>Feature sequence01 229 1905 gene locus_tag LOCUS_00010 229 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2088 2012 gene locus_tag LOCUS_t00010 2088 2012 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3231 2200 gene locus_tag LOCUS_00020 gene tdh 3231 2200 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLB9 protein_id gnl|my_center|LOCUS_00020 4442 3228 gene locus_tag LOCUS_00030 gene kbl 4442 3228 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV5 protein_id gnl|my_center|LOCUS_00030 5209 4640 gene locus_tag LOCUS_00040 5209 4640 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_00040 5335 5865 gene locus_tag LOCUS_00050 5335 5865 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 protein_id gnl|my_center|LOCUS_00050 5998 7062 gene locus_tag LOCUS_00060 5998 7062 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_00060 7377 9815 gene locus_tag LOCUS_00070 gene fyuA 7377 9815 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_00070 9977 12280 gene locus_tag LOCUS_00080 9977 12280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_00080 13138 12404 gene locus_tag LOCUS_00090 13138 12404 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919722.1 protein_id gnl|my_center|LOCUS_00090 14620 13244 gene locus_tag LOCUS_00100 14620 13244 CDS product multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919886.1 protein_id gnl|my_center|LOCUS_00100 14941 14813 gene locus_tag LOCUS_00110 14941 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15798 15157 gene locus_tag LOCUS_00120 15798 15157 CDS product UPF0056 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRY9 protein_id gnl|my_center|LOCUS_00120 16688 15804 gene locus_tag LOCUS_00130 gene folD 16688 15804 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_00130 17008 16685 gene locus_tag LOCUS_00140 17008 16685 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC38 protein_id gnl|my_center|LOCUS_00140 17308 17018 gene locus_tag LOCUS_00150 17308 17018 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_00150 19376 17472 gene locus_tag LOCUS_00160 gene htpG 19376 17472 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYB8 protein_id gnl|my_center|LOCUS_00160 20164 19475 gene locus_tag LOCUS_00170 gene ligE 20164 19475 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090161.1 protein_id gnl|my_center|LOCUS_00170 20568 20936 gene locus_tag LOCUS_00180 20568 20936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 protein_id gnl|my_center|LOCUS_00180 21264 21812 gene locus_tag LOCUS_00190 21264 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23516 21882 gene locus_tag LOCUS_00200 gene nadB 23516 21882 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_00200 24687 23599 gene locus_tag LOCUS_00210 24687 23599 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_00210 24919 25137 gene locus_tag LOCUS_00220 24919 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25275 28052 gene locus_tag LOCUS_00230 25275 28052 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921293.1 protein_id gnl|my_center|LOCUS_00230 28665 28504 gene locus_tag LOCUS_00240 28665 28504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28762 29232 gene locus_tag LOCUS_00250 28762 29232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29232 29717 gene locus_tag LOCUS_00260 29232 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32573 29865 gene locus_tag LOCUS_00270 32573 29865 CDS product TonB system transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266217.1 protein_id gnl|my_center|LOCUS_00270 33218 32829 gene locus_tag LOCUS_00280 33218 32829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33762 33325 gene locus_tag LOCUS_00290 33762 33325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37305 34510 gene locus_tag LOCUS_00300 gene flaEY 37305 34510 CDS product regulatory protein FlaEY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15345 protein_id gnl|my_center|LOCUS_00300 38350 37604 gene locus_tag LOCUS_00310 38350 37604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528690.1 protein_id gnl|my_center|LOCUS_00310 38545 39414 gene locus_tag LOCUS_00320 38545 39414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40173 39433 gene locus_tag LOCUS_00330 40173 39433 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 protein_id gnl|my_center|LOCUS_00330 40309 42000 gene locus_tag LOCUS_00340 40309 42000 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_00340 41997 42173 gene locus_tag LOCUS_00350 41997 42173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 44928 42244 gene locus_tag LOCUS_00360 44928 42244 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_00360 45349 47430 gene locus_tag LOCUS_00370 45349 47430 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390307.1 protein_id gnl|my_center|LOCUS_00370 47623 47853 gene locus_tag LOCUS_00380 47623 47853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 48020 48655 gene locus_tag LOCUS_00390 gene ccmA 48020 48655 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIT8 protein_id gnl|my_center|LOCUS_00390 48652 49320 gene locus_tag LOCUS_00400 48652 49320 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF1 protein_id gnl|my_center|LOCUS_00400 49663 49379 gene locus_tag LOCUS_00410 49663 49379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49917 50648 gene locus_tag LOCUS_00420 49917 50648 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_00420 50662 50868 gene locus_tag LOCUS_00430 50662 50868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50865 51380 gene locus_tag LOCUS_00440 gene ccmE 50865 51380 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45401 protein_id gnl|my_center|LOCUS_00440 51377 53428 gene locus_tag LOCUS_00450 51377 53428 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_00450 53418 53948 gene locus_tag LOCUS_00460 gene ccmG 53418 53948 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 protein_id gnl|my_center|LOCUS_00460 53945 54475 gene locus_tag LOCUS_00470 53945 54475 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_00470 54472 55629 gene locus_tag LOCUS_00480 54472 55629 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 protein_id gnl|my_center|LOCUS_00480 55851 56135 gene locus_tag LOCUS_00490 55851 56135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56179 56745 gene locus_tag LOCUS_00500 56179 56745 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_00500 57430 56870 gene locus_tag LOCUS_00510 57430 56870 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L49 protein_id gnl|my_center|LOCUS_00510 58403 57465 gene locus_tag LOCUS_00520 58403 57465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59720 58413 gene locus_tag LOCUS_00530 59720 58413 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_00530 60604 59720 gene locus_tag LOCUS_00540 gene dapF 60604 59720 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_00540 62119 60695 gene locus_tag LOCUS_00550 62119 60695 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_00550 62917 62234 gene locus_tag LOCUS_00560 62917 62234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 63372 64739 gene locus_tag LOCUS_00570 gene ffh 63372 64739 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG5 protein_id gnl|my_center|LOCUS_00570 64848 65264 gene locus_tag LOCUS_00580 64848 65264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65270 65878 gene locus_tag LOCUS_00590 gene rimM 65270 65878 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW7 protein_id gnl|my_center|LOCUS_00590 65882 66634 gene locus_tag LOCUS_00600 gene trmD 65882 66634 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV57 protein_id gnl|my_center|LOCUS_00600 66876 67271 gene locus_tag LOCUS_00610 gene rplS 66876 67271 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X35 protein_id gnl|my_center|LOCUS_00610 67450 68847 gene locus_tag LOCUS_00620 gene leuC 67450 68847 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 protein_id gnl|my_center|LOCUS_00620 68863 69480 gene locus_tag LOCUS_00630 gene leuD 68863 69480 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDX5 protein_id gnl|my_center|LOCUS_00630 69560 70675 gene locus_tag LOCUS_00640 gene leuB 69560 70675 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 protein_id gnl|my_center|LOCUS_00640 70720 71739 gene locus_tag LOCUS_00650 gene asd 70720 71739 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X21 protein_id gnl|my_center|LOCUS_00650 71919 73748 gene locus_tag LOCUS_00660 71919 73748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_00660 73870 75675 gene locus_tag LOCUS_00670 73870 75675 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_00670 75997 76971 gene locus_tag LOCUS_00680 75997 76971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78045 77263 gene locus_tag LOCUS_00690 78045 77263 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIY6 protein_id gnl|my_center|LOCUS_00690 79850 78063 gene locus_tag LOCUS_00700 gene sdhA 79850 78063 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 protein_id gnl|my_center|LOCUS_00700 80250 79876 gene locus_tag LOCUS_00710 80250 79876 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 protein_id gnl|my_center|LOCUS_00710 80650 80264 gene locus_tag LOCUS_00720 gene sdhC 80650 80264 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_00720 81798 80857 gene locus_tag LOCUS_00730 81798 80857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_00730 82201 81806 gene locus_tag LOCUS_00740 82201 81806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 83458 82361 gene locus_tag LOCUS_00750 gene mch 83458 82361 CDS product beta-methylmalyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC34 protein_id gnl|my_center|LOCUS_00750 84354 83461 gene locus_tag LOCUS_00760 84354 83461 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_00760 84711 86081 gene locus_tag LOCUS_00770 84711 86081 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_00770 86158 86622 gene locus_tag LOCUS_00780 86158 86622 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477782.1 protein_id gnl|my_center|LOCUS_00780 87094 86873 gene locus_tag LOCUS_00790 87094 86873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87531 87319 gene locus_tag LOCUS_00800 87531 87319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87877 89013 gene locus_tag LOCUS_00810 87877 89013 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388963.1 protein_id gnl|my_center|LOCUS_00810 89466 90428 gene locus_tag LOCUS_00820 gene mdh 89466 90428 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 protein_id gnl|my_center|LOCUS_00820 90545 91714 gene locus_tag LOCUS_00830 gene sucC 90545 91714 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 protein_id gnl|my_center|LOCUS_00830 91714 92589 gene locus_tag LOCUS_00840 91714 92589 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_00840 92637 95579 gene locus_tag LOCUS_00850 gene sucA 92637 95579 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067152.1 protein_id gnl|my_center|LOCUS_00850 95768 97378 gene locus_tag LOCUS_00860 gene sucB 95768 97378 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ87 protein_id gnl|my_center|LOCUS_00860 97400 98806 gene locus_tag LOCUS_00870 gene lpdA2 97400 98806 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK0 protein_id gnl|my_center|LOCUS_00870 100500 98893 gene locus_tag LOCUS_00880 100500 98893 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_00880 101588 100629 gene locus_tag LOCUS_00890 gene xerC 101588 100629 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 protein_id gnl|my_center|LOCUS_00890 102289 101567 gene locus_tag LOCUS_00900 102289 101567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 102986 102333 gene locus_tag LOCUS_00910 gene tal 102986 102333 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM7 protein_id gnl|my_center|LOCUS_00910 103213 105411 gene locus_tag LOCUS_00920 gene priA 103213 105411 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL6 protein_id gnl|my_center|LOCUS_00920 105659 106243 gene locus_tag LOCUS_00930 gene atpH 105659 106243 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM4 protein_id gnl|my_center|LOCUS_00930 106240 107772 gene locus_tag LOCUS_00940 gene atpA 106240 107772 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC74 protein_id gnl|my_center|LOCUS_00940 107813 108691 gene locus_tag LOCUS_00950 gene atpG 107813 108691 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK7 protein_id gnl|my_center|LOCUS_00950 108769 110160 gene locus_tag LOCUS_00960 gene atpD 108769 110160 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_00960 110187 110597 gene locus_tag LOCUS_00970 gene atpC 110187 110597 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL34 protein_id gnl|my_center|LOCUS_00970 111126 111461 gene locus_tag LOCUS_00980 111126 111461 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_00980 111463 111936 gene locus_tag LOCUS_00990 111463 111936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 112027 112476 gene locus_tag LOCUS_01000 112027 112476 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_01000 114007 112538 gene locus_tag LOCUS_01010 114007 112538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_01010 114904 114206 gene locus_tag LOCUS_01020 114904 114206 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_01020 115362 114916 gene locus_tag LOCUS_01030 115362 114916 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528594.1 protein_id gnl|my_center|LOCUS_01030 115471 115839 gene locus_tag LOCUS_01040 115471 115839 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_01040 116690 115836 gene locus_tag LOCUS_01050 116690 115836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 117568 116744 gene locus_tag LOCUS_01060 117568 116744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 118155 117610 gene locus_tag LOCUS_01070 gene rppH 118155 117610 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 protein_id gnl|my_center|LOCUS_01070 118296 119003 gene locus_tag LOCUS_01080 118296 119003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_01080 120330 119047 gene locus_tag LOCUS_01090 120330 119047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067225.1 protein_id gnl|my_center|LOCUS_01090 121787 120453 gene locus_tag LOCUS_01100 121787 120453 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_01100 123125 121788 gene locus_tag LOCUS_01110 123125 121788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_01110 124722 123112 gene locus_tag LOCUS_01120 gene gpmI 124722 123112 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_01120 125397 124927 gene locus_tag LOCUS_01130 gene rlmH 125397 124927 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X82 protein_id gnl|my_center|LOCUS_01130 125850 125407 gene locus_tag LOCUS_01140 gene rsfS 125850 125407 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLZ3 protein_id gnl|my_center|LOCUS_01140 126371 125874 gene locus_tag LOCUS_01150 gene nadD 126371 125874 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS2 protein_id gnl|my_center|LOCUS_01150 127776 126508 gene locus_tag LOCUS_01160 gene proA 127776 126508 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS1 protein_id gnl|my_center|LOCUS_01160 129026 127896 gene locus_tag LOCUS_01170 gene proB 129026 127896 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBS0 protein_id gnl|my_center|LOCUS_01170 129256 129023 gene locus_tag LOCUS_01180 129256 129023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 130175 129150 gene locus_tag LOCUS_01190 gene obg 130175 129150 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV6 protein_id gnl|my_center|LOCUS_01190 130068 130265 gene locus_tag LOCUS_01200 130068 130265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 130680 130423 gene locus_tag LOCUS_01210 gene rpmA 130680 130423 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV03 protein_id gnl|my_center|LOCUS_01210 131205 130684 gene locus_tag LOCUS_01220 131205 130684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 132209 131439 gene locus_tag LOCUS_01230 132209 131439 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_01230 132668 133114 gene locus_tag LOCUS_01240 132668 133114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135344 133257 gene locus_tag LOCUS_01250 135344 133257 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_01250 136084 135497 gene locus_tag LOCUS_01260 gene tlpA 136084 135497 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 protein_id gnl|my_center|LOCUS_01260 136120 137547 gene locus_tag LOCUS_01270 gene argH 136120 137547 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 protein_id gnl|my_center|LOCUS_01270 137704 137916 gene locus_tag LOCUS_01280 137704 137916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 137801 138460 gene locus_tag LOCUS_01290 137801 138460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 139028 138642 gene locus_tag LOCUS_01300 139028 138642 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968794.1 protein_id gnl|my_center|LOCUS_01300 139214 139411 gene locus_tag LOCUS_01310 139214 139411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 139428 140699 gene locus_tag LOCUS_01320 gene lysA 139428 140699 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MG9 protein_id gnl|my_center|LOCUS_01320 140744 142807 gene locus_tag LOCUS_01330 140744 142807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 143249 142875 gene locus_tag LOCUS_01340 143249 142875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066761.1 protein_id gnl|my_center|LOCUS_01340 144301 143378 gene locus_tag LOCUS_01350 144301 143378 CDS product MJ0042 family finger-like domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 protein_id gnl|my_center|LOCUS_01350 144474 145214 gene locus_tag LOCUS_01360 144474 145214 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 protein_id gnl|my_center|LOCUS_01360 145217 146098 gene locus_tag LOCUS_01370 145217 146098 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_01370 146118 146696 gene locus_tag LOCUS_01380 146118 146696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 146847 147560 gene locus_tag LOCUS_01390 146847 147560 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_01390 147672 148751 gene locus_tag LOCUS_01400 147672 148751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 149851 148910 gene locus_tag LOCUS_01410 gene tyrC 149851 148910 CDS product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970109.1 protein_id gnl|my_center|LOCUS_01410 150944 149853 gene locus_tag LOCUS_01420 gene hisC 150944 149853 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9W3 protein_id gnl|my_center|LOCUS_01420 151183 152346 gene locus_tag LOCUS_01430 gene metX 151183 152346 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_01430 152343 152975 gene locus_tag LOCUS_01440 152343 152975 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_01440 153862 153059 gene locus_tag LOCUS_01450 153862 153059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_01450 155372 153852 gene locus_tag LOCUS_01460 155372 153852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 protein_id gnl|my_center|LOCUS_01460 155675 156748 gene locus_tag LOCUS_01470 155675 156748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 157032 159314 gene locus_tag LOCUS_01480 157032 159314 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_01480 159385 160359 gene locus_tag LOCUS_01490 159385 160359 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083062.1 protein_id gnl|my_center|LOCUS_01490 161099 160296 gene locus_tag LOCUS_01500 161099 160296 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973187.1 protein_id gnl|my_center|LOCUS_01500 162037 161315 gene locus_tag LOCUS_01510 162037 161315 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720931.1 protein_id gnl|my_center|LOCUS_01510 162376 162197 gene locus_tag LOCUS_01520 162376 162197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 163475 162300 gene locus_tag LOCUS_01530 163475 162300 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709751.1 protein_id gnl|my_center|LOCUS_01530 164821 163745 gene locus_tag LOCUS_01540 164821 163745 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 165610 165200 gene locus_tag LOCUS_01550 165610 165200 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_01550 166125 165928 gene locus_tag LOCUS_01560 166125 165928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 166393 167016 gene locus_tag LOCUS_01570 166393 167016 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_01570 167074 169134 gene locus_tag LOCUS_01580 gene pepO 167074 169134 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_01580 169836 169330 gene locus_tag LOCUS_01590 169836 169330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_01590 170532 169939 gene locus_tag LOCUS_01600 170532 169939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_01600 170690 170854 gene locus_tag LOCUS_01610 170690 170854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 173605 171200 gene locus_tag LOCUS_01620 173605 171200 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921290.1 protein_id gnl|my_center|LOCUS_01620 173682 173864 gene locus_tag LOCUS_01630 173682 173864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 175908 174103 gene locus_tag LOCUS_01640 gene lepA 175908 174103 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCA2 protein_id gnl|my_center|LOCUS_01640 176955 175981 gene locus_tag LOCUS_01650 176955 175981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 177983 176970 gene locus_tag LOCUS_01660 177983 176970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 180023 178122 gene locus_tag LOCUS_01670 gene cobT 180023 178122 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709223.1 protein_id gnl|my_center|LOCUS_01670 181100 180093 gene locus_tag LOCUS_01680 181100 180093 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_01680 181702 181097 gene locus_tag LOCUS_01690 181702 181097 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_01690 181842 182105 gene locus_tag LOCUS_01700 181842 182105 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_01700 183373 182498 gene locus_tag LOCUS_01710 183373 182498 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_01710 184275 183373 gene locus_tag LOCUS_01720 184275 183373 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 protein_id gnl|my_center|LOCUS_01720 184487 186094 gene locus_tag LOCUS_01730 gene mccB 184487 186094 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_01730 186098 186904 gene locus_tag LOCUS_01740 186098 186904 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 protein_id gnl|my_center|LOCUS_01740 186911 188896 gene locus_tag LOCUS_01750 gene accC 186911 188896 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_01750 188893 189789 gene locus_tag LOCUS_01760 188893 189789 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483384.1 protein_id gnl|my_center|LOCUS_01760 189913 191079 gene locus_tag LOCUS_01770 189913 191079 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887258.1 protein_id gnl|my_center|LOCUS_01770 191293 191637 gene locus_tag LOCUS_01780 191293 191637 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704640.1 protein_id gnl|my_center|LOCUS_01780 192765 191677 gene locus_tag LOCUS_01790 192765 191677 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_01790 194925 192964 gene locus_tag LOCUS_01800 194925 192964 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_01800 195953 195006 gene locus_tag LOCUS_01810 195953 195006 CDS product Galanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074255.1 protein_id gnl|my_center|LOCUS_01810 196572 196012 gene locus_tag LOCUS_01820 196572 196012 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 protein_id gnl|my_center|LOCUS_01820 197314 196616 gene locus_tag LOCUS_01830 197314 196616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 197836 197426 gene locus_tag LOCUS_01840 197836 197426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 198284 197838 gene locus_tag LOCUS_01850 198284 197838 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 protein_id gnl|my_center|LOCUS_01850 198960 198274 gene locus_tag LOCUS_01860 198960 198274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 199781 199458 gene locus_tag LOCUS_01870 199781 199458 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 protein_id gnl|my_center|LOCUS_01870 200185 199781 gene locus_tag LOCUS_01880 200185 199781 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 protein_id gnl|my_center|LOCUS_01880 201135 200218 gene locus_tag LOCUS_01890 201135 200218 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_01890 201670 201242 gene locus_tag LOCUS_01900 201670 201242 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_01900 203403 201754 gene locus_tag LOCUS_01910 203403 201754 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_01910 204134 203430 gene locus_tag LOCUS_01920 204134 203430 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_01920 204534 205031 gene locus_tag LOCUS_01930 204534 205031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 205184 206779 gene locus_tag LOCUS_01940 205184 206779 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_01940 207366 206857 gene locus_tag LOCUS_01950 207366 206857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_01950 207816 207424 gene locus_tag LOCUS_01960 207816 207424 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228878.1 protein_id gnl|my_center|LOCUS_01960 208102 209397 gene locus_tag LOCUS_01970 gene ahcY 208102 209397 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_01970 209641 212109 gene locus_tag LOCUS_01980 209641 212109 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_01980 212214 212732 gene locus_tag LOCUS_01990 212214 212732 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_01990 212725 217590 gene locus_tag LOCUS_02000 212725 217590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 217587 221009 gene locus_tag LOCUS_02010 217587 221009 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_02010 221118 221438 gene locus_tag LOCUS_02020 221118 221438 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L8 protein_id gnl|my_center|LOCUS_02020 222948 221641 gene locus_tag LOCUS_02030 gene folC 222948 221641 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383296.1 protein_id gnl|my_center|LOCUS_02030 223850 222969 gene locus_tag LOCUS_02040 gene accD 223850 222969 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7R7 protein_id gnl|my_center|LOCUS_02040 224757 223918 gene locus_tag LOCUS_02050 gene trpA 224757 223918 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500R5 protein_id gnl|my_center|LOCUS_02050 225993 224770 gene locus_tag LOCUS_02060 gene trpB 225993 224770 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS4 protein_id gnl|my_center|LOCUS_02060 226671 226021 gene locus_tag LOCUS_02070 gene trpF 226671 226021 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E3 protein_id gnl|my_center|LOCUS_02070 227397 226675 gene locus_tag LOCUS_02080 gene pyrF 227397 226675 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_02080 227767 227459 gene locus_tag LOCUS_02090 227767 227459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 228290 228009 gene locus_tag LOCUS_02100 gene ihfB 228290 228009 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCQ1 protein_id gnl|my_center|LOCUS_02100 229222 228314 gene locus_tag LOCUS_02110 gene sppA 229222 228314 CDS product Clp protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706610.1 protein_id gnl|my_center|LOCUS_02110 228885 228973 gene locus_tag LOCUS_t00020 228885 228973 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 229559 231628 gene locus_tag LOCUS_02120 229559 231628 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085334.1 protein_id gnl|my_center|LOCUS_02120 231808 231733 gene locus_tag LOCUS_t00030 231808 231733 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 232271 231933 gene locus_tag LOCUS_02130 232271 231933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 232623 233945 gene locus_tag LOCUS_02140 gene aroA 232623 233945 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_02140 233942 234595 gene locus_tag LOCUS_02150 gene cmk 233942 234595 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF1 protein_id gnl|my_center|LOCUS_02150 234766 236478 gene locus_tag LOCUS_02160 234766 236478 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCW5 protein_id gnl|my_center|LOCUS_02160 238195 236885 gene locus_tag LOCUS_02170 gene hslU 238195 236885 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH6 protein_id gnl|my_center|LOCUS_02170 238746 238192 gene locus_tag LOCUS_02180 gene hslV 238746 238192 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA2 protein_id gnl|my_center|LOCUS_02180 238971 239582 gene locus_tag LOCUS_02190 gene hisB 238971 239582 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 protein_id gnl|my_center|LOCUS_02190 239603 240013 gene locus_tag LOCUS_02200 239603 240013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 240195 240782 gene locus_tag LOCUS_02210 gene hisH 240195 240782 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_02210 240839 241384 gene locus_tag LOCUS_02220 240839 241384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 241385 242125 gene locus_tag LOCUS_02230 gene hisA 241385 242125 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_02230 242125 242883 gene locus_tag LOCUS_02240 gene hisF 242125 242883 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 protein_id gnl|my_center|LOCUS_02240 242904 243245 gene locus_tag LOCUS_02250 gene hisE 242904 243245 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA8 protein_id gnl|my_center|LOCUS_02250 243287 243646 gene locus_tag LOCUS_02260 243287 243646 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_02260 243740 244198 gene locus_tag LOCUS_02270 243740 244198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 244915 244505 gene locus_tag LOCUS_02280 244915 244505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 245940 244930 gene locus_tag LOCUS_02290 245940 244930 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 protein_id gnl|my_center|LOCUS_02290 246219 246974 gene locus_tag LOCUS_02300 246219 246974 CDS product cysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 protein_id gnl|my_center|LOCUS_02300 246971 247525 gene locus_tag LOCUS_02310 246971 247525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 248099 247455 gene locus_tag LOCUS_02320 gene nth 248099 247455 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 protein_id gnl|my_center|LOCUS_02320 248289 248783 gene locus_tag LOCUS_02330 248289 248783 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_02330 248899 249291 gene locus_tag LOCUS_02340 248899 249291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 249487 249720 gene locus_tag LOCUS_02350 249487 249720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 250068 249853 gene locus_tag LOCUS_02360 250068 249853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 250676 250143 gene locus_tag LOCUS_02370 250676 250143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 251688 250873 gene locus_tag LOCUS_02380 gene dapB 251688 250873 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_02380 251875 252399 gene locus_tag LOCUS_02390 251875 252399 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337074.1 protein_id gnl|my_center|LOCUS_02390 252641 252378 gene locus_tag LOCUS_02400 252641 252378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 254954 252681 gene locus_tag LOCUS_02410 254954 252681 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_02410 255475 254951 gene locus_tag LOCUS_02420 255475 254951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 257099 255531 gene locus_tag LOCUS_02430 gene fixG 257099 255531 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971694.1 protein_id gnl|my_center|LOCUS_02430 258136 257273 gene locus_tag LOCUS_02440 gene fixP 258136 257273 CDS product Cbb3-type cytochrome c oxidase subunit FixP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03075 protein_id gnl|my_center|LOCUS_02440 258294 258139 gene locus_tag LOCUS_02450 258294 258139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 259055 258330 gene locus_tag LOCUS_02460 gene fixO 259055 258330 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 protein_id gnl|my_center|LOCUS_02460 260746 259073 gene locus_tag LOCUS_02470 gene fixN 260746 259073 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03073 protein_id gnl|my_center|LOCUS_02470 261589 261762 gene locus_tag LOCUS_02480 261589 261762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 262776 263447 gene locus_tag LOCUS_02490 262776 263447 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_02490 263444 264817 gene locus_tag LOCUS_02500 gene ttpC 263444 264817 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_02500 264820 265347 gene locus_tag LOCUS_02510 gene exbB 264820 265347 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_02510 265358 265762 gene locus_tag LOCUS_02520 265358 265762 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_02520 265759 266364 gene locus_tag LOCUS_02530 gene tonB2 265759 266364 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_02530 266379 267779 gene locus_tag LOCUS_02540 266379 267779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_02540 268510 268025 gene locus_tag LOCUS_02550 268510 268025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 268709 269950 gene locus_tag LOCUS_02560 gene tipF 268709 269950 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_02560 271262 270225 gene locus_tag LOCUS_02570 271262 270225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 271648 271262 gene locus_tag LOCUS_02580 271648 271262 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_02580 271916 272347 gene locus_tag LOCUS_02590 gene phaJ 271916 272347 CDS product (R)-specific enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ36 protein_id gnl|my_center|LOCUS_02590 272429 273427 gene locus_tag LOCUS_02600 272429 273427 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_02600 273580 276441 gene locus_tag LOCUS_02610 gene ileS 273580 276441 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 protein_id gnl|my_center|LOCUS_02610 276441 276950 gene locus_tag LOCUS_02620 gene lspA 276441 276950 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DF7 protein_id gnl|my_center|LOCUS_02620 277021 277236 gene locus_tag LOCUS_02630 277021 277236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 277337 278752 gene locus_tag LOCUS_02640 277337 278752 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090216.1 protein_id gnl|my_center|LOCUS_02640 278749 280176 gene locus_tag LOCUS_02650 278749 280176 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537967.1 protein_id gnl|my_center|LOCUS_02650 280396 280199 gene locus_tag LOCUS_02660 280396 280199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 280613 282553 gene locus_tag LOCUS_02670 gene mutL 280613 282553 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ52 protein_id gnl|my_center|LOCUS_02670 282784 282578 gene locus_tag LOCUS_02680 282784 282578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 283446 282883 gene locus_tag LOCUS_02690 283446 282883 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_02690 284465 283443 gene locus_tag LOCUS_02700 284465 283443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 284678 285133 gene locus_tag LOCUS_02710 gene tadA 284678 285133 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DE3 protein_id gnl|my_center|LOCUS_02710 285182 285754 gene locus_tag LOCUS_02720 285182 285754 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 protein_id gnl|my_center|LOCUS_02720 285796 287154 gene locus_tag LOCUS_02730 285796 287154 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_02730 287405 287175 gene locus_tag LOCUS_02740 287405 287175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 288560 287421 gene locus_tag LOCUS_02750 gene nptA 288560 287421 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_02750 290003 288723 gene locus_tag LOCUS_02760 gene purD 290003 288723 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHE2 protein_id gnl|my_center|LOCUS_02760 290086 291693 gene locus_tag LOCUS_02770 gene xseA 290086 291693 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCQ9 protein_id gnl|my_center|LOCUS_02770 291720 292520 gene locus_tag LOCUS_02780 291720 292520 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_02780 293534 292533 gene locus_tag LOCUS_02790 293534 292533 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_02790 293687 294295 gene locus_tag LOCUS_02800 293687 294295 CDS product putative transcription regulator, AraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703318.1 protein_id gnl|my_center|LOCUS_02800 294545 295255 gene locus_tag LOCUS_02810 294545 295255 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_02810 296824 295463 gene locus_tag LOCUS_02820 296824 295463 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_02820 297338 297661 gene locus_tag LOCUS_02830 297338 297661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 299284 297782 gene locus_tag LOCUS_02840 299284 297782 CDS product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_02840 299891 299358 gene locus_tag LOCUS_02850 299891 299358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 301788 299773 gene locus_tag LOCUS_02860 301788 299773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 302554 302009 gene locus_tag LOCUS_02870 gene ppa 302554 302009 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WY0 protein_id gnl|my_center|LOCUS_02870 302754 304739 gene locus_tag LOCUS_02880 gene hppA1 302754 304739 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_02880 304900 306273 gene locus_tag LOCUS_02890 304900 306273 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_02890 306242 307480 gene locus_tag LOCUS_02900 306242 307480 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968001.1 protein_id gnl|my_center|LOCUS_02900 307990 307562 gene locus_tag LOCUS_02910 307990 307562 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_02910 308194 309057 gene locus_tag LOCUS_02920 308194 309057 CDS product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204502.1 protein_id gnl|my_center|LOCUS_02920 309156 309428 gene locus_tag LOCUS_02930 309156 309428 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 protein_id gnl|my_center|LOCUS_02930 309435 309731 gene locus_tag LOCUS_02940 309435 309731 CDS product RelE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence02 <1 1083 gene locus_tag LOCUS_02950 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705166.1:glutaryl-CoA dehydrogenase 1375 1187 gene locus_tag LOCUS_02960 1375 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2531 1386 gene locus_tag LOCUS_02970 2531 1386 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_02970 3488 2628 gene locus_tag LOCUS_02980 3488 2628 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 protein_id gnl|my_center|LOCUS_02980 3863 4594 gene locus_tag LOCUS_02990 3863 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5622 5248 gene locus_tag LOCUS_03000 5622 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 6436 5768 gene locus_tag LOCUS_03010 6436 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976182.1 protein_id gnl|my_center|LOCUS_03010 7392 6436 gene locus_tag LOCUS_03020 7392 6436 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888088.1 protein_id gnl|my_center|LOCUS_03020 7777 8460 gene locus_tag LOCUS_03030 7777 8460 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480641.1 protein_id gnl|my_center|LOCUS_03030 9569 8448 gene locus_tag LOCUS_03040 9569 8448 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_03040 9696 11339 gene locus_tag LOCUS_03050 9696 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_03050 11777 11583 gene locus_tag LOCUS_03060 11777 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_03060 13436 11826 gene locus_tag LOCUS_03070 13436 11826 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_03070 14570 13617 gene locus_tag LOCUS_03080 14570 13617 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_03080 15573 14737 gene locus_tag LOCUS_03090 15573 14737 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 protein_id gnl|my_center|LOCUS_03090 15675 16004 gene locus_tag LOCUS_03100 15675 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_03100 16918 15986 gene locus_tag LOCUS_03110 16918 15986 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930748.1 protein_id gnl|my_center|LOCUS_03110 17558 16923 gene locus_tag LOCUS_03120 17558 16923 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_03120 17721 17563 gene locus_tag LOCUS_03130 17721 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 17855 18412 gene locus_tag LOCUS_03140 17855 18412 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532489.1 protein_id gnl|my_center|LOCUS_03140 18950 18543 gene locus_tag LOCUS_03150 18950 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 19309 18947 gene locus_tag LOCUS_03160 19309 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 19665 19952 gene locus_tag LOCUS_03170 gene groS5 19665 19952 CDS product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 protein_id gnl|my_center|LOCUS_03170 19992 21632 gene locus_tag LOCUS_03180 gene groL1 19992 21632 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY28 protein_id gnl|my_center|LOCUS_03180 21781 22551 gene locus_tag LOCUS_03190 21781 22551 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_03190 24185 22683 gene locus_tag LOCUS_03200 24185 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 24531 26195 gene locus_tag LOCUS_03210 gene cysI 24531 26195 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_03210 26176 26655 gene locus_tag LOCUS_03220 26176 26655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_03220 26909 28207 gene locus_tag LOCUS_03230 26909 28207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918795.1 protein_id gnl|my_center|LOCUS_03230 28365 28880 gene locus_tag LOCUS_03240 28365 28880 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 protein_id gnl|my_center|LOCUS_03240 28958 29593 gene locus_tag LOCUS_03250 28958 29593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_03250 29606 30256 gene locus_tag LOCUS_03260 29606 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 30256 31467 gene locus_tag LOCUS_03270 30256 31467 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969879.1 protein_id gnl|my_center|LOCUS_03270 32481 31609 gene locus_tag LOCUS_03280 gene hemF 32481 31609 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAT8 protein_id gnl|my_center|LOCUS_03280 32994 32542 gene locus_tag LOCUS_03290 gene trmL 32994 32542 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE3 protein_id gnl|my_center|LOCUS_03290 33077 34078 gene locus_tag LOCUS_03300 33077 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 34122 35231 gene locus_tag LOCUS_03310 34122 35231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 36314 35235 gene locus_tag LOCUS_03320 36314 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 36455 37546 gene locus_tag LOCUS_03330 36455 37546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 38733 37789 gene locus_tag LOCUS_03340 38733 37789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 39033 39563 gene locus_tag LOCUS_03350 39033 39563 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_03350 39573 40841 gene locus_tag LOCUS_03360 39573 40841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 40846 41685 gene locus_tag LOCUS_03370 40846 41685 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_03370 41779 42699 gene locus_tag LOCUS_03380 gene mtnP 41779 42699 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E8 protein_id gnl|my_center|LOCUS_03380 42696 43226 gene locus_tag LOCUS_03390 gene apt 42696 43226 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SB5 protein_id gnl|my_center|LOCUS_03390 43229 43981 gene locus_tag LOCUS_03400 43229 43981 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_03400 44522 44046 gene locus_tag LOCUS_03410 44522 44046 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_03410 44708 45940 gene locus_tag LOCUS_03420 44708 45940 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222055.1 protein_id gnl|my_center|LOCUS_03420 47102 45999 gene locus_tag LOCUS_03430 gene ychF 47102 45999 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 protein_id gnl|my_center|LOCUS_03430 47759 47106 gene locus_tag LOCUS_03440 gene pth 47759 47106 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9C8 protein_id gnl|my_center|LOCUS_03440 48430 47786 gene locus_tag LOCUS_03450 gene rplY 48430 47786 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_03450 49552 48620 gene locus_tag LOCUS_03460 gene prs 49552 48620 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 protein_id gnl|my_center|LOCUS_03460 50572 49814 gene locus_tag LOCUS_03470 50572 49814 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ3 protein_id gnl|my_center|LOCUS_03470 51690 50575 gene locus_tag LOCUS_03480 51690 50575 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_03480 52557 51739 gene locus_tag LOCUS_03490 gene lgt 52557 51739 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 protein_id gnl|my_center|LOCUS_03490 52694 52984 gene locus_tag LOCUS_03500 52694 52984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976378.1 protein_id gnl|my_center|LOCUS_03500 52981 53487 gene locus_tag LOCUS_03510 52981 53487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090187.1 protein_id gnl|my_center|LOCUS_03510 53549 54394 gene locus_tag LOCUS_03520 gene proC 53549 54394 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWW7 protein_id gnl|my_center|LOCUS_03520 55200 54364 gene locus_tag LOCUS_03530 55200 54364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 56302 55799 gene locus_tag LOCUS_03540 56302 55799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 56444 56295 gene locus_tag LOCUS_03550 56444 56295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 56443 57324 gene locus_tag LOCUS_03560 56443 57324 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_03560 57888 57433 gene locus_tag LOCUS_03570 57888 57433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 59695 58001 gene locus_tag LOCUS_03580 59695 58001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 60954 60037 gene locus_tag LOCUS_03590 60954 60037 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_03590 61313 61161 gene locus_tag LOCUS_03600 61313 61161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 61930 61472 gene locus_tag LOCUS_03610 gene moaE 61930 61472 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090206.1 protein_id gnl|my_center|LOCUS_03610 62185 61934 gene locus_tag LOCUS_03620 gene moaD 62185 61934 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKK2 protein_id gnl|my_center|LOCUS_03620 62746 62195 gene locus_tag LOCUS_03630 62746 62195 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_03630 64698 62854 gene locus_tag LOCUS_03640 gene uvrC 64698 62854 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 protein_id gnl|my_center|LOCUS_03640 65619 65191 gene locus_tag LOCUS_03650 65619 65191 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_03650 66702 65749 gene locus_tag LOCUS_03660 gene yrbG 66702 65749 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_03660 67984 66812 gene locus_tag LOCUS_03670 67984 66812 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_03670 69892 68009 gene locus_tag LOCUS_03680 69892 68009 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_03680 71013 70081 gene locus_tag LOCUS_03690 71013 70081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_03690 71217 72170 gene locus_tag LOCUS_03700 71217 72170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 72574 72182 gene locus_tag LOCUS_03710 72574 72182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_03710 72567 72788 gene locus_tag LOCUS_03720 72567 72788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 72853 73224 gene locus_tag LOCUS_03730 72853 73224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_03730 73338 73895 gene locus_tag LOCUS_03740 73338 73895 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_03740 73882 74289 gene locus_tag LOCUS_03750 73882 74289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 74628 75209 gene locus_tag LOCUS_03760 gene sodB 74628 75209 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED83 protein_id gnl|my_center|LOCUS_03760 75976 75332 gene locus_tag LOCUS_03770 75976 75332 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_03770 76695 75979 gene locus_tag LOCUS_03780 76695 75979 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_03780 77056 77586 gene locus_tag LOCUS_03790 77056 77586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_03790 77656 78852 gene locus_tag LOCUS_03800 gene rlmN 77656 78852 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X03 protein_id gnl|my_center|LOCUS_03800 79062 80537 gene locus_tag LOCUS_03810 79062 80537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 80538 81710 gene locus_tag LOCUS_03820 80538 81710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 81871 82509 gene locus_tag LOCUS_03830 81871 82509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 83624 82521 gene locus_tag LOCUS_03840 83624 82521 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_03840 84952 83621 gene locus_tag LOCUS_03850 84952 83621 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_03850 85098 85295 gene locus_tag LOCUS_03860 85098 85295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 85285 86295 gene locus_tag LOCUS_03870 85285 86295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 88052 86298 gene locus_tag LOCUS_03880 88052 86298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 88947 88069 gene locus_tag LOCUS_03890 88947 88069 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_03890 89833 88961 gene locus_tag LOCUS_03900 89833 88961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 90110 89859 gene locus_tag LOCUS_03910 90110 89859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_03910 91285 90221 gene locus_tag LOCUS_03920 91285 90221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390874.1 protein_id gnl|my_center|LOCUS_03920 92456 91329 gene locus_tag LOCUS_03930 92456 91329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 92792 94384 gene locus_tag LOCUS_03940 92792 94384 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551903.1 protein_id gnl|my_center|LOCUS_03940 94433 95665 gene locus_tag LOCUS_03950 94433 95665 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_03950 95675 97534 gene locus_tag LOCUS_03960 95675 97534 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_03960 97812 98438 gene locus_tag LOCUS_03970 97812 98438 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_03970 98533 100116 gene locus_tag LOCUS_03980 98533 100116 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_03980 100150 101094 gene locus_tag LOCUS_03990 100150 101094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 101123 102556 gene locus_tag LOCUS_04000 101123 102556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 102565 103620 gene locus_tag LOCUS_04010 102565 103620 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_04010 103626 104534 gene locus_tag LOCUS_04020 103626 104534 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_04020 104525 105559 gene locus_tag LOCUS_04030 104525 105559 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_04030 105774 107252 gene locus_tag LOCUS_04040 105774 107252 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_04040 107334 108125 gene locus_tag LOCUS_04050 107334 108125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 108459 108196 gene locus_tag LOCUS_04060 108459 108196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 109449 108760 gene locus_tag LOCUS_04070 109449 108760 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_04070 110183 109458 gene locus_tag LOCUS_04080 110183 109458 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_04080 111039 110230 gene locus_tag LOCUS_04090 gene pstB 111039 110230 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 protein_id gnl|my_center|LOCUS_04090 112382 111045 gene locus_tag LOCUS_04100 112382 111045 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_04100 113613 112375 gene locus_tag LOCUS_04110 113613 112375 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_04110 114896 113859 gene locus_tag LOCUS_04120 114896 113859 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_04120 116412 115087 gene locus_tag LOCUS_04130 116412 115087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 116783 117196 gene locus_tag LOCUS_04140 116783 117196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 117296 117610 gene locus_tag LOCUS_04150 117296 117610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 117700 118650 gene locus_tag LOCUS_04160 117700 118650 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_04160 118657 119739 gene locus_tag LOCUS_04170 118657 119739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_04170 120433 119720 gene locus_tag LOCUS_04180 gene gph 120433 119720 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEY9 protein_id gnl|my_center|LOCUS_04180 120590 121942 gene locus_tag LOCUS_04190 gene glmU 120590 121942 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_04190 121964 123790 gene locus_tag LOCUS_04200 gene glmS 121964 123790 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 protein_id gnl|my_center|LOCUS_04200 123872 125695 gene locus_tag LOCUS_04210 123872 125695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920658.1 protein_id gnl|my_center|LOCUS_04210 127229 125739 gene locus_tag LOCUS_04220 127229 125739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244153.1 protein_id gnl|my_center|LOCUS_04220 127378 128730 gene locus_tag LOCUS_04230 gene gor 127378 128730 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189043.1 protein_id gnl|my_center|LOCUS_04230 128900 130279 gene locus_tag LOCUS_04240 128900 130279 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_04240 130301 131983 gene locus_tag LOCUS_04250 gene nadE 130301 131983 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971777.1 protein_id gnl|my_center|LOCUS_04250 132223 133560 gene locus_tag LOCUS_04260 gene gltX 132223 133560 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 protein_id gnl|my_center|LOCUS_04260 133557 134912 gene locus_tag LOCUS_04270 gene cysS 133557 134912 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_04270 134919 135641 gene locus_tag LOCUS_04280 134919 135641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 135662 136483 gene locus_tag LOCUS_04290 gene trmJ 135662 136483 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ5 protein_id gnl|my_center|LOCUS_04290 136755 137369 gene locus_tag LOCUS_04300 gene rpsD 136755 137369 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J446 protein_id gnl|my_center|LOCUS_04300 137550 139658 gene locus_tag LOCUS_04310 137550 139658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 139854 140456 gene locus_tag LOCUS_04320 139854 140456 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888772.1 protein_id gnl|my_center|LOCUS_04320 141418 140573 gene locus_tag LOCUS_04330 gene flgH 141418 140573 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF3 protein_id gnl|my_center|LOCUS_04330 142433 141441 gene locus_tag LOCUS_04340 gene flgA 142433 141441 CDS product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_04340 143233 142448 gene locus_tag LOCUS_04350 gene flgG 143233 142448 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06172 protein_id gnl|my_center|LOCUS_04350 144007 143261 gene locus_tag LOCUS_04360 144007 143261 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF6 protein_id gnl|my_center|LOCUS_04360 144429 144953 gene locus_tag LOCUS_04370 144429 144953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 144962 146047 gene locus_tag LOCUS_04380 144962 146047 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF8 protein_id gnl|my_center|LOCUS_04380 146052 146462 gene locus_tag LOCUS_04390 146052 146462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 146546 147247 gene locus_tag LOCUS_04400 146546 147247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_04400 147348 147989 gene locus_tag LOCUS_04410 147348 147989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 148095 148853 gene locus_tag LOCUS_04420 148095 148853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 148846 149571 gene locus_tag LOCUS_04430 148846 149571 CDS product OmpA/MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 protein_id gnl|my_center|LOCUS_04430 149655 152588 gene locus_tag LOCUS_04440 149655 152588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390459.1 protein_id gnl|my_center|LOCUS_04440 153390 152608 gene locus_tag LOCUS_04450 gene fliP 153390 152608 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG8 protein_id gnl|my_center|LOCUS_04450 153740 153390 gene locus_tag LOCUS_04460 153740 153390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 154115 153741 gene locus_tag LOCUS_04470 154115 153741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 154445 154861 gene locus_tag LOCUS_04480 gene flgB 154445 154861 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I25 protein_id gnl|my_center|LOCUS_04480 154893 155300 gene locus_tag LOCUS_04490 gene flgC 154893 155300 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I26 protein_id gnl|my_center|LOCUS_04490 155326 155667 gene locus_tag LOCUS_04500 gene fliE 155326 155667 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52945 protein_id gnl|my_center|LOCUS_04500 155713 155979 gene locus_tag LOCUS_04510 gene fliQ 155713 155979 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45974 protein_id gnl|my_center|LOCUS_04510 155972 156730 gene locus_tag LOCUS_04520 gene fliR 155972 156730 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 protein_id gnl|my_center|LOCUS_04520 156752 157861 gene locus_tag LOCUS_04530 gene flhB 156752 157861 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_04530 158058 160574 gene locus_tag LOCUS_04540 158058 160574 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531860.1 protein_id gnl|my_center|LOCUS_04540 160854 161924 gene locus_tag LOCUS_04550 gene recA 160854 161924 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33156 protein_id gnl|my_center|LOCUS_04550 162343 164997 gene locus_tag LOCUS_04560 gene alaS 162343 164997 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI0 protein_id gnl|my_center|LOCUS_04560 165053 166252 gene locus_tag LOCUS_04570 165053 166252 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088493.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04570 167526 166312 gene locus_tag LOCUS_04580 167526 166312 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0R6 protein_id gnl|my_center|LOCUS_04580 168258 167674 gene locus_tag LOCUS_04590 168258 167674 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 protein_id gnl|my_center|LOCUS_04590 168635 169651 gene locus_tag LOCUS_04600 168635 169651 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_04600 170193 169714 gene locus_tag LOCUS_04610 170193 169714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 170405 172195 gene locus_tag LOCUS_04620 170405 172195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810841.1 protein_id gnl|my_center|LOCUS_04620 172278 172973 gene locus_tag LOCUS_04630 gene psd 172278 172973 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_04630 172970 173794 gene locus_tag LOCUS_04640 172970 173794 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_04640 177085 173849 gene locus_tag LOCUS_04650 177085 173849 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_04650 178173 177082 gene locus_tag LOCUS_04660 178173 177082 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_04660 178401 179054 gene locus_tag LOCUS_04670 178401 179054 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919941.1 protein_id gnl|my_center|LOCUS_04670 179642 179094 gene locus_tag LOCUS_04680 179642 179094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_04680 181261 179852 gene locus_tag LOCUS_04690 181261 179852 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 protein_id gnl|my_center|LOCUS_04690 181666 181328 gene locus_tag LOCUS_04700 gene glnB 181666 181328 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_04700 182019 182095 gene locus_tag LOCUS_t00040 182019 182095 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 182282 184141 gene locus_tag LOCUS_04710 182282 184141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_04710 184428 185984 gene locus_tag LOCUS_04720 184428 185984 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 protein_id gnl|my_center|LOCUS_04720 186082 186166 gene locus_tag LOCUS_t00050 186082 186166 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 186289 187887 gene locus_tag LOCUS_04730 gene tig 186289 187887 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG0 protein_id gnl|my_center|LOCUS_04730 188051 188680 gene locus_tag LOCUS_04740 gene clpP 188051 188680 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 protein_id gnl|my_center|LOCUS_04740 189176 190444 gene locus_tag LOCUS_04750 gene clpX 189176 190444 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFY5 protein_id gnl|my_center|LOCUS_04750 190707 193061 gene locus_tag LOCUS_04760 gene lon 190707 193061 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 protein_id gnl|my_center|LOCUS_04760 193265 193603 gene locus_tag LOCUS_04770 193265 193603 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_04770 193731 193806 gene locus_tag LOCUS_t00060 193731 193806 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 193915 193991 gene locus_tag LOCUS_t00070 193915 193991 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 194490 194855 gene locus_tag LOCUS_04780 gene nuoA 194490 194855 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 protein_id gnl|my_center|LOCUS_04780 194846 195427 gene locus_tag LOCUS_04790 gene nuoB 194846 195427 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W4 protein_id gnl|my_center|LOCUS_04790 195443 196087 gene locus_tag LOCUS_04800 gene nuoC 195443 196087 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6X2 protein_id gnl|my_center|LOCUS_04800 196087 197265 gene locus_tag LOCUS_04810 gene nuoD 196087 197265 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJA9 protein_id gnl|my_center|LOCUS_04810 197262 197897 gene locus_tag LOCUS_04820 197262 197897 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_04820 197897 199174 gene locus_tag LOCUS_04830 197897 199174 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_04830 199184 201244 gene locus_tag LOCUS_04840 199184 201244 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 protein_id gnl|my_center|LOCUS_04840 201237 202289 gene locus_tag LOCUS_04850 gene nuoH 201237 202289 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 protein_id gnl|my_center|LOCUS_04850 202305 202793 gene locus_tag LOCUS_04860 gene nuoI 202305 202793 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA65 protein_id gnl|my_center|LOCUS_04860 202803 203414 gene locus_tag LOCUS_04870 202803 203414 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975092.1 protein_id gnl|my_center|LOCUS_04870 203430 203738 gene locus_tag LOCUS_04880 gene nuoK1 203430 203738 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 protein_id gnl|my_center|LOCUS_04880 203744 205669 gene locus_tag LOCUS_04890 203744 205669 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975093.1 protein_id gnl|my_center|LOCUS_04890 205673 207181 gene locus_tag LOCUS_04900 205673 207181 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_04900 207213 208670 gene locus_tag LOCUS_04910 gene nuoN1 207213 208670 CDS product NADH-quinone oxidoreductase subunit N 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QN9 protein_id gnl|my_center|LOCUS_04910 208716 209471 gene locus_tag LOCUS_04920 208716 209471 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_04920 209483 210277 gene locus_tag LOCUS_04930 gene coaX 209483 210277 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 protein_id gnl|my_center|LOCUS_04930 210280 211959 gene locus_tag LOCUS_04940 210280 211959 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_04940 211975 212400 gene locus_tag LOCUS_04950 211975 212400 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_04950 212417 212665 gene locus_tag LOCUS_04960 212417 212665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 213050 213493 gene locus_tag LOCUS_04970 213050 213493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 213576 214886 gene locus_tag LOCUS_04980 gene proS 213576 214886 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWT1 protein_id gnl|my_center|LOCUS_04980 215089 216345 gene locus_tag LOCUS_04990 215089 216345 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_04990 216358 217110 gene locus_tag LOCUS_05000 gene lolD 216358 217110 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA77 protein_id gnl|my_center|LOCUS_05000 217176 217580 gene locus_tag LOCUS_05010 217176 217580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 217610 221125 gene locus_tag LOCUS_05020 217610 221125 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_05020 221269 222087 gene locus_tag LOCUS_05030 221269 222087 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_05030 222646 223455 gene locus_tag LOCUS_05040 222646 223455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 224008 224892 gene locus_tag LOCUS_05050 gene rpsB 224008 224892 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWS3 protein_id gnl|my_center|LOCUS_05050 225000 225926 gene locus_tag LOCUS_05060 gene tsf 225000 225926 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFM2 protein_id gnl|my_center|LOCUS_05060 226119 226844 gene locus_tag LOCUS_05070 gene pyrH 226119 226844 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 protein_id gnl|my_center|LOCUS_05070 226847 227407 gene locus_tag LOCUS_05080 gene frr 226847 227407 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K5 protein_id gnl|my_center|LOCUS_05080 227431 228180 gene locus_tag LOCUS_05090 227431 228180 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU05 protein_id gnl|my_center|LOCUS_05090 228252 228989 gene locus_tag LOCUS_05100 228252 228989 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 protein_id gnl|my_center|LOCUS_05100 229003 230184 gene locus_tag LOCUS_05110 gene dxr 229003 230184 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_05110 230194 231303 gene locus_tag LOCUS_05120 230194 231303 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_05120 231350 233674 gene locus_tag LOCUS_05130 gene bamA 231350 233674 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 protein_id gnl|my_center|LOCUS_05130 233674 234249 gene locus_tag LOCUS_05140 233674 234249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 234397 234861 gene locus_tag LOCUS_05150 gene fabZ 234397 234861 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_05150 234896 235288 gene locus_tag LOCUS_05160 gene gloA 234896 235288 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_05160 236744 235428 gene locus_tag LOCUS_05170 gene gltA 236744 235428 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33915 protein_id gnl|my_center|LOCUS_05170 238321 236903 gene locus_tag LOCUS_05180 gene gltX 238321 236903 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR5 protein_id gnl|my_center|LOCUS_05180 238480 240702 gene locus_tag LOCUS_05190 238480 240702 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence03 206 132 gene locus_tag LOCUS_t00080 206 132 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 393 992 gene locus_tag LOCUS_05200 393 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2629 1040 gene locus_tag LOCUS_05210 gene prfC 2629 1040 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_05210 3194 2850 gene locus_tag LOCUS_05220 3194 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3687 4322 gene locus_tag LOCUS_05230 3687 4322 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976086.1 protein_id gnl|my_center|LOCUS_05230 4863 4315 gene locus_tag LOCUS_05240 4863 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5193 4909 gene locus_tag LOCUS_05250 5193 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6732 5506 gene locus_tag LOCUS_05260 6732 5506 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 protein_id gnl|my_center|LOCUS_05260 6945 7751 gene locus_tag LOCUS_05270 6945 7751 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_05270 9035 8055 gene locus_tag LOCUS_05280 9035 8055 CDS product ArgK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_05280 9483 9055 gene locus_tag LOCUS_05290 9483 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_05290 12172 9506 gene locus_tag LOCUS_05300 12172 9506 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_05300 14301 12247 gene locus_tag LOCUS_05310 gene glyS 14301 12247 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S69 protein_id gnl|my_center|LOCUS_05310 15232 14294 gene locus_tag LOCUS_05320 gene glyQ 15232 14294 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_05320 15639 15352 gene locus_tag LOCUS_05330 15639 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 16606 15725 gene locus_tag LOCUS_05340 gene sohB 16606 15725 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_05340 17411 16641 gene locus_tag LOCUS_05350 17411 16641 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_05350 17683 17483 gene locus_tag LOCUS_05360 17683 17483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 17938 18981 gene locus_tag LOCUS_05370 17938 18981 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_05370 19959 18994 gene locus_tag LOCUS_05380 gene dusC 19959 18994 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD1 protein_id gnl|my_center|LOCUS_05380 20654 19971 gene locus_tag LOCUS_05390 gene rluA 20654 19971 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_05390 22083 20668 gene locus_tag LOCUS_05400 22083 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_05400 23437 22244 gene locus_tag LOCUS_05410 23437 22244 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_05410 23590 24477 gene locus_tag LOCUS_05420 23590 24477 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_05420 24591 25895 gene locus_tag LOCUS_05430 gene dinB 24591 25895 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ46 protein_id gnl|my_center|LOCUS_05430 26046 27077 gene locus_tag LOCUS_05440 gene nadA 26046 27077 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_05440 27085 27948 gene locus_tag LOCUS_05450 27085 27948 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_05450 29078 27930 gene locus_tag LOCUS_05460 29078 27930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 30189 29086 gene locus_tag LOCUS_05470 30189 29086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 protein_id gnl|my_center|LOCUS_05470 30167 30334 gene locus_tag LOCUS_05480 30167 30334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 30402 31289 gene locus_tag LOCUS_05490 30402 31289 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_05490 33014 31431 gene locus_tag LOCUS_05500 33014 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 33183 33055 gene locus_tag LOCUS_05510 33183 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 33274 33975 gene locus_tag LOCUS_05520 33274 33975 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926969.1 protein_id gnl|my_center|LOCUS_05520 34612 34127 gene locus_tag LOCUS_05530 34612 34127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_05530 34776 34627 gene locus_tag LOCUS_05540 34776 34627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 34976 35830 gene locus_tag LOCUS_05550 34976 35830 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389512.1 protein_id gnl|my_center|LOCUS_05550 37210 35858 gene locus_tag LOCUS_05560 gene trmFO 37210 35858 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_05560 38915 37737 gene locus_tag LOCUS_05570 38915 37737 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_05570 39037 39513 gene locus_tag LOCUS_05580 gene def 39037 39513 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ4 protein_id gnl|my_center|LOCUS_05580 39533 40465 gene locus_tag LOCUS_05590 gene fmt 39533 40465 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH6 protein_id gnl|my_center|LOCUS_05590 40462 41220 gene locus_tag LOCUS_05600 gene truA 40462 41220 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ8 protein_id gnl|my_center|LOCUS_05600 41906 41295 gene locus_tag LOCUS_05610 41906 41295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 43096 41939 gene locus_tag LOCUS_05620 gene dapE 43096 41939 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM1 protein_id gnl|my_center|LOCUS_05620 43957 43100 gene locus_tag LOCUS_05630 gene dapD 43957 43100 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_05630 44800 44060 gene locus_tag LOCUS_05640 44800 44060 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_05640 44983 46806 gene locus_tag LOCUS_05650 44983 46806 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_05650 46803 48056 gene locus_tag LOCUS_05660 46803 48056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 49098 48181 gene locus_tag LOCUS_05670 gene argB 49098 48181 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_05670 49819 49169 gene locus_tag LOCUS_05680 gene engB 49819 49169 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_05680 51628 49880 gene locus_tag LOCUS_05690 gene yidC 51628 49880 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_05690 51993 51721 gene locus_tag LOCUS_05700 51993 51721 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F4W4 protein_id gnl|my_center|LOCUS_05700 52469 51990 gene locus_tag LOCUS_05710 52469 51990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 52984 53745 gene locus_tag LOCUS_05720 52984 53745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 53742 55196 gene locus_tag LOCUS_05730 gene merA1 53742 55196 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_05730 55202 56611 gene locus_tag LOCUS_05740 55202 56611 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974298.1 protein_id gnl|my_center|LOCUS_05740 57331 56690 gene locus_tag LOCUS_05750 57331 56690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 57548 57624 gene locus_tag LOCUS_t00090 57548 57624 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58991 57762 gene locus_tag LOCUS_05760 58991 57762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_05760 59492 59040 gene locus_tag LOCUS_05770 59492 59040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 60178 59495 gene locus_tag LOCUS_05780 gene narV 60178 59495 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617139.1 protein_id gnl|my_center|LOCUS_05780 60883 60188 gene locus_tag LOCUS_05790 gene narJ 60883 60188 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_05790 62436 60883 gene locus_tag LOCUS_05800 gene narH 62436 60883 CDS product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_05800 66206 62448 gene locus_tag LOCUS_05810 gene narG 66206 62448 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 protein_id gnl|my_center|LOCUS_05810 67874 66231 gene locus_tag LOCUS_05820 67874 66231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 69327 67915 gene locus_tag LOCUS_05830 69327 67915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_05830 69493 71160 gene locus_tag LOCUS_05840 69493 71160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 71342 72319 gene locus_tag LOCUS_05850 gene moaA 71342 72319 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 protein_id gnl|my_center|LOCUS_05850 72392 73660 gene locus_tag LOCUS_05860 gene moeA 72392 73660 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397358.1 protein_id gnl|my_center|LOCUS_05860 74587 73769 gene locus_tag LOCUS_05870 74587 73769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 76102 74612 gene locus_tag LOCUS_05880 76102 74612 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709512.1 protein_id gnl|my_center|LOCUS_05880 77301 76111 gene locus_tag LOCUS_05890 77301 76111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 78863 77346 gene locus_tag LOCUS_05900 78863 77346 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 protein_id gnl|my_center|LOCUS_05900 79752 78892 gene locus_tag LOCUS_05910 79752 78892 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_05910 80685 79918 gene locus_tag LOCUS_05920 80685 79918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 81986 80682 gene locus_tag LOCUS_05930 81986 80682 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_05930 84425 82116 gene locus_tag LOCUS_05940 84425 82116 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_05940 84370 84519 gene locus_tag LOCUS_05950 84370 84519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 84808 85422 gene locus_tag LOCUS_05960 84808 85422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 87816 85549 gene locus_tag LOCUS_05970 87816 85549 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_05970 88101 88667 gene locus_tag LOCUS_05980 88101 88667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 88978 91242 gene locus_tag LOCUS_05990 88978 91242 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_05990 92298 91288 gene locus_tag LOCUS_06000 92298 91288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390397.1 protein_id gnl|my_center|LOCUS_06000 92495 93259 gene locus_tag LOCUS_06010 92495 93259 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_06010 93515 94726 gene locus_tag LOCUS_06020 93515 94726 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_06020 95502 94732 gene locus_tag LOCUS_06030 95502 94732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 97358 95499 gene locus_tag LOCUS_06040 gene copA 97358 95499 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_06040 97918 97466 gene locus_tag LOCUS_06050 97918 97466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 99754 98171 gene locus_tag LOCUS_06060 99754 98171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 100005 101138 gene locus_tag LOCUS_06070 100005 101138 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390873.1 protein_id gnl|my_center|LOCUS_06070 102394 101150 gene locus_tag LOCUS_06080 102394 101150 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942493.1 protein_id gnl|my_center|LOCUS_06080 103655 102453 gene locus_tag LOCUS_06090 103655 102453 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_06090 106526 103758 gene locus_tag LOCUS_06100 106526 103758 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_06100 107954 106596 gene locus_tag LOCUS_06110 107954 106596 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_06110 110069 107964 gene locus_tag LOCUS_06120 110069 107964 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_06120 111463 110075 gene locus_tag LOCUS_06130 111463 110075 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_06130 112155 112916 gene locus_tag LOCUS_06140 112155 112916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 115066 113039 gene locus_tag LOCUS_06150 115066 113039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 117907 115082 gene locus_tag LOCUS_06160 117907 115082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 118837 118034 gene locus_tag LOCUS_06170 118837 118034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 119163 119864 gene locus_tag LOCUS_06180 119163 119864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 120500 119901 gene locus_tag LOCUS_06190 120500 119901 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971937.1 protein_id gnl|my_center|LOCUS_06190 121338 120490 gene locus_tag LOCUS_06200 121338 120490 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 protein_id gnl|my_center|LOCUS_06200 121545 122975 gene locus_tag LOCUS_06210 121545 122975 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_06210 123170 125536 gene locus_tag LOCUS_06220 123170 125536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 125581 127359 gene locus_tag LOCUS_06230 125581 127359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 127435 129066 gene locus_tag LOCUS_06240 gene nfrB 127435 129066 CDS product bacteriophage N4 adsorption protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266778.1 protein_id gnl|my_center|LOCUS_06240 129393 129253 gene locus_tag LOCUS_06250 129393 129253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 129356 130507 gene locus_tag LOCUS_06260 129356 130507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 133232 130575 gene locus_tag LOCUS_06270 gene pepN 133232 130575 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 protein_id gnl|my_center|LOCUS_06270 134421 133288 gene locus_tag LOCUS_06280 134421 133288 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 protein_id gnl|my_center|LOCUS_06280 135975 134551 gene locus_tag LOCUS_06290 135975 134551 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_06290 136434 136075 gene locus_tag LOCUS_06300 136434 136075 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 protein_id gnl|my_center|LOCUS_06300 136620 137480 gene locus_tag LOCUS_06310 136620 137480 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640054.1 protein_id gnl|my_center|LOCUS_06310 138826 137537 gene locus_tag LOCUS_06320 gene capL 138826 137537 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_06320 141361 138992 gene locus_tag LOCUS_06330 141361 138992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 144348 141502 gene locus_tag LOCUS_06340 144348 141502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 145415 144510 gene locus_tag LOCUS_06350 gene ispE 145415 144510 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS7 protein_id gnl|my_center|LOCUS_06350 147120 145396 gene locus_tag LOCUS_06360 147120 145396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_06360 148800 147130 gene locus_tag LOCUS_06370 148800 147130 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_06370 149092 150015 gene locus_tag LOCUS_06380 149092 150015 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_06380 150012 151997 gene locus_tag LOCUS_06390 150012 151997 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_06390 151984 152505 gene locus_tag LOCUS_06400 151984 152505 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_06400 153126 152521 gene locus_tag LOCUS_06410 153126 152521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124719.1 protein_id gnl|my_center|LOCUS_06410 153785 153123 gene locus_tag LOCUS_06420 153785 153123 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_06420 153898 155013 gene locus_tag LOCUS_06430 153898 155013 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_06430 155103 155753 gene locus_tag LOCUS_06440 gene rnhB 155103 155753 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H3 protein_id gnl|my_center|LOCUS_06440 155809 156987 gene locus_tag LOCUS_06450 155809 156987 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_06450 157287 159074 gene locus_tag LOCUS_06460 157287 159074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 159145 160479 gene locus_tag LOCUS_06470 gene amaA 159145 160479 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_06470 160490 160918 gene locus_tag LOCUS_06480 160490 160918 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_06480 160921 161844 gene locus_tag LOCUS_06490 160921 161844 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_06490 162045 162608 gene locus_tag LOCUS_06500 gene efp 162045 162608 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1B4 protein_id gnl|my_center|LOCUS_06500 162658 163476 gene locus_tag LOCUS_06510 162658 163476 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_06510 163537 163989 gene locus_tag LOCUS_06520 163537 163989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 164145 165407 gene locus_tag LOCUS_06530 164145 165407 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 protein_id gnl|my_center|LOCUS_06530 165407 166492 gene locus_tag LOCUS_06540 165407 166492 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_06540 167148 166564 gene locus_tag LOCUS_06550 167148 166564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 169150 167342 gene locus_tag LOCUS_06560 169150 167342 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_06560 169341 169565 gene locus_tag LOCUS_06570 gene rpmE 169341 169565 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 protein_id gnl|my_center|LOCUS_06570 170133 169651 gene locus_tag LOCUS_06580 170133 169651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 170444 170908 gene locus_tag LOCUS_06590 170444 170908 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_06590 171242 171048 gene locus_tag LOCUS_06600 171242 171048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 171352 172353 gene locus_tag LOCUS_06610 171352 172353 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_06610 174733 172577 gene locus_tag LOCUS_06620 174733 172577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 176667 175003 gene locus_tag LOCUS_06630 176667 175003 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 protein_id gnl|my_center|LOCUS_06630 177187 177816 gene locus_tag LOCUS_06640 177187 177816 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921152.1 protein_id gnl|my_center|LOCUS_06640 179328 177895 gene locus_tag LOCUS_06650 179328 177895 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7A4 protein_id gnl|my_center|LOCUS_06650 179666 180487 gene locus_tag LOCUS_06660 179666 180487 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709339.1 protein_id gnl|my_center|LOCUS_06660 180567 180872 gene locus_tag LOCUS_06670 180567 180872 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089871.1 protein_id gnl|my_center|LOCUS_06670 180981 181235 gene locus_tag LOCUS_06680 180981 181235 CDS product UPF0335 protein R02793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M59 protein_id gnl|my_center|LOCUS_06680 181530 181300 gene locus_tag LOCUS_06690 181530 181300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 183175 181655 gene locus_tag LOCUS_06700 gene tacA 183175 181655 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_06700 183382 185109 gene locus_tag LOCUS_06710 183382 185109 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529736.1 protein_id gnl|my_center|LOCUS_06710 185660 186841 gene locus_tag LOCUS_06720 gene pntAA 185660 186841 CDS product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 protein_id gnl|my_center|LOCUS_06720 186841 187206 gene locus_tag LOCUS_06730 186841 187206 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066973.1 protein_id gnl|my_center|LOCUS_06730 187222 188640 gene locus_tag LOCUS_06740 gene pntB 187222 188640 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 protein_id gnl|my_center|LOCUS_06740 189331 188858 gene locus_tag LOCUS_06750 189331 188858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 189764 189480 gene locus_tag LOCUS_06760 189764 189480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 190031 189777 gene locus_tag LOCUS_06770 190031 189777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 190285 191181 gene locus_tag LOCUS_06780 190285 191181 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_06780 191270 192268 gene locus_tag LOCUS_06790 191270 192268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_06790 192319 193179 gene locus_tag LOCUS_06800 192319 193179 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_06800 193281 194045 gene locus_tag LOCUS_06810 193281 194045 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_06810 194423 194124 gene locus_tag LOCUS_06820 194423 194124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 195175 194420 gene locus_tag LOCUS_06830 gene cobB 195175 194420 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN56 protein_id gnl|my_center|LOCUS_06830 195328 195819 gene locus_tag LOCUS_06840 gene ptpA 195328 195819 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_06840 196006 196749 gene locus_tag LOCUS_06850 196006 196749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_06850 197054 197130 gene locus_tag LOCUS_t00100 197054 197130 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 197882 201001 gene locus_tag LOCUS_06860 gene cas9 197882 201001 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX87 protein_id gnl|my_center|LOCUS_06860 201003 201911 gene locus_tag LOCUS_06870 gene cas1 201003 201911 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_06870 201916 202245 gene locus_tag LOCUS_06880 gene cas2 201916 202245 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_06880 202318 >202486 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcatagcatttcagaaattgaggtccagctgcaac >Feature sequence04 875 189 gene locus_tag LOCUS_06890 875 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3406 1109 gene locus_tag LOCUS_06900 3406 1109 CDS product malic protein NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_06900 3685 6540 gene locus_tag LOCUS_06910 gene mutS 3685 6540 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_06910 6533 9340 gene locus_tag LOCUS_06920 gene glnD 6533 9340 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_06920 9361 10914 gene locus_tag LOCUS_06930 9361 10914 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_06930 11064 12074 gene locus_tag LOCUS_06940 gene trpS 11064 12074 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_06940 12159 12782 gene locus_tag LOCUS_06950 12159 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039537.1 protein_id gnl|my_center|LOCUS_06950 12870 13835 gene locus_tag LOCUS_06960 12870 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391281.1 protein_id gnl|my_center|LOCUS_06960 13956 14447 gene locus_tag LOCUS_06970 13956 14447 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 protein_id gnl|my_center|LOCUS_06970 14541 15095 gene locus_tag LOCUS_06980 14541 15095 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_06980 16199 15111 gene locus_tag LOCUS_06990 16199 15111 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_06990 16461 17057 gene locus_tag LOCUS_07000 16461 17057 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCJ9 protein_id gnl|my_center|LOCUS_07000 17082 17801 gene locus_tag LOCUS_07010 17082 17801 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_07010 17806 18273 gene locus_tag LOCUS_07020 17806 18273 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_07020 18421 18831 gene locus_tag LOCUS_07030 18421 18831 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_07030 18924 19748 gene locus_tag LOCUS_07040 18924 19748 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_07040 19868 21259 gene locus_tag LOCUS_07050 gene miaB 19868 21259 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 protein_id gnl|my_center|LOCUS_07050 21276 22334 gene locus_tag LOCUS_07060 21276 22334 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_07060 22337 22894 gene locus_tag LOCUS_07070 gene ybeY 22337 22894 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID9 protein_id gnl|my_center|LOCUS_07070 22928 23893 gene locus_tag LOCUS_07080 22928 23893 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_07080 23883 25520 gene locus_tag LOCUS_07090 gene lnt 23883 25520 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 protein_id gnl|my_center|LOCUS_07090 25629 26051 gene locus_tag LOCUS_07100 25629 26051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 26258 27328 gene locus_tag LOCUS_07110 gene pyrD 26258 27328 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_07110 27953 27474 gene locus_tag LOCUS_07120 gene bfrB 27953 27474 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_07120 28336 28088 gene locus_tag LOCUS_07130 28336 28088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 28570 28917 gene locus_tag LOCUS_07140 gene yfgD 28570 28917 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCJ8 protein_id gnl|my_center|LOCUS_07140 30464 29043 gene locus_tag LOCUS_07150 gene dinF 30464 29043 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 protein_id gnl|my_center|LOCUS_07150 30833 32707 gene locus_tag LOCUS_07160 gene korA 30833 32707 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_07160 32704 33720 gene locus_tag LOCUS_07170 32704 33720 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_07170 33972 34571 gene locus_tag LOCUS_07180 33972 34571 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMV6 protein_id gnl|my_center|LOCUS_07180 34568 34915 gene locus_tag LOCUS_07190 34568 34915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 34912 35415 gene locus_tag LOCUS_07200 34912 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 36068 35562 gene locus_tag LOCUS_07210 36068 35562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 36176 37105 gene locus_tag LOCUS_07220 36176 37105 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529199.1 protein_id gnl|my_center|LOCUS_07220 39288 37048 gene locus_tag LOCUS_07230 39288 37048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 41732 39555 gene locus_tag LOCUS_07240 41732 39555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 41846 43048 gene locus_tag LOCUS_07250 gene aatA 41846 43048 CDS product aspartate aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02635 protein_id gnl|my_center|LOCUS_07250 43771 43076 gene locus_tag LOCUS_07260 43771 43076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 protein_id gnl|my_center|LOCUS_07260 44416 43916 gene locus_tag LOCUS_07270 44416 43916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 44762 45229 gene locus_tag LOCUS_07280 44762 45229 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_07280 45317 45958 gene locus_tag LOCUS_07290 45317 45958 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 protein_id gnl|my_center|LOCUS_07290 46226 46041 gene locus_tag LOCUS_07300 46226 46041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 47324 46440 gene locus_tag LOCUS_07310 47324 46440 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_07310 48082 47477 gene locus_tag LOCUS_07320 gene tsaA 48082 47477 CDS product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_07320 48482 50134 gene locus_tag LOCUS_07330 48482 50134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 50319 51272 gene locus_tag LOCUS_07340 50319 51272 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 protein_id gnl|my_center|LOCUS_07340 51426 52196 gene locus_tag LOCUS_07350 51426 52196 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388807.1 protein_id gnl|my_center|LOCUS_07350 52348 52707 gene locus_tag LOCUS_07360 52348 52707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 53555 52737 gene locus_tag LOCUS_07370 53555 52737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 54850 54002 gene locus_tag LOCUS_07380 54850 54002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087743.1 protein_id gnl|my_center|LOCUS_07380 55861 54863 gene locus_tag LOCUS_07390 55861 54863 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_07390 56053 56127 gene locus_tag LOCUS_t00110 56053 56127 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56443 59169 gene locus_tag LOCUS_07400 gene acoK 56443 59169 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 protein_id gnl|my_center|LOCUS_07400 59356 61524 gene locus_tag LOCUS_07410 59356 61524 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265751.1 protein_id gnl|my_center|LOCUS_07410 61648 63735 gene locus_tag LOCUS_07420 61648 63735 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538146.1 protein_id gnl|my_center|LOCUS_07420 63739 65412 gene locus_tag LOCUS_07430 63739 65412 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_07430 65419 67092 gene locus_tag LOCUS_07440 65419 67092 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_07440 67089 68408 gene locus_tag LOCUS_07450 67089 68408 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227356.1 protein_id gnl|my_center|LOCUS_07450 68415 70112 gene locus_tag LOCUS_07460 gene huyB 68415 70112 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538145.1 protein_id gnl|my_center|LOCUS_07460 70109 71491 gene locus_tag LOCUS_07470 70109 71491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_07470 71556 71936 gene locus_tag LOCUS_07480 71556 71936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 72086 73057 gene locus_tag LOCUS_07490 72086 73057 CDS product FeaR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105262.1 protein_id gnl|my_center|LOCUS_07490 73210 75483 gene locus_tag LOCUS_07500 gene fyuA 73210 75483 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_07500 75576 77186 gene locus_tag LOCUS_07510 75576 77186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 77230 77547 gene locus_tag LOCUS_07520 77230 77547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 77594 78646 gene locus_tag LOCUS_07530 77594 78646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 79780 78809 gene locus_tag LOCUS_07540 79780 78809 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920948.1 protein_id gnl|my_center|LOCUS_07540 79895 80848 gene locus_tag LOCUS_07550 79895 80848 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084145.1 protein_id gnl|my_center|LOCUS_07550 80899 82626 gene locus_tag LOCUS_07560 80899 82626 CDS product AMP-dependent acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 protein_id gnl|my_center|LOCUS_07560 82619 83227 gene locus_tag LOCUS_07570 82619 83227 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_07570 83224 84456 gene locus_tag LOCUS_07580 83224 84456 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 protein_id gnl|my_center|LOCUS_07580 84462 85664 gene locus_tag LOCUS_07590 gene fadA 84462 85664 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_07590 87045 85711 gene locus_tag LOCUS_07600 87045 85711 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 protein_id gnl|my_center|LOCUS_07600 87683 87156 gene locus_tag LOCUS_07610 87683 87156 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391211.1 protein_id gnl|my_center|LOCUS_07610 88849 91506 gene locus_tag LOCUS_07620 88849 91506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 92345 91662 gene locus_tag LOCUS_07630 92345 91662 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040661.1 protein_id gnl|my_center|LOCUS_07630 92782 94248 gene locus_tag LOCUS_07640 92782 94248 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814912.1 protein_id gnl|my_center|LOCUS_07640 94395 95888 gene locus_tag LOCUS_07650 94395 95888 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809852.1 protein_id gnl|my_center|LOCUS_07650 96083 96823 gene locus_tag LOCUS_07660 96083 96823 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727683.1 protein_id gnl|my_center|LOCUS_07660 97036 97404 gene locus_tag LOCUS_07670 97036 97404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892846.1 protein_id gnl|my_center|LOCUS_07670 97466 97942 gene locus_tag LOCUS_07680 97466 97942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_07680 98137 98688 gene locus_tag LOCUS_07690 98137 98688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 99192 98767 gene locus_tag LOCUS_07700 99192 98767 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709595.1 protein_id gnl|my_center|LOCUS_07700 99452 100054 gene locus_tag LOCUS_07710 99452 100054 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_07710 100120 101544 gene locus_tag LOCUS_07720 100120 101544 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_07720 101659 104550 gene locus_tag LOCUS_07730 101659 104550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 106233 104779 gene locus_tag LOCUS_07740 gene davD 106233 104779 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_07740 107931 106330 gene locus_tag LOCUS_07750 107931 106330 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_07750 109761 108091 gene locus_tag LOCUS_07760 109761 108091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_07760 110191 111096 gene locus_tag LOCUS_07770 gene rimK 110191 111096 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_07770 111093 112139 gene locus_tag LOCUS_07780 111093 112139 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_07780 113241 112216 gene locus_tag LOCUS_07790 113241 112216 CDS product methyltransferase/methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_07790 113638 113318 gene locus_tag LOCUS_07800 113638 113318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 113607 115391 gene locus_tag LOCUS_07810 113607 115391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037549.1 protein_id gnl|my_center|LOCUS_07810 116350 115373 gene locus_tag LOCUS_07820 116350 115373 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_07820 117418 116372 gene locus_tag LOCUS_07830 117418 116372 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528049.1 protein_id gnl|my_center|LOCUS_07830 118738 117479 gene locus_tag LOCUS_07840 118738 117479 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 protein_id gnl|my_center|LOCUS_07840 118995 119903 gene locus_tag LOCUS_07850 118995 119903 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454899.1 protein_id gnl|my_center|LOCUS_07850 119969 120970 gene locus_tag LOCUS_07860 119969 120970 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 protein_id gnl|my_center|LOCUS_07860 121061 122503 gene locus_tag LOCUS_07870 121061 122503 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528145.1 protein_id gnl|my_center|LOCUS_07870 122549 123217 gene locus_tag LOCUS_07880 gene hypR 122549 123217 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 protein_id gnl|my_center|LOCUS_07880 123295 123507 gene locus_tag LOCUS_07890 123295 123507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 123719 123976 gene locus_tag LOCUS_07900 123719 123976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 123951 124199 gene locus_tag LOCUS_07910 123951 124199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_07910 125187 124699 gene locus_tag LOCUS_07920 125187 124699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 125912 125475 gene locus_tag LOCUS_07930 gene nsrR 125912 125475 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_07930 129242 126102 gene locus_tag LOCUS_07940 129242 126102 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_07940 130680 129235 gene locus_tag LOCUS_07950 130680 129235 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_07950 131926 130673 gene locus_tag LOCUS_07960 131926 130673 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 protein_id gnl|my_center|LOCUS_07960 132276 132022 gene locus_tag LOCUS_07970 132276 132022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 132827 133246 gene locus_tag LOCUS_07980 132827 133246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 133342 133668 gene locus_tag LOCUS_07990 133342 133668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 133665 134111 gene locus_tag LOCUS_08000 133665 134111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 134116 134664 gene locus_tag LOCUS_08010 134116 134664 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_08010 134828 135181 gene locus_tag LOCUS_08020 134828 135181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 135387 135611 gene locus_tag LOCUS_08030 135387 135611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 135807 137075 gene locus_tag LOCUS_08040 135807 137075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 137096 137389 gene locus_tag LOCUS_08050 137096 137389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 137386 137745 gene locus_tag LOCUS_08060 137386 137745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 137921 138487 gene locus_tag LOCUS_08070 137921 138487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 protein_id gnl|my_center|LOCUS_08070 138559 139092 gene locus_tag LOCUS_08080 gene petA 138559 139092 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDQ5 protein_id gnl|my_center|LOCUS_08080 140524 139175 gene locus_tag LOCUS_08090 140524 139175 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_08090 143076 140644 gene locus_tag LOCUS_08100 143076 140644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 145971 143263 gene locus_tag LOCUS_08110 145971 143263 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 protein_id gnl|my_center|LOCUS_08110 146574 146110 gene locus_tag LOCUS_08120 146574 146110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 147169 149136 gene locus_tag LOCUS_08130 147169 149136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 149297 149106 gene locus_tag LOCUS_08140 149297 149106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 149484 150362 gene locus_tag LOCUS_08150 149484 150362 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 protein_id gnl|my_center|LOCUS_08150 150487 152856 gene locus_tag LOCUS_08160 150487 152856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_08160 152929 154527 gene locus_tag LOCUS_08170 152929 154527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 154524 156398 gene locus_tag LOCUS_08180 154524 156398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 156551 156736 gene locus_tag LOCUS_08190 156551 156736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 156733 157974 gene locus_tag LOCUS_08200 156733 157974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 158089 159507 gene locus_tag LOCUS_08210 158089 159507 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_08210 159663 159914 gene locus_tag LOCUS_08220 159663 159914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 159911 160288 gene locus_tag LOCUS_08230 159911 160288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_08230 160595 161878 gene locus_tag LOCUS_08240 gene gabT 160595 161878 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence05 820 158 gene locus_tag LOCUS_08250 820 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 933 1730 gene locus_tag LOCUS_08260 933 1730 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709035.1 protein_id gnl|my_center|LOCUS_08260 2408 1782 gene locus_tag LOCUS_08270 2408 1782 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_08270 2554 2952 gene locus_tag LOCUS_08280 2554 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3360 2932 gene locus_tag LOCUS_08290 3360 2932 CDS product Mov34/MPN/PAD-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388868.1 protein_id gnl|my_center|LOCUS_08290 3763 3368 gene locus_tag LOCUS_08300 3763 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3762 4817 gene locus_tag LOCUS_08310 gene rluD 3762 4817 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MA7 protein_id gnl|my_center|LOCUS_08310 4952 5854 gene locus_tag LOCUS_08320 gene rpoH 4952 5854 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 protein_id gnl|my_center|LOCUS_08320 6119 7921 gene locus_tag LOCUS_08330 6119 7921 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 protein_id gnl|my_center|LOCUS_08330 8116 9654 gene locus_tag LOCUS_08340 8116 9654 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_08340 9780 11330 gene locus_tag LOCUS_08350 9780 11330 CDS product feruloyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226485.1 protein_id gnl|my_center|LOCUS_08350 11384 13675 gene locus_tag LOCUS_08360 gene fyuA 11384 13675 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_08360 13736 14176 gene locus_tag LOCUS_08370 13736 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 14186 15865 gene locus_tag LOCUS_08380 14186 15865 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 protein_id gnl|my_center|LOCUS_08380 15855 16619 gene locus_tag LOCUS_08390 15855 16619 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_08390 16632 17834 gene locus_tag LOCUS_08400 gene caiA 16632 17834 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_08400 18577 17888 gene locus_tag LOCUS_08410 18577 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 18746 21061 gene locus_tag LOCUS_08420 18746 21061 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_08420 21547 21200 gene locus_tag LOCUS_08430 21547 21200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 21431 22723 gene locus_tag LOCUS_08440 21431 22723 CDS product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08440 22716 23651 gene locus_tag LOCUS_08450 22716 23651 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_08450 23629 24156 gene locus_tag LOCUS_08460 23629 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 24149 24574 gene locus_tag LOCUS_08470 24149 24574 CDS product MaoC-like dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702791.1 protein_id gnl|my_center|LOCUS_08470 25493 24678 gene locus_tag LOCUS_08480 25493 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 26490 25600 gene locus_tag LOCUS_08490 26490 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 27176 27385 gene locus_tag LOCUS_08500 gene cspA 27176 27385 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309931.1 protein_id gnl|my_center|LOCUS_08500 27635 28780 gene locus_tag LOCUS_08510 27635 28780 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_08510 28912 28825 gene locus_tag LOCUS_t00120 28912 28825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29260 31455 gene locus_tag LOCUS_08520 29260 31455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 31610 31804 gene locus_tag LOCUS_08530 31610 31804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 33264 31843 gene locus_tag LOCUS_08540 33264 31843 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_08540 33736 33407 gene locus_tag LOCUS_08550 33736 33407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_08550 33999 34745 gene locus_tag LOCUS_08560 gene purC 33999 34745 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI0 protein_id gnl|my_center|LOCUS_08560 34791 35030 gene locus_tag LOCUS_08570 gene purS 34791 35030 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_08570 35126 35815 gene locus_tag LOCUS_08580 gene purQ 35126 35815 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L4 protein_id gnl|my_center|LOCUS_08580 35826 38036 gene locus_tag LOCUS_08590 gene purL 35826 38036 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 protein_id gnl|my_center|LOCUS_08590 38068 38298 gene locus_tag LOCUS_08600 38068 38298 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_08600 38346 38678 gene locus_tag LOCUS_08610 38346 38678 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI6 protein_id gnl|my_center|LOCUS_08610 39066 39785 gene locus_tag LOCUS_08620 39066 39785 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188690.1 protein_id gnl|my_center|LOCUS_08620 39953 40576 gene locus_tag LOCUS_08630 39953 40576 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFK3 protein_id gnl|my_center|LOCUS_08630 40579 40788 gene locus_tag LOCUS_08640 40579 40788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 41023 41631 gene locus_tag LOCUS_08650 41023 41631 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918102.1 protein_id gnl|my_center|LOCUS_08650 41628 42470 gene locus_tag LOCUS_08660 41628 42470 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 protein_id gnl|my_center|LOCUS_08660 43283 42450 gene locus_tag LOCUS_08670 43283 42450 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930668.1 protein_id gnl|my_center|LOCUS_08670 44686 43280 gene locus_tag LOCUS_08680 gene hflx 44686 43280 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ1 protein_id gnl|my_center|LOCUS_08680 44946 44698 gene locus_tag LOCUS_08690 gene hfq 44946 44698 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ2 protein_id gnl|my_center|LOCUS_08690 46573 45095 gene locus_tag LOCUS_08700 46573 45095 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPF4 protein_id gnl|my_center|LOCUS_08700 47952 46576 gene locus_tag LOCUS_08710 gene trkA 47952 46576 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_08710 49381 48011 gene locus_tag LOCUS_08720 49381 48011 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975267.1 protein_id gnl|my_center|LOCUS_08720 51656 49371 gene locus_tag LOCUS_08730 51656 49371 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_08730 53166 51715 gene locus_tag LOCUS_08740 53166 51715 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_08740 54288 53188 gene locus_tag LOCUS_08750 gene ntrB 54288 53188 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_08750 55250 54288 gene locus_tag LOCUS_08760 gene dus 55250 54288 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_08760 55471 56634 gene locus_tag LOCUS_08770 gene ispDF 55471 56634 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS1 protein_id gnl|my_center|LOCUS_08770 56631 57119 gene locus_tag LOCUS_08780 56631 57119 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389622.1 protein_id gnl|my_center|LOCUS_08780 57112 57603 gene locus_tag LOCUS_08790 57112 57603 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 protein_id gnl|my_center|LOCUS_08790 57769 58395 gene locus_tag LOCUS_08800 57769 58395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 58927 58490 gene locus_tag LOCUS_08810 58927 58490 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_08810 59954 58944 gene locus_tag LOCUS_08820 gene lipA 59954 58944 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFG1 protein_id gnl|my_center|LOCUS_08820 61408 59987 gene locus_tag LOCUS_08830 61408 59987 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 protein_id gnl|my_center|LOCUS_08830 62710 61421 gene locus_tag LOCUS_08840 62710 61421 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT66 protein_id gnl|my_center|LOCUS_08840 64174 62729 gene locus_tag LOCUS_08850 gene pdhAb 64174 62729 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337522.1 protein_id gnl|my_center|LOCUS_08850 65243 64200 gene locus_tag LOCUS_08860 gene pdhA 65243 64200 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 protein_id gnl|my_center|LOCUS_08860 65784 65473 gene locus_tag LOCUS_08870 65784 65473 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531480.1 protein_id gnl|my_center|LOCUS_08870 67190 65919 gene locus_tag LOCUS_08880 gene eno 67190 65919 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 protein_id gnl|my_center|LOCUS_08880 68862 67228 gene locus_tag LOCUS_08890 gene pyrG 68862 67228 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X3 protein_id gnl|my_center|LOCUS_08890 69357 69037 gene locus_tag LOCUS_08900 69357 69037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 70214 69462 gene locus_tag LOCUS_08910 gene tpiA 70214 69462 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_08910 70637 72550 gene locus_tag LOCUS_08920 gene ppiD 70637 72550 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969377.1 protein_id gnl|my_center|LOCUS_08920 72618 74147 gene locus_tag LOCUS_08930 72618 74147 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_08930 75341 74181 gene locus_tag LOCUS_08940 75341 74181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 75524 77494 gene locus_tag LOCUS_08950 gene parE 75524 77494 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD54 protein_id gnl|my_center|LOCUS_08950 77614 78921 gene locus_tag LOCUS_08960 77614 78921 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708071.1 protein_id gnl|my_center|LOCUS_08960 79099 80178 gene locus_tag LOCUS_08970 79099 80178 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_08970 80797 80438 gene locus_tag LOCUS_08980 80797 80438 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919000.1 protein_id gnl|my_center|LOCUS_08980 82315 80852 gene locus_tag LOCUS_08990 82315 80852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 82446 82640 gene locus_tag LOCUS_09000 82446 82640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 84484 82805 gene locus_tag LOCUS_09010 gene aspS 84484 82805 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 protein_id gnl|my_center|LOCUS_09010 84713 85876 gene locus_tag LOCUS_09020 gene rnd 84713 85876 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_09020 87370 85901 gene locus_tag LOCUS_09030 87370 85901 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_09030 89537 87378 gene locus_tag LOCUS_09040 gene ppk 89537 87378 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 protein_id gnl|my_center|LOCUS_09040 90293 89613 gene locus_tag LOCUS_09050 90293 89613 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_09050 91414 90290 gene locus_tag LOCUS_09060 91414 90290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 91740 92858 gene locus_tag LOCUS_09070 gene purM 91740 92858 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC8 protein_id gnl|my_center|LOCUS_09070 92818 93546 gene locus_tag LOCUS_09080 gene purN 92818 93546 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 protein_id gnl|my_center|LOCUS_09080 94129 93707 gene locus_tag LOCUS_09090 gene ndk 94129 93707 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7K1 protein_id gnl|my_center|LOCUS_09090 94266 96149 gene locus_tag LOCUS_09100 94266 96149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969079.1 protein_id gnl|my_center|LOCUS_09100 96602 96153 gene locus_tag LOCUS_09110 96602 96153 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_09110 98130 96640 gene locus_tag LOCUS_09120 gene pepA 98130 96640 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_09120 98319 100517 gene locus_tag LOCUS_09130 gene lptD 98319 100517 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 protein_id gnl|my_center|LOCUS_09130 100594 101898 gene locus_tag LOCUS_09140 100594 101898 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA7 protein_id gnl|my_center|LOCUS_09140 101948 102940 gene locus_tag LOCUS_09150 gene pdxA 101948 102940 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGD4 protein_id gnl|my_center|LOCUS_09150 102937 103797 gene locus_tag LOCUS_09160 gene rsmA 102937 103797 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MU0 protein_id gnl|my_center|LOCUS_09160 104506 103874 gene locus_tag LOCUS_09170 gene gmk 104506 103874 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_09170 105385 104513 gene locus_tag LOCUS_09180 105385 104513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 protein_id gnl|my_center|LOCUS_09180 105482 106246 gene locus_tag LOCUS_09190 105482 106246 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_09190 106666 106364 gene locus_tag LOCUS_09200 106666 106364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 107793 106807 gene locus_tag LOCUS_09210 107793 106807 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532514.1 protein_id gnl|my_center|LOCUS_09210 109062 107800 gene locus_tag LOCUS_09220 gene fabF 109062 107800 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 protein_id gnl|my_center|LOCUS_09220 109430 109197 gene locus_tag LOCUS_09230 gene acpP 109430 109197 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_09230 110434 109697 gene locus_tag LOCUS_09240 gene fabG 110434 109697 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_09240 111418 110468 gene locus_tag LOCUS_09250 111418 110468 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_09250 111760 112107 gene locus_tag LOCUS_09260 111760 112107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 112128 112391 gene locus_tag LOCUS_09270 gene rpsR 112128 112391 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVN5 protein_id gnl|my_center|LOCUS_09270 112403 113047 gene locus_tag LOCUS_09280 gene rplI 112403 113047 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L9 protein_id gnl|my_center|LOCUS_09280 113151 114680 gene locus_tag LOCUS_09290 113151 114680 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 protein_id gnl|my_center|LOCUS_09290 114680 115816 gene locus_tag LOCUS_09300 gene alr 114680 115816 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD1 protein_id gnl|my_center|LOCUS_09300 115852 116628 gene locus_tag LOCUS_09310 115852 116628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_09310 116625 117416 gene locus_tag LOCUS_09320 116625 117416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_09320 117419 118792 gene locus_tag LOCUS_09330 gene radA 117419 118792 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_09330 118798 119445 gene locus_tag LOCUS_09340 gene cvpA 118798 119445 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086837.1 protein_id gnl|my_center|LOCUS_09340 119516 121066 gene locus_tag LOCUS_09350 gene purF 119516 121066 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 protein_id gnl|my_center|LOCUS_09350 121068 121805 gene locus_tag LOCUS_09360 121068 121805 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971379.1 protein_id gnl|my_center|LOCUS_09360 123369 121951 gene locus_tag LOCUS_09370 gene der 123369 121951 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UK6 protein_id gnl|my_center|LOCUS_09370 124823 123477 gene locus_tag LOCUS_09380 124823 123477 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384150.1 protein_id gnl|my_center|LOCUS_09380 125490 124846 gene locus_tag LOCUS_09390 125490 124846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 126418 125594 gene locus_tag LOCUS_09400 gene panB 126418 125594 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NN1 protein_id gnl|my_center|LOCUS_09400 128078 126531 gene locus_tag LOCUS_09410 gene guaA 128078 126531 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 protein_id gnl|my_center|LOCUS_09410 129434 128151 gene locus_tag LOCUS_09420 129434 128151 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_09420 130903 129443 gene locus_tag LOCUS_09430 gene guaB 130903 129443 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RT5 protein_id gnl|my_center|LOCUS_09430 131848 131117 gene locus_tag LOCUS_09440 gene rlmE 131848 131117 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 protein_id gnl|my_center|LOCUS_09440 133032 131845 gene locus_tag LOCUS_09450 133032 131845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 133232 133305 gene locus_tag LOCUS_t00130 133232 133305 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 133427 134041 gene locus_tag LOCUS_09460 133427 134041 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_09460 134038 135054 gene locus_tag LOCUS_09470 gene trpD 134038 135054 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_09470 135079 135876 gene locus_tag LOCUS_09480 gene trpC 135079 135876 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_09480 135876 136352 gene locus_tag LOCUS_09490 gene moaC 135876 136352 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_09490 136362 137570 gene locus_tag LOCUS_09500 gene moeA 136362 137570 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_09500 137690 138364 gene locus_tag LOCUS_09510 gene lexA 137690 138364 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A724 protein_id gnl|my_center|LOCUS_09510 >Feature sequence06 1797 49 gene locus_tag LOCUS_09520 1797 49 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_09520 1965 2120 gene locus_tag LOCUS_09530 1965 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3110 3751 gene locus_tag LOCUS_09540 3110 3751 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702119.1 protein_id gnl|my_center|LOCUS_09540 3786 4433 gene locus_tag LOCUS_09550 3786 4433 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089828.1 protein_id gnl|my_center|LOCUS_09550 4501 5604 gene locus_tag LOCUS_09560 4501 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 5871 8090 gene locus_tag LOCUS_09570 5871 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 8390 8587 gene locus_tag LOCUS_09580 8390 8587 CDS product heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 protein_id gnl|my_center|LOCUS_09580 8666 10936 gene locus_tag LOCUS_09590 8666 10936 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_09590 10949 11350 gene locus_tag LOCUS_09600 gene hmrR2 10949 11350 CDS product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 protein_id gnl|my_center|LOCUS_09600 12621 11374 gene locus_tag LOCUS_09610 12621 11374 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_09610 13141 14316 gene locus_tag LOCUS_09620 13141 14316 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_09620 14609 15001 gene locus_tag LOCUS_09630 14609 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15245 15892 gene locus_tag LOCUS_09640 15245 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16052 18613 gene locus_tag LOCUS_09650 16052 18613 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_09650 18610 18987 gene locus_tag LOCUS_09660 18610 18987 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 protein_id gnl|my_center|LOCUS_09660 19145 19345 gene locus_tag LOCUS_09670 19145 19345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 19722 20075 gene locus_tag LOCUS_09680 19722 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 20512 20099 gene locus_tag LOCUS_09690 20512 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_09690 21280 21062 gene locus_tag LOCUS_09700 21280 21062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 21596 22219 gene locus_tag LOCUS_09710 21596 22219 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_09710 22232 24028 gene locus_tag LOCUS_09720 22232 24028 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 protein_id gnl|my_center|LOCUS_09720 25182 24136 gene locus_tag LOCUS_09730 25182 24136 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933660.1 protein_id gnl|my_center|LOCUS_09730 25911 25375 gene locus_tag LOCUS_09740 gene ahpD 25911 25375 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM5 protein_id gnl|my_center|LOCUS_09740 26529 25990 gene locus_tag LOCUS_09750 26529 25990 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_09750 26652 27533 gene locus_tag LOCUS_09760 gene oxyR 26652 27533 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_09760 28070 27528 gene locus_tag LOCUS_09770 gene ogt 28070 27528 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN39 protein_id gnl|my_center|LOCUS_09770 29581 28067 gene locus_tag LOCUS_09780 29581 28067 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_09780 29911 31041 gene locus_tag LOCUS_09790 29911 31041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_09790 31045 32754 gene locus_tag LOCUS_09800 31045 32754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 33317 32820 gene locus_tag LOCUS_09810 33317 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 34100 33327 gene locus_tag LOCUS_09820 gene nadK 34100 33327 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_09820 35108 34116 gene locus_tag LOCUS_09830 gene moaA 35108 34116 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 protein_id gnl|my_center|LOCUS_09830 36331 35207 gene locus_tag LOCUS_09840 gene spmY 36331 35207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640181.1 protein_id gnl|my_center|LOCUS_09840 36953 36543 gene locus_tag LOCUS_09850 36953 36543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 40606 37106 gene locus_tag LOCUS_09860 gene mfd 40606 37106 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 protein_id gnl|my_center|LOCUS_09860 40920 40603 gene locus_tag LOCUS_09870 40920 40603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919711.1 protein_id gnl|my_center|LOCUS_09870 41057 43150 gene locus_tag LOCUS_09880 41057 43150 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_09880 43954 43142 gene locus_tag LOCUS_09890 43954 43142 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_09890 45223 44051 gene locus_tag LOCUS_09900 gene yghO 45223 44051 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001774043.1 protein_id gnl|my_center|LOCUS_09900 46112 45300 gene locus_tag LOCUS_09910 46112 45300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 47337 46210 gene locus_tag LOCUS_09920 47337 46210 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_09920 48514 47339 gene locus_tag LOCUS_09930 48514 47339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918643.1 protein_id gnl|my_center|LOCUS_09930 48740 49702 gene locus_tag LOCUS_09940 48740 49702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 50963 49731 gene locus_tag LOCUS_09950 50963 49731 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_09950 51187 50960 gene locus_tag LOCUS_09960 51187 50960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 52218 51271 gene locus_tag LOCUS_09970 52218 51271 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077158.1 protein_id gnl|my_center|LOCUS_09970 54091 52349 gene locus_tag LOCUS_09980 54091 52349 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298766.1 protein_id gnl|my_center|LOCUS_09980 54536 55186 gene locus_tag LOCUS_09990 54536 55186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 55183 56400 gene locus_tag LOCUS_10000 gene hcaT 55183 56400 CDS product 3-phenylpropionic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262770.1 protein_id gnl|my_center|LOCUS_10000 56497 57030 gene locus_tag LOCUS_10010 56497 57030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 57219 58100 gene locus_tag LOCUS_10020 gene dapA 57219 58100 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH76 protein_id gnl|my_center|LOCUS_10020 58101 58574 gene locus_tag LOCUS_10030 gene smpB 58101 58574 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8R6 protein_id gnl|my_center|LOCUS_10030 58934 58635 gene locus_tag LOCUS_10040 58934 58635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 59161 58919 gene locus_tag LOCUS_10050 59161 58919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 59106 59276 gene locus_tag LOCUS_10060 59106 59276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 60277 59351 gene locus_tag LOCUS_10070 60277 59351 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_10070 61074 60373 gene locus_tag LOCUS_10080 61074 60373 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 protein_id gnl|my_center|LOCUS_10080 61616 61071 gene locus_tag LOCUS_10090 61616 61071 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_10090 61821 62366 gene locus_tag LOCUS_10100 61821 62366 CDS product 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_10100 62563 62946 gene locus_tag LOCUS_10110 gene rpoZ 62563 62946 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT88 protein_id gnl|my_center|LOCUS_10110 63144 65291 gene locus_tag LOCUS_10120 63144 65291 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_10120 65351 65941 gene locus_tag LOCUS_10130 gene pyrE 65351 65941 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H621 protein_id gnl|my_center|LOCUS_10130 66120 66746 gene locus_tag LOCUS_10140 66120 66746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 protein_id gnl|my_center|LOCUS_10140 66740 67522 gene locus_tag LOCUS_10150 gene pdxJ 66740 67522 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_10150 67522 67938 gene locus_tag LOCUS_10160 gene acpS 67522 67938 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S2 protein_id gnl|my_center|LOCUS_10160 68049 68873 gene locus_tag LOCUS_10170 68049 68873 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_10170 68878 69579 gene locus_tag LOCUS_10180 gene rnc 68878 69579 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_10180 69576 70481 gene locus_tag LOCUS_10190 gene era 69576 70481 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R46 protein_id gnl|my_center|LOCUS_10190 71792 70584 gene locus_tag LOCUS_10200 gene rocD 71792 70584 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38021 protein_id gnl|my_center|LOCUS_10200 72760 71795 gene locus_tag LOCUS_10210 gene argI 72760 71795 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z1 protein_id gnl|my_center|LOCUS_10210 72989 73474 gene locus_tag LOCUS_10220 72989 73474 CDS product Lrp-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265572.1 protein_id gnl|my_center|LOCUS_10220 73694 73981 gene locus_tag LOCUS_10230 gene gatC 73694 73981 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH3 protein_id gnl|my_center|LOCUS_10230 73991 75484 gene locus_tag LOCUS_10240 gene gatA 73991 75484 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 protein_id gnl|my_center|LOCUS_10240 75484 76968 gene locus_tag LOCUS_10250 gene gatB 75484 76968 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK5 protein_id gnl|my_center|LOCUS_10250 77167 77490 gene locus_tag LOCUS_10260 77167 77490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 77739 78008 gene locus_tag LOCUS_10270 77739 78008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 protein_id gnl|my_center|LOCUS_10270 78180 78269 gene locus_tag LOCUS_t00140 78180 78269 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78501 78743 gene locus_tag LOCUS_10280 78501 78743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 78876 79748 gene locus_tag LOCUS_10290 78876 79748 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_10290 79745 80554 gene locus_tag LOCUS_10300 79745 80554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 80663 80938 gene locus_tag LOCUS_10310 80663 80938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 protein_id gnl|my_center|LOCUS_10310 80983 81861 gene locus_tag LOCUS_10320 80983 81861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946413.1 protein_id gnl|my_center|LOCUS_10320 81858 82625 gene locus_tag LOCUS_10330 81858 82625 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931205.1 protein_id gnl|my_center|LOCUS_10330 82656 83165 gene locus_tag LOCUS_10340 82656 83165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_10340 83697 83230 gene locus_tag LOCUS_10350 83697 83230 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_10350 83996 85573 gene locus_tag LOCUS_10360 gene nhaB 83996 85573 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU7 protein_id gnl|my_center|LOCUS_10360 85797 86402 gene locus_tag LOCUS_10370 85797 86402 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531329.1 protein_id gnl|my_center|LOCUS_10370 86461 87105 gene locus_tag LOCUS_10380 86461 87105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 87179 87255 gene locus_tag LOCUS_t00150 87179 87255 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 87513 87737 gene locus_tag LOCUS_10390 87513 87737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 87789 87865 gene locus_tag LOCUS_t00160 87789 87865 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 88024 88479 gene locus_tag LOCUS_10400 88024 88479 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088958.1 protein_id gnl|my_center|LOCUS_10400 88488 90704 gene locus_tag LOCUS_10410 88488 90704 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064553.1 protein_id gnl|my_center|LOCUS_10410 91169 90753 gene locus_tag LOCUS_10420 gene hisI 91169 90753 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_10420 91268 91732 gene locus_tag LOCUS_10430 gene np20 91268 91732 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_10430 91747 92544 gene locus_tag LOCUS_10440 gene znuC 91747 92544 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CH84 protein_id gnl|my_center|LOCUS_10440 92537 93328 gene locus_tag LOCUS_10450 gene znuB 92537 93328 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_10450 94549 93380 gene locus_tag LOCUS_10460 gene metC 94549 93380 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_10460 95413 94565 gene locus_tag LOCUS_10470 95413 94565 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_10470 96476 95478 gene locus_tag LOCUS_10480 gene cysK 96476 95478 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_10480 96943 96602 gene locus_tag LOCUS_10490 96943 96602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 97136 97600 gene locus_tag LOCUS_10500 gene queF 97136 97600 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N45 protein_id gnl|my_center|LOCUS_10500 98360 97686 gene locus_tag LOCUS_10510 gene queE 98360 97686 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YK9 protein_id gnl|my_center|LOCUS_10510 99064 98357 gene locus_tag LOCUS_10520 gene queC 99064 98357 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSY8 protein_id gnl|my_center|LOCUS_10520 99272 99907 gene locus_tag LOCUS_10530 99272 99907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_10530 100040 99965 gene locus_tag LOCUS_t00170 100040 99965 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 100584 101030 gene locus_tag LOCUS_10540 100584 101030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 101247 101174 gene locus_tag LOCUS_t00180 101247 101174 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 101586 102239 gene locus_tag LOCUS_10550 101586 102239 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_10550 102400 103764 gene locus_tag LOCUS_10560 102400 103764 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_10560 104153 104698 gene locus_tag LOCUS_10570 104153 104698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 104900 107557 gene locus_tag LOCUS_10580 gene valS 104900 107557 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 protein_id gnl|my_center|LOCUS_10580 107595 107807 gene locus_tag LOCUS_10590 107595 107807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 107826 109328 gene locus_tag LOCUS_10600 107826 109328 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_10600 110630 109335 gene locus_tag LOCUS_10610 110630 109335 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_10610 111298 110747 gene locus_tag LOCUS_10620 111298 110747 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_10620 113556 111319 gene locus_tag LOCUS_10630 gene parC 113556 111319 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_10630 115306 113633 gene locus_tag LOCUS_10640 115306 113633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 116115 115387 gene locus_tag LOCUS_10650 gene recO 116115 115387 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLQ0 protein_id gnl|my_center|LOCUS_10650 116263 116712 gene locus_tag LOCUS_10660 116263 116712 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_10660 117038 116709 gene locus_tag LOCUS_10670 117038 116709 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708963.1 protein_id gnl|my_center|LOCUS_10670 118660 117062 gene locus_tag LOCUS_10680 118660 117062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 119196 118660 gene locus_tag LOCUS_10690 119196 118660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_10690 120329 119223 gene locus_tag LOCUS_10700 120329 119223 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_10700 121202 120525 gene locus_tag LOCUS_10710 121202 120525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 123288 121420 gene locus_tag LOCUS_10720 gene sac1 123288 121420 CDS product dATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339215.1 protein_id gnl|my_center|LOCUS_10720 124509 123613 gene locus_tag LOCUS_10730 124509 123613 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_10730 126006 124723 gene locus_tag LOCUS_10740 126006 124723 CDS product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2D0 protein_id gnl|my_center|LOCUS_10740 126421 127422 gene locus_tag LOCUS_10750 126421 127422 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339529.1 protein_id gnl|my_center|LOCUS_10750 127542 128363 gene locus_tag LOCUS_10760 127542 128363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 128809 129450 gene locus_tag LOCUS_10770 128809 129450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 129447 130418 gene locus_tag LOCUS_10780 129447 130418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence07 4580 657 gene locus_tag LOCUS_10790 4580 657 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_10790 4934 4602 gene locus_tag LOCUS_10800 4934 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_10800 5502 4921 gene locus_tag LOCUS_10810 5502 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_10810 5722 7911 gene locus_tag LOCUS_10820 5722 7911 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480856.1 protein_id gnl|my_center|LOCUS_10820 9542 8286 gene locus_tag LOCUS_10830 9542 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 11480 9630 gene locus_tag LOCUS_10840 gene phbC 11480 9630 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088814.1 protein_id gnl|my_center|LOCUS_10840 12235 11615 gene locus_tag LOCUS_10850 12235 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_10850 13647 12232 gene locus_tag LOCUS_10860 13647 12232 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_10860 14324 13647 gene locus_tag LOCUS_10870 14324 13647 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 protein_id gnl|my_center|LOCUS_10870 14892 14473 gene locus_tag LOCUS_10880 14892 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 15104 15433 gene locus_tag LOCUS_10890 15104 15433 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_10890 16294 15452 gene locus_tag LOCUS_10900 gene hpcB 16294 15452 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194590.1 protein_id gnl|my_center|LOCUS_10900 17848 16331 gene locus_tag LOCUS_10910 17848 16331 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 protein_id gnl|my_center|LOCUS_10910 18246 17851 gene locus_tag LOCUS_10920 gene hpcD 18246 17851 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085753.1 protein_id gnl|my_center|LOCUS_10920 18398 19303 gene locus_tag LOCUS_10930 gene dapA 18398 19303 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJQ1 protein_id gnl|my_center|LOCUS_10930 19336 20199 gene locus_tag LOCUS_10940 19336 20199 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888082.1 protein_id gnl|my_center|LOCUS_10940 20699 20277 gene locus_tag LOCUS_10950 gene hpaR 20699 20277 CDS product homoprotocatechuate degradation operon regulator, HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194637.1 protein_id gnl|my_center|LOCUS_10950 23994 20827 gene locus_tag LOCUS_10960 gene mexF 23994 20827 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709300.1 protein_id gnl|my_center|LOCUS_10960 25271 23991 gene locus_tag LOCUS_10970 25271 23991 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_10970 27406 25517 gene locus_tag LOCUS_10980 27406 25517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_10980 27741 28166 gene locus_tag LOCUS_10990 27741 28166 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530871.1 protein_id gnl|my_center|LOCUS_10990 29632 28205 gene locus_tag LOCUS_11000 gene putP 29632 28205 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_11000 30579 29629 gene locus_tag LOCUS_11010 30579 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_11010 32002 30569 gene locus_tag LOCUS_11020 32002 30569 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 protein_id gnl|my_center|LOCUS_11020 32982 32065 gene locus_tag LOCUS_11030 32982 32065 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_11030 33394 32996 gene locus_tag LOCUS_11040 gene ectC 33394 32996 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 protein_id gnl|my_center|LOCUS_11040 34808 33495 gene locus_tag LOCUS_11050 gene ectB 34808 33495 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 protein_id gnl|my_center|LOCUS_11050 35368 34886 gene locus_tag LOCUS_11060 gene ectA 35368 34886 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_11060 35686 36177 gene locus_tag LOCUS_11070 35686 36177 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_11070 36583 38445 gene locus_tag LOCUS_11080 36583 38445 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_11080 38445 39323 gene locus_tag LOCUS_11090 38445 39323 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 protein_id gnl|my_center|LOCUS_11090 39587 40312 gene locus_tag LOCUS_11100 39587 40312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 40309 41367 gene locus_tag LOCUS_11110 gene cobC 40309 41367 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 protein_id gnl|my_center|LOCUS_11110 41351 41971 gene locus_tag LOCUS_11120 gene cobO 41351 41971 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I472 protein_id gnl|my_center|LOCUS_11120 42734 41979 gene locus_tag LOCUS_11130 42734 41979 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_11130 43537 42731 gene locus_tag LOCUS_11140 gene cobS 43537 42731 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P97 protein_id gnl|my_center|LOCUS_11140 44567 43530 gene locus_tag LOCUS_11150 gene cobT 44567 43530 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3P6 protein_id gnl|my_center|LOCUS_11150 45127 44564 gene locus_tag LOCUS_11160 gene cobP 45127 44564 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_11160 45374 45105 gene locus_tag LOCUS_11170 45374 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 47082 45610 gene locus_tag LOCUS_11180 47082 45610 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_11180 47478 47296 gene locus_tag LOCUS_11190 47478 47296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_11190 48356 47487 gene locus_tag LOCUS_11200 48356 47487 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_11200 49441 48377 gene locus_tag LOCUS_11210 49441 48377 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_11210 49723 50865 gene locus_tag LOCUS_11220 gene mrp 49723 50865 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NU2 protein_id gnl|my_center|LOCUS_11220 50862 51296 gene locus_tag LOCUS_11230 50862 51296 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_11230 52635 51409 gene locus_tag LOCUS_11240 52635 51409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 53390 52884 gene locus_tag LOCUS_11250 gene folA 53390 52884 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF3 protein_id gnl|my_center|LOCUS_11250 54184 53390 gene locus_tag LOCUS_11260 gene thyA 54184 53390 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_11260 54903 55448 gene locus_tag LOCUS_11270 54903 55448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 protein_id gnl|my_center|LOCUS_11270 55465 56889 gene locus_tag LOCUS_11280 gene fumC 55465 56889 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9S6 protein_id gnl|my_center|LOCUS_11280 57016 57846 gene locus_tag LOCUS_11290 57016 57846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_11290 58787 60397 gene locus_tag LOCUS_11300 58787 60397 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_11300 60423 60647 gene locus_tag LOCUS_11310 60423 60647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 64278 60670 gene locus_tag LOCUS_11320 64278 60670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 64576 65100 gene locus_tag LOCUS_11330 64576 65100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 65114 66949 gene locus_tag LOCUS_11340 65114 66949 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389287.1 protein_id gnl|my_center|LOCUS_11340 67959 67033 gene locus_tag LOCUS_11350 67959 67033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 68347 70626 gene locus_tag LOCUS_11360 gene pcrA 68347 70626 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXZ3 protein_id gnl|my_center|LOCUS_11360 71595 70840 gene locus_tag LOCUS_11370 71595 70840 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_11370 72270 71635 gene locus_tag LOCUS_11380 72270 71635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 72522 73421 gene locus_tag LOCUS_11390 gene prmA 72522 73421 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 protein_id gnl|my_center|LOCUS_11390 73856 73563 gene locus_tag LOCUS_11400 73856 73563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 76172 74082 gene locus_tag LOCUS_11410 gene ligA 76172 74082 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEL9 protein_id gnl|my_center|LOCUS_11410 77849 76179 gene locus_tag LOCUS_11420 gene recN 77849 76179 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM7 protein_id gnl|my_center|LOCUS_11420 78667 77867 gene locus_tag LOCUS_11430 gene bamD 78667 77867 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_11430 80341 79070 gene locus_tag LOCUS_11440 80341 79070 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085760.1 protein_id gnl|my_center|LOCUS_11440 80922 80344 gene locus_tag LOCUS_11450 80922 80344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_11450 81681 81163 gene locus_tag LOCUS_11460 81681 81163 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390131.1 protein_id gnl|my_center|LOCUS_11460 81924 83312 gene locus_tag LOCUS_11470 gene atoE 81924 83312 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_11470 83452 84468 gene locus_tag LOCUS_11480 gene znuA 83452 84468 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_11480 85124 84540 gene locus_tag LOCUS_11490 85124 84540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 85716 85243 gene locus_tag LOCUS_11500 85716 85243 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640520.1 protein_id gnl|my_center|LOCUS_11500 85859 89338 gene locus_tag LOCUS_11510 85859 89338 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769363.2 protein_id gnl|my_center|LOCUS_11510 89399 90484 gene locus_tag LOCUS_11520 gene hisC 89399 90484 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHV5 protein_id gnl|my_center|LOCUS_11520 90644 91207 gene locus_tag LOCUS_11530 90644 91207 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073616.1 protein_id gnl|my_center|LOCUS_11530 91755 91288 gene locus_tag LOCUS_11540 gene ybaO 91755 91288 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 protein_id gnl|my_center|LOCUS_11540 91893 92945 gene locus_tag LOCUS_11550 gene hppD 91893 92945 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence08 983 327 gene locus_tag LOCUS_11560 983 327 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706462.1 protein_id gnl|my_center|LOCUS_11560 4550 1320 gene locus_tag LOCUS_11570 4550 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5188 4733 gene locus_tag LOCUS_11580 5188 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5416 6459 gene locus_tag LOCUS_11590 5416 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6930 9056 gene locus_tag LOCUS_11600 6930 9056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_11600 9176 10420 gene locus_tag LOCUS_11610 9176 10420 CDS product peptidase M38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_11610 10439 11110 gene locus_tag LOCUS_11620 10439 11110 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6F6 protein_id gnl|my_center|LOCUS_11620 11160 11654 gene locus_tag LOCUS_11630 11160 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_11630 12956 11691 gene locus_tag LOCUS_11640 12956 11691 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002075981.1 protein_id gnl|my_center|LOCUS_11640 14108 13104 gene locus_tag LOCUS_11650 gene eutR 14108 13104 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_11650 14327 14989 gene locus_tag LOCUS_11660 14327 14989 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_11660 14994 15629 gene locus_tag LOCUS_11670 14994 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 18517 15683 gene locus_tag LOCUS_11680 18517 15683 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_11680 18785 19507 gene locus_tag LOCUS_11690 18785 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546675.1 protein_id gnl|my_center|LOCUS_11690 20427 19591 gene locus_tag LOCUS_11700 20427 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_11700 21398 20430 gene locus_tag LOCUS_11710 21398 20430 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_11710 22030 21431 gene locus_tag LOCUS_11720 22030 21431 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMU2 protein_id gnl|my_center|LOCUS_11720 22274 22981 gene locus_tag LOCUS_11730 22274 22981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083670.1 protein_id gnl|my_center|LOCUS_11730 23052 23390 gene locus_tag LOCUS_11740 23052 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 24371 23466 gene locus_tag LOCUS_11750 24371 23466 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_11750 24423 26084 gene locus_tag LOCUS_11760 gene lysS 24423 26084 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VB4 protein_id gnl|my_center|LOCUS_11760 26450 27094 gene locus_tag LOCUS_11770 26450 27094 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_11770 28821 27211 gene locus_tag LOCUS_11780 28821 27211 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388808.1 protein_id gnl|my_center|LOCUS_11780 29032 30198 gene locus_tag LOCUS_11790 gene metK2 29032 30198 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_11790 30244 31008 gene locus_tag LOCUS_11800 gene trmB 30244 31008 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_11800 31274 31768 gene locus_tag LOCUS_11810 gene rimP 31274 31768 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y659 protein_id gnl|my_center|LOCUS_11810 31901 33514 gene locus_tag LOCUS_11820 gene nusA 31901 33514 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_11820 33551 34243 gene locus_tag LOCUS_11830 33551 34243 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 protein_id gnl|my_center|LOCUS_11830 34263 36950 gene locus_tag LOCUS_11840 gene infB 34263 36950 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS0 protein_id gnl|my_center|LOCUS_11840 37047 37472 gene locus_tag LOCUS_11850 gene rbfA 37047 37472 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 protein_id gnl|my_center|LOCUS_11850 37476 38396 gene locus_tag LOCUS_11860 gene truB 37476 38396 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB1 protein_id gnl|my_center|LOCUS_11860 38413 38682 gene locus_tag LOCUS_11870 gene rpsO 38413 38682 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_11870 38903 40984 gene locus_tag LOCUS_11880 gene pnp 38903 40984 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKQ7 protein_id gnl|my_center|LOCUS_11880 41147 42550 gene locus_tag LOCUS_11890 41147 42550 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_11890 42905 43333 gene locus_tag LOCUS_11900 42905 43333 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_11900 44020 43448 gene locus_tag LOCUS_11910 44020 43448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 protein_id gnl|my_center|LOCUS_11910 44329 45294 gene locus_tag LOCUS_11920 44329 45294 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_11920 45861 45403 gene locus_tag LOCUS_11930 45861 45403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_11930 46922 46158 gene locus_tag LOCUS_11940 46922 46158 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_11940 47218 46919 gene locus_tag LOCUS_11950 47218 46919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 48237 47278 gene locus_tag LOCUS_11960 48237 47278 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_11960 48818 48363 gene locus_tag LOCUS_11970 48818 48363 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_11970 49304 48849 gene locus_tag LOCUS_11980 gene dut 49304 48849 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T772 protein_id gnl|my_center|LOCUS_11980 50587 49313 gene locus_tag LOCUS_11990 50587 49313 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_11990 52310 50763 gene locus_tag LOCUS_12000 52310 50763 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 protein_id gnl|my_center|LOCUS_12000 53152 52313 gene locus_tag LOCUS_12010 gene ubiE 53152 52313 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 protein_id gnl|my_center|LOCUS_12010 53246 54088 gene locus_tag LOCUS_12020 gene mutM 53246 54088 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E4 protein_id gnl|my_center|LOCUS_12020 54121 54627 gene locus_tag LOCUS_12030 54121 54627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 54856 55632 gene locus_tag LOCUS_12040 gene paaF 54856 55632 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186913.1 protein_id gnl|my_center|LOCUS_12040 55929 56198 gene locus_tag LOCUS_12050 gene rpsT 55929 56198 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E3 protein_id gnl|my_center|LOCUS_12050 56314 56090 gene locus_tag LOCUS_12060 56314 56090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 56863 57282 gene locus_tag LOCUS_12070 56863 57282 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_12070 57292 58770 gene locus_tag LOCUS_12080 gene dnaA 57292 58770 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_12080 59302 60423 gene locus_tag LOCUS_12090 59302 60423 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_12090 60725 61957 gene locus_tag LOCUS_12100 gene recF 60725 61957 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ65 protein_id gnl|my_center|LOCUS_12100 62020 64467 gene locus_tag LOCUS_12110 gene gyrB 62020 64467 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY57 protein_id gnl|my_center|LOCUS_12110 67785 64615 gene locus_tag LOCUS_12120 67785 64615 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_12120 68972 67782 gene locus_tag LOCUS_12130 68972 67782 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_12130 70460 68976 gene locus_tag LOCUS_12140 70460 68976 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_12140 71592 70726 gene locus_tag LOCUS_12150 71592 70726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 72322 71819 gene locus_tag LOCUS_12160 72322 71819 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383623.1 protein_id gnl|my_center|LOCUS_12160 73216 72878 gene locus_tag LOCUS_12170 73216 72878 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_12170 73857 73405 gene locus_tag LOCUS_12180 73857 73405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_12180 74241 74462 gene locus_tag LOCUS_12190 74241 74462 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389274.1 protein_id gnl|my_center|LOCUS_12190 74593 75372 gene locus_tag LOCUS_12200 74593 75372 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_12200 77833 75443 gene locus_tag LOCUS_12210 77833 75443 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_12210 78109 79431 gene locus_tag LOCUS_12220 78109 79431 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_12220 79442 81517 gene locus_tag LOCUS_12230 79442 81517 CDS product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RF6 protein_id gnl|my_center|LOCUS_12230 81883 85398 gene locus_tag LOCUS_12240 81883 85398 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_12240 86118 85504 gene locus_tag LOCUS_12250 86118 85504 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_12250 87143 86343 gene locus_tag LOCUS_12260 87143 86343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence09 1809 232 gene locus_tag LOCUS_12270 gene gcvPB 1809 232 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A354 protein_id gnl|my_center|LOCUS_12270 3152 1806 gene locus_tag LOCUS_12280 gene gcvPA 3152 1806 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A353 protein_id gnl|my_center|LOCUS_12280 3568 3194 gene locus_tag LOCUS_12290 gene gcvH 3568 3194 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD42 protein_id gnl|my_center|LOCUS_12290 4741 3608 gene locus_tag LOCUS_12300 4741 3608 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I01 protein_id gnl|my_center|LOCUS_12300 5568 5329 gene locus_tag LOCUS_12310 5568 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5668 6618 gene locus_tag LOCUS_12320 gene ispH 5668 6618 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 protein_id gnl|my_center|LOCUS_12320 6621 7586 gene locus_tag LOCUS_12330 gene thrB 6621 7586 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK2 protein_id gnl|my_center|LOCUS_12330 7586 8020 gene locus_tag LOCUS_12340 gene rnhA 7586 8020 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_12340 8068 8718 gene locus_tag LOCUS_12350 gene arp 8068 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155666.1 protein_id gnl|my_center|LOCUS_12350 9277 8855 gene locus_tag LOCUS_12360 9277 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 9963 9328 gene locus_tag LOCUS_12370 9963 9328 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEC9 protein_id gnl|my_center|LOCUS_12370 10168 11706 gene locus_tag LOCUS_12380 10168 11706 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_12380 11703 13484 gene locus_tag LOCUS_12390 11703 13484 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_12390 14008 13634 gene locus_tag LOCUS_12400 14008 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 15109 14504 gene locus_tag LOCUS_12410 15109 14504 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK7 protein_id gnl|my_center|LOCUS_12410 15275 16150 gene locus_tag LOCUS_12420 15275 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 16190 17629 gene locus_tag LOCUS_12430 16190 17629 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_12430 17626 18108 gene locus_tag LOCUS_12440 17626 18108 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_12440 18300 18779 gene locus_tag LOCUS_12450 18300 18779 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_12450 18859 19275 gene locus_tag LOCUS_12460 18859 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 19367 20356 gene locus_tag LOCUS_12470 19367 20356 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_12470 20997 20569 gene locus_tag LOCUS_12480 20997 20569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 21821 21105 gene locus_tag LOCUS_12490 21821 21105 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_12490 21996 22334 gene locus_tag LOCUS_12500 21996 22334 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_12500 22869 22417 gene locus_tag LOCUS_12510 gene ElaA 22869 22417 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 protein_id gnl|my_center|LOCUS_12510 23131 24057 gene locus_tag LOCUS_12520 23131 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 24718 24074 gene locus_tag LOCUS_12530 gene thiE 24718 24074 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_12530 25753 24833 gene locus_tag LOCUS_12540 gene fbaB 25753 24833 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_12540 27049 25838 gene locus_tag LOCUS_12550 gene pgk 27049 25838 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M79 protein_id gnl|my_center|LOCUS_12550 28079 27075 gene locus_tag LOCUS_12560 gene gapA 28079 27075 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_12560 30092 28122 gene locus_tag LOCUS_12570 gene tkt2 30092 28122 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M82 protein_id gnl|my_center|LOCUS_12570 30416 30787 gene locus_tag LOCUS_12580 30416 30787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 30876 31217 gene locus_tag LOCUS_12590 30876 31217 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 protein_id gnl|my_center|LOCUS_12590 31642 32907 gene locus_tag LOCUS_12600 gene bioI 31642 32907 CDS product biotin biosynthesis cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53554 protein_id gnl|my_center|LOCUS_12600 32972 34177 gene locus_tag LOCUS_12610 32972 34177 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 protein_id gnl|my_center|LOCUS_12610 34237 35937 gene locus_tag LOCUS_12620 34237 35937 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 protein_id gnl|my_center|LOCUS_12620 37191 36115 gene locus_tag LOCUS_12630 37191 36115 CDS product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 protein_id gnl|my_center|LOCUS_12630 38209 37415 gene locus_tag LOCUS_12640 38209 37415 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 protein_id gnl|my_center|LOCUS_12640 38314 39870 gene locus_tag LOCUS_12650 38314 39870 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701348.1 protein_id gnl|my_center|LOCUS_12650 39887 40381 gene locus_tag LOCUS_12660 39887 40381 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867764.1 protein_id gnl|my_center|LOCUS_12660 40378 40848 gene locus_tag LOCUS_12670 gene asnC 40378 40848 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 protein_id gnl|my_center|LOCUS_12670 40988 42151 gene locus_tag LOCUS_12680 40988 42151 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_12680 42194 43024 gene locus_tag LOCUS_12690 gene mhpC 42194 43024 CDS product 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_12690 43027 43812 gene locus_tag LOCUS_12700 43027 43812 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_12700 43821 44759 gene locus_tag LOCUS_12710 gene mhpF 43821 44759 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK04 protein_id gnl|my_center|LOCUS_12710 44756 45799 gene locus_tag LOCUS_12720 gene mhpE 44756 45799 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 protein_id gnl|my_center|LOCUS_12720 45879 46802 gene locus_tag LOCUS_12730 45879 46802 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 protein_id gnl|my_center|LOCUS_12730 46806 47681 gene locus_tag LOCUS_12740 46806 47681 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_12740 47692 48483 gene locus_tag LOCUS_12750 47692 48483 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_12750 48480 49385 gene locus_tag LOCUS_12760 gene paaG 48480 49385 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_12760 49385 50488 gene locus_tag LOCUS_12770 49385 50488 CDS product putative 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701355.1 protein_id gnl|my_center|LOCUS_12770 50466 51227 gene locus_tag LOCUS_12780 50466 51227 CDS product putative enoyl-CoA hydratase EchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701358.1 protein_id gnl|my_center|LOCUS_12780 51227 52393 gene locus_tag LOCUS_12790 51227 52393 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701347.1 protein_id gnl|my_center|LOCUS_12790 52397 53425 gene locus_tag LOCUS_12800 52397 53425 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701346.1 protein_id gnl|my_center|LOCUS_12800 53461 54612 gene locus_tag LOCUS_12810 gene atoB 53461 54612 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_12810 54622 55503 gene locus_tag LOCUS_12820 54622 55503 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 protein_id gnl|my_center|LOCUS_12820 55509 56699 gene locus_tag LOCUS_12830 55509 56699 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_12830 56696 57883 gene locus_tag LOCUS_12840 56696 57883 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_12840 57876 58661 gene locus_tag LOCUS_12850 gene fabG 57876 58661 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_12850 58661 59140 gene locus_tag LOCUS_12860 58661 59140 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_12860 59133 60335 gene locus_tag LOCUS_12870 59133 60335 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_12870 60414 61286 gene locus_tag LOCUS_12880 60414 61286 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_12880 61587 63731 gene locus_tag LOCUS_12890 61587 63731 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_12890 63826 65139 gene locus_tag LOCUS_12900 63826 65139 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_12900 65075 65833 gene locus_tag LOCUS_12910 65075 65833 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258271.1 protein_id gnl|my_center|LOCUS_12910 65830 67524 gene locus_tag LOCUS_12920 gene kstD 65830 67524 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71864 protein_id gnl|my_center|LOCUS_12920 67733 68404 gene locus_tag LOCUS_12930 67733 68404 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_12930 68516 69145 gene locus_tag LOCUS_12940 68516 69145 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_12940 69518 69979 gene locus_tag LOCUS_12950 69518 69979 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_12950 69981 71843 gene locus_tag LOCUS_12960 69981 71843 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_12960 72241 74391 gene locus_tag LOCUS_12970 gene nosR 72241 74391 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083146.1 protein_id gnl|my_center|LOCUS_12970 74440 76401 gene locus_tag LOCUS_12980 gene nosZ 74440 76401 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XJ6 protein_id gnl|my_center|LOCUS_12980 76398 77711 gene locus_tag LOCUS_12990 gene nosD 76398 77711 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083148.1 protein_id gnl|my_center|LOCUS_12990 77704 78627 gene locus_tag LOCUS_13000 gene nosF 77704 78627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 protein_id gnl|my_center|LOCUS_13000 78624 79445 gene locus_tag LOCUS_13010 gene nosY 78624 79445 CDS product NosY permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967625.1 protein_id gnl|my_center|LOCUS_13010 79449 80018 gene locus_tag LOCUS_13020 gene nosL 79449 80018 CDS product NosL protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083151.1 protein_id gnl|my_center|LOCUS_13020 80015 80974 gene locus_tag LOCUS_13030 gene nosX 80015 80974 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Z49 protein_id gnl|my_center|LOCUS_13030 81033 82463 gene locus_tag LOCUS_13040 81033 82463 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_13040 83074 82490 gene locus_tag LOCUS_13050 83074 82490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 84047 83634 gene locus_tag LOCUS_13060 84047 83634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence10 1582 116 gene locus_tag LOCUS_13070 1582 116 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_13070 3316 2060 gene locus_tag LOCUS_13080 gene rho 3316 2060 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 protein_id gnl|my_center|LOCUS_13080 3982 3539 gene locus_tag LOCUS_13090 3982 3539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_13090 5009 4005 gene locus_tag LOCUS_13100 gene hemH 5009 4005 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN84 protein_id gnl|my_center|LOCUS_13100 6040 5006 gene locus_tag LOCUS_13110 gene hemE 6040 5006 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_13110 6511 7410 gene locus_tag LOCUS_13120 6511 7410 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_13120 7574 8167 gene locus_tag LOCUS_13130 7574 8167 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B07 protein_id gnl|my_center|LOCUS_13130 8164 9012 gene locus_tag LOCUS_13140 gene aroE 8164 9012 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_13140 9009 9707 gene locus_tag LOCUS_13150 gene coaE 9009 9707 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I0 protein_id gnl|my_center|LOCUS_13150 9731 10426 gene locus_tag LOCUS_13160 9731 10426 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_13160 11216 10602 gene locus_tag LOCUS_13170 11216 10602 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461065.1 protein_id gnl|my_center|LOCUS_13170 11549 12166 gene locus_tag LOCUS_13180 11549 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 12170 12859 gene locus_tag LOCUS_13190 12170 12859 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941619.1 protein_id gnl|my_center|LOCUS_13190 12856 13866 gene locus_tag LOCUS_13200 gene ybhG 12856 13866 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_13200 13854 14804 gene locus_tag LOCUS_13210 gene ybhF-N 13854 14804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_13210 14797 15759 gene locus_tag LOCUS_13220 gene ybhF-C 14797 15759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_13220 15790 16206 gene locus_tag LOCUS_13230 15790 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 16203 16694 gene locus_tag LOCUS_13240 16203 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 16747 17880 gene locus_tag LOCUS_13250 gene ybhS 16747 17880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_13250 17877 19010 gene locus_tag LOCUS_13260 gene ybhR 17877 19010 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B8 protein_id gnl|my_center|LOCUS_13260 19662 19126 gene locus_tag LOCUS_13270 gene secB 19662 19126 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE7 protein_id gnl|my_center|LOCUS_13270 20361 19870 gene locus_tag LOCUS_13280 20361 19870 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391356.1 protein_id gnl|my_center|LOCUS_13280 20715 21419 gene locus_tag LOCUS_13290 20715 21419 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067421.1 protein_id gnl|my_center|LOCUS_13290 21412 22701 gene locus_tag LOCUS_13300 21412 22701 CDS product membrane-bound lytic murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU14 protein_id gnl|my_center|LOCUS_13300 23003 23338 gene locus_tag LOCUS_13310 23003 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 23335 23700 gene locus_tag LOCUS_13320 23335 23700 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_13320 25056 23734 gene locus_tag LOCUS_13330 25056 23734 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_13330 26262 25117 gene locus_tag LOCUS_13340 gene aroB 26262 25117 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_13340 26864 26259 gene locus_tag LOCUS_13350 gene aroK 26864 26259 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H331 protein_id gnl|my_center|LOCUS_13350 27242 29488 gene locus_tag LOCUS_13360 27242 29488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 29531 30436 gene locus_tag LOCUS_13370 gene xerD 29531 30436 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME3 protein_id gnl|my_center|LOCUS_13370 30548 31501 gene locus_tag LOCUS_13380 gene accA 30548 31501 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_13380 32219 31650 gene locus_tag LOCUS_13390 32219 31650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 33533 32250 gene locus_tag LOCUS_13400 33533 32250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 34339 33560 gene locus_tag LOCUS_13410 34339 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 37523 34761 gene locus_tag LOCUS_13420 gene secA 37523 34761 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHS0 protein_id gnl|my_center|LOCUS_13420 37789 39030 gene locus_tag LOCUS_13430 gene argJ 37789 39030 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_13430 39034 39600 gene locus_tag LOCUS_13440 39034 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 39597 40037 gene locus_tag LOCUS_13450 gene mutT 39597 40037 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_13450 40045 40551 gene locus_tag LOCUS_13460 40045 40551 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_13460 40793 40548 gene locus_tag LOCUS_13470 40793 40548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 40986 40765 gene locus_tag LOCUS_13480 40986 40765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 41884 41117 gene locus_tag LOCUS_13490 41884 41117 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYE9 protein_id gnl|my_center|LOCUS_13490 42187 43161 gene locus_tag LOCUS_13500 42187 43161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_13500 43161 45914 gene locus_tag LOCUS_13510 43161 45914 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_13510 45918 47045 gene locus_tag LOCUS_13520 45918 47045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 protein_id gnl|my_center|LOCUS_13520 47136 47807 gene locus_tag LOCUS_13530 47136 47807 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_13530 47924 48697 gene locus_tag LOCUS_13540 47924 48697 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 protein_id gnl|my_center|LOCUS_13540 48789 49445 gene locus_tag LOCUS_13550 48789 49445 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_13550 51020 49896 gene locus_tag LOCUS_13560 51020 49896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688558.1 protein_id gnl|my_center|LOCUS_13560 51402 52949 gene locus_tag LOCUS_13570 gene yclF 51402 52949 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_13570 54830 53004 gene locus_tag LOCUS_13580 54830 53004 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_13580 55027 56007 gene locus_tag LOCUS_13590 gene msrP 55027 56007 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4T2 protein_id gnl|my_center|LOCUS_13590 56010 56708 gene locus_tag LOCUS_13600 56010 56708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 56653 57072 gene locus_tag LOCUS_13610 56653 57072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_13610 58132 57119 gene locus_tag LOCUS_13620 58132 57119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 58843 58253 gene locus_tag LOCUS_13630 58843 58253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 58742 58993 gene locus_tag LOCUS_13640 58742 58993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 59428 59886 gene locus_tag LOCUS_13650 59428 59886 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883461.1 protein_id gnl|my_center|LOCUS_13650 59883 60074 gene locus_tag LOCUS_13660 59883 60074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 60283 60879 gene locus_tag LOCUS_13670 60283 60879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703909.1 protein_id gnl|my_center|LOCUS_13670 63380 61227 gene locus_tag LOCUS_13680 63380 61227 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_13680 64598 63393 gene locus_tag LOCUS_13690 64598 63393 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_13690 66413 64623 gene locus_tag LOCUS_13700 66413 64623 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_13700 66819 66400 gene locus_tag LOCUS_13710 66819 66400 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707798.1 protein_id gnl|my_center|LOCUS_13710 67174 68115 gene locus_tag LOCUS_13720 67174 68115 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_13720 68172 68948 gene locus_tag LOCUS_13730 68172 68948 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537523.1 protein_id gnl|my_center|LOCUS_13730 69031 69765 gene locus_tag LOCUS_13740 69031 69765 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_13740 70293 70003 gene locus_tag LOCUS_13750 70293 70003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 71111 70416 gene locus_tag LOCUS_13760 gene bioD 71111 70416 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE1 protein_id gnl|my_center|LOCUS_13760 72289 71108 gene locus_tag LOCUS_13770 gene bioF 72289 71108 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z1 protein_id gnl|my_center|LOCUS_13770 72449 73480 gene locus_tag LOCUS_13780 gene bioB 72449 73480 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_13780 73458 74783 gene locus_tag LOCUS_13790 gene bioA 73458 74783 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_13790 77115 74836 gene locus_tag LOCUS_13800 77115 74836 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence11 2689 89 gene locus_tag LOCUS_13810 gene acoK 2689 89 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 protein_id gnl|my_center|LOCUS_13810 2905 3135 gene locus_tag LOCUS_13820 2905 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4056 3040 gene locus_tag LOCUS_13830 4056 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4970 4230 gene locus_tag LOCUS_13840 4970 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5679 5209 gene locus_tag LOCUS_13850 5679 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6815 5793 gene locus_tag LOCUS_13860 6815 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 8705 7398 gene locus_tag LOCUS_13870 8705 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 10173 8698 gene locus_tag LOCUS_13880 10173 8698 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189039.1 protein_id gnl|my_center|LOCUS_13880 11602 10532 gene locus_tag LOCUS_13890 gene modD 11602 10532 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4U7 protein_id gnl|my_center|LOCUS_13890 12279 11599 gene locus_tag LOCUS_13900 gene modB 12279 11599 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_13900 13073 12279 gene locus_tag LOCUS_13910 gene modA 13073 12279 CDS product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_13910 13439 13756 gene locus_tag LOCUS_13920 13439 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 13850 15430 gene locus_tag LOCUS_13930 gene glpD 13850 15430 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDH8 protein_id gnl|my_center|LOCUS_13930 15427 16923 gene locus_tag LOCUS_13940 gene glpK1 15427 16923 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_13940 17812 16913 gene locus_tag LOCUS_13950 gene serB 17812 16913 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 protein_id gnl|my_center|LOCUS_13950 17954 18874 gene locus_tag LOCUS_13960 gene miaA 17954 18874 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEB5 protein_id gnl|my_center|LOCUS_13960 19204 20958 gene locus_tag LOCUS_13970 gene ilvI 19204 20958 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NR5 protein_id gnl|my_center|LOCUS_13970 21044 21562 gene locus_tag LOCUS_13980 gene ilvH 21044 21562 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_13980 21626 22645 gene locus_tag LOCUS_13990 gene ilvC 21626 22645 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 protein_id gnl|my_center|LOCUS_13990 23089 23388 gene locus_tag LOCUS_14000 23089 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 23441 23827 gene locus_tag LOCUS_14010 23441 23827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 24063 24218 gene locus_tag LOCUS_14020 24063 24218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 24702 26243 gene locus_tag LOCUS_14030 gene leuA 24702 26243 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H607 protein_id gnl|my_center|LOCUS_14030 26601 27638 gene locus_tag LOCUS_14040 26601 27638 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_14040 27851 28738 gene locus_tag LOCUS_14050 27851 28738 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 protein_id gnl|my_center|LOCUS_14050 28738 29250 gene locus_tag LOCUS_14060 28738 29250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 29261 31114 gene locus_tag LOCUS_14070 29261 31114 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_14070 31114 32262 gene locus_tag LOCUS_14080 gene rodA 31114 32262 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_14080 33371 32772 gene locus_tag LOCUS_14090 33371 32772 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 protein_id gnl|my_center|LOCUS_14090 34198 33368 gene locus_tag LOCUS_14100 34198 33368 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_14100 35324 34170 gene locus_tag LOCUS_14110 gene mnaA 35324 34170 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437003.1 protein_id gnl|my_center|LOCUS_14110 35544 36875 gene locus_tag LOCUS_14120 gene pyrC 35544 36875 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 protein_id gnl|my_center|LOCUS_14120 37609 36983 gene locus_tag LOCUS_14130 37609 36983 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_14130 40888 37937 gene locus_tag LOCUS_14140 gene btuB 40888 37937 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_14140 41059 43416 gene locus_tag LOCUS_14150 41059 43416 CDS product putative dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703651.1 protein_id gnl|my_center|LOCUS_14150 44727 43558 gene locus_tag LOCUS_14160 44727 43558 CDS product putative MscS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66994 protein_id gnl|my_center|LOCUS_14160 47009 44724 gene locus_tag LOCUS_14170 47009 44724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 48097 47171 gene locus_tag LOCUS_14180 48097 47171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 48353 49384 gene locus_tag LOCUS_14190 48353 49384 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC20 protein_id gnl|my_center|LOCUS_14190 49457 49879 gene locus_tag LOCUS_14200 49457 49879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 49885 50562 gene locus_tag LOCUS_14210 49885 50562 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_14210 50636 52024 gene locus_tag LOCUS_14220 50636 52024 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_14220 52130 52603 gene locus_tag LOCUS_14230 gene omp 52130 52603 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_14230 53218 52787 gene locus_tag LOCUS_14240 gene ygdD 53218 52787 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_14240 53780 53256 gene locus_tag LOCUS_14250 53780 53256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 54216 55337 gene locus_tag LOCUS_14260 54216 55337 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_14260 55334 56050 gene locus_tag LOCUS_14270 55334 56050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 56759 56445 gene locus_tag LOCUS_14280 56759 56445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 57441 56842 gene locus_tag LOCUS_14290 57441 56842 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389687.1 protein_id gnl|my_center|LOCUS_14290 57616 58824 gene locus_tag LOCUS_14300 gene fadA 57616 58824 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_14300 58961 60565 gene locus_tag LOCUS_14310 58961 60565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 60681 62114 gene locus_tag LOCUS_14320 60681 62114 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_14320 62248 63606 gene locus_tag LOCUS_14330 62248 63606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 63624 64514 gene locus_tag LOCUS_14340 63624 64514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 64522 65679 gene locus_tag LOCUS_14350 64522 65679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 65703 67304 gene locus_tag LOCUS_14360 65703 67304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 67439 67759 gene locus_tag LOCUS_14370 gene tyrA 67439 67759 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310875.1 protein_id gnl|my_center|LOCUS_14370 69144 67927 gene locus_tag LOCUS_14380 69144 67927 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_14380 70858 69362 gene locus_tag LOCUS_14390 70858 69362 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_14390 71195 72550 gene locus_tag LOCUS_14400 71195 72550 CDS product alkylhalidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119821.1 protein_id gnl|my_center|LOCUS_14400 72547 74265 gene locus_tag LOCUS_14410 72547 74265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583190.1 protein_id gnl|my_center|LOCUS_14410 74258 74983 gene locus_tag LOCUS_14420 74258 74983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 75084 75695 gene locus_tag LOCUS_14430 75084 75695 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 protein_id gnl|my_center|LOCUS_14430 75698 76474 gene locus_tag LOCUS_14440 gene dcaE 75698 76474 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence12 947 99 gene locus_tag LOCUS_14450 947 99 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_14450 1617 919 gene locus_tag LOCUS_14460 1617 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2756 1731 gene locus_tag LOCUS_14470 2756 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3213 2743 gene locus_tag LOCUS_14480 3213 2743 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 protein_id gnl|my_center|LOCUS_14480 3515 3309 gene locus_tag LOCUS_14490 gene rpsU 3515 3309 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK1 protein_id gnl|my_center|LOCUS_14490 3717 4385 gene locus_tag LOCUS_14500 3717 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_14500 4572 5213 gene locus_tag LOCUS_14510 4572 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6391 5294 gene locus_tag LOCUS_14520 gene purK 6391 5294 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EH0 protein_id gnl|my_center|LOCUS_14520 6930 6436 gene locus_tag LOCUS_14530 gene purE 6930 6436 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ4 protein_id gnl|my_center|LOCUS_14530 7207 7947 gene locus_tag LOCUS_14540 gene dgcA 7207 7947 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_14540 8285 8082 gene locus_tag LOCUS_14550 8285 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383748.1 protein_id gnl|my_center|LOCUS_14550 8380 9000 gene locus_tag LOCUS_14560 8380 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 9202 9372 gene locus_tag LOCUS_14570 9202 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 10253 9657 gene locus_tag LOCUS_14580 10253 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 10909 10532 gene locus_tag LOCUS_14590 10909 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 11202 11789 gene locus_tag LOCUS_14600 11202 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 11799 12035 gene locus_tag LOCUS_14610 11799 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 protein_id gnl|my_center|LOCUS_14610 12472 13095 gene locus_tag LOCUS_14620 12472 13095 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_14620 13100 14239 gene locus_tag LOCUS_14630 gene queG 13100 14239 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_14630 15090 14236 gene locus_tag LOCUS_14640 15090 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 15238 16011 gene locus_tag LOCUS_14650 15238 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 16040 16918 gene locus_tag LOCUS_14660 16040 16918 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391125.1 protein_id gnl|my_center|LOCUS_14660 17717 16938 gene locus_tag LOCUS_14670 17717 16938 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140274.1 protein_id gnl|my_center|LOCUS_14670 17904 19844 gene locus_tag LOCUS_14680 gene thrS 17904 19844 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_14680 19969 20490 gene locus_tag LOCUS_14690 gene infC 19969 20490 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_14690 20580 20783 gene locus_tag LOCUS_14700 20580 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 21389 22468 gene locus_tag LOCUS_14710 21389 22468 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_14710 22472 25582 gene locus_tag LOCUS_14720 22472 25582 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_14720 26687 25755 gene locus_tag LOCUS_14730 26687 25755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_14730 27103 27300 gene locus_tag LOCUS_14740 gene rpmI 27103 27300 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8A5 protein_id gnl|my_center|LOCUS_14740 27312 27674 gene locus_tag LOCUS_14750 gene rplT 27312 27674 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_14750 27784 28860 gene locus_tag LOCUS_14760 gene pheS 27784 28860 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ST0 protein_id gnl|my_center|LOCUS_14760 28878 31268 gene locus_tag LOCUS_14770 gene pheT 28878 31268 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC6 protein_id gnl|my_center|LOCUS_14770 31942 31379 gene locus_tag LOCUS_14780 31942 31379 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_14780 32229 32678 gene locus_tag LOCUS_14790 32229 32678 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_14790 32870 33091 gene locus_tag LOCUS_14800 32870 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 33119 33733 gene locus_tag LOCUS_14810 33119 33733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 34502 33741 gene locus_tag LOCUS_14820 34502 33741 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_14820 35288 34515 gene locus_tag LOCUS_14830 35288 34515 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z2 protein_id gnl|my_center|LOCUS_14830 35566 36921 gene locus_tag LOCUS_14840 35566 36921 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_14840 37340 36942 gene locus_tag LOCUS_14850 37340 36942 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_14850 38367 37354 gene locus_tag LOCUS_14860 38367 37354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268266.1 protein_id gnl|my_center|LOCUS_14860 39715 38393 gene locus_tag LOCUS_14870 39715 38393 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_14870 39876 40859 gene locus_tag LOCUS_14880 39876 40859 CDS product 10 TMS drug/metabolite efflux pump (DME) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073755.1 protein_id gnl|my_center|LOCUS_14880 41407 43353 gene locus_tag LOCUS_14890 41407 43353 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529362.1 protein_id gnl|my_center|LOCUS_14890 43428 44798 gene locus_tag LOCUS_14900 43428 44798 CDS product UPF0229 protein R01398 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QD3 protein_id gnl|my_center|LOCUS_14900 44795 46339 gene locus_tag LOCUS_14910 44795 46339 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707794.1 protein_id gnl|my_center|LOCUS_14910 46906 46430 gene locus_tag LOCUS_14920 46906 46430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 47277 47759 gene locus_tag LOCUS_14930 47277 47759 CDS product protein-S-isoprenylcysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709235.1 protein_id gnl|my_center|LOCUS_14930 48774 47854 gene locus_tag LOCUS_14940 48774 47854 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_14940 49818 48784 gene locus_tag LOCUS_14950 49818 48784 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59650 protein_id gnl|my_center|LOCUS_14950 51115 49877 gene locus_tag LOCUS_14960 51115 49877 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_14960 51934 51440 gene locus_tag LOCUS_14970 51934 51440 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529229.1 protein_id gnl|my_center|LOCUS_14970 52027 52380 gene locus_tag LOCUS_14980 52027 52380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_14980 52373 52741 gene locus_tag LOCUS_14990 52373 52741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 54103 52796 gene locus_tag LOCUS_15000 gene purA 54103 52796 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MA5 protein_id gnl|my_center|LOCUS_15000 55328 54177 gene locus_tag LOCUS_15010 gene hisZ 55328 54177 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_15010 57062 55497 gene locus_tag LOCUS_15020 57062 55497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 57853 57059 gene locus_tag LOCUS_15030 57853 57059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 59655 58078 gene locus_tag LOCUS_15040 gene serA 59655 58078 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_15040 60910 59756 gene locus_tag LOCUS_15050 gene serC 60910 59756 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_15050 61293 61697 gene locus_tag LOCUS_15060 61293 61697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919353.1 protein_id gnl|my_center|LOCUS_15060 63024 61702 gene locus_tag LOCUS_15070 gene bla 63024 61702 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 protein_id gnl|my_center|LOCUS_15070 63616 63098 gene locus_tag LOCUS_15080 63616 63098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 65994 63628 gene locus_tag LOCUS_15090 gene pepN 65994 63628 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_15090 66896 66084 gene locus_tag LOCUS_15100 66896 66084 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_15100 68200 66905 gene locus_tag LOCUS_15110 gene glmM 68200 66905 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE4 protein_id gnl|my_center|LOCUS_15110 69621 68527 gene locus_tag LOCUS_15120 69621 68527 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_15120 71627 69696 gene locus_tag LOCUS_15130 gene ftsH 71627 69696 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 protein_id gnl|my_center|LOCUS_15130 73127 71775 gene locus_tag LOCUS_15140 gene tilS 73127 71775 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE7 protein_id gnl|my_center|LOCUS_15140 >Feature sequence13 346 179 gene locus_tag LOCUS_15150 gene rpmG 346 179 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZL9 protein_id gnl|my_center|LOCUS_15150 2766 517 gene locus_tag LOCUS_15160 gene rnr 2766 517 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE7 protein_id gnl|my_center|LOCUS_15160 5332 2786 gene locus_tag LOCUS_15170 gene topA 5332 2786 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_15170 6575 5442 gene locus_tag LOCUS_15180 6575 5442 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_15180 7232 6630 gene locus_tag LOCUS_15190 gene plsY 7232 6630 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ47 protein_id gnl|my_center|LOCUS_15190 8535 7246 gene locus_tag LOCUS_15200 gene pyrC 8535 7246 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 protein_id gnl|my_center|LOCUS_15200 9524 8532 gene locus_tag LOCUS_15210 gene pyrB 9524 8532 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H1 protein_id gnl|my_center|LOCUS_15210 10081 9602 gene locus_tag LOCUS_15220 10081 9602 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_15220 10316 12193 gene locus_tag LOCUS_15230 gene thiC 10316 12193 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TI9 protein_id gnl|my_center|LOCUS_15230 12872 13462 gene locus_tag LOCUS_15240 12872 13462 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918865.1 protein_id gnl|my_center|LOCUS_15240 13553 14710 gene locus_tag LOCUS_15250 13553 14710 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_15250 14939 18265 gene locus_tag LOCUS_15260 14939 18265 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_15260 18516 21449 gene locus_tag LOCUS_15270 18516 21449 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_15270 21764 22996 gene locus_tag LOCUS_15280 gene argG 21764 22996 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV0 protein_id gnl|my_center|LOCUS_15280 23062 23607 gene locus_tag LOCUS_15290 23062 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 24818 23634 gene locus_tag LOCUS_15300 24818 23634 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_15300 25562 25119 gene locus_tag LOCUS_15310 25562 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061418.1 protein_id gnl|my_center|LOCUS_15310 26322 25828 gene locus_tag LOCUS_15320 26322 25828 CDS product aromatic 1,2-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086185.1 protein_id gnl|my_center|LOCUS_15320 27647 26319 gene locus_tag LOCUS_15330 27647 26319 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086184.1 protein_id gnl|my_center|LOCUS_15330 28378 27659 gene locus_tag LOCUS_15340 28378 27659 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 protein_id gnl|my_center|LOCUS_15340 28760 28365 gene locus_tag LOCUS_15350 28760 28365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 29944 28763 gene locus_tag LOCUS_15360 29944 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086213.1 protein_id gnl|my_center|LOCUS_15360 31563 29941 gene locus_tag LOCUS_15370 31563 29941 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086186.1 protein_id gnl|my_center|LOCUS_15370 32188 31712 gene locus_tag LOCUS_15380 32188 31712 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553253.1 protein_id gnl|my_center|LOCUS_15380 32329 35847 gene locus_tag LOCUS_15390 32329 35847 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088094.1 protein_id gnl|my_center|LOCUS_15390 35900 36967 gene locus_tag LOCUS_15400 gene ldh 35900 36967 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_15400 37126 37971 gene locus_tag LOCUS_15410 gene kynA 37126 37971 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CK2 protein_id gnl|my_center|LOCUS_15410 38851 37982 gene locus_tag LOCUS_15420 38851 37982 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_15420 39004 39630 gene locus_tag LOCUS_15430 39004 39630 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385685.1 protein_id gnl|my_center|LOCUS_15430 39631 40866 gene locus_tag LOCUS_15440 gene kynU 39631 40866 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP4 protein_id gnl|my_center|LOCUS_15440 41295 42224 gene locus_tag LOCUS_15450 41295 42224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 43079 42309 gene locus_tag LOCUS_15460 43079 42309 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_15460 43428 43084 gene locus_tag LOCUS_15470 gene erpA 43428 43084 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q6 protein_id gnl|my_center|LOCUS_15470 43636 44838 gene locus_tag LOCUS_15480 43636 44838 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTG5 protein_id gnl|my_center|LOCUS_15480 44835 46586 gene locus_tag LOCUS_15490 gene argS 44835 46586 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3V3 protein_id gnl|my_center|LOCUS_15490 46629 47510 gene locus_tag LOCUS_15500 46629 47510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 47528 48553 gene locus_tag LOCUS_15510 47528 48553 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_15510 48556 49236 gene locus_tag LOCUS_15520 48556 49236 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_15520 49243 50058 gene locus_tag LOCUS_15530 49243 50058 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 protein_id gnl|my_center|LOCUS_15530 50061 50657 gene locus_tag LOCUS_15540 50061 50657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 50808 51041 gene locus_tag LOCUS_15550 50808 51041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 51061 51420 gene locus_tag LOCUS_15560 51061 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 51417 52238 gene locus_tag LOCUS_15570 gene tatC 51417 52238 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH4 protein_id gnl|my_center|LOCUS_15570 52231 53505 gene locus_tag LOCUS_15580 gene serS 52231 53505 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q22 protein_id gnl|my_center|LOCUS_15580 53505 54284 gene locus_tag LOCUS_15590 gene surE 53505 54284 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6T5 protein_id gnl|my_center|LOCUS_15590 54284 54940 gene locus_tag LOCUS_15600 gene pcm 54284 54940 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E332 protein_id gnl|my_center|LOCUS_15600 54964 56010 gene locus_tag LOCUS_15610 54964 56010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 56202 57398 gene locus_tag LOCUS_15620 56202 57398 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708796.1 protein_id gnl|my_center|LOCUS_15620 57720 58451 gene locus_tag LOCUS_15630 57720 58451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 59529 58672 gene locus_tag LOCUS_15640 59529 58672 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 protein_id gnl|my_center|LOCUS_15640 59699 60049 gene locus_tag LOCUS_15650 59699 60049 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_15650 60098 61714 gene locus_tag LOCUS_15660 gene secD 60098 61714 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 protein_id gnl|my_center|LOCUS_15660 61731 62678 gene locus_tag LOCUS_15670 gene secF 61731 62678 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L14 protein_id gnl|my_center|LOCUS_15670 62714 63091 gene locus_tag LOCUS_15680 62714 63091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_15680 63296 63775 gene locus_tag LOCUS_15690 63296 63775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 63791 64015 gene locus_tag LOCUS_15700 63791 64015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 65430 64135 gene locus_tag LOCUS_15710 65430 64135 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K7 protein_id gnl|my_center|LOCUS_15710 67261 65567 gene locus_tag LOCUS_15720 67261 65567 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_15720 68098 67388 gene locus_tag LOCUS_15730 68098 67388 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_15730 68952 68131 gene locus_tag LOCUS_15740 gene map 68952 68131 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_15740 69676 68963 gene locus_tag LOCUS_15750 gene sfsA 69676 68963 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF6 protein_id gnl|my_center|LOCUS_15750 69740 70498 gene locus_tag LOCUS_15760 69740 70498 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence14 723 211 gene locus_tag LOCUS_15770 723 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265683.1 protein_id gnl|my_center|LOCUS_15770 1267 716 gene locus_tag LOCUS_15780 1267 716 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_15780 1906 1388 gene locus_tag LOCUS_15790 1906 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526271.1 protein_id gnl|my_center|LOCUS_15790 2189 4795 gene locus_tag LOCUS_15800 2189 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919359.1 protein_id gnl|my_center|LOCUS_15800 6027 4909 gene locus_tag LOCUS_15810 6027 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_15810 6239 7768 gene locus_tag LOCUS_15820 gene dagA 6239 7768 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_15820 7806 8189 gene locus_tag LOCUS_15830 7806 8189 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969576.1 protein_id gnl|my_center|LOCUS_15830 8367 9116 gene locus_tag LOCUS_15840 8367 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 9687 9145 gene locus_tag LOCUS_15850 9687 9145 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389313.1 protein_id gnl|my_center|LOCUS_15850 9860 10087 gene locus_tag LOCUS_15860 9860 10087 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_15860 10311 10123 gene locus_tag LOCUS_15870 10311 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 10517 11074 gene locus_tag LOCUS_15880 10517 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_15880 11236 11054 gene locus_tag LOCUS_15890 11236 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 11178 12158 gene locus_tag LOCUS_15900 11178 12158 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_15900 12875 12144 gene locus_tag LOCUS_15910 12875 12144 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920496.1 protein_id gnl|my_center|LOCUS_15910 13804 13154 gene locus_tag LOCUS_15920 13804 13154 CDS product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 protein_id gnl|my_center|LOCUS_15920 16338 13954 gene locus_tag LOCUS_15930 16338 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 16473 16742 gene locus_tag LOCUS_15940 16473 16742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 16751 17662 gene locus_tag LOCUS_15950 16751 17662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_15950 18310 17726 gene locus_tag LOCUS_15960 18310 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 20127 18361 gene locus_tag LOCUS_15970 20127 18361 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_15970 20544 20469 gene locus_tag LOCUS_t00190 20544 20469 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22460 20649 gene locus_tag LOCUS_15980 22460 20649 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_15980 23445 22471 gene locus_tag LOCUS_15990 23445 22471 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD76 protein_id gnl|my_center|LOCUS_15990 24827 23535 gene locus_tag LOCUS_16000 24827 23535 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_16000 26042 24828 gene locus_tag LOCUS_16010 26042 24828 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_16010 26242 28038 gene locus_tag LOCUS_16020 26242 28038 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_16020 28619 28065 gene locus_tag LOCUS_16030 28619 28065 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_16030 29781 28648 gene locus_tag LOCUS_16040 gene argC 29781 28648 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRM4 protein_id gnl|my_center|LOCUS_16040 31136 29919 gene locus_tag LOCUS_16050 31136 29919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 32708 31308 gene locus_tag LOCUS_16060 32708 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 33379 32882 gene locus_tag LOCUS_16070 gene rpsI 33379 32882 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H6 protein_id gnl|my_center|LOCUS_16070 33846 33382 gene locus_tag LOCUS_16080 gene rplM 33846 33382 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFZ7 protein_id gnl|my_center|LOCUS_16080 34166 35452 gene locus_tag LOCUS_16090 34166 35452 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 protein_id gnl|my_center|LOCUS_16090 35539 35970 gene locus_tag LOCUS_16100 35539 35970 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969051.1 protein_id gnl|my_center|LOCUS_16100 36354 36034 gene locus_tag LOCUS_16110 36354 36034 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_16110 37376 36351 gene locus_tag LOCUS_16120 gene ctaA 37376 36351 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_16120 37502 37711 gene locus_tag LOCUS_16130 37502 37711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 40007 37701 gene locus_tag LOCUS_16140 gene maeB 40007 37701 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_16140 41350 40244 gene locus_tag LOCUS_16150 41350 40244 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN15 protein_id gnl|my_center|LOCUS_16150 41468 41956 gene locus_tag LOCUS_16160 41468 41956 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391432.1 protein_id gnl|my_center|LOCUS_16160 42719 41949 gene locus_tag LOCUS_16170 42719 41949 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_16170 43771 42716 gene locus_tag LOCUS_16180 43771 42716 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_16180 45016 43805 gene locus_tag LOCUS_16190 45016 43805 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_16190 45373 45762 gene locus_tag LOCUS_16200 45373 45762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 45894 45818 gene locus_tag LOCUS_t00200 45894 45818 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 46418 45972 gene locus_tag LOCUS_16210 46418 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 46807 46505 gene locus_tag LOCUS_16220 gene ihfA 46807 46505 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 protein_id gnl|my_center|LOCUS_16220 47926 46949 gene locus_tag LOCUS_16230 gene fabH 47926 46949 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 protein_id gnl|my_center|LOCUS_16230 48984 47923 gene locus_tag LOCUS_16240 gene plsX 48984 47923 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 protein_id gnl|my_center|LOCUS_16240 49634 49149 gene locus_tag LOCUS_16250 49634 49149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 50257 49721 gene locus_tag LOCUS_16260 50257 49721 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_16260 50435 50914 gene locus_tag LOCUS_16270 50435 50914 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 protein_id gnl|my_center|LOCUS_16270 51506 51006 gene locus_tag LOCUS_16280 51506 51006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 52576 51581 gene locus_tag LOCUS_16290 gene thiL 52576 51581 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 protein_id gnl|my_center|LOCUS_16290 53127 52669 gene locus_tag LOCUS_16300 gene nusB 53127 52669 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I9 protein_id gnl|my_center|LOCUS_16300 53567 53127 gene locus_tag LOCUS_16310 gene ribH2 53567 53127 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_16310 54728 53589 gene locus_tag LOCUS_16320 54728 53589 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_16320 55345 54746 gene locus_tag LOCUS_16330 55345 54746 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_16330 56459 55347 gene locus_tag LOCUS_16340 56459 55347 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_16340 57025 56555 gene locus_tag LOCUS_16350 gene nrdR 57025 56555 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_16350 58363 57083 gene locus_tag LOCUS_16360 gene glyA2 58363 57083 CDS product serine hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB8 protein_id gnl|my_center|LOCUS_16360 58877 58443 gene locus_tag LOCUS_16370 58877 58443 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_16370 59289 59101 gene locus_tag LOCUS_16380 59289 59101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 60549 59323 gene locus_tag LOCUS_16390 60549 59323 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 protein_id gnl|my_center|LOCUS_16390 61259 60744 gene locus_tag LOCUS_16400 gene mucS 61259 60744 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_16400 61559 62569 gene locus_tag LOCUS_16410 gene hemB 61559 62569 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_16410 63474 62599 gene locus_tag LOCUS_16420 gene motA 63474 62599 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_16420 64133 63897 gene locus_tag LOCUS_16430 64133 63897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 64969 64370 gene locus_tag LOCUS_16440 gene pulO 64969 64370 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4N1 protein_id gnl|my_center|LOCUS_16440 65491 65327 gene locus_tag LOCUS_16450 65491 65327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence15 1159 287 gene locus_tag LOCUS_16460 gene uspE 1159 287 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261910.1 protein_id gnl|my_center|LOCUS_16460 2479 1295 gene locus_tag LOCUS_16470 2479 1295 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_16470 3333 2488 gene locus_tag LOCUS_16480 3333 2488 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_16480 5212 3524 gene locus_tag LOCUS_16490 gene flbA 5212 3524 CDS product protein FlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21296 protein_id gnl|my_center|LOCUS_16490 5396 5821 gene locus_tag LOCUS_16500 gene flbT 5396 5821 CDS product putative flagellum biosynthesis repressor protein FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5S2 protein_id gnl|my_center|LOCUS_16500 5781 6215 gene locus_tag LOCUS_16510 gene flaF 5781 6215 CDS product flagellar biosynthesis regulatory protein FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919335.1 protein_id gnl|my_center|LOCUS_16510 6500 7342 gene locus_tag LOCUS_16520 gene fljJ 6500 7342 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 protein_id gnl|my_center|LOCUS_16520 7529 7984 gene locus_tag LOCUS_16530 7529 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9006 8176 gene locus_tag LOCUS_16540 gene fljJ 9006 8176 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8A4 protein_id gnl|my_center|LOCUS_16540 9786 9289 gene locus_tag LOCUS_16550 9786 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10146 9796 gene locus_tag LOCUS_16560 10146 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11288 10146 gene locus_tag LOCUS_16570 gene flgI 11288 10146 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE9 protein_id gnl|my_center|LOCUS_16570 11681 12103 gene locus_tag LOCUS_16580 11681 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 12276 12692 gene locus_tag LOCUS_16590 gene dksA 12276 12692 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 protein_id gnl|my_center|LOCUS_16590 13233 12841 gene locus_tag LOCUS_16600 gene yciA 13233 12841 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_16600 14006 13311 gene locus_tag LOCUS_16610 14006 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 15865 14108 gene locus_tag LOCUS_16620 15865 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 19642 15974 gene locus_tag LOCUS_16630 19642 15974 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_16630 19985 20383 gene locus_tag LOCUS_16640 19985 20383 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 protein_id gnl|my_center|LOCUS_16640 20422 20865 gene locus_tag LOCUS_16650 20422 20865 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_16650 20858 21319 gene locus_tag LOCUS_16660 20858 21319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 protein_id gnl|my_center|LOCUS_16660 21912 21256 gene locus_tag LOCUS_16670 gene aat 21912 21256 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A741 protein_id gnl|my_center|LOCUS_16670 23255 21909 gene locus_tag LOCUS_16680 23255 21909 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_16680 23727 23269 gene locus_tag LOCUS_16690 gene accB 23727 23269 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_16690 24188 23757 gene locus_tag LOCUS_16700 gene aroQ 24188 23757 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_16700 24432 24644 gene locus_tag LOCUS_16710 gene thiS 24432 24644 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941252.1 protein_id gnl|my_center|LOCUS_16710 24637 25407 gene locus_tag LOCUS_16720 gene thiG 24637 25407 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_16720 26295 25549 gene locus_tag LOCUS_16730 26295 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 27840 26389 gene locus_tag LOCUS_16740 27840 26389 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_16740 30607 28010 gene locus_tag LOCUS_16750 gene rne 30607 28010 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4J9 protein_id gnl|my_center|LOCUS_16750 31143 32363 gene locus_tag LOCUS_16760 31143 32363 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_16760 32540 35005 gene locus_tag LOCUS_16770 32540 35005 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_16770 35223 36188 gene locus_tag LOCUS_16780 gene prfB 35223 36188 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QJ2 protein_id gnl|my_center|LOCUS_16780 36724 36308 gene locus_tag LOCUS_16790 36724 36308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 37949 36738 gene locus_tag LOCUS_16800 37949 36738 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 protein_id gnl|my_center|LOCUS_16800 38747 38136 gene locus_tag LOCUS_16810 38747 38136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 38628 38945 gene locus_tag LOCUS_16820 38628 38945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 39411 38950 gene locus_tag LOCUS_16830 39411 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 42465 39451 gene locus_tag LOCUS_16840 gene glnE 42465 39451 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 protein_id gnl|my_center|LOCUS_16840 42563 45808 gene locus_tag LOCUS_16850 42563 45808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_16850 47170 45899 gene locus_tag LOCUS_16860 gene tyrS 47170 45899 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 protein_id gnl|my_center|LOCUS_16860 47259 48440 gene locus_tag LOCUS_16870 gene anmK 47259 48440 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 protein_id gnl|my_center|LOCUS_16870 49167 48526 gene locus_tag LOCUS_16880 49167 48526 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720607.1 protein_id gnl|my_center|LOCUS_16880 49381 50136 gene locus_tag LOCUS_16890 49381 50136 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_16890 50144 51271 gene locus_tag LOCUS_16900 50144 51271 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_16900 51268 52431 gene locus_tag LOCUS_16910 gene iscS 51268 52431 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 protein_id gnl|my_center|LOCUS_16910 53396 52464 gene locus_tag LOCUS_16920 53396 52464 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJH2 protein_id gnl|my_center|LOCUS_16920 54188 53397 gene locus_tag LOCUS_16930 54188 53397 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_16930 54777 54430 gene locus_tag LOCUS_16940 54777 54430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 55637 54969 gene locus_tag LOCUS_16950 55637 54969 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 protein_id gnl|my_center|LOCUS_16950 55702 56430 gene locus_tag LOCUS_16960 55702 56430 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 protein_id gnl|my_center|LOCUS_16960 56415 58985 gene locus_tag LOCUS_16970 56415 58985 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_16970 61110 59530 gene locus_tag LOCUS_16980 61110 59530 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence16 189 3344 gene locus_tag LOCUS_16990 189 3344 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067322.1 protein_id gnl|my_center|LOCUS_16990 3388 3774 gene locus_tag LOCUS_17000 3388 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3916 4455 gene locus_tag LOCUS_17010 3916 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7352 4491 gene locus_tag LOCUS_17020 gene fdhF 7352 4491 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195994.1 protein_id gnl|my_center|LOCUS_17020 8934 7357 gene locus_tag LOCUS_17030 gene fdsB 8934 7357 CDS product NAD-dependent formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_17030 9416 8931 gene locus_tag LOCUS_17040 gene nuoE 9416 8931 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 protein_id gnl|my_center|LOCUS_17040 10435 9575 gene locus_tag LOCUS_17050 10435 9575 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CB24 protein_id gnl|my_center|LOCUS_17050 11541 10435 gene locus_tag LOCUS_17060 11541 10435 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_17060 14332 11660 gene locus_tag LOCUS_17070 14332 11660 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967604.1 protein_id gnl|my_center|LOCUS_17070 15884 14343 gene locus_tag LOCUS_17080 15884 14343 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088812.1 protein_id gnl|my_center|LOCUS_17080 17482 15965 gene locus_tag LOCUS_17090 17482 15965 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_17090 18831 17563 gene locus_tag LOCUS_17100 18831 17563 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_17100 19483 18926 gene locus_tag LOCUS_17110 19483 18926 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V70 protein_id gnl|my_center|LOCUS_17110 20052 19483 gene locus_tag LOCUS_17120 20052 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 20740 20141 gene locus_tag LOCUS_17130 20740 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 21033 22472 gene locus_tag LOCUS_17140 gene cobQ 21033 22472 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR0 protein_id gnl|my_center|LOCUS_17140 22825 23436 gene locus_tag LOCUS_17150 22825 23436 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_17150 23429 24826 gene locus_tag LOCUS_17160 23429 24826 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598577.1 protein_id gnl|my_center|LOCUS_17160 24838 25860 gene locus_tag LOCUS_17170 24838 25860 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886238.1 protein_id gnl|my_center|LOCUS_17170 26029 25877 gene locus_tag LOCUS_17180 26029 25877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 26348 27355 gene locus_tag LOCUS_17190 26348 27355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_17190 27352 28176 gene locus_tag LOCUS_17200 27352 28176 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_17200 28949 28149 gene locus_tag LOCUS_17210 gene hutG 28949 28149 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064863.1 protein_id gnl|my_center|LOCUS_17210 30483 28942 gene locus_tag LOCUS_17220 gene hutH 30483 28942 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LJ6 protein_id gnl|my_center|LOCUS_17220 32137 30488 gene locus_tag LOCUS_17230 gene hutU 32137 30488 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V80 protein_id gnl|my_center|LOCUS_17230 32988 32266 gene locus_tag LOCUS_17240 gene hutC 32988 32266 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211280.1 protein_id gnl|my_center|LOCUS_17240 34399 33029 gene locus_tag LOCUS_17250 34399 33029 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_17250 34491 35726 gene locus_tag LOCUS_17260 gene hutI 34491 35726 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUU1 protein_id gnl|my_center|LOCUS_17260 37158 35767 gene locus_tag LOCUS_17270 37158 35767 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 protein_id gnl|my_center|LOCUS_17270 37450 38823 gene locus_tag LOCUS_17280 gene ykoK 37450 38823 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM21 protein_id gnl|my_center|LOCUS_17280 38849 39838 gene locus_tag LOCUS_17290 gene ansA 38849 39838 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_17290 39953 40234 gene locus_tag LOCUS_17300 39953 40234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 40535 41002 gene locus_tag LOCUS_17310 40535 41002 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809351.1 protein_id gnl|my_center|LOCUS_17310 42282 41035 gene locus_tag LOCUS_17320 42282 41035 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_17320 42393 42584 gene locus_tag LOCUS_17330 42393 42584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 43089 42613 gene locus_tag LOCUS_17340 43089 42613 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 protein_id gnl|my_center|LOCUS_17340 44723 43149 gene locus_tag LOCUS_17350 44723 43149 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_17350 45005 44805 gene locus_tag LOCUS_17360 45005 44805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 45104 47503 gene locus_tag LOCUS_17370 45104 47503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_17370 47675 48652 gene locus_tag LOCUS_17380 gene eutR 47675 48652 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_17380 48896 49681 gene locus_tag LOCUS_17390 gene bacC 48896 49681 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 protein_id gnl|my_center|LOCUS_17390 49706 50926 gene locus_tag LOCUS_17400 49706 50926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 protein_id gnl|my_center|LOCUS_17400 51519 51085 gene locus_tag LOCUS_17410 51519 51085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 51994 51521 gene locus_tag LOCUS_17420 51994 51521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 52553 51996 gene locus_tag LOCUS_17430 52553 51996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 53187 52573 gene locus_tag LOCUS_17440 53187 52573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 53731 53180 gene locus_tag LOCUS_17450 53731 53180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 54896 53742 gene locus_tag LOCUS_17460 54896 53742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 <56235 54956 gene locus_tag LOCUS_17470 <56235 54956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918074.1:TonB-dependent receptor >Feature sequence17 809 96 gene locus_tag LOCUS_17480 809 96 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_17480 1381 2565 gene locus_tag LOCUS_17490 1381 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3442 2801 gene locus_tag LOCUS_17500 3442 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4147 3575 gene locus_tag LOCUS_17510 4147 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4282 5727 gene locus_tag LOCUS_17520 gene rimK 4282 5727 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_17520 6565 5756 gene locus_tag LOCUS_17530 6565 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921519.1 protein_id gnl|my_center|LOCUS_17530 6750 7691 gene locus_tag LOCUS_17540 6750 7691 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_17540 7815 8747 gene locus_tag LOCUS_17550 7815 8747 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_17550 8740 9810 gene locus_tag LOCUS_17560 8740 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17560 9841 12471 gene locus_tag LOCUS_17570 9841 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17570 13607 12657 gene locus_tag LOCUS_17580 gene ubiA 13607 12657 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 protein_id gnl|my_center|LOCUS_17580 13650 14432 gene locus_tag LOCUS_17590 13650 14432 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_17590 14500 15291 gene locus_tag LOCUS_17600 14500 15291 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_17600 15336 16100 gene locus_tag LOCUS_17610 15336 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 16271 17641 gene locus_tag LOCUS_17620 16271 17641 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_17620 17875 18324 gene locus_tag LOCUS_17630 17875 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 19849 18359 gene locus_tag LOCUS_17640 19849 18359 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_17640 20248 21084 gene locus_tag LOCUS_17650 gene coxB 20248 21084 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6E5 protein_id gnl|my_center|LOCUS_17650 21105 22733 gene locus_tag LOCUS_17660 gene ctaD 21105 22733 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 protein_id gnl|my_center|LOCUS_17660 22868 23788 gene locus_tag LOCUS_17670 gene ctaB 22868 23788 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_17670 23788 23907 gene locus_tag LOCUS_17680 23788 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 23916 24467 gene locus_tag LOCUS_17690 gene ctaG 23916 24467 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_17690 24532 25347 gene locus_tag LOCUS_17700 24532 25347 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_17700 25356 25757 gene locus_tag LOCUS_17710 25356 25757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_17710 25754 26485 gene locus_tag LOCUS_17720 25754 26485 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Y02 protein_id gnl|my_center|LOCUS_17720 26576 27967 gene locus_tag LOCUS_17730 26576 27967 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974738.1 protein_id gnl|my_center|LOCUS_17730 28013 29269 gene locus_tag LOCUS_17740 28013 29269 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_17740 29460 29753 gene locus_tag LOCUS_17750 29460 29753 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_17750 30558 29950 gene locus_tag LOCUS_17760 gene gst 30558 29950 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 protein_id gnl|my_center|LOCUS_17760 31686 30580 gene locus_tag LOCUS_17770 31686 30580 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_17770 32009 32530 gene locus_tag LOCUS_17780 32009 32530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 32608 33381 gene locus_tag LOCUS_17790 32608 33381 CDS product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 protein_id gnl|my_center|LOCUS_17790 33503 36982 gene locus_tag LOCUS_17800 gene smc 33503 36982 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Y9 protein_id gnl|my_center|LOCUS_17800 37187 37525 gene locus_tag LOCUS_17810 gene atpI 37187 37525 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7H7 protein_id gnl|my_center|LOCUS_17810 37571 38314 gene locus_tag LOCUS_17820 gene atpB 37571 38314 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T933 protein_id gnl|my_center|LOCUS_17820 38414 38638 gene locus_tag LOCUS_17830 gene atpC 38414 38638 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007599451.1 protein_id gnl|my_center|LOCUS_17830 38735 39304 gene locus_tag LOCUS_17840 38735 39304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 39297 39887 gene locus_tag LOCUS_17850 gene atpF 39297 39887 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T930 protein_id gnl|my_center|LOCUS_17850 40069 40569 gene locus_tag LOCUS_17860 40069 40569 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_17860 40752 41354 gene locus_tag LOCUS_17870 40752 41354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_17870 42153 41401 gene locus_tag LOCUS_17880 42153 41401 CDS product proline hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920346.1 protein_id gnl|my_center|LOCUS_17880 42487 42155 gene locus_tag LOCUS_17890 42487 42155 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_17890 43816 42500 gene locus_tag LOCUS_17900 43816 42500 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_17900 47557 43946 gene locus_tag LOCUS_17910 gene oplaH 47557 43946 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_17910 47688 48410 gene locus_tag LOCUS_17920 47688 48410 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_17920 48431 49315 gene locus_tag LOCUS_17930 48431 49315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 protein_id gnl|my_center|LOCUS_17930 49338 50093 gene locus_tag LOCUS_17940 49338 50093 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_17940 50309 50100 gene locus_tag LOCUS_17950 50309 50100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence18 744 139 gene locus_tag LOCUS_17960 744 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1400 756 gene locus_tag LOCUS_17970 1400 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2444 1473 gene locus_tag LOCUS_17980 2444 1473 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_17980 3427 2447 gene locus_tag LOCUS_17990 3427 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5208 3481 gene locus_tag LOCUS_18000 5208 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 6471 5215 gene locus_tag LOCUS_18010 6471 5215 CDS product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193520.1 protein_id gnl|my_center|LOCUS_18010 7102 6482 gene locus_tag LOCUS_18020 7102 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8611 7115 gene locus_tag LOCUS_18030 8611 7115 CDS product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 protein_id gnl|my_center|LOCUS_18030 9495 8614 gene locus_tag LOCUS_18040 gene ctpC 9495 8614 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 protein_id gnl|my_center|LOCUS_18040 10035 9508 gene locus_tag LOCUS_18050 gene cpaA1 10035 9508 CDS product type 4 prepilin peptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968379.1 protein_id gnl|my_center|LOCUS_18050 10350 10171 gene locus_tag LOCUS_18060 10350 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 10607 10431 gene locus_tag LOCUS_18070 gene pilA1 10607 10431 CDS product PilA pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709934.1 protein_id gnl|my_center|LOCUS_18070 13274 10908 gene locus_tag LOCUS_18080 13274 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 13481 13654 gene locus_tag LOCUS_18090 13481 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 13658 14134 gene locus_tag LOCUS_18100 13658 14134 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_18100 14353 15006 gene locus_tag LOCUS_18110 14353 15006 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_18110 15620 15072 gene locus_tag LOCUS_18120 15620 15072 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_18120 16326 15853 gene locus_tag LOCUS_18130 gene greA 16326 15853 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_18130 19738 16439 gene locus_tag LOCUS_18140 19738 16439 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_18140 20921 19731 gene locus_tag LOCUS_18150 gene carA 20921 19731 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_18150 21012 21191 gene locus_tag LOCUS_18160 21012 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 21302 21757 gene locus_tag LOCUS_18170 21302 21757 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_18170 21823 23778 gene locus_tag LOCUS_18180 gene dnaG 21823 23778 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N97 protein_id gnl|my_center|LOCUS_18180 23974 26058 gene locus_tag LOCUS_18190 gene rpoD 23974 26058 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM5 protein_id gnl|my_center|LOCUS_18190 26092 26364 gene locus_tag LOCUS_18200 26092 26364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 26578 26502 gene locus_tag LOCUS_t00210 26578 26502 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27698 26799 gene locus_tag LOCUS_18210 27698 26799 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090353.1 protein_id gnl|my_center|LOCUS_18210 28684 27689 gene locus_tag LOCUS_18220 28684 27689 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090354.1 protein_id gnl|my_center|LOCUS_18220 29301 28681 gene locus_tag LOCUS_18230 29301 28681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 29612 29932 gene locus_tag LOCUS_18240 29612 29932 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 protein_id gnl|my_center|LOCUS_18240 30365 30048 gene locus_tag LOCUS_18250 30365 30048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 32129 30660 gene locus_tag LOCUS_18260 32129 30660 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_18260 33254 32151 gene locus_tag LOCUS_18270 33254 32151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 35541 33304 gene locus_tag LOCUS_18280 gene fyuA 35541 33304 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_18280 36945 35776 gene locus_tag LOCUS_18290 36945 35776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 40096 37019 gene locus_tag LOCUS_18300 gene oar 40096 37019 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_18300 41367 40420 gene locus_tag LOCUS_18310 41367 40420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_18310 41720 41415 gene locus_tag LOCUS_18320 41720 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 42023 41757 gene locus_tag LOCUS_18330 42023 41757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 42910 42047 gene locus_tag LOCUS_18340 gene nodI 42910 42047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_18340 43305 42925 gene locus_tag LOCUS_18350 43305 42925 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_18350 43424 43260 gene locus_tag LOCUS_18360 43424 43260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 43534 43998 gene locus_tag LOCUS_18370 43534 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_18370 44024 44323 gene locus_tag LOCUS_18380 44024 44323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 44411 45733 gene locus_tag LOCUS_18390 44411 45733 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_18390 45820 47499 gene locus_tag LOCUS_18400 45820 47499 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence19 725 261 gene locus_tag LOCUS_18410 725 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1369 1881 gene locus_tag LOCUS_18420 1369 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3242 2340 gene locus_tag LOCUS_18430 3242 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3683 3886 gene locus_tag LOCUS_18440 3683 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_18440 3890 4519 gene locus_tag LOCUS_18450 3890 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4674 6455 gene locus_tag LOCUS_18460 4674 6455 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_18460 7474 6578 gene locus_tag LOCUS_18470 7474 6578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065109.1 protein_id gnl|my_center|LOCUS_18470 7778 9274 gene locus_tag LOCUS_18480 7778 9274 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389824.1 protein_id gnl|my_center|LOCUS_18480 9356 10492 gene locus_tag LOCUS_18490 9356 10492 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_18490 10557 11612 gene locus_tag LOCUS_18500 10557 11612 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_18500 11664 12551 gene locus_tag LOCUS_18510 11664 12551 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_18510 12869 12555 gene locus_tag LOCUS_18520 12869 12555 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531878.1 protein_id gnl|my_center|LOCUS_18520 13415 12930 gene locus_tag LOCUS_18530 gene lrp 13415 12930 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 protein_id gnl|my_center|LOCUS_18530 13677 13453 gene locus_tag LOCUS_18540 13677 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 14120 14278 gene locus_tag LOCUS_18550 14120 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 14387 15766 gene locus_tag LOCUS_18560 gene sdaA 14387 15766 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_18560 15913 19110 gene locus_tag LOCUS_18570 gene putA 15913 19110 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_18570 22288 19250 gene locus_tag LOCUS_18580 22288 19250 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_18580 23325 23759 gene locus_tag LOCUS_18590 23325 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 24051 24485 gene locus_tag LOCUS_18600 24051 24485 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028073.1 protein_id gnl|my_center|LOCUS_18600 24882 25064 gene locus_tag LOCUS_18610 24882 25064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 25112 27046 gene locus_tag LOCUS_18620 25112 27046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 27280 27876 gene locus_tag LOCUS_18630 27280 27876 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814464.1 protein_id gnl|my_center|LOCUS_18630 28018 29115 gene locus_tag LOCUS_18640 28018 29115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 29441 32089 gene locus_tag LOCUS_18650 29441 32089 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_18650 32236 33372 gene locus_tag LOCUS_18660 32236 33372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 34324 33380 gene locus_tag LOCUS_18670 34324 33380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_18670 35427 34324 gene locus_tag LOCUS_18680 gene ansA 35427 34324 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_18680 35808 35623 gene locus_tag LOCUS_18690 gene rpmF 35808 35623 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE65 protein_id gnl|my_center|LOCUS_18690 36356 36060 gene locus_tag LOCUS_18700 36356 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 36517 36604 gene locus_tag LOCUS_t00220 36517 36604 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36692 36919 gene locus_tag LOCUS_18710 36692 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 37788 37183 gene locus_tag LOCUS_18720 37788 37183 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531635.1 protein_id gnl|my_center|LOCUS_18720 38532 39776 gene locus_tag LOCUS_18730 38532 39776 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MND0 protein_id gnl|my_center|LOCUS_18730 39769 40221 gene locus_tag LOCUS_18740 39769 40221 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_18740 40607 41467 gene locus_tag LOCUS_18750 40607 41467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 42064 41864 gene locus_tag LOCUS_18760 42064 41864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 42124 42396 gene locus_tag LOCUS_18770 42124 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 43210 43022 gene locus_tag LOCUS_18780 43210 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 43621 43382 gene locus_tag LOCUS_18790 43621 43382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 43740 44018 gene locus_tag LOCUS_18800 43740 44018 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727964.1 protein_id gnl|my_center|LOCUS_18800 44114 44890 gene locus_tag LOCUS_18810 44114 44890 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence20 1289 519 gene locus_tag LOCUS_18820 1289 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1636 2769 gene locus_tag LOCUS_18830 1636 2769 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_18830 4597 2903 gene locus_tag LOCUS_18840 4597 2903 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_18840 5340 4696 gene locus_tag LOCUS_18850 5340 4696 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706351.1 protein_id gnl|my_center|LOCUS_18850 7166 5412 gene locus_tag LOCUS_18860 7166 5412 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_18860 9587 7233 gene locus_tag LOCUS_18870 gene fyuA 9587 7233 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_18870 10943 9837 gene locus_tag LOCUS_18880 10943 9837 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_18880 12389 10944 gene locus_tag LOCUS_18890 12389 10944 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_18890 15341 12552 gene locus_tag LOCUS_18900 15341 12552 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 protein_id gnl|my_center|LOCUS_18900 19910 15507 gene locus_tag LOCUS_18910 19910 15507 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_18910 21613 19910 gene locus_tag LOCUS_18920 21613 19910 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_18920 21776 21597 gene locus_tag LOCUS_18930 21776 21597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 22212 23786 gene locus_tag LOCUS_18940 22212 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 protein_id gnl|my_center|LOCUS_18940 24776 23793 gene locus_tag LOCUS_18950 24776 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 25382 24855 gene locus_tag LOCUS_18960 gene paaI 25382 24855 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_18960 25465 26385 gene locus_tag LOCUS_18970 25465 26385 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096751.1 protein_id gnl|my_center|LOCUS_18970 26523 27518 gene locus_tag LOCUS_18980 gene paaA 26523 27518 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_18980 27650 27955 gene locus_tag LOCUS_18990 gene paaB 27650 27955 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_18990 28003 28767 gene locus_tag LOCUS_19000 gene paaC 28003 28767 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 protein_id gnl|my_center|LOCUS_19000 28773 29291 gene locus_tag LOCUS_19010 gene paaD 28773 29291 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551025.1 protein_id gnl|my_center|LOCUS_19010 29388 30470 gene locus_tag LOCUS_19020 gene paaE 29388 30470 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_19020 30731 31432 gene locus_tag LOCUS_19030 30731 31432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 31581 33005 gene locus_tag LOCUS_19040 31581 33005 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533676.1 protein_id gnl|my_center|LOCUS_19040 33079 33429 gene locus_tag LOCUS_19050 33079 33429 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970731.1 protein_id gnl|my_center|LOCUS_19050 33552 34418 gene locus_tag LOCUS_19060 33552 34418 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_19060 35175 34573 gene locus_tag LOCUS_19070 gene cycM 35175 34573 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30323 protein_id gnl|my_center|LOCUS_19070 35430 36296 gene locus_tag LOCUS_19080 35430 36296 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527936.1 protein_id gnl|my_center|LOCUS_19080 38281 36431 gene locus_tag LOCUS_19090 gene ilvD 38281 36431 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 protein_id gnl|my_center|LOCUS_19090 39315 38368 gene locus_tag LOCUS_19100 39315 38368 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_19100 39936 39541 gene locus_tag LOCUS_19110 39936 39541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence21 166 891 gene locus_tag LOCUS_19120 166 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640564.1 protein_id gnl|my_center|LOCUS_19120 904 2730 gene locus_tag LOCUS_19130 904 2730 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920557.1 protein_id gnl|my_center|LOCUS_19130 5140 2756 gene locus_tag LOCUS_19140 5140 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 7355 5178 gene locus_tag LOCUS_19150 7355 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 10229 7485 gene locus_tag LOCUS_19160 10229 7485 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920555.1 protein_id gnl|my_center|LOCUS_19160 11661 10564 gene locus_tag LOCUS_19170 gene fpvR 11661 10564 CDS product protein FpvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115643.1 protein_id gnl|my_center|LOCUS_19170 12242 11670 gene locus_tag LOCUS_19180 12242 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 13516 12818 gene locus_tag LOCUS_19190 13516 12818 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084685.1 protein_id gnl|my_center|LOCUS_19190 13876 14058 gene locus_tag LOCUS_19200 13876 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 13973 15460 gene locus_tag LOCUS_19210 gene phoA 13973 15460 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_19210 15791 16690 gene locus_tag LOCUS_19220 gene cysD 15791 16690 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A881 protein_id gnl|my_center|LOCUS_19220 16690 18624 gene locus_tag LOCUS_19230 16690 18624 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_19230 18935 19333 gene locus_tag LOCUS_19240 18935 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205759.1 protein_id gnl|my_center|LOCUS_19240 19375 19995 gene locus_tag LOCUS_19250 gene gst 19375 19995 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_19250 20032 21288 gene locus_tag LOCUS_19260 20032 21288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_19260 21348 22007 gene locus_tag LOCUS_19270 21348 22007 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_19270 22301 22513 gene locus_tag LOCUS_19280 22301 22513 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_19280 22515 22718 gene locus_tag LOCUS_19290 22515 22718 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_19290 22754 25396 gene locus_tag LOCUS_19300 22754 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 25393 26190 gene locus_tag LOCUS_19310 25393 26190 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_19310 26238 27620 gene locus_tag LOCUS_19320 26238 27620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 28499 27933 gene locus_tag LOCUS_19330 28499 27933 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_19330 28780 28589 gene locus_tag LOCUS_19340 28780 28589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 29970 31088 gene locus_tag LOCUS_19350 gene sdh 29970 31088 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338705.1 protein_id gnl|my_center|LOCUS_19350 31125 32300 gene locus_tag LOCUS_19360 31125 32300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 34198 32555 gene locus_tag LOCUS_19370 34198 32555 CDS product (2S)-methylsuccinyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_19370 35521 34211 gene locus_tag LOCUS_19380 35521 34211 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_19380 35842 37824 gene locus_tag LOCUS_19390 35842 37824 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_19390 37869 38261 gene locus_tag LOCUS_19400 37869 38261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390973.1 protein_id gnl|my_center|LOCUS_19400 38233 38949 gene locus_tag LOCUS_19410 38233 38949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 protein_id gnl|my_center|LOCUS_19410 39021 39767 gene locus_tag LOCUS_19420 39021 39767 CDS product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence22 310 128 gene locus_tag LOCUS_19430 310 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 851 546 gene locus_tag LOCUS_19440 851 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 759 1874 gene locus_tag LOCUS_19450 759 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2063 2281 gene locus_tag LOCUS_19460 2063 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4999 2420 gene locus_tag LOCUS_19470 gene clpB 4999 2420 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWD8 protein_id gnl|my_center|LOCUS_19470 6478 5546 gene locus_tag LOCUS_19480 6478 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 7504 6695 gene locus_tag LOCUS_19490 gene prmC 7504 6695 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X6 protein_id gnl|my_center|LOCUS_19490 8635 7556 gene locus_tag LOCUS_19500 gene prfA 8635 7556 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCF2 protein_id gnl|my_center|LOCUS_19500 9952 8702 gene locus_tag LOCUS_19510 gene hisS 9952 8702 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_19510 11107 9974 gene locus_tag LOCUS_19520 gene ispG 11107 9974 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 protein_id gnl|my_center|LOCUS_19520 12426 11218 gene locus_tag LOCUS_19530 12426 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 15163 12899 gene locus_tag LOCUS_19540 15163 12899 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529460.1 protein_id gnl|my_center|LOCUS_19540 16351 15305 gene locus_tag LOCUS_19550 16351 15305 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_19550 17563 16361 gene locus_tag LOCUS_19560 17563 16361 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_19560 17871 18560 gene locus_tag LOCUS_19570 gene ubiG 17871 18560 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM5 protein_id gnl|my_center|LOCUS_19570 18566 19387 gene locus_tag LOCUS_19580 gene fdhD 18566 19387 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z7 protein_id gnl|my_center|LOCUS_19580 20008 19400 gene locus_tag LOCUS_19590 gene mobA 20008 19400 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKR0 protein_id gnl|my_center|LOCUS_19590 20579 20061 gene locus_tag LOCUS_19600 20579 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388498.1 protein_id gnl|my_center|LOCUS_19600 21450 20566 gene locus_tag LOCUS_19610 21450 20566 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_19610 21720 21466 gene locus_tag LOCUS_19620 21720 21466 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 protein_id gnl|my_center|LOCUS_19620 22595 21792 gene locus_tag LOCUS_19630 22595 21792 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_19630 22739 23737 gene locus_tag LOCUS_19640 22739 23737 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_19640 23797 24012 gene locus_tag LOCUS_19650 23797 24012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 24679 24044 gene locus_tag LOCUS_19660 gene hmgA 24679 24044 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_19660 25739 24747 gene locus_tag LOCUS_19670 gene fahA 25739 24747 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_19670 26911 25781 gene locus_tag LOCUS_19680 gene hmgA 26911 25781 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_19680 27135 27596 gene locus_tag LOCUS_19690 27135 27596 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_19690 29052 27634 gene locus_tag LOCUS_19700 29052 27634 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE1 protein_id gnl|my_center|LOCUS_19700 29448 29203 gene locus_tag LOCUS_19710 29448 29203 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_19710 29502 29930 gene locus_tag LOCUS_19720 29502 29930 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_19720 31670 30051 gene locus_tag LOCUS_19730 31670 30051 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088817.1 protein_id gnl|my_center|LOCUS_19730 32958 31783 gene locus_tag LOCUS_19740 32958 31783 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_19740 33769 32960 gene locus_tag LOCUS_19750 33769 32960 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_19750 34340 33834 gene locus_tag LOCUS_19760 34340 33834 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 protein_id gnl|my_center|LOCUS_19760 35117 34350 gene locus_tag LOCUS_19770 35117 34350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_19770 37467 35143 gene locus_tag LOCUS_19780 37467 35143 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_19780 37752 38174 gene locus_tag LOCUS_19790 37752 38174 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814990.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence23 164 481 gene locus_tag LOCUS_19800 gene rpsJ 164 481 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_19800 487 1254 gene locus_tag LOCUS_19810 gene rplC 487 1254 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QH0 protein_id gnl|my_center|LOCUS_19810 1260 1880 gene locus_tag LOCUS_19820 gene rplD 1260 1880 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V2 protein_id gnl|my_center|LOCUS_19820 1877 2170 gene locus_tag LOCUS_19830 gene rplW 1877 2170 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE20 protein_id gnl|my_center|LOCUS_19830 2174 3007 gene locus_tag LOCUS_19840 gene rplB 2174 3007 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE21 protein_id gnl|my_center|LOCUS_19840 3020 3298 gene locus_tag LOCUS_19850 gene rpsS 3020 3298 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U863 protein_id gnl|my_center|LOCUS_19850 3304 3684 gene locus_tag LOCUS_19860 gene rplV 3304 3684 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 protein_id gnl|my_center|LOCUS_19860 3684 4382 gene locus_tag LOCUS_19870 gene rpsC 3684 4382 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U865 protein_id gnl|my_center|LOCUS_19870 4401 4814 gene locus_tag LOCUS_19880 gene rplP 4401 4814 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_19880 4830 5039 gene locus_tag LOCUS_19890 gene rpmC 4830 5039 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD2 protein_id gnl|my_center|LOCUS_19890 5062 5295 gene locus_tag LOCUS_19900 gene rpsQ 5062 5295 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R3 protein_id gnl|my_center|LOCUS_19900 5347 5715 gene locus_tag LOCUS_19910 gene rplN 5347 5715 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 protein_id gnl|my_center|LOCUS_19910 5715 6044 gene locus_tag LOCUS_19920 gene rplX 5715 6044 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_19920 6037 6588 gene locus_tag LOCUS_19930 gene rplE 6037 6588 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5R0 protein_id gnl|my_center|LOCUS_19930 6614 6919 gene locus_tag LOCUS_19940 gene rpsN 6614 6919 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX3 protein_id gnl|my_center|LOCUS_19940 6933 7331 gene locus_tag LOCUS_19950 gene rpsH 6933 7331 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q8 protein_id gnl|my_center|LOCUS_19950 7343 7876 gene locus_tag LOCUS_19960 gene rplF 7343 7876 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U874 protein_id gnl|my_center|LOCUS_19960 7889 8251 gene locus_tag LOCUS_19970 gene rplR 7889 8251 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF4 protein_id gnl|my_center|LOCUS_19970 8272 8826 gene locus_tag LOCUS_19980 gene rpsE 8272 8826 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T6 protein_id gnl|my_center|LOCUS_19980 8833 9024 gene locus_tag LOCUS_19990 gene rpmD 8833 9024 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX8 protein_id gnl|my_center|LOCUS_19990 9041 9541 gene locus_tag LOCUS_20000 gene rplO 9041 9541 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF1 protein_id gnl|my_center|LOCUS_20000 9584 10918 gene locus_tag LOCUS_20010 gene secY 9584 10918 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_20010 10915 11565 gene locus_tag LOCUS_20020 gene adk 10915 11565 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q1 protein_id gnl|my_center|LOCUS_20020 11691 12059 gene locus_tag LOCUS_20030 gene rpsM 11691 12059 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_20030 12072 12458 gene locus_tag LOCUS_20040 gene rpsK 12072 12458 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_20040 12532 13548 gene locus_tag LOCUS_20050 gene rpoA 12532 13548 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_20050 13610 14074 gene locus_tag LOCUS_20060 gene rplQ 13610 14074 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U884 protein_id gnl|my_center|LOCUS_20060 15157 14129 gene locus_tag LOCUS_20070 15157 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 16644 15157 gene locus_tag LOCUS_20080 16644 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_20080 17275 16655 gene locus_tag LOCUS_20090 17275 16655 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_20090 17383 18855 gene locus_tag LOCUS_20100 17383 18855 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919161.1 protein_id gnl|my_center|LOCUS_20100 18867 20186 gene locus_tag LOCUS_20110 18867 20186 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_20110 21491 20292 gene locus_tag LOCUS_20120 21491 20292 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710081.1 protein_id gnl|my_center|LOCUS_20120 21525 22439 gene locus_tag LOCUS_20130 21525 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 22540 22920 gene locus_tag LOCUS_20140 gene crcB 22540 22920 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_20140 22929 23921 gene locus_tag LOCUS_20150 22929 23921 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_20150 23928 24620 gene locus_tag LOCUS_20160 23928 24620 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_20160 24670 25362 gene locus_tag LOCUS_20170 24670 25362 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707780.1 protein_id gnl|my_center|LOCUS_20170 26615 25407 gene locus_tag LOCUS_20180 gene nhaA 26615 25407 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 protein_id gnl|my_center|LOCUS_20180 26966 28498 gene locus_tag LOCUS_20190 gene pccB 26966 28498 CDS product propionyl-CoA carboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E3 protein_id gnl|my_center|LOCUS_20190 28513 30507 gene locus_tag LOCUS_20200 gene pccA 28513 30507 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 protein_id gnl|my_center|LOCUS_20200 30562 30897 gene locus_tag LOCUS_20210 gene acyP 30562 30897 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ4 protein_id gnl|my_center|LOCUS_20210 31605 30949 gene locus_tag LOCUS_20220 gene lipB 31605 30949 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A6 protein_id gnl|my_center|LOCUS_20220 31717 31956 gene locus_tag LOCUS_20230 31717 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390918.1 protein_id gnl|my_center|LOCUS_20230 32183 32959 gene locus_tag LOCUS_20240 32183 32959 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 protein_id gnl|my_center|LOCUS_20240 33089 33175 gene locus_tag LOCUS_t00230 33089 33175 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33330 34304 gene locus_tag LOCUS_20250 33330 34304 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 protein_id gnl|my_center|LOCUS_20250 34565 34296 gene locus_tag LOCUS_20260 34565 34296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 34922 35182 gene locus_tag LOCUS_20270 34922 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 35282 35482 gene locus_tag LOCUS_20280 35282 35482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 36329 36102 gene locus_tag LOCUS_20290 36329 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence24 525 1667 gene locus_tag LOCUS_20300 525 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1828 2115 gene locus_tag LOCUS_20310 1828 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2167 2958 gene locus_tag LOCUS_20320 2167 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3034 3333 gene locus_tag LOCUS_20330 3034 3333 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_20330 5940 3799 gene locus_tag LOCUS_20340 gene mcmA 5940 3799 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_20340 6173 7936 gene locus_tag LOCUS_20350 6173 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_20350 8030 9814 gene locus_tag LOCUS_20360 8030 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_20360 10139 10567 gene locus_tag LOCUS_20370 10139 10567 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 protein_id gnl|my_center|LOCUS_20370 11061 10708 gene locus_tag LOCUS_20380 11061 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_20380 11308 12723 gene locus_tag LOCUS_20390 gene rhlE 11308 12723 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 protein_id gnl|my_center|LOCUS_20390 12659 13921 gene locus_tag LOCUS_20400 12659 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_20400 14930 13929 gene locus_tag LOCUS_20410 14930 13929 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361494.1 protein_id gnl|my_center|LOCUS_20410 16004 14997 gene locus_tag LOCUS_20420 16004 14997 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028327.1 protein_id gnl|my_center|LOCUS_20420 16124 17134 gene locus_tag LOCUS_20430 16124 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 protein_id gnl|my_center|LOCUS_20430 17289 19427 gene locus_tag LOCUS_20440 17289 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 19860 19417 gene locus_tag LOCUS_20450 19860 19417 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 protein_id gnl|my_center|LOCUS_20450 20342 19857 gene locus_tag LOCUS_20460 20342 19857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 20797 20366 gene locus_tag LOCUS_20470 20797 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 21237 20830 gene locus_tag LOCUS_20480 21237 20830 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_20480 21510 21256 gene locus_tag LOCUS_20490 21510 21256 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066791.1 protein_id gnl|my_center|LOCUS_20490 21643 23877 gene locus_tag LOCUS_20500 21643 23877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 24143 23895 gene locus_tag LOCUS_20510 24143 23895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 26538 24214 gene locus_tag LOCUS_20520 26538 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 27266 26682 gene locus_tag LOCUS_20530 27266 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 28940 27432 gene locus_tag LOCUS_20540 28940 27432 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_20540 29166 29909 gene locus_tag LOCUS_20550 29166 29909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 30001 30555 gene locus_tag LOCUS_20560 30001 30555 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104065.1 protein_id gnl|my_center|LOCUS_20560 30540 31823 gene locus_tag LOCUS_20570 30540 31823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 31927 33870 gene locus_tag LOCUS_20580 gene acsA 31927 33870 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_20580 34383 33967 gene locus_tag LOCUS_20590 34383 33967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 35657 34458 gene locus_tag LOCUS_20600 35657 34458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 36103 36579 gene locus_tag LOCUS_20610 36103 36579 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531541.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence25 1008 2528 gene locus_tag LOCUS_20620 1008 2528 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_20620 2663 3823 gene locus_tag LOCUS_20630 2663 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_20630 3856 5274 gene locus_tag LOCUS_20640 3856 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5957 5280 gene locus_tag LOCUS_20650 gene tcsR 5957 5280 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_20650 7639 6008 gene locus_tag LOCUS_20660 7639 6008 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_20660 8055 9425 gene locus_tag LOCUS_20670 8055 9425 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_20670 9636 10772 gene locus_tag LOCUS_20680 9636 10772 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_20680 12350 10809 gene locus_tag LOCUS_20690 12350 10809 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_20690 14534 12363 gene locus_tag LOCUS_20700 gene iorA 14534 12363 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_20700 15466 14681 gene locus_tag LOCUS_20710 15466 14681 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527969.1 protein_id gnl|my_center|LOCUS_20710 15991 17343 gene locus_tag LOCUS_20720 15991 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 17448 22301 gene locus_tag LOCUS_20730 17448 22301 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_20730 22598 22389 gene locus_tag LOCUS_20740 22598 22389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 22594 23025 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcatagcttcccttttcacaccgataggctatgat 23374 23072 gene locus_tag LOCUS_20750 23374 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 23914 23420 gene locus_tag LOCUS_20760 23914 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20760 26926 24404 gene locus_tag LOCUS_20770 26926 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20770 27682 27125 gene locus_tag LOCUS_20780 27682 27125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 27893 27717 gene locus_tag LOCUS_20790 27893 27717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 28474 28097 gene locus_tag LOCUS_20800 28474 28097 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_20800 28797 28492 gene locus_tag LOCUS_20810 28797 28492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972463.1 protein_id gnl|my_center|LOCUS_20810 29834 28827 gene locus_tag LOCUS_20820 gene gpsA 29834 28827 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_20820 31020 29911 gene locus_tag LOCUS_20830 gene tsaD 31020 29911 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_20830 31131 32084 gene locus_tag LOCUS_20840 gene hemC 31131 32084 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_20840 32081 32869 gene locus_tag LOCUS_20850 32081 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 32866 34260 gene locus_tag LOCUS_20860 32866 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 34257 35525 gene locus_tag LOCUS_20870 34257 35525 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336796.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence26 2044 3744 gene locus_tag LOCUS_20880 gene rtxB 2044 3744 CDS product RTX toxin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705263.1 protein_id gnl|my_center|LOCUS_20880 3741 6053 gene locus_tag LOCUS_20890 3741 6053 CDS product peptide ABC transporter ATP-binidng protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088216.1 protein_id gnl|my_center|LOCUS_20890 6040 7515 gene locus_tag LOCUS_20900 6040 7515 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_20900 8575 7631 gene locus_tag LOCUS_20910 gene gshB 8575 7631 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_20910 9466 8579 gene locus_tag LOCUS_20920 9466 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_20920 9948 9556 gene locus_tag LOCUS_20930 9948 9556 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_20930 10813 9938 gene locus_tag LOCUS_20940 gene rsmI 10813 9938 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK8 protein_id gnl|my_center|LOCUS_20940 11755 11489 gene locus_tag LOCUS_20950 11755 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 12097 11813 gene locus_tag LOCUS_20960 12097 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13430 12261 gene locus_tag LOCUS_20970 gene hemN 13430 12261 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_20970 14055 13417 gene locus_tag LOCUS_20980 14055 13417 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_20980 14789 14073 gene locus_tag LOCUS_20990 gene rph 14789 14073 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK4 protein_id gnl|my_center|LOCUS_20990 14977 16017 gene locus_tag LOCUS_21000 gene hrcA 14977 16017 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_21000 16031 16705 gene locus_tag LOCUS_21010 gene grpE 16031 16705 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SK0 protein_id gnl|my_center|LOCUS_21010 17395 16889 gene locus_tag LOCUS_21020 17395 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269021.1 protein_id gnl|my_center|LOCUS_21020 17670 19583 gene locus_tag LOCUS_21030 gene dnaK 17670 19583 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY0 protein_id gnl|my_center|LOCUS_21030 19707 20840 gene locus_tag LOCUS_21040 gene dnaJ 19707 20840 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM8 protein_id gnl|my_center|LOCUS_21040 21461 20901 gene locus_tag LOCUS_21050 21461 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 22063 21626 gene locus_tag LOCUS_21060 22063 21626 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088818.1 protein_id gnl|my_center|LOCUS_21060 22340 23782 gene locus_tag LOCUS_21070 22340 23782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 23854 25290 gene locus_tag LOCUS_21080 23854 25290 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_21080 25975 25397 gene locus_tag LOCUS_21090 25975 25397 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947373.1 protein_id gnl|my_center|LOCUS_21090 26350 26090 gene locus_tag LOCUS_21100 26350 26090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 26716 26378 gene locus_tag LOCUS_21110 26716 26378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 27323 26883 gene locus_tag LOCUS_21120 27323 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 29230 27563 gene locus_tag LOCUS_21130 29230 27563 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_21130 29497 30288 gene locus_tag LOCUS_21140 gene paaG 29497 30288 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 protein_id gnl|my_center|LOCUS_21140 30416 31933 gene locus_tag LOCUS_21150 30416 31933 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_21150 31930 32445 gene locus_tag LOCUS_21160 gene paaI 31930 32445 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_21160 32468 33673 gene locus_tag LOCUS_21170 32468 33673 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931117.1 protein_id gnl|my_center|LOCUS_21170 33717 35024 gene locus_tag LOCUS_21180 gene paaA 33717 35024 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_21180 >Feature sequence27 116 40 gene locus_tag LOCUS_t00240 116 40 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1592 351 gene locus_tag LOCUS_21190 gene mnmA 1592 351 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_21190 2585 1662 gene locus_tag LOCUS_21200 2585 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 4815 2698 gene locus_tag LOCUS_21210 gene flaN 4815 2698 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918784.1 protein_id gnl|my_center|LOCUS_21210 6743 7411 gene locus_tag LOCUS_21220 6743 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 7425 8120 gene locus_tag LOCUS_21230 gene flgD 7425 8120 CDS product flagellar hook assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_773637.2 protein_id gnl|my_center|LOCUS_21230 8215 9573 gene locus_tag LOCUS_21240 8215 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 9805 10104 gene locus_tag LOCUS_21250 9805 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 protein_id gnl|my_center|LOCUS_21250 10464 12200 gene locus_tag LOCUS_21260 gene fliF 10464 12200 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6R7 protein_id gnl|my_center|LOCUS_21260 12283 13305 gene locus_tag LOCUS_21270 gene fliG 12283 13305 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04955 protein_id gnl|my_center|LOCUS_21270 13328 13984 gene locus_tag LOCUS_21280 gene fliH 13328 13984 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_21280 14094 14444 gene locus_tag LOCUS_21290 14094 14444 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_21290 14501 15262 gene locus_tag LOCUS_21300 14501 15262 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_21300 15276 16658 gene locus_tag LOCUS_21310 gene flbD 15276 16658 CDS product transcriptional regulatory protein FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17899 protein_id gnl|my_center|LOCUS_21310 16767 18797 gene locus_tag LOCUS_21320 gene flhA 16767 18797 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_21320 18846 19979 gene locus_tag LOCUS_21330 18846 19979 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 protein_id gnl|my_center|LOCUS_21330 19976 20743 gene locus_tag LOCUS_21340 19976 20743 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_21340 20850 23174 gene locus_tag LOCUS_21350 20850 23174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 23217 23597 gene locus_tag LOCUS_21360 23217 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 24129 23722 gene locus_tag LOCUS_21370 24129 23722 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_21370 25560 24190 gene locus_tag LOCUS_21380 gene fliI 25560 24190 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_21380 25974 26678 gene locus_tag LOCUS_21390 25974 26678 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 protein_id gnl|my_center|LOCUS_21390 27687 26851 gene locus_tag LOCUS_21400 27687 26851 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_21400 28772 27684 gene locus_tag LOCUS_21410 gene cheB1 28772 27684 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_21410 29208 28843 gene locus_tag LOCUS_21420 29208 28843 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_21420 29713 29255 gene locus_tag LOCUS_21430 29713 29255 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_21430 32830 29738 gene locus_tag LOCUS_21440 32830 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence28 243 329 gene locus_tag LOCUS_t00250 243 329 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1297 593 gene locus_tag LOCUS_21450 1297 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1676 2449 gene locus_tag LOCUS_21460 1676 2449 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013382.1 protein_id gnl|my_center|LOCUS_21460 2632 3993 gene locus_tag LOCUS_21470 2632 3993 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 protein_id gnl|my_center|LOCUS_21470 4006 4434 gene locus_tag LOCUS_21480 4006 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 protein_id gnl|my_center|LOCUS_21480 5290 4472 gene locus_tag LOCUS_21490 5290 4472 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_21490 5478 6620 gene locus_tag LOCUS_21500 gene dauA 5478 6620 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_21500 6898 6617 gene locus_tag LOCUS_21510 6898 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8868 7039 gene locus_tag LOCUS_21520 8868 7039 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_21520 9150 10124 gene locus_tag LOCUS_21530 9150 10124 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_21530 12065 10155 gene locus_tag LOCUS_21540 12065 10155 CDS product spermidine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 protein_id gnl|my_center|LOCUS_21540 13113 12202 gene locus_tag LOCUS_21550 gene panC 13113 12202 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP31 protein_id gnl|my_center|LOCUS_21550 14013 13153 gene locus_tag LOCUS_21560 14013 13153 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 protein_id gnl|my_center|LOCUS_21560 14239 15093 gene locus_tag LOCUS_21570 14239 15093 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_21570 15113 15598 gene locus_tag LOCUS_21580 15113 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 15600 16988 gene locus_tag LOCUS_21590 15600 16988 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_21590 17337 17852 gene locus_tag LOCUS_21600 17337 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 18155 18481 gene locus_tag LOCUS_21610 gene clpS 18155 18481 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSI5 protein_id gnl|my_center|LOCUS_21610 18595 20901 gene locus_tag LOCUS_21620 18595 20901 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_21620 21068 21499 gene locus_tag LOCUS_21630 21068 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 22674 21505 gene locus_tag LOCUS_21640 22674 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640419.1 protein_id gnl|my_center|LOCUS_21640 23449 22718 gene locus_tag LOCUS_21650 23449 22718 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_21650 23935 23465 gene locus_tag LOCUS_21660 23935 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_21660 24754 24017 gene locus_tag LOCUS_21670 24754 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 24776 24991 gene locus_tag LOCUS_21680 24776 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 25327 24938 gene locus_tag LOCUS_21690 25327 24938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 26745 25462 gene locus_tag LOCUS_21700 gene dinB 26745 25462 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD26 protein_id gnl|my_center|LOCUS_21700 27656 26748 gene locus_tag LOCUS_21710 27656 26748 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_21710 28409 27753 gene locus_tag LOCUS_21720 28409 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920322.1 protein_id gnl|my_center|LOCUS_21720 28700 28422 gene locus_tag LOCUS_21730 28700 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 28859 29224 gene locus_tag LOCUS_21740 28859 29224 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 protein_id gnl|my_center|LOCUS_21740 29234 30607 gene locus_tag LOCUS_21750 gene pleD 29234 30607 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence29 830 396 gene locus_tag LOCUS_21760 830 396 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_21760 1410 2555 gene locus_tag LOCUS_21770 gene corA 1410 2555 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_21770 3569 4330 gene locus_tag LOCUS_21780 3569 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4626 5852 gene locus_tag LOCUS_21790 4626 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 6255 7601 gene locus_tag LOCUS_21800 6255 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_21800 7579 8931 gene locus_tag LOCUS_21810 gene murD 7579 8931 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P775 protein_id gnl|my_center|LOCUS_21810 8998 10581 gene locus_tag LOCUS_21820 8998 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 11680 10727 gene locus_tag LOCUS_21830 11680 10727 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAF0 protein_id gnl|my_center|LOCUS_21830 12062 13216 gene locus_tag LOCUS_21840 12062 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_21840 14897 13263 gene locus_tag LOCUS_21850 14897 13263 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_21850 16316 15075 gene locus_tag LOCUS_21860 16316 15075 CDS product MFS transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331467.1 protein_id gnl|my_center|LOCUS_21860 17373 16327 gene locus_tag LOCUS_21870 gene gapA-1 17373 16327 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IUX5 protein_id gnl|my_center|LOCUS_21870 17739 17404 gene locus_tag LOCUS_21880 17739 17404 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 protein_id gnl|my_center|LOCUS_21880 18363 19181 gene locus_tag LOCUS_21890 18363 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 19919 19224 gene locus_tag LOCUS_21900 19919 19224 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203376.1 protein_id gnl|my_center|LOCUS_21900 21320 20127 gene locus_tag LOCUS_21910 21320 20127 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_21910 21603 22841 gene locus_tag LOCUS_21920 gene amaB 21603 22841 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_21920 24893 22848 gene locus_tag LOCUS_21930 gene asnB 24893 22848 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_21930 26041 24971 gene locus_tag LOCUS_21940 gene pyrB 26041 24971 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_21940 26154 26035 gene locus_tag LOCUS_21950 26154 26035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 27599 26151 gene locus_tag LOCUS_21960 gene dur3 27599 26151 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_21960 28087 27596 gene locus_tag LOCUS_21970 28087 27596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 30309 28378 gene locus_tag LOCUS_21980 30309 28378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence30 275 199 gene locus_tag LOCUS_t00260 275 199 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 533 1222 gene locus_tag LOCUS_21990 533 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1246 2058 gene locus_tag LOCUS_22000 1246 2058 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387844.1 protein_id gnl|my_center|LOCUS_22000 2091 3611 gene locus_tag LOCUS_22010 2091 3611 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709743.1 protein_id gnl|my_center|LOCUS_22010 3832 4131 gene locus_tag LOCUS_22020 3832 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4141 6009 gene locus_tag LOCUS_22030 4141 6009 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089263.1 protein_id gnl|my_center|LOCUS_22030 7291 5999 gene locus_tag LOCUS_22040 7291 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 7813 8562 gene locus_tag LOCUS_22050 7813 8562 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887737.1 protein_id gnl|my_center|LOCUS_22050 8565 9497 gene locus_tag LOCUS_22060 8565 9497 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_22060 9638 10510 gene locus_tag LOCUS_22070 gene hbdA 9638 10510 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_22070 10752 11528 gene locus_tag LOCUS_22080 10752 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942253.1 protein_id gnl|my_center|LOCUS_22080 12009 11578 gene locus_tag LOCUS_22090 12009 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067451.1 protein_id gnl|my_center|LOCUS_22090 13101 12184 gene locus_tag LOCUS_22100 13101 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_22100 13145 13486 gene locus_tag LOCUS_22110 13145 13486 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 protein_id gnl|my_center|LOCUS_22110 13479 13865 gene locus_tag LOCUS_22120 13479 13865 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086585.1 protein_id gnl|my_center|LOCUS_22120 13963 15705 gene locus_tag LOCUS_22130 13963 15705 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_22130 16818 15826 gene locus_tag LOCUS_22140 16818 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 17120 19129 gene locus_tag LOCUS_22150 17120 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 19447 20019 gene locus_tag LOCUS_22160 19447 20019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 20016 20831 gene locus_tag LOCUS_22170 20016 20831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_22170 20982 21731 gene locus_tag LOCUS_22180 20982 21731 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_22180 21728 22333 gene locus_tag LOCUS_22190 gene ruvC 21728 22333 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIH7 protein_id gnl|my_center|LOCUS_22190 22330 22965 gene locus_tag LOCUS_22200 gene ruvA 22330 22965 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF6 protein_id gnl|my_center|LOCUS_22200 22962 24032 gene locus_tag LOCUS_22210 gene ruvB 22962 24032 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN03 protein_id gnl|my_center|LOCUS_22210 24055 24543 gene locus_tag LOCUS_22220 24055 24543 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_22220 24566 25282 gene locus_tag LOCUS_22230 24566 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 25282 25722 gene locus_tag LOCUS_22240 gene tolR 25282 25722 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_22240 25735 26574 gene locus_tag LOCUS_22250 25735 26574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 26653 27990 gene locus_tag LOCUS_22260 gene tolB 26653 27990 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_22260 28125 28670 gene locus_tag LOCUS_22270 28125 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 29081 30046 gene locus_tag LOCUS_22280 29081 30046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence31 210 1583 gene locus_tag LOCUS_22290 210 1583 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_22290 3220 1619 gene locus_tag LOCUS_22300 gene purH 3220 1619 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 protein_id gnl|my_center|LOCUS_22300 5108 3417 gene locus_tag LOCUS_22310 5108 3417 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067395.1 protein_id gnl|my_center|LOCUS_22310 5980 5288 gene locus_tag LOCUS_22320 gene rpe 5980 5288 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IF9 protein_id gnl|my_center|LOCUS_22320 7324 6020 gene locus_tag LOCUS_22330 gene sun 7324 6020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_22330 8407 7433 gene locus_tag LOCUS_22340 gene htpX 8407 7433 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC2 protein_id gnl|my_center|LOCUS_22340 8568 8729 gene locus_tag LOCUS_22350 8568 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 8765 9595 gene locus_tag LOCUS_22360 8765 9595 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_22360 9592 10107 gene locus_tag LOCUS_22370 9592 10107 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_22370 10185 12695 gene locus_tag LOCUS_22380 10185 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 13112 12762 gene locus_tag LOCUS_22390 13112 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD62 protein_id gnl|my_center|LOCUS_22390 13596 13135 gene locus_tag LOCUS_22400 13596 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 14878 13628 gene locus_tag LOCUS_22410 14878 13628 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_22410 16209 14875 gene locus_tag LOCUS_22420 gene sufD 16209 14875 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_22420 17034 16243 gene locus_tag LOCUS_22430 gene sufC 17034 16243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537716.1 protein_id gnl|my_center|LOCUS_22430 18515 17061 gene locus_tag LOCUS_22440 18515 17061 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_22440 19033 18533 gene locus_tag LOCUS_22450 19033 18533 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_22450 20183 19275 gene locus_tag LOCUS_22460 20183 19275 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 protein_id gnl|my_center|LOCUS_22460 21092 20265 gene locus_tag LOCUS_22470 21092 20265 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709820.1 protein_id gnl|my_center|LOCUS_22470 21752 21117 gene locus_tag LOCUS_22480 gene rsmG 21752 21117 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_22480 23642 21753 gene locus_tag LOCUS_22490 gene mnmG 23642 21753 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 protein_id gnl|my_center|LOCUS_22490 25167 23821 gene locus_tag LOCUS_22500 gene mnmE 25167 23821 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 protein_id gnl|my_center|LOCUS_22500 25491 25231 gene locus_tag LOCUS_22510 25491 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_22510 25756 27792 gene locus_tag LOCUS_22520 25756 27792 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence32 288 728 gene locus_tag LOCUS_22530 288 728 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388927.1 protein_id gnl|my_center|LOCUS_22530 864 2597 gene locus_tag LOCUS_22540 864 2597 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 protein_id gnl|my_center|LOCUS_22540 2658 4166 gene locus_tag LOCUS_22550 2658 4166 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 protein_id gnl|my_center|LOCUS_22550 4195 5436 gene locus_tag LOCUS_22560 4195 5436 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_22560 5521 6237 gene locus_tag LOCUS_22570 5521 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 7169 6219 gene locus_tag LOCUS_22580 7169 6219 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_22580 7263 7526 gene locus_tag LOCUS_22590 7263 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 8193 7654 gene locus_tag LOCUS_22600 8193 7654 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_22600 9061 8441 gene locus_tag LOCUS_22610 9061 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9285 11231 gene locus_tag LOCUS_22620 gene pbpC 9285 11231 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970655.1 protein_id gnl|my_center|LOCUS_22620 11288 11764 gene locus_tag LOCUS_22630 gene nodN 11288 11764 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 protein_id gnl|my_center|LOCUS_22630 12468 11767 gene locus_tag LOCUS_22640 12468 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 12995 12531 gene locus_tag LOCUS_22650 12995 12531 CDS product UPF0260 protein R01011 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R94 protein_id gnl|my_center|LOCUS_22650 13649 13008 gene locus_tag LOCUS_22660 13649 13008 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_22660 13733 14311 gene locus_tag LOCUS_22670 13733 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 15415 14330 gene locus_tag LOCUS_22680 15415 14330 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813312.1 protein_id gnl|my_center|LOCUS_22680 15776 15534 gene locus_tag LOCUS_22690 15776 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 15906 16796 gene locus_tag LOCUS_22700 15906 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 protein_id gnl|my_center|LOCUS_22700 17888 16839 gene locus_tag LOCUS_22710 17888 16839 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_22710 18037 19398 gene locus_tag LOCUS_22720 18037 19398 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388879.1 protein_id gnl|my_center|LOCUS_22720 19445 19840 gene locus_tag LOCUS_22730 gene msrB 19445 19840 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_22730 20142 22220 gene locus_tag LOCUS_22740 20142 22220 CDS product putative peptidase y4nA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55577 protein_id gnl|my_center|LOCUS_22740 23144 22383 gene locus_tag LOCUS_22750 23144 22383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 23561 26509 gene locus_tag LOCUS_22760 23561 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 27543 26566 gene locus_tag LOCUS_22770 27543 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 27565 27720 gene locus_tag LOCUS_22780 27565 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence33 194 541 gene locus_tag LOCUS_22790 194 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1164 1481 gene locus_tag LOCUS_22800 1164 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2225 1581 gene locus_tag LOCUS_22810 gene bjaI 2225 1581 CDS product isovaleryl-homoserine lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VI2 protein_id gnl|my_center|LOCUS_22810 3205 2486 gene locus_tag LOCUS_22820 3205 2486 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188690.1 protein_id gnl|my_center|LOCUS_22820 3438 3920 gene locus_tag LOCUS_22830 3438 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 4070 3849 gene locus_tag LOCUS_22840 4070 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4429 4809 gene locus_tag LOCUS_22850 4429 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5029 6237 gene locus_tag LOCUS_22860 5029 6237 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_22860 6309 8381 gene locus_tag LOCUS_22870 6309 8381 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_22870 8546 8896 gene locus_tag LOCUS_22880 8546 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 9336 9815 gene locus_tag LOCUS_22890 gene mraZ 9336 9815 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCY1 protein_id gnl|my_center|LOCUS_22890 9815 10867 gene locus_tag LOCUS_22900 gene rsmH 9815 10867 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_22900 10864 11382 gene locus_tag LOCUS_22910 10864 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 11379 13097 gene locus_tag LOCUS_22920 11379 13097 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_22920 13094 14587 gene locus_tag LOCUS_22930 gene murE 13094 14587 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N0 protein_id gnl|my_center|LOCUS_22930 14584 16059 gene locus_tag LOCUS_22940 gene murF 14584 16059 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB89 protein_id gnl|my_center|LOCUS_22940 16104 17192 gene locus_tag LOCUS_22950 gene mraY 16104 17192 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_22950 17229 18377 gene locus_tag LOCUS_22960 gene ftsW 17229 18377 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708634.1 protein_id gnl|my_center|LOCUS_22960 18374 19654 gene locus_tag LOCUS_22970 gene murG 18374 19654 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_22970 19651 21108 gene locus_tag LOCUS_22980 gene murC 19651 21108 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 protein_id gnl|my_center|LOCUS_22980 21108 22040 gene locus_tag LOCUS_22990 gene murB 21108 22040 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_22990 22037 22951 gene locus_tag LOCUS_23000 gene ddl 22037 22951 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEM6 protein_id gnl|my_center|LOCUS_23000 22939 23832 gene locus_tag LOCUS_23010 gene ftsQ 22939 23832 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30993 protein_id gnl|my_center|LOCUS_23010 23832 25085 gene locus_tag LOCUS_23020 gene ftsA 23832 25085 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_23020 25247 27022 gene locus_tag LOCUS_23030 gene ftsZ 25247 27022 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF60 protein_id gnl|my_center|LOCUS_23030 >Feature sequence34 2439 5876 gene locus_tag LOCUS_23040 2439 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5878 6201 gene locus_tag LOCUS_23050 5878 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 6448 6774 gene locus_tag LOCUS_23060 6448 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 6774 7127 gene locus_tag LOCUS_23070 6774 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 7132 7911 gene locus_tag LOCUS_23080 7132 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7911 8432 gene locus_tag LOCUS_23090 7911 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 8554 9360 gene locus_tag LOCUS_23100 8554 9360 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 protein_id gnl|my_center|LOCUS_23100 10178 9429 gene locus_tag LOCUS_23110 10178 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 10842 10165 gene locus_tag LOCUS_23120 10842 10165 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 protein_id gnl|my_center|LOCUS_23120 11194 10847 gene locus_tag LOCUS_23130 11194 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_23130 11498 11187 gene locus_tag LOCUS_23140 11498 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 14583 11518 gene locus_tag LOCUS_23150 14583 11518 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_23150 15704 14583 gene locus_tag LOCUS_23160 15704 14583 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_23160 16975 15701 gene locus_tag LOCUS_23170 16975 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 17198 18097 gene locus_tag LOCUS_23180 17198 18097 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083970.1 protein_id gnl|my_center|LOCUS_23180 18102 18362 gene locus_tag LOCUS_23190 18102 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946774.1 protein_id gnl|my_center|LOCUS_23190 18363 19016 gene locus_tag LOCUS_23200 18363 19016 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 protein_id gnl|my_center|LOCUS_23200 19169 20434 gene locus_tag LOCUS_23210 gene nhaA 19169 20434 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD7 protein_id gnl|my_center|LOCUS_23210 20467 22908 gene locus_tag LOCUS_23220 20467 22908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_23220 22930 24297 gene locus_tag LOCUS_23230 22930 24297 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 protein_id gnl|my_center|LOCUS_23230 24311 25834 gene locus_tag LOCUS_23240 24311 25834 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_23240 25831 26712 gene locus_tag LOCUS_23250 25831 26712 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence35 218 2164 gene locus_tag LOCUS_23260 218 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2180 2323 gene locus_tag LOCUS_23270 2180 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2398 2688 gene locus_tag LOCUS_23280 2398 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2685 3122 gene locus_tag LOCUS_23290 2685 3122 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 protein_id gnl|my_center|LOCUS_23290 3201 3392 gene locus_tag LOCUS_23300 3201 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3389 4006 gene locus_tag LOCUS_23310 3389 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4003 4203 gene locus_tag LOCUS_23320 4003 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 4172 4315 gene locus_tag LOCUS_23330 4172 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 4401 4724 gene locus_tag LOCUS_23340 4401 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4738 5322 gene locus_tag LOCUS_23350 4738 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5348 5686 gene locus_tag LOCUS_23360 5348 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5700 6113 gene locus_tag LOCUS_23370 5700 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 6106 6510 gene locus_tag LOCUS_23380 6106 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6497 8095 gene locus_tag LOCUS_23390 6497 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 8105 8398 gene locus_tag LOCUS_23400 8105 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 8628 8416 gene locus_tag LOCUS_23410 8628 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 9528 9334 gene locus_tag LOCUS_23420 9528 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 9544 9741 gene locus_tag LOCUS_23430 9544 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 9891 9802 gene locus_tag LOCUS_t00270 9891 9802 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10075 10281 gene locus_tag LOCUS_23440 10075 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 10181 11221 gene locus_tag LOCUS_23450 gene mltB 10181 11221 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_23450 11260 12126 gene locus_tag LOCUS_23460 11260 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 12190 13362 gene locus_tag LOCUS_23470 12190 13362 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_23470 13352 14035 gene locus_tag LOCUS_23480 gene tmk 13352 14035 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP2 protein_id gnl|my_center|LOCUS_23480 14041 15165 gene locus_tag LOCUS_23490 14041 15165 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_23490 15198 16742 gene locus_tag LOCUS_23500 gene metG 15198 16742 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_23500 16748 17551 gene locus_tag LOCUS_23510 16748 17551 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_23510 17551 18306 gene locus_tag LOCUS_23520 17551 18306 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_23520 18335 19576 gene locus_tag LOCUS_23530 18335 19576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 protein_id gnl|my_center|LOCUS_23530 19573 20199 gene locus_tag LOCUS_23540 19573 20199 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918863.1 protein_id gnl|my_center|LOCUS_23540 20202 20882 gene locus_tag LOCUS_23550 20202 20882 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67726 protein_id gnl|my_center|LOCUS_23550 22153 20939 gene locus_tag LOCUS_23560 22153 20939 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_23560 22533 24146 gene locus_tag LOCUS_23570 22533 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 24163 24672 gene locus_tag LOCUS_23580 24163 24672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence36 994 119 gene locus_tag LOCUS_23590 994 119 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921461.1 protein_id gnl|my_center|LOCUS_23590 2436 1012 gene locus_tag LOCUS_23600 2436 1012 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_23600 3440 2433 gene locus_tag LOCUS_23610 3440 2433 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_23610 3786 5582 gene locus_tag LOCUS_23620 3786 5582 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_23620 5652 6482 gene locus_tag LOCUS_23630 5652 6482 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_23630 6550 8292 gene locus_tag LOCUS_23640 6550 8292 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_23640 8458 9381 gene locus_tag LOCUS_23650 8458 9381 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_23650 9452 9715 gene locus_tag LOCUS_23660 gene xseB 9452 9715 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6M3 protein_id gnl|my_center|LOCUS_23660 9761 10678 gene locus_tag LOCUS_23670 9761 10678 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_23670 10748 12688 gene locus_tag LOCUS_23680 gene dxs 10748 12688 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW1 protein_id gnl|my_center|LOCUS_23680 12693 13442 gene locus_tag LOCUS_23690 12693 13442 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_23690 13439 14704 gene locus_tag LOCUS_23700 13439 14704 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8M7 protein_id gnl|my_center|LOCUS_23700 14970 15443 gene locus_tag LOCUS_23710 14970 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 15792 15610 gene locus_tag LOCUS_23720 15792 15610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 16914 15838 gene locus_tag LOCUS_23730 gene aroC 16914 15838 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0R6 protein_id gnl|my_center|LOCUS_23730 17735 16914 gene locus_tag LOCUS_23740 gene fabI1 17735 16914 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58380 protein_id gnl|my_center|LOCUS_23740 18740 17853 gene locus_tag LOCUS_23750 18740 17853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597738.1 protein_id gnl|my_center|LOCUS_23750 19633 18737 gene locus_tag LOCUS_23760 19633 18737 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 protein_id gnl|my_center|LOCUS_23760 20171 19716 gene locus_tag LOCUS_23770 20171 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 20313 20903 gene locus_tag LOCUS_23780 gene pdxH 20313 20903 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_23780 20969 21910 gene locus_tag LOCUS_23790 20969 21910 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_23790 21907 22263 gene locus_tag LOCUS_23800 21907 22263 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919515.1 protein_id gnl|my_center|LOCUS_23800 22315 23073 gene locus_tag LOCUS_23810 gene fixR 22315 23073 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_23810 24562 23087 gene locus_tag LOCUS_23820 24562 23087 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U990 protein_id gnl|my_center|LOCUS_23820 >Feature sequence37 178 104 gene locus_tag LOCUS_t00280 178 104 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 338 901 gene locus_tag LOCUS_23830 338 901 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_23830 942 1883 gene locus_tag LOCUS_23840 942 1883 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067252.1 protein_id gnl|my_center|LOCUS_23840 2010 2702 gene locus_tag LOCUS_23850 2010 2702 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_23850 2741 2992 gene locus_tag LOCUS_23860 2741 2992 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THT5 protein_id gnl|my_center|LOCUS_23860 4204 2996 gene locus_tag LOCUS_23870 4204 2996 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_23870 4479 4817 gene locus_tag LOCUS_23880 gene glnK 4479 4817 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721100.1 protein_id gnl|my_center|LOCUS_23880 4829 6154 gene locus_tag LOCUS_23890 gene amt-2 4829 6154 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_23890 6300 7508 gene locus_tag LOCUS_23900 6300 7508 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391453.1 protein_id gnl|my_center|LOCUS_23900 7518 7790 gene locus_tag LOCUS_23910 7518 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 7684 10062 gene locus_tag LOCUS_23920 7684 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 10274 10945 gene locus_tag LOCUS_23930 10274 10945 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEG1 protein_id gnl|my_center|LOCUS_23930 11342 11911 gene locus_tag LOCUS_23940 11342 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 11958 12755 gene locus_tag LOCUS_23950 gene xthA3 11958 12755 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_23950 12848 13387 gene locus_tag LOCUS_23960 12848 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 13555 13481 gene locus_tag LOCUS_t00290 13555 13481 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13976 13776 gene locus_tag LOCUS_23970 13976 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 15367 13979 gene locus_tag LOCUS_23980 15367 13979 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546353.1 protein_id gnl|my_center|LOCUS_23980 16035 15364 gene locus_tag LOCUS_23990 16035 15364 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL87 protein_id gnl|my_center|LOCUS_23990 16298 16080 gene locus_tag LOCUS_24000 gene infA 16298 16080 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAM1 protein_id gnl|my_center|LOCUS_24000 17068 16544 gene locus_tag LOCUS_24010 17068 16544 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_24010 17582 17076 gene locus_tag LOCUS_24020 17582 17076 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM8 protein_id gnl|my_center|LOCUS_24020 18973 17666 gene locus_tag LOCUS_24030 gene hisD 18973 17666 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_24030 19625 18957 gene locus_tag LOCUS_24040 gene hisG 19625 18957 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_24040 20291 19797 gene locus_tag LOCUS_24050 20291 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 21728 20433 gene locus_tag LOCUS_24060 gene murA 21728 20433 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J077 protein_id gnl|my_center|LOCUS_24060 22352 21759 gene locus_tag LOCUS_24070 gene dcd 22352 21759 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZE77 protein_id gnl|my_center|LOCUS_24070 22555 22394 gene locus_tag LOCUS_24080 22555 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 22814 22888 gene locus_tag LOCUS_t00300 22814 22888 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23120 24475 gene locus_tag LOCUS_24090 23120 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence38 591 1499 gene locus_tag LOCUS_24100 591 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1572 2390 gene locus_tag LOCUS_24110 gene paaG 1572 2390 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 protein_id gnl|my_center|LOCUS_24110 3515 2469 gene locus_tag LOCUS_24120 gene holA 3515 2469 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_24120 4136 3534 gene locus_tag LOCUS_24130 4136 3534 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 protein_id gnl|my_center|LOCUS_24130 6761 4188 gene locus_tag LOCUS_24140 gene leuS 6761 4188 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 protein_id gnl|my_center|LOCUS_24140 7438 6920 gene locus_tag LOCUS_24150 7438 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 8101 8943 gene locus_tag LOCUS_24160 8101 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 9627 8968 gene locus_tag LOCUS_24170 9627 8968 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_24170 9656 10327 gene locus_tag LOCUS_24180 9656 10327 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970578.1 protein_id gnl|my_center|LOCUS_24180 10995 10444 gene locus_tag LOCUS_24190 10995 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_24190 11349 11077 gene locus_tag LOCUS_24200 11349 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 11650 11396 gene locus_tag LOCUS_24210 11650 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 12111 11701 gene locus_tag LOCUS_24220 12111 11701 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705755.1 protein_id gnl|my_center|LOCUS_24220 12326 12108 gene locus_tag LOCUS_24230 gene pspB 12326 12108 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462365.1 protein_id gnl|my_center|LOCUS_24230 13122 12430 gene locus_tag LOCUS_24240 gene pspA 13122 12430 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_24240 13318 14391 gene locus_tag LOCUS_24250 gene pspF 13318 14391 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_24250 15723 14590 gene locus_tag LOCUS_24260 15723 14590 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_24260 15813 16502 gene locus_tag LOCUS_24270 15813 16502 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_24270 16665 17207 gene locus_tag LOCUS_24280 16665 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 17319 18161 gene locus_tag LOCUS_24290 17319 18161 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_24290 18154 18525 gene locus_tag LOCUS_24300 gene folB 18154 18525 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_24300 18602 18958 gene locus_tag LOCUS_24310 gene arsR 18602 18958 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 protein_id gnl|my_center|LOCUS_24310 18988 19485 gene locus_tag LOCUS_24320 gene arsC2 18988 19485 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 protein_id gnl|my_center|LOCUS_24320 19487 20506 gene locus_tag LOCUS_24330 19487 20506 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_24330 20513 21508 gene locus_tag LOCUS_24340 20513 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_24340 21519 21755 gene locus_tag LOCUS_24350 21519 21755 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 protein_id gnl|my_center|LOCUS_24350 22298 21870 gene locus_tag LOCUS_24360 22298 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24360 22812 22432 gene locus_tag LOCUS_24370 22812 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 24123 23227 gene locus_tag LOCUS_24380 24123 23227 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918403.1 protein_id gnl|my_center|LOCUS_24380 24383 24117 gene locus_tag LOCUS_24390 24383 24117 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence39 335 262 gene locus_tag LOCUS_t00310 335 262 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 550 1551 gene locus_tag LOCUS_24400 gene pseB 550 1551 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_24400 1548 2735 gene locus_tag LOCUS_24410 gene rkpM 1548 2735 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887051.1 protein_id gnl|my_center|LOCUS_24410 2732 3433 gene locus_tag LOCUS_24420 gene rkpN 2732 3433 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887052.1 protein_id gnl|my_center|LOCUS_24420 3430 4485 gene locus_tag LOCUS_24430 gene rkpO 3430 4485 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887053.1 protein_id gnl|my_center|LOCUS_24430 4531 5604 gene locus_tag LOCUS_24440 4531 5604 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_24440 5616 6179 gene locus_tag LOCUS_24450 5616 6179 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919339.1 protein_id gnl|my_center|LOCUS_24450 8681 6552 gene locus_tag LOCUS_24460 8681 6552 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_24460 9224 8778 gene locus_tag LOCUS_24470 9224 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 9771 9382 gene locus_tag LOCUS_24480 9771 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 10275 9967 gene locus_tag LOCUS_24490 10275 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11144 10293 gene locus_tag LOCUS_24500 11144 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 11571 11170 gene locus_tag LOCUS_24510 gene zntR 11571 11170 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 protein_id gnl|my_center|LOCUS_24510 12921 11728 gene locus_tag LOCUS_24520 gene ackA 12921 11728 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P762 protein_id gnl|my_center|LOCUS_24520 13877 12918 gene locus_tag LOCUS_24530 gene pta 13877 12918 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086241.1 protein_id gnl|my_center|LOCUS_24530 14066 15034 gene locus_tag LOCUS_24540 14066 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 15201 16421 gene locus_tag LOCUS_24550 gene metZ 15201 16421 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE2 protein_id gnl|my_center|LOCUS_24550 16427 16837 gene locus_tag LOCUS_24560 gene apaG 16427 16837 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS7 protein_id gnl|my_center|LOCUS_24560 16916 17527 gene locus_tag LOCUS_24570 gene folE 16916 17527 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B0 protein_id gnl|my_center|LOCUS_24570 17573 19021 gene locus_tag LOCUS_24580 17573 19021 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_24580 19082 20302 gene locus_tag LOCUS_24590 19082 20302 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_24590 20318 20890 gene locus_tag LOCUS_24600 20318 20890 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence40 386 18 gene locus_tag LOCUS_24610 386 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 772 401 gene locus_tag LOCUS_24620 772 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3504 901 gene locus_tag LOCUS_24630 3504 901 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_24630 6222 3538 gene locus_tag LOCUS_24640 6222 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 9478 6434 gene locus_tag LOCUS_24650 9478 6434 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_24650 10653 9649 gene locus_tag LOCUS_24660 10653 9649 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 protein_id gnl|my_center|LOCUS_24660 11665 10655 gene locus_tag LOCUS_24670 11665 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 protein_id gnl|my_center|LOCUS_24670 13691 11706 gene locus_tag LOCUS_24680 13691 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 14996 14082 gene locus_tag LOCUS_24690 14996 14082 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531536.1 protein_id gnl|my_center|LOCUS_24690 16361 15075 gene locus_tag LOCUS_24700 gene gabT 16361 15075 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_24700 17877 16411 gene locus_tag LOCUS_24710 17877 16411 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_24710 18856 18005 gene locus_tag LOCUS_24720 18856 18005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 protein_id gnl|my_center|LOCUS_24720 20021 18918 gene locus_tag LOCUS_24730 20021 18918 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_24730 20195 20773 gene locus_tag LOCUS_24740 gene ubiX 20195 20773 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G3X8 protein_id gnl|my_center|LOCUS_24740 >Feature sequence41 399 989 gene locus_tag LOCUS_24750 399 989 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939959.1 protein_id gnl|my_center|LOCUS_24750 986 1363 gene locus_tag LOCUS_24760 986 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1353 1607 gene locus_tag LOCUS_24770 1353 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1711 2355 gene locus_tag LOCUS_24780 1711 2355 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_24780 2352 2558 gene locus_tag LOCUS_24790 2352 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2561 2908 gene locus_tag LOCUS_24800 2561 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2892 3515 gene locus_tag LOCUS_24810 2892 3515 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_24810 3531 3719 gene locus_tag LOCUS_24820 3531 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3712 4128 gene locus_tag LOCUS_24830 3712 4128 CDS product GemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 protein_id gnl|my_center|LOCUS_24830 4125 4622 gene locus_tag LOCUS_24840 4125 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4629 5024 gene locus_tag LOCUS_24850 4629 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 5608 6129 gene locus_tag LOCUS_24860 5608 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937513.1 protein_id gnl|my_center|LOCUS_24860 6140 6754 gene locus_tag LOCUS_24870 6140 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 6754 6975 gene locus_tag LOCUS_24880 6754 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 6953 7324 gene locus_tag LOCUS_24890 6953 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 7321 7623 gene locus_tag LOCUS_24900 gene gp26 7321 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_24900 7634 8179 gene locus_tag LOCUS_24910 7634 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 8179 9765 gene locus_tag LOCUS_24920 8179 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 protein_id gnl|my_center|LOCUS_24920 9765 11306 gene locus_tag LOCUS_24930 gene gpH 9765 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_24930 11306 12598 gene locus_tag LOCUS_24940 11306 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 12976 14043 gene locus_tag LOCUS_24950 12976 14043 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 protein_id gnl|my_center|LOCUS_24950 14040 14441 gene locus_tag LOCUS_24960 14040 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 14454 15347 gene locus_tag LOCUS_24970 14454 15347 CDS product head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_24970 15363 15569 gene locus_tag LOCUS_24980 15363 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 15665 15988 gene locus_tag LOCUS_24990 15665 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 15997 17376 gene locus_tag LOCUS_25000 15997 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence42 264 339 gene locus_tag LOCUS_t00320 264 339 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 437 634 gene locus_tag LOCUS_25010 gene secE 437 634 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU7 protein_id gnl|my_center|LOCUS_25010 637 1173 gene locus_tag LOCUS_25020 gene nusG 637 1173 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU8 protein_id gnl|my_center|LOCUS_25020 1419 1847 gene locus_tag LOCUS_25030 gene rplK 1419 1847 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J69 protein_id gnl|my_center|LOCUS_25030 1852 2550 gene locus_tag LOCUS_25040 gene rplA 1852 2550 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J70 protein_id gnl|my_center|LOCUS_25040 2933 3442 gene locus_tag LOCUS_25050 gene rplJ 2933 3442 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J72 protein_id gnl|my_center|LOCUS_25050 3509 3886 gene locus_tag LOCUS_25060 gene rplL 3509 3886 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLI2 protein_id gnl|my_center|LOCUS_25060 4176 8273 gene locus_tag LOCUS_25070 gene rpoB 4176 8273 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J74 protein_id gnl|my_center|LOCUS_25070 8307 12500 gene locus_tag LOCUS_25080 gene rpoC 8307 12500 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV4 protein_id gnl|my_center|LOCUS_25080 12893 13264 gene locus_tag LOCUS_25090 gene rpsL 12893 13264 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 protein_id gnl|my_center|LOCUS_25090 13301 13771 gene locus_tag LOCUS_25100 gene rpsG 13301 13771 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5E1 protein_id gnl|my_center|LOCUS_25100 13796 15871 gene locus_tag LOCUS_25110 gene fusA 13796 15871 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV7 protein_id gnl|my_center|LOCUS_25110 >Feature sequence43 140 895 gene locus_tag LOCUS_25120 140 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2190 973 gene locus_tag LOCUS_25130 2190 973 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_25130 3428 2433 gene locus_tag LOCUS_25140 3428 2433 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_25140 5869 3440 gene locus_tag LOCUS_25150 5869 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_25150 7253 5970 gene locus_tag LOCUS_25160 7253 5970 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_25160 8680 7250 gene locus_tag LOCUS_25170 8680 7250 CDS product imidazolonepropionase related amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265753.1 protein_id gnl|my_center|LOCUS_25170 9332 8895 gene locus_tag LOCUS_25180 9332 8895 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_25180 9558 10367 gene locus_tag LOCUS_25190 9558 10367 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_25190 10542 11795 gene locus_tag LOCUS_25200 gene argD 10542 11795 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKT0 protein_id gnl|my_center|LOCUS_25200 11797 12744 gene locus_tag LOCUS_25210 gene argF 11797 12744 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE8 protein_id gnl|my_center|LOCUS_25210 12759 13697 gene locus_tag LOCUS_25220 12759 13697 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q9 protein_id gnl|my_center|LOCUS_25220 >Feature sequence44 457 227 gene locus_tag LOCUS_25230 457 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2096 675 gene locus_tag LOCUS_25240 gene gltD 2096 675 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_25240 6754 2099 gene locus_tag LOCUS_25250 6754 2099 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_25250 7407 9971 gene locus_tag LOCUS_25260 gene hrpB 7407 9971 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_25260 10635 12479 gene locus_tag LOCUS_25270 10635 12479 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD34 protein_id gnl|my_center|LOCUS_25270 12557 13516 gene locus_tag LOCUS_25280 12557 13516 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD35 protein_id gnl|my_center|LOCUS_25280 >Feature sequence45 <1 2142 gene locus_tag LOCUS_25290 <1 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887292.1:calcium-binding protein 2285 4618 gene locus_tag LOCUS_25300 2285 4618 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_25300 4638 5453 gene locus_tag LOCUS_25310 4638 5453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_25310 5833 7632 gene locus_tag LOCUS_25320 5833 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 7798 8487 gene locus_tag LOCUS_25330 7798 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 8673 10193 gene locus_tag LOCUS_25340 8673 10193 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083488.1 protein_id gnl|my_center|LOCUS_25340 10400 11677 gene locus_tag LOCUS_25350 10400 11677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_25350 12235 11678 gene locus_tag LOCUS_25360 12235 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 12451 13296 gene locus_tag LOCUS_25370 12451 13296 CDS product ornithine-acyl ACP N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence46 1080 256 gene locus_tag LOCUS_25380 1080 256 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDI9 protein_id gnl|my_center|LOCUS_25380 1389 2189 gene locus_tag LOCUS_25390 gene nadX 1389 2189 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FY1 protein_id gnl|my_center|LOCUS_25390 2991 2215 gene locus_tag LOCUS_25400 2991 2215 CDS product 4-oxalocrotonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230345.1 protein_id gnl|my_center|LOCUS_25400 3842 2988 gene locus_tag LOCUS_25410 3842 2988 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_25410 4910 3861 gene locus_tag LOCUS_25420 gene mhpE 4910 3861 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 protein_id gnl|my_center|LOCUS_25420 5856 4921 gene locus_tag LOCUS_25430 gene mhpF 5856 4921 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4P2 protein_id gnl|my_center|LOCUS_25430 6657 5863 gene locus_tag LOCUS_25440 gene mhpD 6657 5863 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK05 protein_id gnl|my_center|LOCUS_25440 6967 6665 gene locus_tag LOCUS_25450 6967 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25450 8148 6964 gene locus_tag LOCUS_25460 8148 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25460 9174 8251 gene locus_tag LOCUS_25470 9174 8251 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338974.1 protein_id gnl|my_center|LOCUS_25470 9537 9187 gene locus_tag LOCUS_25480 9537 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 10600 9539 gene locus_tag LOCUS_25490 gene mphP 10600 9539 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_25490 10959 10600 gene locus_tag LOCUS_25500 gene mphO 10959 10600 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_25500 12059 11031 gene locus_tag LOCUS_25510 12059 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence47 176 9 gene locus_tag LOCUS_25520 176 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 737 216 gene locus_tag LOCUS_25530 737 216 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_25530 1043 1369 gene locus_tag LOCUS_25540 1043 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1366 3054 gene locus_tag LOCUS_25550 1366 3054 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_25550 4152 3139 gene locus_tag LOCUS_25560 gene mclA 4152 3139 CDS product Malyl-CoA/beta-methylmalyl-CoA/citramalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC35 protein_id gnl|my_center|LOCUS_25560 4486 5631 gene locus_tag LOCUS_25570 gene dauA 4486 5631 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_25570 7608 5749 gene locus_tag LOCUS_25580 7608 5749 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 protein_id gnl|my_center|LOCUS_25580 8039 7734 gene locus_tag LOCUS_25590 8039 7734 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393857.1 protein_id gnl|my_center|LOCUS_25590 9672 8488 gene locus_tag LOCUS_25600 9672 8488 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025517.1 protein_id gnl|my_center|LOCUS_25600 10070 9768 gene locus_tag LOCUS_25610 10070 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence48 297 1046 gene locus_tag LOCUS_25620 297 1046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967585.1 protein_id gnl|my_center|LOCUS_25620 1051 3462 gene locus_tag LOCUS_25630 1051 3462 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_25630 3473 4678 gene locus_tag LOCUS_25640 3473 4678 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_25640 5207 7009 gene locus_tag LOCUS_25650 gene pckG 5207 7009 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNT2 protein_id gnl|my_center|LOCUS_25650 8100 7099 gene locus_tag LOCUS_25660 8100 7099 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_25660 9405 8110 gene locus_tag LOCUS_25670 9405 8110 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence49 123 788 gene locus_tag LOCUS_25680 123 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 906 2084 gene locus_tag LOCUS_25690 906 2084 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265968.1 protein_id gnl|my_center|LOCUS_25690 2214 2645 gene locus_tag LOCUS_25700 2214 2645 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_25700 2685 3617 gene locus_tag LOCUS_25710 2685 3617 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_25710 3791 5398 gene locus_tag LOCUS_25720 3791 5398 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_25720 5470 6465 gene locus_tag LOCUS_25730 5470 6465 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_25730 6652 6945 gene locus_tag LOCUS_25740 gene rpmB 6652 6945 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9V8 protein_id gnl|my_center|LOCUS_25740 8090 7068 gene locus_tag LOCUS_25750 8090 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973193.1 protein_id gnl|my_center|LOCUS_25750 8187 8044 gene locus_tag LOCUS_25760 8187 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 8332 9039 gene locus_tag LOCUS_25770 8332 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence50 208 648 gene locus_tag LOCUS_25780 208 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2898 688 gene locus_tag LOCUS_25790 2898 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3259 3969 gene locus_tag LOCUS_25800 3259 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4068 5453 gene locus_tag LOCUS_25810 4068 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 6973 5921 gene locus_tag LOCUS_25820 gene ccpA 6973 5921 CDS product cytochrome c551 peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14532 protein_id gnl|my_center|LOCUS_25820 7207 7683 gene locus_tag LOCUS_25830 7207 7683 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence51 1956 106 gene locus_tag LOCUS_25840 1956 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2094 2330 gene locus_tag LOCUS_25850 2094 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2417 3304 gene locus_tag LOCUS_25860 gene garR 2417 3304 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 protein_id gnl|my_center|LOCUS_25860 3359 3751 gene locus_tag LOCUS_25870 3359 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 4638 3817 gene locus_tag LOCUS_25880 4638 3817 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_25880 5024 4689 gene locus_tag LOCUS_25890 5024 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391409.1 protein_id gnl|my_center|LOCUS_25890 5417 6043 gene locus_tag LOCUS_25900 5417 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 6256 6465 gene locus_tag LOCUS_25910 6256 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence52 179 2323 gene locus_tag LOCUS_25920 gene iutA 179 2323 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_25920 2335 3444 gene locus_tag LOCUS_25930 2335 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4063 3455 gene locus_tag LOCUS_25940 gene recR 4063 3455 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC58 protein_id gnl|my_center|LOCUS_25940 4399 4076 gene locus_tag LOCUS_25950 4399 4076 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM9 protein_id gnl|my_center|LOCUS_25950 6298 4472 gene locus_tag LOCUS_25960 6298 4472 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence53 703 152 gene locus_tag LOCUS_25970 703 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1805 915 gene locus_tag LOCUS_25980 1805 915 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_25980 1804 2544 gene locus_tag LOCUS_25990 1804 2544 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_25990 2730 3317 gene locus_tag LOCUS_26000 2730 3317 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 protein_id gnl|my_center|LOCUS_26000 3942 3355 gene locus_tag LOCUS_26010 gene coq7 3942 3355 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_26010 4432 3935 gene locus_tag LOCUS_26020 4432 3935 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_26020 4541 5272 gene locus_tag LOCUS_26030 4541 5272 CDS product proline hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920346.1 protein_id gnl|my_center|LOCUS_26030 5873 5295 gene locus_tag LOCUS_26040 5873 5295 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084142.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence54 196 1767 gene locus_tag LOCUS_26050 196 1767 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727684.1 protein_id gnl|my_center|LOCUS_26050 1769 2554 gene locus_tag LOCUS_26060 1769 2554 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_26060 3337 2579 gene locus_tag LOCUS_26070 3337 2579 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_26070 5022 3565 gene locus_tag LOCUS_26080 5022 3565 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727685.1 protein_id gnl|my_center|LOCUS_26080 5495 5025 gene locus_tag LOCUS_26090 5495 5025 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815416.1 protein_id gnl|my_center|LOCUS_26090