..159914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 159911..160288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 160595..161878 product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene gabT sequence05 source 1..138654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 933..1730 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(1782..2408) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 2554..2952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(2932..3360) product Mov34/MPN/PAD-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(3368..3763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 3762..4817 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MA7 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rluD CDS 4952..5854 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene rpoH CDS 6119..7921 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 8116..9654 product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 9780..11330 product feruloyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226485.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 11384..13675 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene fyuA CDS 13736..14176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 14186..15865 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 15855..16619 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 16632..17834 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene caiA CDS complement(17888..18577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 18746..21061 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(21200..21547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 21431..22723 product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 note possible pseudo, frameshifted CDS 22716..23651 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 23629..24156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 24149..24574 product MaoC-like dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(24678..25493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(25600..26490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 27176..27385 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene cspA CDS 27635..28780 product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 tRNA complement(28825..28912) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 29260..31455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 31610..31804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(31843..33264) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(33407..33736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 33999..34745 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI0 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene purC CDS 34791..35030 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene purS CDS 35126..35815 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L4 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene purQ CDS 35826..38036 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene purL CDS 38068..38298 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 38346..38678 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI6 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 39066..39785 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 39953..40576 product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFK3 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 40579..40788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 41023..41631 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 41628..42470 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(42450..43283) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(43280..44686) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene hflx CDS complement(44698..44946) product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ2 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene hfq CDS complement(45095..46573) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPF4 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(46576..47952) product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene trkA CDS complement(48011..49381) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(49371..51656) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(51715..53166) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(53188..54288) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene ntrB CDS complement(54288..55250) product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene dus CDS 55471..56634 product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene ispDF CDS 56631..57119 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 57112..57603 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 57769..58395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(58490..58927) product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(58944..59954) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFG1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene lipA CDS complement(59987..61408) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(61421..62710) product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT66 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(62729..64174) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene pdhAb CDS complement(64200..65243) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene pdhA CDS complement(65473..65784) product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(65919..67190) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene eno CDS complement(67228..68862) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X3 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene pyrG CDS complement(69037..69357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(69462..70214) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene tpiA CDS 70637..72550 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene ppiD CDS 72618..74147 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(74181..75341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 75524..77494 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD54 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene parE CDS 77614..78921 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 79099..80178 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(80438..80797) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(80852..82315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 82446..82640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(82805..84484) product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene aspS CDS 84713..85876 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene rnd CDS complement(85901..87370) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(87378..89537) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene ppk CDS complement(89613..90293) product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(90290..91414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 91740..92858 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC8 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene purM CDS 92818..93546 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene purN CDS complement(93707..94129) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7K1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ndk CDS 94266..96149 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(96153..96602) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(96640..98130) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene pepA CDS 98319..100517 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene lptD CDS 100594..101898 product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA7 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 101948..102940 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD4 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene pdxA CDS 102937..103797 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MU0 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene rsmA CDS complement(103874..104506) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene gmk CDS complement(104513..105385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 105482..106246 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(106364..106666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(106807..107793) product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(107800..109062) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene fabF CDS complement(109197..109430) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene acpP CDS complement(109697..110434) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene fabG CDS complement(110468..111418) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 111760..112107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 112128..112391 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVN5 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene rpsR CDS 112403..113047 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L9 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene rplI CDS 113151..114680 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 114680..115816 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene alr CDS 115852..116628 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 116625..117416 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 117419..118792 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene radA CDS 118798..119445 product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene cvpA CDS 119516..121066 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene purF CDS 121068..121805 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(121951..123369) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UK6 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene der CDS complement(123477..124823) product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(124846..125490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(125594..126418) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NN1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene panB CDS complement(126531..128078) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene guaA CDS complement(128151..129434) product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(129443..130903) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RT5 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene guaB CDS complement(131117..131848) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rlmE CDS complement(131845..133032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 tRNA 133232..133305 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 133427..134041 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 134038..135054 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene trpD CDS 135079..135876 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene trpC CDS 135876..136352 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene moaC CDS 136362..137570 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene moeA CDS 137690..138364 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A724 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene lexA sequence06 source 1..130477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..1797) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1965..2120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 3110..3751 product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 3786..4433 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 4501..5604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 5871..8090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 8390..8587 product heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 8666..10936 product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 10949..11350 product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene hmrR2 CDS complement(11374..12621) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 13141..14316 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 14609..15001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 15245..15892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 16052..18613 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 18610..18987 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 19145..19345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 19722..20075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(20099..20512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(21062..21280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 21596..22219 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 22232..24028 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(24136..25182) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(25375..25911) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM5 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene ahpD CDS complement(25990..26529) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 26652..27533 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene oxyR CDS complement(27528..28070) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN39 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene ogt CDS complement(28067..29581) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 29911..31041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 31045..32754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(32820..33317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(33327..34100) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene nadK CDS complement(34116..35108) product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene moaA CDS complement(35207..36331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene spmY CDS complement(36543..36953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(37106..40606) product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene mfd CDS complement(40603..40920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919711.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 41057..43150 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(43142..43954) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(44051..45223) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001774043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene yghO CDS complement(45300..46112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(46210..47337) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(47339..48514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 48740..49702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(49731..50963) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(50960..51187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(51271..52218) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(52349..54091) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 54536..55186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 55183..56400 product 3-phenylpropionic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene hcaT CDS 56497..57030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 57219..58100 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene dapA CDS 58101..58574 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8R6 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene smpB CDS complement(58635..58934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(58919..59161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 59106..59276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(59351..60277) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(60373..61074) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(61071..61616) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 61821..62366 product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 62563..62946 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT88 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene rpoZ CDS 63144..65291 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 65351..65941 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H621 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene pyrE CDS 66120..66746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 66740..67522 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene pdxJ CDS 67522..67938 product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S2 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene acpS CDS 68049..68873 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 68878..69579 product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene rnc CDS 69576..70481 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene era CDS complement(70584..71792) product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38021 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene rocD CDS complement(71795..72760) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene argI CDS 72989..73474 product Lrp-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 73694..73981 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH3 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene gatC CDS 73991..75484 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene gatA CDS 75484..76968 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK5 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene gatB CDS 77167..77490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 77739..78008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 tRNA 78180..78269 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 78501..78743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 78876..79748 product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 79745..80554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 80663..80938 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 80983..81861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946413.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 81858..82625 product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 82656..83165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(83230..83697) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 83996..85573 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU7 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene nhaB CDS 85797..86402 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 86461..87105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 tRNA 87179..87255 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 87513..87737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 tRNA 87789..87865 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 88024..88479 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 88488..90704 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(90753..91169) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene hisI CDS 91268..91732 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene np20 CDS 91747..92544 product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH84 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene znuC CDS 92537..93328 product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene znuB CDS complement(93380..94549) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene metC CDS complement(94565..95413) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(95478..96476) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene cysK CDS complement(96602..96943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 97136..97600 product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N45 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene queF CDS complement(97686..98360) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YK9 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene queE CDS complement(98357..99064) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene queC CDS 99272..99907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 tRNA complement(99965..100040) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 100584..101030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 tRNA complement(101174..101247) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 101586..102239 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 102400..103764 product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 104153..104698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 104900..107557 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene valS CDS 107595..107807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 107826..109328 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(109335..110630) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(110747..111298) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(111319..113556) product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene parC CDS complement(113633..115306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(115387..116115) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ0 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene recO CDS 116263..116712 product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(116709..117038) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708963.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(117062..118660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(118660..119196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(119223..120329) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(120525..121202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(121420..123288) product dATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene sac1 CDS complement(123613..124509) product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(124723..126006) product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D0 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 126421..127422 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 127542..128363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 128809..129450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 129447..130418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 sequence07 source 1..93087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(657..4580) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(4602..4934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(4921..5502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 5722..7911 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(8286..9542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(9630..11480) product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene phbC CDS complement(11615..12235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(12232..13647) product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(13647..14324) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(14473..14892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 15104..15433 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(15452..16294) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194590.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene hpcB CDS complement(16331..17848) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(17851..18246) product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene hpcD CDS 18398..19303 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJQ1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene dapA CDS 19336..20199 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(20277..20699) product homoprotocatechuate degradation operon regulator, HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene hpaR CDS complement(20827..23994) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene mexF CDS complement(23991..25271) product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(25517..27406) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 27741..28166 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(28205..29632) product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene putP CDS complement(29629..30579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(30569..32002) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(32065..32982) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(32996..33394) product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene ectC CDS complement(33495..34808) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene ectB CDS complement(34886..35368) product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene ectA CDS 35686..36177 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 36583..38445 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 38445..39323 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 39587..40312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 40309..41367 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene cobC CDS 41351..41971 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene cobO CDS complement(41979..42734) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(42731..43537) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P97 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene cobS CDS complement(43530..44567) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3P6 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene cobT CDS complement(44564..45127) product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene cobP CDS complement(45105..45374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(45610..47082) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(47296..47478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(47487..48356) product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(48377..49441) product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 49723..50865 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NU2 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene mrp CDS 50862..51296 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(51409..52635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(52884..53390) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF3 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene folA CDS complement(53390..54184) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene thyA CDS 54903..55448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 55465..56889 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9S6 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene fumC CDS 57016..57846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 58787..60397 product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 60423..60647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(60670..64278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 64576..65100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 65114..66949 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(67033..67959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 68347..70626 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXZ3 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene pcrA CDS complement(70840..71595) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(71635..72270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 72522..73421 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene prmA CDS complement(73563..73856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(74082..76172) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEL9 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene ligA CDS complement(76179..77849) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM7 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene recN CDS complement(77867..78667) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene bamD CDS complement(79070..80341) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(80344..80922) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(81163..81681) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 81924..83312 product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene atoE CDS 83452..84468 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene znuA CDS complement(84540..85124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(85243..85716) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 85859..89338 product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769363.2 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 89399..90484 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHV5 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene hisC CDS 90644..91207 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(91288..91755) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene ybaO CDS 91893..92945 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene hppD sequence08 source 1..87842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..983) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1320..4550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(4733..5188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 5416..6459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 6930..9056 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 9176..10420 product peptidase M38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 10439..11110 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6F6 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 11160..11654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(11691..12956) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002075981.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(13104..14108) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene eutR CDS 14327..14989 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 14994..15629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(15683..18517) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 18785..19507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(19591..20427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(20430..21398) product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(21431..22030) product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMU2 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 22274..22981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 23052..23390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(23466..24371) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 24423..26084 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VB4 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene lysS CDS 26450..27094 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(27211..28821) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 29032..30198 product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene metK2 CDS 30244..31008 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene trmB CDS 31274..31768 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene rimP CDS 31901..33514 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene nusA CDS 33551..34243 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 34263..36950 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS0 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene infB CDS 37047..37472 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene rbfA CDS 37476..38396 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene truB CDS 38413..38682 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene rpsO CDS 38903..40984 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKQ7 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene pnp CDS 41147..42550 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 42905..43333 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(43448..44020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 44329..45294 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(45403..45861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(46158..46922) product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(46919..47218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(47278..48237) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(48363..48818) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(48849..49304) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T772 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene dut CDS complement(49313..50587) product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(50763..52310) product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(52313..53152) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene ubiE CDS 53246..54088 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E4 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene mutM CDS 54121..54627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 54856..55632 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene paaF CDS 55929..56198 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E3 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene rpsT CDS complement(56090..56314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 56863..57282 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 57292..58770 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene dnaA CDS 59302..60423 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 60725..61957 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ65 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene recF CDS 62020..64467 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY57 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene gyrB CDS complement(64615..67785) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(67782..68972) product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(68976..70460) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(70726..71592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(71819..72322) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(72878..73216) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(73405..73857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 74241..74462 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 74593..75372 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(75443..77833) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 78109..79431 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 79442..81517 product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RF6 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 81883..85398 product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(85504..86118) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(86343..87143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 sequence09 source 1..84361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..1809) product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A354 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene gcvPB CDS complement(1806..3152) product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A353 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene gcvPA CDS complement(3194..3568) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD42 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene gcvH CDS complement(3608..4741) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I01 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(5329..5568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 5668..6618 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene ispH CDS 6621..7586 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK2 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene thrB CDS 7586..8020 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rnhA CDS 8068..8718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene arp CDS complement(8855..9277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(9328..9963) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEC9 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 10168..11706 product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 11703..13484 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(13634..14008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(14504..15109) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK7 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 15275..16150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 16190..17629 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 17626..18108 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 18300..18779 product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 18859..19275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 19367..20356 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(20569..20997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(21105..21821) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 21996..22334 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(22417..22869) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene ElaA CDS 23131..24057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(24074..24718) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene thiE CDS complement(24833..25753) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene fbaB CDS complement(25838..27049) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M79 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene pgk CDS complement(27075..28079) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene gapA CDS complement(28122..30092) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M82 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene tkt2 CDS 30416..30787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 30876..31217 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 31642..32907 product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53554 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene bioI CDS 32972..34177 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 34237..35937 product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(36115..37191) product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(37415..38209) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 38314..39870 product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 39887..40381 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 40378..40848 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene asnC CDS 40988..42151 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 42194..43024 product 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene mhpC CDS 43027..43812 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 43821..44759 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK04 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene mhpF CDS 44756..45799 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene mhpE CDS 45879..46802 product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 46806..47681 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 47692..48483 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 48480..49385 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene paaG CDS 49385..50488 product putative 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 50466..51227 product putative enoyl-CoA hydratase EchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 51227..52393 product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 52397..53425 product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 53461..54612 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene atoB CDS 54622..55503 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 55509..56699 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 56696..57883 product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 57876..58661 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene fabG CDS 58661..59140 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 59133..60335 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 60414..61286 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 61587..63731 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 63826..65139 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 65075..65833 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 65830..67524 product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71864 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene kstD CDS 67733..68404 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 68516..69145 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 69518..69979 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 69981..71843 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 72241..74391 product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene nosR CDS 74440..76401 product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ6 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene nosZ CDS 76398..77711 product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene nosD CDS 77704..78627 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene nosF CDS 78624..79445 product NosY permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene nosY CDS 79449..80018 product NosL protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene nosL CDS 80015..80974 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Z49 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene nosX CDS 81033..82463 product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(82490..83074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(83634..84047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 sequence10 source 1..77449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1582) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(2060..3316) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene rho CDS complement(3539..3982) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(4005..5009) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN84 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene hemH CDS complement(5006..6040) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene hemE CDS 6511..7410 product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 7574..8167 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B07 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 8164..9012 product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene aroE CDS 9009..9707 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I0 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene coaE CDS 9731..10426 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(10602..11216) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 11549..12166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 12170..12859 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 12856..13866 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene ybhG CDS 13854..14804 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene ybhF-N CDS 14797..15759 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ybhF-C CDS 15790..16206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 16203..16694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 16747..17880 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene ybhS CDS 17877..19010 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B8 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene ybhR CDS complement(19126..19662) product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE7 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene secB CDS complement(19870..20361) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 20715..21419 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 21412..22701 product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU14 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 23003..23338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 23335..23700 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(23734..25056) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(25117..26262) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene aroB CDS complement(26259..26864) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H331 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene aroK CDS 27242..29488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 29531..30436 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME3 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene xerD CDS 30548..31501 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene accA CDS complement(31650..32219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(32250..33533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(33560..34339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(34761..37523) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHS0 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene secA CDS 37789..39030 product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene argJ CDS 39034..39600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 39597..40037 product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene mutT CDS 40045..40551 product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(40548..40793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(40765..40986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(41117..41884) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 42187..43161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 43161..45914 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 45918..47045 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 47136..47807 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 47924..48697 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 48789..49445 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(49896..51020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 51402..52949 product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene yclF CDS complement(53004..54830) product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 55027..56007 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4T2 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene msrP CDS 56010..56708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 56653..57072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(57119..58132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(58253..58843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 58742..58993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 59428..59886 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 59883..60074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 60283..60879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(61227..63380) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(63393..64598) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(64623..66413) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(66400..66819) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 67174..68115 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 68172..68948 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 69031..69765 product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(70003..70293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(70416..71111) product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene bioD CDS complement(71108..72289) product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene bioF CDS 72449..73480 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene bioB CDS 73458..74783 product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene bioA CDS complement(74836..77115) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 sequence11 source 1..76627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..2689) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene acoK CDS 2905..3135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(3040..4056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(4230..4970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(5209..5679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(5793..6815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(7398..8705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(8698..10173) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(10532..11602) product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4U7 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene modD CDS complement(11599..12279) product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene modB CDS complement(12279..13073) product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene modA CDS 13439..13756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 13850..15430 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDH8 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene glpD CDS 15427..16923 product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene glpK1 CDS complement(16913..17812) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene serB CDS 17954..18874 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEB5 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene miaA CDS 19204..20958 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NR5 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ilvI CDS 21044..21562 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ilvH CDS 21626..22645 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene ilvC CDS 23089..23388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 23441..23827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 24063..24218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 24702..26243 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H607 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene leuA CDS 26601..27638 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 27851..28738 product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 28738..29250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 29261..31114 product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 31114..32262 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rodA CDS complement(32772..33371) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(33368..34198) product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(34170..35324) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene mnaA CDS 35544..36875 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene pyrC CDS complement(36983..37609) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(37937..40888) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene btuB CDS 41059..43416 product putative dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703651.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(43558..44727) product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(44724..47009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(47171..48097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 48353..49384 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC20 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 49457..49879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 49885..50562 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 50636..52024 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 52130..52603 product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene omp CDS complement(52787..53218) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene ygdD CDS complement(53256..53780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 54216..55337 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 55334..56050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(56445..56759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(56842..57441) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 57616..58824 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene fadA CDS 58961..60565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 60681..62114 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 62248..63606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 63624..64514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 64522..65679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 65703..67304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 67439..67759 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene tyrA CDS complement(67927..69144) product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(69362..70858) product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 71195..72550 product alkylhalidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 72547..74265 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 74258..74983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 75084..75695 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 75698..76474 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene dcaE sequence12 source 1..73274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..947) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(919..1617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1731..2756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(2743..3213) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(3309..3515) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene rpsU CDS 3717..4385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 4572..5213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(5294..6391) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EH0 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene purK CDS complement(6436..6930) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ4 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene purE CDS 7207..7947 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene dgcA CDS complement(8082..8285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 8380..9000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 9202..9372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(9657..10253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(10532..10909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 11202..11789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 11799..12035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 12472..13095 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 13100..14239 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene queG CDS complement(14236..15090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 15238..16011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 16040..16918 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(16938..17717) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 17904..19844 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene thrS CDS 19969..20490 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene infC CDS 20580..20783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 21389..22468 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 22472..25582 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(25755..26687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 27103..27300 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A5 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene rpmI CDS 27312..27674 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene rplT CDS 27784..28860 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ST0 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene pheS CDS 28878..31268 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC6 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene pheT CDS complement(31379..31942) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 32229..32678 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 32870..33091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 33119..33733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(33741..34502) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(34515..35288) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z2 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 35566..36921 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(36942..37340) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(37354..38367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(38393..39715) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 39876..40859 product 10 TMS drug/metabolite efflux pump (DME) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 41407..43353 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 43428..44798 product UPF0229 protein R01398 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QD3 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 44795..46339 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(46430..46906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 47277..47759 product protein-S-isoprenylcysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709235.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(47854..48774) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(48784..49818) product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59650 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(49877..51115) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(51440..51934) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 52027..52380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 52373..52741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(52796..54103) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MA5 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene purA CDS complement(54177..55328) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene hisZ CDS complement(55497..57062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(57059..57853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(58078..59655) product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene serA CDS complement(59756..60910) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene serC CDS 61293..61697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919353.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(61702..63024) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene bla CDS complement(63098..63616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(63628..65994) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene pepN CDS complement(66084..66896) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(66905..68200) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE4 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene glmM CDS complement(68527..69621) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(69696..71627) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene ftsH CDS complement(71775..73127) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE7 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene tilS sequence13 source 1..70586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..346) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZL9 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rpmG CDS complement(517..2766) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE7 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene rnr CDS complement(2786..5332) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene topA CDS complement(5442..6575) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(6630..7232) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ47 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene plsY CDS complement(7246..8535) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene pyrC CDS complement(8532..9524) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene pyrB CDS complement(9602..10081) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 10316..12193 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TI9 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene thiC CDS 12872..13462 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 13553..14710 product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 14939..18265 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 18516..21449 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 21764..22996 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV0 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene argG CDS 23062..23607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(23634..24818) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(25119..25562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061418.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(25828..26322) product aromatic 1,2-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(26319..27647) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086184.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(27659..28378) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(28365..28760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(28763..29944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(29941..31563) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(31712..32188) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 32329..35847 product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 35900..36967 product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene ldh CDS 37126..37971 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK2 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene kynA CDS complement(37982..38851) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 39004..39630 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385685.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 39631..40866 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP4 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene kynU CDS 41295..42224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(42309..43079) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(43084..43428) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q6 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene erpA CDS 43636..44838 product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 44835..46586 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3V3 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene argS CDS 46629..47510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 47528..48553 product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 48556..49236 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 49243..50058 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 50061..50657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 50808..51041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 51061..51420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 51417..52238 product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene tatC CDS 52231..53505 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q22 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene serS CDS 53505..54284 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene surE CDS 54284..54940 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E332 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene pcm CDS 54964..56010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 56202..57398 product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 57720..58451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(58672..59529) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 59699..60049 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 60098..61714 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene secD CDS 61731..62678 product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L14 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene secF CDS 62714..63091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 63296..63775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 63791..64015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(64135..65430) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K7 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(65567..67261) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(67388..68098) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(68131..68952) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene map CDS complement(68963..69676) product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF6 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene sfsA CDS 69740..70498 product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 sequence14 source 1..66061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(716..1267) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1388..1906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 2189..4795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(4909..6027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 6239..7768 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene dagA CDS 7806..8189 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 8367..9116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(9145..9687) product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 9860..10087 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(10123..10311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 10517..11074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(11054..11236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 11178..12158 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(12144..12875) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(13154..13804) product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(13954..16338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 16473..16742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 16751..17662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(17726..18310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(18361..20127) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 tRNA complement(20469..20544) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(20649..22460) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(22471..23445) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD76 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(23535..24827) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(24828..26042) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 26242..28038 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(28065..28619) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(28648..29781) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRM4 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene argC CDS complement(29919..31136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(31308..32708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(32882..33379) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H6 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene rpsI CDS complement(33382..33846) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFZ7 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rplM CDS 34166..35452 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 35539..35970 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(36034..36354) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(36351..37376) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene ctaA CDS 37502..37711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(37701..40007) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene maeB CDS complement(40244..41350) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN15 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 41468..41956 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(41949..42719) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(42716..43771) product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(43805..45016) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 45373..45762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 tRNA complement(45818..45894) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(45972..46418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(46505..46807) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene ihfA CDS complement(46949..47926) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene fabH CDS complement(47923..48984) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene plsX CDS complement(49149..49634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(49721..50257) product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 50435..50914 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(51006..51506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(51581..52576) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene thiL CDS complement(52669..53127) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I9 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene nusB CDS complement(53127..53567) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene ribH2 CDS complement(53589..54728) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(54746..55345) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(55347..56459) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(56555..57025) product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene nrdR CDS complement(57083..58363) product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB8 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene glyA2 CDS complement(58443..58877) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(59101..59289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(59323..60549) product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(60744..61259) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene mucS CDS 61559..62569 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene hemB CDS complement(62599..63474) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene motA CDS complement(63897..64133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(64370..64969) product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4N1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene pulO CDS complement(65327..65491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 sequence15 source 1..61488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1159) product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene uspE CDS complement(1295..2479) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(2488..3333) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(3524..5212) product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21296 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene flbA CDS 5396..5821 product putative flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5S2 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene flbT CDS 5781..6215 product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene flaF CDS 6500..7342 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene fljJ CDS 7529..7984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(8176..9006) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene fljJ CDS complement(9289..9786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(9796..10146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(10146..11288) product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE9 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene flgI CDS 11681..12103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 12276..12692 product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene dksA CDS complement(12841..13233) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene yciA CDS complement(13311..14006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(14108..15865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(15974..19642) product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 19985..20383 product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 20422..20865 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 20858..21319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(21256..21912) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A741 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene aat CDS complement(21909..23255) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(23269..23727) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene accB CDS complement(23757..24188) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene aroQ CDS 24432..24644 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene thiS CDS 24637..25407 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene thiG CDS complement(25549..26295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(26389..27840) product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(28010..30607) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4J9 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene rne CDS 31143..32363 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 32540..35005 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 35223..36188 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QJ2 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene prfB CDS complement(36308..36724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(36738..37949) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(38136..38747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 38628..38945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(38950..39411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(39451..42465) product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene glnE CDS 42563..45808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(45899..47170) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene tyrS CDS 47259..48440 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene anmK CDS complement(48526..49167) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 49381..50136 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 50144..51271 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 51268..52431 product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene iscS CDS complement(52464..53396) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(53397..54188) product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(54430..54777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(54969..55637) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 55702..56430 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 56415..58985 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(59530..61110) product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 sequence16 source 1..56235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..3344 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 3388..3774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 3916..4455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(4491..7352) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195994.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene fdhF CDS complement(7357..8934) product NAD-dependent formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene fdsB CDS complement(8931..9416) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene nuoE CDS complement(9575..10435) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB24 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(10435..11541) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(11660..14332) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(14343..15884) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088812.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(15965..17482) product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(17563..18831) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(18926..19483) product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V70 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(19483..20052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(20141..20740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 21033..22472 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR0 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene cobQ CDS 22825..23436 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 23429..24826 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 24838..25860 product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(25877..26029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 26348..27355 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 27352..28176 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(28149..28949) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene hutG CDS complement(28942..30483) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LJ6 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene hutH CDS complement(30488..32137) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V80 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene hutU CDS complement(32266..32988) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene hutC CDS complement(33029..34399) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 34491..35726 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene hutI CDS complement(35767..37158) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 37450..38823 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM21 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene ykoK CDS 38849..39838 product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene ansA CDS 39953..40234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 40535..41002 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(41035..42282) product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 42393..42584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(42613..43089) product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(43149..44723) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(44805..45005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 45104..47503 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 47675..48652 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene eutR CDS 48896..49681 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene bacC CDS 49706..50926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(51085..51519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(51521..51994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(51996..52553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(52573..53187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(53180..53731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(53742..54896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 misc_feature complement(54956..>56235) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918074.1:TonB-dependent receptor locus_tag LOCUS_17470 sequence17 source 1..50480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..809) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1381..2565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(2801..3442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(3575..4147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 4282..5727 product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene rimK CDS complement(5756..6565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 6750..7691 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 7815..8747 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 8740..9810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 note possible pseudo, internal stop codon CDS 9841..12471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 note possible pseudo, internal stop codon CDS complement(12657..13607) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene ubiA CDS 13650..14432 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 14500..15291 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 15336..16100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 16271..17641 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 17875..18324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(18359..19849) product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 20248..21084 product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6E5 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene coxB CDS 21105..22733 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene ctaD CDS 22868..23788 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene ctaB CDS 23788..23907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 23916..24467 product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene ctaG CDS 24532..25347 product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 25356..25757 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 25754..26485 product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Y02 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 26576..27967 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 28013..29269 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 29460..29753 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(29950..30558) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene gst CDS complement(30580..31686) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 32009..32530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 32608..33381 product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 33503..36982 product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Y9 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene smc CDS 37187..37525 product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7H7 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene atpI CDS 37571..38314 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene atpB CDS 38414..38638 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007599451.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene atpC CDS 38735..39304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 39297..39887 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T930 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene atpF CDS 40069..40569 product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 40752..41354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(41401..42153) product proline hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(42155..42487) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(42500..43816) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(43946..47557) product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene oplaH CDS 47688..48410 product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 48431..49315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 49338..50093 product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(50100..50309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 sequence18 source 1..47650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(756..1400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1473..2444) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2447..3427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(3481..5208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(5215..6471) product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(6482..7102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(7115..8611) product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(8614..9495) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene ctpC CDS complement(9508..10035) product type 4 prepilin peptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968379.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene cpaA1 CDS complement(10171..10350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(10431..10607) product PilA pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene pilA1 CDS complement(10908..13274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 13481..13654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 13658..14134 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 14353..15006 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(15072..15620) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(15853..16326) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene greA CDS complement(16439..19738) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(19731..20921) product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene carA CDS 21012..21191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 21302..21757 product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 21823..23778 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N97 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene dnaG CDS 23974..26058 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM5 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene rpoD CDS 26092..26364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 tRNA complement(26502..26578) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(26799..27698) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(27689..28684) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(28681..29301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 29612..29932 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(30048..30365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(30660..32129) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(32151..33254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(33304..35541) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene fyuA CDS complement(35776..36945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(37019..40096) product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene oar CDS complement(40420..41367) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(41415..41720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(41757..42023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(42047..42910) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene nodI CDS complement(42925..43305) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(43260..43424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 43534..43998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 44024..44323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 44411..45733 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 45820..47499 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 sequence19 source 1..44961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(261..725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 1369..1881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(2340..3242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 3683..3886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 3890..4519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 4674..6455 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(6578..7474) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065109.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 7778..9274 product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 9356..10492 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 10557..11612 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 11664..12551 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(12555..12869) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(12930..13415) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene lrp CDS complement(13453..13677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 14120..14278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 14387..15766 product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene sdaA CDS 15913..19110 product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene putA CDS complement(19250..22288) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 23325..23759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 24051..24485 product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028073.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 24882..25064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 25112..27046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 27280..27876 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 28018..29115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 29441..32089 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 32236..33372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(33380..34324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(34324..35427) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene ansA CDS complement(35623..35808) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE65 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene rpmF CDS complement(36060..36356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 tRNA 36517..36604 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 36692..36919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(37183..37788) product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 38532..39776 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MND0 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 39769..40221 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 40607..41467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(41864..42064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 42124..42396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(43022..43210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(43382..43621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 43740..44018 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 44114..44890 product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 sequence20 source 1..40596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(519..1289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1636..2769 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2903..4597) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(4696..5340) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(5412..7166) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(7233..9587) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene fyuA CDS complement(9837..10943) product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(10944..12389) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(12552..15341) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(15507..19910) product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(19910..21613) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(21597..21776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 22212..23786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(23793..24776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(24855..25382) product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene paaI CDS 25465..26385 product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 26523..27518 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene paaA CDS 27650..27955 product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene paaB CDS 28003..28767 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene paaC CDS 28773..29291 product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene paaD CDS 29388..30470 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene paaE CDS 30731..31432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 31581..33005 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 33079..33429 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970731.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 33552..34418 product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(34573..35175) product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30323 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene cycM CDS 35430..36296 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(36431..38281) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene ilvD CDS complement(38368..39315) product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(39541..39936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 sequence21 source 1..39916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 904..2730 product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2756..5140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(5178..7355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(7485..10229) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(10564..11661) product protein FpvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115643.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene fpvR CDS complement(11670..12242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(12818..13516) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 13876..14058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 13973..15460 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene phoA CDS 15791..16690 product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A881 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene cysD CDS 16690..18624 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 18935..19333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205759.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 19375..19995 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene gst CDS 20032..21288 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 21348..22007 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 22301..22513 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 22515..22718 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 22754..25396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 25393..26190 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 26238..27620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(27933..28499) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(28589..28780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 29970..31088 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338705.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene sdh CDS 31125..32300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(32555..34198) product (2S)-methylsuccinyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(34211..35521) product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 35842..37824 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 37869..38261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 38233..38949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 39021..39767 product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 sequence22 source 1..38568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(546..851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 759..1874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2063..2281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2420..4999) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWD8 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene clpB CDS complement(5546..6478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(6695..7504) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X6 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene prmC CDS complement(7556..8635) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCF2 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene prfA CDS complement(8702..9952) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene hisS CDS complement(9974..11107) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene ispG CDS complement(11218..12426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(12899..15163) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(15305..16351) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(16361..17563) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 17871..18560 product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM5 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene ubiG CDS 18566..19387 product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z7 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene fdhD CDS complement(19400..20008) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKR0 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene mobA CDS complement(20061..20579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(20566..21450) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(21466..21720) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(21792..22595) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 22739..23737 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 23797..24012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(24044..24679) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene hmgA CDS complement(24747..25739) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene fahA CDS complement(25781..26911) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene hmgA CDS 27135..27596 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(27634..29052) product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(29203..29448) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 29502..29930 product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(30051..31670) product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(31783..32958) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(32960..33769) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(33834..34340) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(34350..35117) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(35143..37467) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 37752..38174 product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 sequence23 source 1..36942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..481 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene rpsJ CDS 487..1254 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QH0 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rplC CDS 1260..1880 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V2 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rplD CDS 1877..2170 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE20 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene rplW CDS 2174..3007 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE21 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene rplB CDS 3020..3298 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U863 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene rpsS CDS 3304..3684 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene rplV CDS 3684..4382 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U865 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene rpsC CDS 4401..4814 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene rplP CDS 4830..5039 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD2 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene rpmC CDS 5062..5295 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R3 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene rpsQ CDS 5347..5715 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene rplN CDS 5715..6044 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene rplX CDS 6037..6588 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R0 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene rplE CDS 6614..6919 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX3 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene rpsN CDS 6933..7331 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q8 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene rpsH CDS 7343..7876 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U874 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene rplF CDS 7889..8251 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF4 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene rplR CDS 8272..8826 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T6 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene rpsE CDS 8833..9024 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene rpmD CDS 9041..9541 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene rplO CDS 9584..10918 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene secY CDS 10915..11565 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene adk CDS 11691..12059 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene rpsM CDS 12072..12458 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene rpsK CDS 12532..13548 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene rpoA CDS 13610..14074 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U884 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene rplQ CDS complement(14129..15157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(15157..16644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(16655..17275) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 17383..18855 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 18867..20186 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(20292..21491) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710081.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 21525..22439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 22540..22920 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene crcB CDS 22929..23921 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 23928..24620 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 24670..25362 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(25407..26615) product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene nhaA CDS 26966..28498 product propionyl-CoA carboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E3 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene pccB CDS 28513..30507 product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene pccA CDS 30562..30897 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ4 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene acyP CDS complement(30949..31605) product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A6 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene lipB CDS 31717..31956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 32183..32959 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 tRNA 33089..33175 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 33330..34304 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(34296..34565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 34922..35182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 35282..35482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(36102..36329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 sequence24 source 1..36744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 525..1667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 1828..2115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 2167..2958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 3034..3333 product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(3799..5940) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene mcmA CDS 6173..7936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 8030..9814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 10139..10567 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(10708..11061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 11308..12723 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene rhlE CDS 12659..13921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(13929..14930) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(14997..16004) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 16124..17134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 17289..19427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(19417..19860) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(19857..20342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(20366..20797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(20830..21237) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(21256..21510) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066791.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 21643..23877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(23895..24143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(24214..26538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(26682..27266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(27432..28940) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 29166..29909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 30001..30555 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 30540..31823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 31927..33870 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene acsA CDS complement(33967..34383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(34458..35657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 36103..36579 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531541.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 sequence25 source 1..35629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1008..2528 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2663..3823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 3856..5274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(5280..5957) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene tcsR CDS complement(6008..7639) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 8055..9425 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 9636..10772 product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(10809..12350) product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(12363..14534) product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene iorA CDS complement(14681..15466) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 15991..17343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 17448..22301 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(22389..22598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 repeat_region 22594..23025 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcatagcttcccttttcacaccgataggctatgat CDS complement(23072..23374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(23420..23914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 note possible pseudo, frameshifted CDS complement(24404..26926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 note possible pseudo, frameshifted CDS complement(27125..27682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(27717..27893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(28097..28474) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(28492..28797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(28827..29834) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene gpsA CDS complement(29911..31020) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene tsaD CDS 31131..32084 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene hemC CDS 32081..32869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 32866..34260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 34257..35525 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 sequence26 source 1..35163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2044..3744 product RTX toxin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705263.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene rtxB CDS 3741..6053 product peptide ABC transporter ATP-binidng protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 6040..7515 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(7631..8575) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene gshB CDS complement(8579..9466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(9556..9948) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(9938..10813) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK8 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene rsmI CDS complement(11489..11755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(11813..12097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(12261..13430) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene hemN CDS complement(13417..14055) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(14073..14789) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK4 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene rph CDS 14977..16017 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene hrcA CDS 16031..16705 product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SK0 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene grpE CDS complement(16889..17395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 17670..19583 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene dnaK CDS 19707..20840 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM8 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene dnaJ CDS complement(20901..21461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(21626..22063) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 22340..23782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 23854..25290 product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(25397..25975) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947373.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(26090..26350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(26378..26716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(26883..27323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(27563..29230) product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 29497..30288 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene paaG CDS 30416..31933 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 31930..32445 product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene paaI CDS 32468..33673 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 33717..35024 product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene paaA sequence27 source 1..33226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(40..116) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(351..1592) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene mnmA CDS complement(1662..2585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2698..4815) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene flaN CDS 6743..7411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 7425..8120 product flagellar hook assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_773637.2 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene flgD CDS 8215..9573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 9805..10104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 10464..12200 product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R7 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene fliF CDS 12283..13305 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04955 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene fliG CDS 13328..13984 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene fliH CDS 14094..14444 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 14501..15262 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 15276..16658 product transcriptional regulatory protein FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17899 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene flbD CDS 16767..18797 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene flhA CDS 18846..19979 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 19976..20743 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 20850..23174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 23217..23597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(23722..24129) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(24190..25560) product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene fliI CDS 25974..26678 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(26851..27687) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(27684..28772) product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene cheB1 CDS complement(28843..29208) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(29255..29713) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(29738..32830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 sequence28 source 1..30833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 243..329 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(593..1297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 1676..2449 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013382.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2632..3993 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 4006..4434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(4472..5290) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 5478..6620 product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene dauA CDS complement(6617..6898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(7039..8868) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 9150..10124 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(10155..12065) product spermidine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(12202..13113) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene panC CDS complement(13153..14013) product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 14239..15093 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 15113..15598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 15600..16988 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 17337..17852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 18155..18481 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene clpS CDS 18595..20901 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 21068..21499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(21505..22674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640419.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(22718..23449) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(23465..23935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(24017..24754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 24776..24991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(24938..25327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(25462..26745) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD26 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene dinB CDS complement(26748..27656) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(27753..28409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(28422..28700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 28859..29224 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 29234..30607 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene pleD sequence29 source 1..30629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..830) product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 1410..2555 product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene corA CDS 3569..4330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 4626..5852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 6255..7601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 7579..8931 product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P775 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene murD CDS 8998..10581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(10727..11680) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF0 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 12062..13216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(13263..14897) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(15075..16316) product MFS transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(16327..17373) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IUX5 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene gapA-1 CDS complement(17404..17739) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 18363..19181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(19224..19919) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203376.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(20127..21320) product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 21603..22841 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene amaB CDS complement(22848..24893) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene asnB CDS complement(24971..26041) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene pyrB CDS complement(26035..26154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(26151..27599) product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene dur3 CDS complement(27596..28087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(28378..30309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 sequence30 source 1..30203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(199..275) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 533..1222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 1246..2058 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2091..3611 product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 3832..4131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 4141..6009 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(5999..7291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 7813..8562 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887737.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 8565..9497 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 9638..10510 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene hbdA CDS 10752..11528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(11578..12009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(12184..13101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 13145..13486 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 13479..13865 product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 13963..15705 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(15826..16818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 17120..19129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 19447..20019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 20016..20831 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 20982..21731 product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 21728..22333 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIH7 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene ruvC CDS 22330..22965 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF6 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene ruvA CDS 22962..24032 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN03 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene ruvB CDS 24055..24543 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 24566..25282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 25282..25722 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene tolR CDS 25735..26574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 26653..27990 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene tolB CDS 28125..28670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 29081..30046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 sequence31 source 1..27992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..1583 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(1619..3220) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene purH CDS complement(3417..5108) product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(5288..5980) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IF9 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene rpe CDS complement(6020..7324) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene sun CDS complement(7433..8407) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC2 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene htpX CDS 8568..8729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 8765..9595 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 9592..10107 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 10185..12695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(12762..13112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD62 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(13135..13596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(13628..14878) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(14875..16209) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene sufD CDS complement(16243..17034) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene sufC CDS complement(17061..18515) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(18533..19033) product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(19275..20183) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(20265..21092) product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709820.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(21117..21752) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene rsmG CDS complement(21753..23642) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene mnmG CDS complement(23821..25167) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene mnmE CDS complement(25231..25491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 25756..27792 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 sequence32 source 1..27942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..728 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388927.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 864..2597 product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2658..4166 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 4195..5436 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 5521..6237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(6219..7169) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 7263..7526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(7654..8193) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(8441..9061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 9285..11231 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970655.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene pbpC CDS 11288..11764 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene nodN CDS complement(11767..12468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(12531..12995) product UPF0260 protein R01011 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R94 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(13008..13649) product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 13733..14311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(14330..15415) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(15534..15776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 15906..16796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(16839..17888) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 18037..19398 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 19445..19840 product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene msrB CDS 20142..22220 product putative peptidase y4nA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55577 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(22383..23144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 23561..26509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(26566..27543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 27565..27720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 sequence33 source 1..27577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 1164..1481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(1581..2225) product isovaleryl-homoserine lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VI2 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene bjaI CDS complement(2486..3205) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188690.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 3438..3920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(3849..4070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 4429..4809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 5029..6237 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 6309..8381 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 8546..8896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 9336..9815 product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene mraZ CDS 9815..10867 product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene rsmH CDS 10864..11382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 11379..13097 product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 13094..14587 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N0 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene murE CDS 14584..16059 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB89 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene murF CDS 16104..17192 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene mraY CDS 17229..18377 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene ftsW CDS 18374..19654 product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene murG CDS 19651..21108 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene murC CDS 21108..22040 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene murB CDS 22037..22951 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEM6 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene ddl CDS 22939..23832 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30993 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene ftsQ CDS 23832..25085 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene ftsA CDS 25247..27022 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF60 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene ftsZ sequence34 source 1..26971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2439..5876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 5878..6201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 6448..6774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 6774..7127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 7132..7911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 7911..8432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 8554..9360 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(9429..10178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(10165..10842) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(10847..11194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(11187..11498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(11518..14583) product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(14583..15704) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(15701..16975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 17198..18097 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 18102..18362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 18363..19016 product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 19169..20434 product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD7 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene nhaA CDS 20467..22908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 22930..24297 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 24311..25834 product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 25831..26712 product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 sequence35 source 1..24867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..2164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2180..2323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 2398..2688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2685..3122 product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 3201..3392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 3389..4006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 4003..4203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 4172..4315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 4401..4724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 4738..5322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 5348..5686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 5700..6113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 6106..6510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 6497..8095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 8105..8398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(8416..8628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(9334..9528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 9544..9741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 tRNA complement(9802..9891) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 10075..10281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 10181..11221 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene mltB CDS 11260..12126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 12190..13362 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 13352..14035 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP2 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene tmk CDS 14041..15165 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 15198..16742 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene metG CDS 16748..17551 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 17551..18306 product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 18335..19576 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 19573..20199 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 20202..20882 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67726 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(20939..22153) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 22533..24146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 24163..24672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 sequence36 source 1..24726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..994) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(1012..2436) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2433..3440) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 3786..5582 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 5652..6482 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 6550..8292 product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 8458..9381 product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 9452..9715 product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene xseB CDS 9761..10678 product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 10748..12688 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene dxs CDS 12693..13442 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 13439..14704 product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8M7 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 14970..15443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(15610..15792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(15838..16914) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0R6 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene aroC CDS complement(16914..17735) product enoyl-[acyl-carrier-protein] reductase [NADH] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58380 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene fabI1 CDS complement(17853..18740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597738.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(18737..19633) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(19716..20171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 20313..20903 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene pdxH CDS 20969..21910 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 21907..22263 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919515.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 22315..23073 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene fixR CDS complement(23087..24562) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U990 transl_table 11 codon_start 1 locus_tag LOCUS_23820 sequence37 source 1..24479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(104..178) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 338..901 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 942..1883 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067252.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2010..2702 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 2741..2992 product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THT5 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2996..4204) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 4479..4817 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene glnK CDS 4829..6154 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene amt-2 CDS 6300..7508 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 7518..7790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 7684..10062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 10274..10945 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEG1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 11342..11911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 11958..12755 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene xthA3 CDS 12848..13387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 tRNA complement(13481..13555) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(13776..13976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(13979..15367) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546353.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(15364..16035) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL87 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(16080..16298) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene infA CDS complement(16544..17068) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(17076..17582) product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM8 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(17666..18973) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene hisD CDS complement(18957..19625) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene hisG CDS complement(19797..20291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(20433..21728) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J077 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene murA CDS complement(21759..22352) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE77 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene dcd CDS complement(22394..22555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 tRNA 22814..22888 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 23120..24475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 sequence38 source 1..24447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 591..1499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 1572..2390 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene paaG CDS complement(2469..3515) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene holA CDS complement(3534..4136) product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(4188..6761) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene leuS CDS complement(6920..7438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 8101..8943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(8968..9627) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 9656..10327 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(10444..10995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(11077..11349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(11396..11650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(11701..12111) product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(12108..12326) product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462365.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene pspB CDS complement(12430..13122) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene pspA CDS 13318..14391 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene pspF CDS complement(14590..15723) product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 15813..16502 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 16665..17207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 17319..18161 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 18154..18525 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene folB CDS 18602..18958 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene arsR CDS 18988..19485 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene arsC2 CDS 19487..20506 product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 20513..21508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 21519..21755 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(21870..22298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 note possible pseudo, frameshifted CDS complement(22432..22812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(23227..24123) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(24117..24383) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 sequence39 source 1..20989 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(262..335) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 550..1551 product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene pseB CDS 1548..2735 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene rkpM CDS 2732..3433 product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene rkpN CDS 3430..4485 product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene rkpO CDS 4531..5604 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 5616..6179 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(6552..8681) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(8778..9224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(9382..9771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(9967..10275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(10293..11144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(11170..11571) product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene zntR CDS complement(11728..12921) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P762 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene ackA CDS complement(12918..13877) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086241.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene pta CDS 14066..15034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 15201..16421 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE2 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene metZ CDS 16427..16837 product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS7 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene apaG CDS 16916..17527 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B0 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene folE CDS 17573..19021 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 19082..20302 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 20318..20890 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 sequence40 source 1..20846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(401..772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(901..3504) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(3538..6222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(6434..9478) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(9649..10653) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(10655..11665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(11706..13691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(14082..14996) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(15075..16361) product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene gabT CDS complement(16411..17877) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(18005..18856) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(18918..20021) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 20195..20773 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3X8 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene ubiX sequence41 source 1..17456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 399..989 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 986..1363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 1353..1607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 1711..2355 product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 2352..2558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 2561..2908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 2892..3515 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 3531..3719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 3712..4128 product GemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 4125..4622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 4629..5024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 5608..6129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937513.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 6140..6754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 6754..6975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 6953..7324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 7321..7623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene gp26 CDS 7634..8179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 8179..9765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 9765..11306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene gpH CDS 11306..12598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 12976..14043 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 14040..14441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 14454..15347 product head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 15363..15569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 15665..15988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 15997..17376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 sequence42 source 1..16064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 264..339 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 437..634 product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU7 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene secE CDS 637..1173 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU8 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene nusG CDS 1419..1847 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J69 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene rplK CDS 1852..2550 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J70 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene rplA CDS 2933..3442 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J72 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene rplJ CDS 3509..3886 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI2 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene rplL CDS 4176..8273 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J74 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene rpoB CDS 8307..12500 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV4 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene rpoC CDS 12893..13264 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene rpsL CDS 13301..13771 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene rpsG CDS 13796..15871 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV7 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene fusA sequence43 source 1..14087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(973..2190) product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(2433..3428) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(3440..5869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(5970..7253) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(7250..8680) product imidazolonepropionase related amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265753.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(8895..9332) product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 9558..10367 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 10542..11795 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKT0 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene argD CDS 11797..12744 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE8 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene argF CDS 12759..13697 product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q9 transl_table 11 codon_start 1 locus_tag LOCUS_25220 sequence44 source 1..13817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(675..2096) product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene gltD CDS complement(2099..6754) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 7407..9971 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene hrpB CDS 10635..12479 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD34 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 12557..13516 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD35 transl_table 11 codon_start 1 locus_tag LOCUS_25280 sequence45 source 1..13435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887292.1:calcium-binding protein locus_tag LOCUS_25290 CDS 2285..4618 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 4638..5453 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 5833..7632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 7798..8487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 8673..10193 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083488.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 10400..11677 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(11678..12235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 12451..13296 product ornithine-acyl ACP N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 sequence46 source 1..12210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(256..1080) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDI9 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 1389..2189 product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FY1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene nadX CDS complement(2215..2991) product 4-oxalocrotonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(2988..3842) product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(3861..4910) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene mhpE CDS complement(4921..5856) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4P2 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene mhpF CDS complement(5863..6657) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK05 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene mhpD CDS complement(6665..6967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 note possible pseudo, frameshifted CDS complement(6964..8148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 note possible pseudo, frameshifted CDS complement(8251..9174) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(9187..9537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(9539..10600) product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene mphP CDS complement(10600..10959) product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene mphO CDS complement(11031..12059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 sequence47 source 1..10175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9..176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(216..737) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 1043..1369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 1366..3054 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(3139..4152) product Malyl-CoA/beta-methylmalyl-CoA/citramalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC35 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene mclA CDS 4486..5631 product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene dauA CDS complement(5749..7608) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(7734..8039) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393857.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(8488..9672) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(9768..10070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 sequence48 source 1..9632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..1046 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 1051..3462 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 3473..4678 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 5207..7009 product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNT2 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene pckG CDS complement(7099..8100) product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(8110..9405) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 sequence49 source 1..9231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 906..2084 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265968.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 2214..2645 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 2685..3617 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 3791..5398 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 5470..6465 product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 6652..6945 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9V8 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene rpmB CDS complement(7068..8090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(8044..8187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 8332..9039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 sequence50 source 1..7824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(688..2898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 3259..3969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 4068..5453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(5921..6973) product cytochrome c551 peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14532 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene ccpA CDS 7207..7683 product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 sequence51 source 1..6692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..1956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 2094..2330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 2417..3304 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene garR CDS 3359..3751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(3817..4638) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(4689..5024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391409.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 5417..6043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 6256..6465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 sequence52 source 1..6526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..2323 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene iutA CDS 2335..3444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(3455..4063) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC58 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene recR CDS complement(4076..4399) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM9 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(4472..6298) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 sequence53 source 1..6107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(915..1805) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 1804..2544 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 2730..3317 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(3355..3942) product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene coq7 CDS complement(3935..4432) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 4541..5272 product proline hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(5295..5873) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 sequence54 source 1..5764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1767 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 1769..2554 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(2579..3337) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(3565..5022) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727685.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(5025..5495) product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815416.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090